Introduction

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common

enzyme deficiency in the world [1, 2]. A preponderance of evidence has recently

emerged to indicate that G6PD deficiency affects cells other than that of erythrocytes

[3-13]. Mouse embryonic stem cells with disrupted G6PD gene are extremely

sensitive to H2O2 and to the sulfhydryl group-oxidizing agent diamide [14]. In

addition, there appears to be a strong somatic cell selection against G6PD-null cells,

suggesting an important role of G6PD in the development and/or survival of oocytes

[14]. We have shown that G6PD-deficient human foreskin fibroblasts (HFF)

underwent growth retardation and accelerated cellular senescence during their serial

cultivation [5]. Moreover, we have also shown that sodium nitroprusside (SNP), a

nitric oxide donor, stimulated growth of normal HFF but induced apoptosis in

G6PD-deficient HFF [4]. These findings indicate that G6PD-deficiency renders

cellular redox status abnormal thus affecting cells besides red cells. However, how

G6PD-deficiency may affect viral infectivity has not been thoroughly studied.

Oxidative stress has been found to affect viral proliferation and virulence [15-22].

Consumption of high iron diet resulted in elevated oxidative stress and co-elevation of

coxsackie B3 virus titers in mice [20]. Increase in oxidative stress and inadequate

antioxidant response were also related to the severity of liver damage and replication

1

status of virus in hepatitis B virus infection [17, 19]. Moreover, selenium- and

vitamin-E deficiency converted benign strain of coxsackie B3 virus to virulent strain

and caused myocarditis due to oxidative-induced mutations in the viral genome [20,

22, 23]. Similar to what was found for coxsackie B3 virus, host deficiency in

selenium led to an increase in influenza virus mutation and resulted in a more virulent

phenotype [21]. Although accumulating evidence suggests that cellular redox status

plays an important role in affecting the pathogenicity of influenza virus and coxsackie

B3 virus, how the cellular redox status may affect the proliferation and pathogenecity

of other virus besides these two types of virus remains largely undefined.

How oxidative stress may affect viral infection to airway cells has not been clearly

defined. In addition to a large intracellular sources of oxidants including

mitochondrial electron transport system, cytochrome P450 reactions and the nitric

oxide synthase system, pulmonary cells are exposed to approximately 8000 liters of

oxygen rich air per day as well as toxic particles such as ozone and other oxidants

[24]. Recent studies indicate that diesel exhaust enhanced influenza virus infections in

respiratory epithelial cells [25, 26]. Human coronavirus 229E (HCoV 229E), a

common pathogen for respiratory tract infection, belongs to large, enveloped RNA

virus in the order Nidovirales [27] and with high affinity toward airway cells [28, 29].

The genome is typical of coronaviruses containing genes for replicase, spike, small

2

envelope, membrane, and nucleocapsid in 5’ to 3’ directions [30]. For a long time

these viruses are known to cause only relatively mild clinical problem such as

common cold [31, 32]. Recent identification of a novel coronavirus as causative agent

of Severe Acute Respiratory Syndrome (SARS) catches much attention [33, 34].

However, how oxidative stress can affect coronavirus has not been investigated.

Therefore, the objective of the current study is to delineate whether oxidative stress

can affect HCoV 229E infection toward cells by using G6PD-deficient cells as a

model for cells with increased oxidative stress.

In this study, we used HCoV 229E to infect G6PD-deficient fibroblasts and

G6PD-knockdown A549 cells. Both G6PD-deficient and G6PD-knockdown cells

exhibited enhanced susceptibility to virus-induced cell death. The enhanced

virus-induced cell death was not caused by the increase in HCoV 229E receptor,

CD13, but by the increase in viral gene expression and in viral particle production.

Moreover, ectopic expression of G6PD in G6PD-deficient fibroblasts or antioxidant

treatment could attenuate the increase in susceptibility to HCoV 229E infection. This

result demonstrates that G6PD deficiency enhanced the HCoV 229E infection in an

oxidative stress-dependent manner, and the phenomena could be modulated by

altering the host redox status.

3

Results

G6PD-deficient fibroblasts exhibited enhanced susceptibility to HCoV 229E-induced

cell death

G6PD deficiency is a common disease worldwide, but there is no information

linking G6PD deficiency with viral pathology. To investigate whether G6PD

deficiency could affect viral infection, G6PD-deficient fibroblasts (HFF1) and normal

fibroblasts (HFF3) were subjected to HCoV 229E infection and cell viability was

determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)

assay [35]. We found that 0.025 to 0.1 M.O.I. of virus to infect cells was a suitable

concentration range of virus inoculum and also found that the cell viability of

G6PD-deficient and normal fibroblasts was different under this concentration range

after 72 h post-infection (Fig. 1A). Then we further compared the susceptibility of

normal and G6PD-deficient fibroblasts to HCoV 229E at 0.025 to 0.1 M.O.I. range

and at different time points of post-infection. We found that the cell viability was

significantly (p< 0.05) lower (8%) in HFF1 than that in HFF3 at 0.1 M.O.I after 48 h

post-infection (Fig. 1B), and the difference in cell viability expanded to 18% after 72

h post-infection when the cells were infected with 0.1 M.O.I. HCoV 229E (Fig. 1C).

These data show that G6PD-deficient fibroblasts had increased susceptibility to

HCoV 229E-induced cell death, especially at 72 h post-infection.

4

G6PD-knockdown A549 epithelial cells also showed enhanced susceptibility to HCoV

229E-induced cell death

In order to investigate whether the enhanced susceptibility of G6PD-deficient

fibroblasts to HCoV 229E infection was cell specific, G6PD-knockdown stable cells

from human lung epithelial carcinoma cell line A549 were used. Three

G6PD-knockdown stable cell lines, A549-5.8, A549-5.18 and A549-5.20, as well as a

control cell line transfected with pCI-neo vector only, A549-5S-5, were selected. The

G6PD activity of A549-5.8, A549-5.18 and A549-5.20 expressed only 18.6, 22.4 and

5.9% G6PD activity of the control cell line A549-5S-5, respectively (Fig. 2A). The

decrease in G6PD expression was confirmed by western blot analysis of G6PD

protein (Fig. 2B). Without virus infection, there was no difference for the growth rate

among A549-5S-S, A549-5.8, A549-5.18 and A549-5.20 cells (data not shown). Then

we determined the cell viability of G6PD-knockdown cells upon HCoV 229E

infection. These G6PD-knockdown epithelial cells (A549-5.8, A549-5.18 and

A549-5.20) showed significant increase in cell death induced by HCoV 229E

infection as compared with control cells (A549-5S-5) at 24 h, 48 h and 72 h

post-infection, respectively (Fig. 2C-E). These data demonstrate that enhanced

susceptibility to HCoV 229E-induced cell death in G6PD-deficient fibroblasts was not

cell-type specific, and the phenomena also could be found in G6PD-knockdown

5

epithelial cells.

Enhanced virus-induced cell death could not be attributed to the increase in HCoV

229E receptor CD13 in G6PD-deficient cells

Since HCoV 229E belongs to coronaviridae group I and needs receptors (CD13)

to infect cells [36], we investigated whether HCoV 229E-induced cell death of

G6PD-deficient cells could be attributed to the elevation of CD13 in these cells. Flow

cytometry and western blot analysis revealed no significant difference in CD13

expression between G6PD-deficient and normal fibroblasts (Fig. 3A and 3B).

Interestingly, G6PD-knockdown epithelial cells (A549-5.8, A549-5.18 & A549-5.20)

expressed less CD13 on their cell surface than their control cells (A549-5S-5) (Fig.

3C and 3D), indicating that the enhanced susceptibility to HCoV 229E infection in

G6PD-deficient fibroblasts and G6PD-knockdown epithelial cells could not be

attributed to the increased expression of the viral receptor CD13.

G6PD deficiency promoted HCoV 229E viral particle production and viral gene

expression

We next determined whether G6PD deficiency results in an increase production of

viral particles in the following experiment. In this notion, viral particles were

quantified by plaque assay at 24 and 48 h post-infection in G6PD-deficient and

control cells. By using A549 plaque assay to determine the viral titer, the amount of

6

viral particles from G6PD-deficient fibroblasts (Fig. 4A) was found to be 3 fold more

than that found in normal fibroblasts at 0.1 M.O.I. after 24 h post-infection (Fig. 4B).

Interestingly, after 48 h post-infection, the difference in viral production between

G6PD-deficient fibroblasts and normal fibroblasts was not as dramatic as that at 24 h

post-infection, but the amount of viral particles from G6PD-deficient cells was still

higher than their control ones. Similar findings were also observed in

G6PD-knockdown A549 cells (Fig. 4C), and the amount of viral particles from

G6PD-knockdown A549 were much higher than that from control A549-5S-5 both at

24 h and 48 h post-infection.

To determine whether enhanced viral particle production in G6PD-deficient cells

was caused by an increase in viral gene expression, RT-PCR technique was applied

using HCoV 229E specific primers representing partial sequence of nucleocapsid.

Since the actual nucleocapsid gene expression was not significantly different between

G6PD-deficient and control cells at 2 h post-infection, the gene expression at 2 h

post-infection was normalized to 1. In G6PD-deficient fibroblasts, viral gene

expression at 4, 6, 8, 10 h post-infection was 2, 29, 470, 1601 fold higher than 2 h

post-infection, respectively. However, in normal fibroblasts, viral gene expression at 4,

6, 8, 10 h post-infection was 1, 6, 47, 155 fold higher than 2 h post-infection,

respectively (Table 1). Likewise, the viral gene expression was similar in A549 stable

7

clones with G6PD-knockdown (A549-5.8, A549-5.18 and A549-5.20) and showed

much higher fold of increase than that in normal control (A549-5S-5) (Table 1). These

data indicate that host cellular G6PD activity modulates viral gene expression.

Ectopic expression of G6PD in fibroblasts ameliorated the enhanced susceptibility to

HCoV 229E infection

To further confirm that enhanced susceptibility to HCoV 229E-induced cell death

as well as enhanced cellular viral production was modulated by cellular G6PD activity,

G6PD-deficient cells (HFF1) were infected with G6PD-expressing retroviral vector,

LGIN and LKGIN [5], and these cells were used to test the effects of G6PD

replenishment on HCoV 229E-induced cell death and viral gene expression. LGIN

and LKGIN expressed 11.1 and 12.8 fold more G6PD activity than their control LEIN

(Fig. 5A), and the increase in G6PD activity was also confirmed by western blot data

(Fig. 5B). It should be pointed out that the cell doubling time was not significantly

different for the passages of LEIN, LGIN, and LKGIN chosen for the subsequent

experiments. The expression of CD13 in LGIN and LKGIN was not significantly

different from the control LEIN (Fig. 5B). However, when the susceptibility of these

cells to HCoV 229E-induced cell death was compared, LEIN showed significantly

decreased viability comparing to LGIN and LKGIN at 72 h post-infection (Fig. 5C).

The viral nucleocapsid gene expression of HCoV 229E in LEIN, LGIN and LKGIN

8

were also determined by quantitative RT-PCR. G6PD-overexpressing fibroblasts

(LGIN and LKGIN) showed significantly decreased viral gene expression comparing

to their control, LEIN (Fig. 5D). Taken together, these data provide strong support to

the notion that cellular G6PD activity modulated cellular susceptibility to viral

infection.

G6PD-knockdown epithelial cells suffered elevated oxidative stress after virus

post-infection

Since G6PD-deficient cells favored viral replication, the redox status of

G6PD-deficient cell was determined by testing cellular ROS level using flow

cytometric technique in combination with DCF staining and by quantifying cellular

NADPH/NADP+, intracellular GSH level using HPLC method. In the basal condition,

G6PD deficient fibroblasts (HFF1) and G6PD-knockdown epithelial cells (A549-5.8)

had lower NADPH/NADP+ ratio and intracellular GSH level than that in control cells

(HFF3 and A549-5S-5) (Table 2). All these data confirmed that G6PD-knockdown

cells had less reducing power than their control ones. Concommitant with the

decrease in cellular reducing power, G6PD-knockdown epithelial cells showed

significant higher production of ROS by DCF-staining (Fig. 6) than that in their

control upon viral infection. Taken together, the diminishment in reducing power and

enhanced ROS production were indicative that G6PD-knockdown epithelial cells

9

exhibited higher oxidative stress than the control cells after viral infection.

Antioxidant had protective effect against viral infection

We then evaluated whether ectopic application of antioxidant provides a

protective effect against virus infection in G6PD-knockdown cells. Toward this end,

the antioxidant, α-lipoic acid, was applied in culture medium for 5 h before virus

infection. A549 cells pre-treated with antioxidant were significantly less susceptible to

virus-induced cell death than control cells after 48 h post-infection at 0.1 M.O.I. (Fig.

7A). ROS production of these epithelial cells was determined and the cells that

pretreated with antioxidant produced less ROS following virus infection than cells

without antioxidant pretreatment (Fig. 7B). In addition, viral gene (nucleocapsid)

expression in G6PD-knockdown cells that treated with or without antioxidant was

determined by Q-PCR. After using 0.1 M.O.I. virus to infect cells, the viral gene

expression in G6PD-knockdown cells pretreated with antioxidant was lower than that

in cells without antioxidant pretreatment (Fig. 7C). Together, these data support the

notion that the susceptibility to HCoV 229E infection was associated with the cellular

redox status.

10

Discussion

A preponderance of evidence has indicated that viral infection increases oxidative

stress in host cells [37-40]. However, only limited information is available concerning

how the redox status can affect viral behavior in the host cells [15, 41]. For example,

in selenium- and vitamin E-deficient mice the virulent of coxsackie B3 virus has been

changed causing myocarditis [18]. Our current study, using G6PD-deficient cells as a

model system, clearly indicates that increased oxidative stress renders G6PD-deficient

cells more susceptible to viral infection than their controls (Table 1 and Fig 6). Such

abnormality can be ameliorated by the antioxidant agent such as lipoic acid. These

data provide additional support to the notion that the redox status of the host plays an

important role to affect viral infectivity.

Increased viral infection in G6PD-deficient cells could be, in part, attributed to

increase viral receptor in these cells or due to the enhanced production of viral

particles inside these cells. HCoV 229E belongs to group I coronavirus and infects

human cells through receptor aminopeptidase N (CD13) [36, 42]. Since

G6PD-deficient cells do not express higher CD13 on their cell surface than their

control as demonstrated by flow cytometry and western blot (Fig. 3), one can rule out

the possibility that enhanced susceptibility to HCoV 229E infection of

G6PD-deficient cells is due to an increase in human receptor CD13 on these cells. On

11

the other hand, enhanced production of viral particles in G6PD-deficient cells was

clearly supported by increased plaque formation (Fig. 4) and by elevated viral gene

(nucleocapsid) expression (Table 1) following virus infection. Thus, G6PD-deficiency

provides a more suitable milieu for viral replication than that provided by

non-G6PD-deficient cells.

One condition which favors viral replication is high oxidative stress.

G6PD-knockdown cells produce more ROS than normal counterparts (Fig. 6) and

have lower cellular GSH content (Table 2) than their control cells during viral

infection. The low GSH content in G6PD-knockdown cells has been related to low

NADPH to NADP+ ratio in these cells (Table 2). Since these changes in redox status

of G6PD-knockdown cells are accompanied by an increase in viral nucleocapsid gene

expression in these cells (Table 1), these findings are consistent with the postulate that

increased oxidative stress in G6PD-knockdown cells promotes viral gene expression.

Increasing evidence shows that ROS play important roles in regulating signal

transduction and controls cellular physiology [43-45]. It has also been shown that

virus infection could up-regulate promoter, like NF-κB, or transcription factor, like

STAT3, to influence cellular gene expression as a consequence of increase in

oxidative stress [46-48]. Altering redox status can also affect proinflammatory

cytokines production [49, 50] and thus influences the antiviral mechanism of

12

G6PD-deficient cells.

Since increased susceptibility of G6PD-knockdown cells to HCoV 229E

infection has been correlated with the ROS production, then antioxidants pretreatment

should be useful to attenuate the phenomena. Indeed, when G6PD-knockdown cells

are pretreated with lipoic acid, the enhanced susceptibility of these cells to virus

infection can be attenuated (Fig. 7). Lipoic acid is synthesized by eukaryotic cells and

is not considered as a vitamin. Lipoic acid and its reduced form dihydrolipoic acid are

involved in defense against oxidative stress and apoptosis [51, 52]. Our finding that

lipoic acid could diminish ROS production in G6PD-knockdown cells (Fig. 7)

supports the postulate that oxidative stress contributes to the enhanced susceptibility

of these cells to HCoV 229E infection. Moreover, this finding also suggests that

antioxidant treatment may have particular health benefit to G6PD-deficient subjects

against viral infection.

All in all, our findings provide strong support to the notion that redox status of host

cells modulates the infectivity of viral pathogen. Our findings also have major

medical implication. Unpublished observation in our laboratory indicates that

G6PD-deficient individuals are more prone to hepatitis viral infection. This

unpublished observation together with the findings reported in the current article

reveal that enhanced oxidative stress in G6PD-deficient individuals may increase their

13

susceptibility to viral infection. Moreover, our findings also suggest that antioxidants

intakes may be helpful to G6PD-deficient subjects against viral infection.

14

Experimental procedures

Reagents and antibodies

Dulbecco’s modified Eagle’s medium (DMEM), trypsin, penicillin, streptomycin

and amphotericin B were purchased from Invitrogen (Carlsbad, CA, USA). The

G6PD antibody was from Genesis Biotech (Taiwan). The anti-actin and anti-CD13

antibodies were from Santa Cruz Biotechnologies (Santa Cruz, CA, USA).

Lipofectamine 2000 (LF2000) transfection reagents and DCFH-DA were from

Invitrogen (Carlsbad, CA, USA). Antibiotic G418 sulfate and α-lipoic acid were from

Promega (Madison, WI, USA).

Cell culture

Primary human foreskin fibroblasts prepared from G6PD-deficient individual

(HFF1) and non-G6PD deficient individual (HFF3) as well as G6PD overexpressing

fibroblasts (LGIN & LKGIN) were described previously [10]. Lung epithelial

carcinoma cell line A549 was from American Type Culture Collection (ATCC). All

cells were cultured in DMEM supplemented with 10% FCS, 100 units/ml of penicillin,

100 units/ml of streptomycin, and 0.25 mg/ml of amphotericin B at 37� in a

humidified atmosphere of 5% CO2 with or without 300 µg/ml G418 dependent on

transfection or not. The cells were sub-cultured at a ratio of 1:8 before the cultures

were confluent. Human fetal lung fibroblast (MRC-5) was purchased from ATCC

15

(CCL-171) and maintained in minimum essential medium (MEM) supplemented with

10% FCS and antibiotics.

Generation of G6PD-knockdown A549 cells by RNAi technique

All possible G6PD-RNAi sequences were confirmed by transient transfection.

RNAi expression vector pTOPO-U6 had the EcoRV and BbsI sites for insertion of

RNAi sequences [53]. In addition, BglII and DraIII cloning sites were designed for

release of the complete RNAi expression cassette and for insertion into pCI-neo [54]

expression vector. For the plasmids G6PD–143, the complementary oligonucleotides

G6PD-143S (5′- ACACACATATTCATCATCGAA

GCTTGGATGATGAATATGTGTGT-3′) and G6PD–143AS (5′-GGATACACACA

TATTCATCATCCAAGCTTCGATGATGAATATGTGTGT-3′), were annealed. The

annealing of G6PD-143S/G6PD–143AS generated sites corresponding to the blunt

end and the overhang that matched the EcoRV- and BbsI- digested pTOPO-U6. The

ligation between the annealed oligo-nucleotides and pTOPO-U6 at the EcoRV and

BbsI cloning sites generated pTOPO G6PD-143. pTOPO G6PD-143 was tested by

transient transfect into K562 to determine the protein expression of G6PD. Complete

RNAi expression cassette was removed by digestion of BglII and DraIII and was

inserted into pCI-neo mammalian expression vector for stable transfection as

described previously. All cells that stably transfected with vector only (A549-5S-5) or

16

G6PD-RNAi (A549-5.8, A549-5.18 & A549-5.20) were grown in 300 µg of G418/ml.

Infection with HCoV 229E

Strain 229E of human coronavirus was kindly provided from Dr. Lai MM

(Academia Sinica, Taiwan) and propagated in monolayer of MRC-5 cells and purified

by centrifugation. The virus titer was determined by plaque assay [55]. Virus pools

were aliquoted, quick frozen on dry ice, and stored at -70 until used.�

G6PD activity

G6PD activity was measured at 340 nm by the reduction of NADP+ in the

presence of glucose-6-phosphate as described [56]. In brief, cells were collected by

centrifugation at 500 × g at 4� for 10 min. Cell pellets were re-suspended in 1 ml of

extraction buffer (20 mM Tris-HCl (pH 8.0), containing 3 mM MgCl2, 1 mM EDTA,

0.02% (w/v) β-mercaptoethanol, 0.1% triton X-100 and 1 µM ε-amino-n-caproic acid)

then chilled immediately in an ice bath and disrupted by sonication. Cell lysate was

centrifuged at 13,000 × g at 4� for 15 min, and the supernatant was used for the

assay. A typical assay mixture consisted of 50 µg of protein in 1 ml of G6PD assay

buffer (50 mM Tris-HCl pH 7.8, with 50 mM MgCl2, 4 mM G6P, and 4 mM NADP+).

Change in absorbance at 340 nm was monitored spectrophotometrically.

Virus infection and MTT assay

For each MTT assay, 2 × 104 cells were seeded in a 12-well dish. Twenty-four

17

hours later, the culture was subjected to HCoV 229E infection. Cells were infected

with HCoV 229E at different M.O.I.. For quantification of the degree of cell death in

cell culture, we employed the viability MTT assay. At different times after infection

(24 h, 48 h & 72 h p.i.), 10% tetrazolium was added to the medium and incubated at

37� for 4 h. The reaction was terminated by dimethyl sulfoxide solution and the

absorbance was determined at 490 nm and 650 nm in an ELISA microplate reader

(Spectramax 340PC384; Molecular Devices). Cell viability was calculated as

percentage of control cells using the formula: (A490-A650) of treated cells × 100/

(A490-A650) of control cells.

Western blot analysis

Cells were harvested and solubilized for 30 min at 4� in 50 mM Tris-HCl pH 7.5

containing 1% Nonidet P (NP)-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1

mM EDTA, 1 mM sodium fluoride, 1 mM sodium orthovanadate, 1 mM PMSF, 1 µg

of aprotinin/ml and 1 µg of leupetin/ml. Cell extracts were subjected to SDS-PAGE.

Gels were electroblotted onto polyvinylidene difluoride membrane in Towbin transfer

buffer (25 mM Tris-HCl, 192 mM glycine and 20% methanol). Membranes were

treated for 1 h in blocking buffer, probed with first antibody overnight, and washed

twice, followed by incubation with secondary antibody for 1 h. After an additional

washing step, immunoblots were visualized using the ECL detection system.

18

Measurements of cell specific receptors for HCoV 229E

Cell surface membrane receptors for CD13 were measured by flow cytometry as

previously described [57]. In brief, cells were harvested and washed by FABS (1×PBS,

1% FBS and 0.1% sodium azide), then probed with first antibody CD13 (1:50) on ice

for 30 min and washed twice with FABS, followed by incubating with

FITC-conjugated goat anti-mouse secondary antibody (dilution 1/1000) in the dark on

ice for 30 min. Cells were washed twice with FABS and fluorescence was determined

by flow cytometry (Becton Dickinson FACScan) followed by analysis with

CELLQuest software.

RNA isolation, RT and Q-PCR

Total RNA was isolated from HCoV-infected cells by using RNeasy Mini Kit

(Qiagene). RT-PCR was also performed with Superscript III reverse transcriptase

(Invitrogen) and AmpliTaq Gold DNA polymerase (Applied Biosystems). To quantify

the DNA fragment, two HCoV 229E specific oligonucleotide primers of nucleocapsid

were used: 5’ AGGCGCAAGAATTCAGAACCAGAG 3’ and 5’

AGCAGGACTCTGATTACGAGAAAG 3’. To 1 µl of the RT mixture the following

was added: 25 µl of 2 × SYBR Green Mix buffer (ABI PCR master mix), 5 µl of

primer mixture (10 pmole each) and the total volume was adjusted to 50 µl with water.

The real-time quantitative polymerase chain reaction was carried out in a sequence

19

detection system GeneAmp®5700 (Applied Biosystems). The PCR conditions were

optimized as follows: 95 for 10 min, and 40 cycles each of 95 for 30 s, 66 for � � �

45 s, and 72 for 30 s. � The intensity of fluorescence, which is a direct measurement

of the amount of amplified product, is measured with each cycle. The threshold at

which significant amplification of first detected is determined, and all samples are

evaluated by determining how quickly each sample reaches this threshold. The cycle

at which this threshold is achieved is recorded as the Ct value. Data were normalized

with primers for a housekeeping gene, actin. A sample with no template was included

to ensure the absence of primer dimmer.

Plaque assay

Lung carcinoma cell line A549 was used for plaque assay because HCoV 229E

was propagated and could form cytopathic effect (CPE) in A549 cells as compared to

MRC-5 cells. Ten-fold serial dilution of virus was made in DMEM without serum.

500 µl of each dilution was used to infect A549 cells, grown in 6-well plate, for 1 h at

37�. The virus inoculum was aspirated off and the monolayer was washed once with

1 ml of phosphate buffer saline. The monolayer was overlaid with 3 ml of the 1:9

mixture of 3% agarose and DMEM followed by incubation at 37� until plaques were

developed. After 3 days post-infection, cells were stained with 0.5% crystal violet.

Plaques were counted by direct observation and the titer of virus was calculated.

20

Quantification of cellular NADPH and NADP+

A total of 1.25 × 107 cells were harvested and washed by 1×PBS twice. To extract

NADP+, 300 µl cell pellet suspension was added to 100 µl of 0.1 M HCl. While on ice,

the cells were incubated for 1 min, and then neutralized with 100 µl 0.1 M NaOH

followed by the addition of 300 µl Tris-HCl buffer (pH 6.8). The mixture was

centrifuged at 3000 g for 10 min to remove insoluble material. For determination of

NADPH, 300 µl cell pellet was treated with 100 µl 0.1 M NaOH then incubated on

ice for 1 min. The suspension was neutralized with 100 µl 0.1 M HCl and 300 µl of 1

M Tris-HCl buffer (pH 11) was added. The mixture was centrifuged at 3000 g for 10

min to remove insoluble material. All these steps are done in the same day and

followed by HPLC determination of NADP+ and NADPH.

HPLC (Waters; model 2695) separation was carried out with a C18 3-µm

reversed-phase column. The mobile phase consisted of a gradient of buffer A (0.1 M

KH2PO4, 5 mM tetrabutylammonium hydrogen sulfate, 2.5% (v/v) acetonitril, pH 6.0)

and buffer B (0.1 M KH2PO4, 5 mM tetrabutylammonium hydrogen sulfate, 25% (v/v)

acetonitril, pH 5.5). After injection of 20-50 µl of sample, the column was initially

eluted at 0.8 ml/min for 3 min with buffer A, followed by 2 min elution with buffer A

containing 11% buffer B and finally a 25 min elution by a buffer gradient with buffer

B gradually increased to 100%. Before the application of next sample, the column

21

was re-equilibrated for 10 min with 100% buffer A. HPLC separations were

performed at room temperature. Detection was done spectroscopically at 260 nm. The

identities of peaks were confirmed by co-elution with standards. Quantitative

measurements were made on the basis of the injection of standard solutions with

known concentration.

Intracellular GSH measurement

Cells (4×105) were acidified with 300 µl of 1% (wt/vol) meta-phosphoric acid and

centrifuged to precipitate the proteins. The supernatant was filtered and

chromatographed on an Intersil 4.6 × 250 mm ODS3 column eluted with mobile

phase containing 49 % of buffer A (10 mM NaH2PO4 and 0.3 mM octane sulfonic

acid adjusted to pH 2.7 with phosphoric acid) and 51% of buffer B (10 mM NaH2PO4,

0.3 mM octane sulfonic acid, and 10% acetonitrile adjusted to pH 2.7 with phosphoric

acid) and a flow rate of 0.8 ml/min. An ESA Coulochem II detector (Waters Alliance

Systems, Milford, MA) was used for analysis. The guard cell was set at 950 mV,

electrode 1 and 2 at 400 mV, electrode 3 at 650 mV, electrode 4 at 700 mV, electrode

5 at 800 mV, electrode 6 at 850 mV, electrode 7 at 900 mV and electrode 8 at 950 mV.

Quantification was obtained by integration relative to the internal standard.

Direct ROS determination by DCF staining

ROS production was determined using 2’,7’-dichlorodihydrogluorescein diacetate

22

(DDFH-DA; Invitrogen). After the cells were treated for 24 h with control media or

virus inoculum, the cells were washed with PBS and then loaded for 30 min with

DCFH-DA (20 µM) in serum free medium. The acetoxymethyl group on DCF-DA is

cleaved by nonspecific esterase within the cells, resulting in a nonfluorescent charged

molecule that does not cross the cell membrane. Intracellular ROS irreversibly oxidize

the DCFH-DA to dichlororluorescein (DCF), which is a fluorescent product. After

treatment, the media was removed, and the cells were harvested and determined by

flow cytometry (Becton Dickinson FACScan) and the data were analyzed with

CELLQuest software.

Statistical analysis

Data are expressed as a mean ± SEM of several experiments. Statistical

differences between the means of two groups were analyzed by the Student’s t test. A

value of p < 0.05 was considered significant.

Acknowledgements

This project is supported by grants from Chang Gung University (CMRPD140041),

from the National Science Council of Taiwan (NSC94-2320-B182-041), and by a

grant from Ministry of Education (EMRPD150241). The technical support in RNAi

plasmid construction from the RNAi core laboratory of Chang Gung University is

appreciated.

23

Reference:

1. Frank JE. Diagnosis and management of G6PD deficiency. Am Fam Physician 2005;72:1277-82 2. Arese P, De Flora A. Pathophysiology of hemolysis in glucose-6-phosphate dehydrogenase deficiency. Semin Hematol 1990;27:1-40 3. Ho HY, Wei TT, Cheng ML and Chiu DT. Green tea polyphenol epigallocatechin-3-gallate protects cells against peroxynitrite-induced cytotoxicity: modulatory effect of cellular G6PD status. J Agric Food Chem 2006;54:1638-45 4. Cheng ML, Ho HY, Liang CM, et al. Cellular glucose-6-phosphate dehydrogenase (G6PD) status modulates the effects of nitric oxide (NO) on human foreskin fibroblasts. FEBS Lett 2000;475:257-62 5. Ho HY, Cheng ML, Lu FJ, et al. Enhanced oxidative stress and accelerated cellular senescence in glucose-6-phosphate dehydrogenase (G6PD)-deficient human fibroblasts. Free Radic Biol Med 2000;29:156-69 6. Tsai KJ, Hung IJ, Chow CK, Stern A, Chao SS and Chiu DT. Impaired production of nitric oxide, superoxide, and hydrogen peroxide in glucose 6-phosphate-dehydrogenase-deficient granulocytes. FEBS Lett 1998;436:411-4 7. Tseng CP, Huang CL, Chong KY, Hung IJ and Chiu DT. Rapid detection of glucose-6-phosphate dehydrogenase gene mutations by denaturing high-performance liquid chromatography. Clin Biochem 2005;38:973-80 8. Nicol CJ, Zielenski J, Tsui LC and Wells PG. An embryoprotective role for glucose-6-phosphate dehydrogenase in developmental oxidative stress and chemical teratogenesis. Faseb J 2000;14:111-27 9. Ayene IS, Stamato TD, Mauldin SK, et al. Mutation in the glucose-6-phosphate dehydrogenase gene leads to inactivation of Ku DNA end binding during oxidative stress. J Biol Chem 2002;277:9929-35 10. Cheng ML, Ho HY, Wu YH and Chiu DT. Glucose-6-phosphate dehydrogenase-deficient cells show an increased propensity for oxidant-induced senescence. Free Radic Biol Med 2004;36:580-91 11. Cheng AJ, Chiu DT, See LC, Liao CT, Chen IH and Chang JT. Poor prognosis in nasopharyngeal cancer patients with low glucose-6-phosphate-dehydrogenase activity. Jpn J Cancer Res 2001;92:576-81 12. Tas S, Donmez AA, Kirali K, Alp MH and Yakut C. Aortic valve replacement for a patient with glucose-6-phosphate dehydrogenase deficiency and autoimmune hemolytic anemia. J Card Surg 2005;20:380-1 13. Sobngwi E, Gautier JF, Kevorkian JP, et al. High prevalence of glucose-6-phosphate dehydrogenase deficiency without gene mutation suggests a

24

novel genetic mechanism predisposing to ketosis-prone diabetes. J Clin Endocrinol Metab 2005;90:4446-51 14. Pandolfi PP, Sonati F, Rivi R, Mason P, Grosveld F and Luzzatto L. Targeted disruption of the housekeeping gene encoding glucose 6-phosphate dehydrogenase (G6PD): G6PD is dispensable for pentose synthesis but essential for defense against oxidative stress. Embo J 1995;14:5209-15 15. Friel H, Lederman H. A nutritional supplement formula for influenza A (H5N1) infection in humans. Med Hypotheses 2006;67:578-87 16. Valyi-Nagy T, Dermody TS. Role of oxidative damage in the pathogenesis of viral infections of the nervous system. Histol Histopathol 2005;20:957-67 17. Beck MA, Handy J and Levander OA. Host nutritional status: the neglected virulence factor. Trends Microbiol 2004;12:417-23 18. Beck MA. Nutritionally induced oxidative stress: effect on viral disease. Am J Clin Nutr 2000;71:1676S-81S 19. Bolukbas C, Bolukbas FF, Horoz M, Aslan M, Celik H and Erel O. Increased oxidative stress associated with the severity of the liver disease in various forms of hepatitis B virus infection. BMC Infect Dis 2005;5:95 20. Beck MA, Shi Q, Morris VC and Levander OA. Benign coxsackievirus damages heart muscle in iron-loaded vitamin E-deficient mice. Free Radic Biol Med 2005;38:112-6 21. Nelson HK, Shi Q, Van Dael P, et al. Host nutritional selenium status as a driving force for influenza virus mutations. Faseb J 2001;15:1846-8 22. Beck MA. Selenium and host defence towards viruses. Proc Nutr Soc 1999;58:707-11 23. Beck MA, Handy J and Levander OA. The role of oxidative stress in viral infections. Ann N Y Acad Sci 2000;917:906-12 24. Cantin AM, White TB, Cross CE, Forman HJ, Sokol RJ and Borowitz D. Antioxidants in cystic fibrosis Conclusions from the CF Antioxidant Workshop, Bethesda, Maryland, November 11-12, 2003. Free Radic Biol Med 2007;42:15-31 25. Ito T, Okumura H, Tsukue N, Kobayashi T, Honda K and Sekizawa K. Effect of diesel exhaust particles on mRNA expression of viral and bacterial receptors in rat lung epithelial L2 cells. Toxicol Lett 2006;165:66-70 26. Jaspers I, Ciencewicki JM, Zhang W, et al. Diesel exhaust enhances influenza virus infections in respiratory epithelial cells. Toxicol Sci 2005;85:990-1002 27. Weiss SR, Navas-Martin S. Coronavirus pathogenesis and the emerging pathogen severe acute respiratory syndrome coronavirus. Microbiol Mol Biol Rev 2005;69:635-64 28. Wang G, Deering C, Macke M, et al. Human coronavirus 229E infects polarized

25

airway epithelia from the apical surface. J Virol 2000;74:9234-9 29. Chilvers MA, McKean M, Rutman A, Myint BS, Silverman M and O'Callaghan C. The effects of coronavirus on human nasal ciliated respiratory epithelium. Eur Respir J 2001;18:965-70 30. Brian DA, Baric RS. Coronavirus genome structure and replication. Curr Top Microbiol Immunol 2005;287:1-30 31. Pene F, Merlat A, Vabret A, et al. Coronavirus 229E-related pneumonia in immunocompromised patients. Clin Infect Dis 2003;37:929-32 32. Chibo D, Birch C. Analysis of human coronavirus 229E spike and nucleoprotein genes demonstrates genetic drift between chronologically distinct strains. J Gen Virol 2006;87:1203-8 33. Yu CH, Liu le T, Liu S, et al. [Enhanced-real time PCR: A highly sensitive method for SARS-coronavirus detection.]. Beijing Da Xue Xue Bao 2006;38:211-3 34. Tan YJ, Lim SG and Hong W. Understanding the accessory viral proteins unique to the severe acute respiratory syndrome (SARS) coronavirus. Antiviral Res 2006;72:78-88 35. Massa EM, Farias RN. Effect of auto-oxidized phospholipids on oxidative enzyme assays based on tetrazolium salt reduction. Biochim Biophys Acta 1983;746:209-15 36. Nomura R, Kiyota A, Suzaki E, et al. Human coronavirus 229E binds to CD13 in rafts and enters the cell through caveolae. J Virol 2004;78:8701-8 37. Riva DA, de Molina MC, Rocchetta I, Gerhardt E, Coulombie FC and Mersich SE. Oxidative stress in vero cells infected with vesicular stomatitis virus. Intervirology 2006;49:294-8 38. Piccoli C, Scrima R, D'Aprile A, et al. Mitochondrial dysfunction in hepatitis C virus infection. Biochim Biophys Acta 2006;1757:1429-37 39. Wang T, Weinman SA. Causes and consequences of mitochondrial reactive oxygen species generation in hepatitis C. J Gastroenterol Hepatol 2006;21 Suppl 3:S34-7 40. Sezer S, Tutal E, Aldemir D, et al. Hepatitis C infection in hemodialysis patients: Protective against oxidative stress? Transplant Proc 2006;38:406-10 41. Ryan-Harshman M, Aldoori W. The relevance of selenium to immunity, cancer, and infectious/inflammatory diseases. Can J Diet Pract Res 2005;66:98-102 42. Wentworth DE, Tresnan DB, Turner BC, et al. Cells of human aminopeptidase N (CD13) transgenic mice are infected by human coronavirus-229E in vitro, but not in vivo. Virology 2005;335:185-97 43. Hasnain SE, Begum R, Ramaiah KV, et al. Host-pathogen interactions during apoptosis. J Biosci 2003;28:349-58 44. Kaimul Ahsan M, Nakamura H, Tanito M, Yamada K, Utsumi H and Yodoi J.

26

Thioredoxin-1 suppresses lung injury and apoptosis induced by diesel exhaust particles (DEP) by scavenging reactive oxygen species and by inhibiting DEP-induced downregulation of Akt. Free Radic Biol Med 2005;39:1549-59 45. Liu T, Castro S, Brasier AR, Jamaluddin M, Garofalo RP and Casola A. Reactive oxygen species mediate virus-induced STAT activation: role of tyrosine phosphatases. J Biol Chem 2004;279:2461-9 46. Waris G, Livolsi A, Imbert V, Peyron JF and Siddiqui A. Hepatitis C virus NS5A and subgenomic replicon activate NF-kappaB via tyrosine phosphorylation of IkappaBalpha and its degradation by calpain protease. J Biol Chem 2003;278:40778-87 47. Agostini M, Di Marco B, Nocentini G and Delfino DV. Oxidative stress and apoptosis in immune diseases. Int J Immunopathol Pharmacol 2002;15:157-164 48. Waris G, Turkson J, Hassanein T and Siddiqui A. Hepatitis C virus (HCV) constitutively activates STAT-3 via oxidative stress: role of STAT-3 in HCV replication. J Virol 2005;79:1569-80 49. Tse HM, Milton MJ, Schreiner S, Profozich JL, Trucco M and Piganelli JD. Disruption of innate-mediated proinflammatory cytokine and reactive oxygen species third signal leads to antigen-specific hyporesponsiveness. J Immunol 2007;178:908-17 50. Wu Y, Cui J, Bao X, et al. Triptolide attenuates oxidative stress, NF-kappaB activation and multiple cytokine gene expression in murine peritoneal macrophage. Int J Mol Med 2006;17:141-50 51. Rydkina E, Sahni SK, Santucci LA, Turpin LC, Baggs RB and Silverman DJ. Selective modulation of antioxidant enzyme activities in host tissues during Rickettsia conorii infection. Microb Pathog 2004;36:293-301 52. Biewenga G, de Jong J and Bast A. Lipoic acid favors thiolsulfinate formation after hypochlorous acid scavenging: a study with lipoic acid derivatives. Arch Biochem Biophys 1994;312:114-20 53. Tseng CP, Huang CL, Huang CH, et al. Disabled-2 small interfering RNA modulates cellular adhesive function and MAPK activity during megakaryocytic differentiation of K562 cells. FEBS Lett 2003;541:21-7 54. Huang CL, Cheng JC, Liao CH, et al. Disabled-2 is a negative regulator of integrin alpha(IIb)beta(3)-mediated fibrinogen adhesion and cell signaling. J Biol Chem 2004;279:42279-89 55. Kuo L, Masters PS. The small envelope protein E is not essential for murine coronavirus replication. J Virol 2003;77:4597-608 56. Chiu DT, Liu TZ. Free Radical and Oxidative Damage in Human Blood Cells. J Biomed Sci 1997;4:256-259

27

57. Lachance C, Arbour N, Cashman NR and Talbot PJ. Involvement of aminopeptidase N (CD13) in infection of human neural cells by human coronavirus 229E. J Virol 1998;72:6511-9

28

Table 1. Increased viral gene (nucleocapsid) expression in G6PD-deficient fibroblasts

(HFF1) and G6PD-knockdown cells (A549-5.8, A549-5.18 and A549-5.20) as

compared to normal fibroblasts (HFF3) and vector-only controls (A549-5S-5)

Post-infection /Viral gene expression (Fold) Cell

2 h 4 h 6 h 8 h 10 h

HFF3 1 1.06±0.85 6.34±0.81 47.01±6.85 155.42±43.44

HFF1

1

1.56±0.06

28.84±3.27*

467.88±89.41*

1601.27±349.69*

A549-5S-5 1 3.06±0.54 9.66±3.09 410.94±49.19 N. D.

A549-5.8 1 13.71±4.56 68.29±7.17* 3586.70±642.819* N. D.

A549-5.18 1 11.82±5.45 59.83±7.19* 3315.55±210.65* N. D.

A549-5.20 1 9.16±2.45 258.01±74.29* 5300.41±313.08* N. D.

Data are the means ± SEM, n=4. Number at 4, 6, 8 and 10 h post-infection were

normalized to that at 2 h post-infection.

* p <.05, G6PD-deficient or knockdown cells vs their control cells at the same

post-infection hour.

N. D. not determined.

29

Table 2. NADPH/NADP+ ratio and intracellular GSH in G6PD-deficient fibroblasts,

G6PD-knockdown epithelial cells, and their control cells with or without viral

infection.

Cells [NADPH]/[NADP+] GSH at basal condition

(µmole/g of protein)

GSH at 48h post-viral infection (µmole/g of

protein) HFF3 (normal fibroblast) 1.32 ± 0.32 35.73 ± 1.99 N.D.

HFF1 (G6PD-deficient) 0.59 ± 0.13* 27.97 ± 2.17* N.D.

A549-5S-5 (vector only control)

2.63 ± 0.19 85.68 ± 2.84 66.26 ± 0.86

A549-5.8 (G6PD-knockdown)

2.09 ± 0.37* 70.71 ± 3.84* 49.50 ± 1.53*

Pyridine nucleotide expressed as NADPH/NADP ratio and total intracellular GSH

amount in cells measured by HPLC. Values are means ± SD, n = 5.

* Significantly different from their control and p <.05.

N. D. not determined.

30

Figure Legends

Fig. 1 Increased cell death in G6PD-deficient fibroblasts following HCoV 229E

infection. Different M.O.I. of HCoV 229E was added to the same passage of

fibroblast cells (PDL 12) and after 48 h (B) and 72 h (A and C) post-infection the cell

viability was determined by MTT assay. All the cell viability was determined by the

absorbance of MTT assay and expressed as percent of the respective HCoV

229E-infected nonexposed control. Data are the means ± SEM, n=4. *p <.05, HFF1

(G6PD-deficient fibroblasts) vs HFF3 (normal fibroblasts) at the same virus titer.

Fig. 2 Increased cell death in G6PD-knockdown A549 epithelial cells following

HCoV 229E infection. The indicated A549 vector and G6PD-knockdown cells were

harvested for G6PD activity assay (A) and western blot of G6PD protein (B). G6PD

activity was given in IU/mg of protein in cell lysate. Cell viability of

G6PD-knockdown A549 and their control with HCoV 229E virus infection at

different M.O.I. for 24 (C), 48 (D) & 72h (E) was shown. Data are the means ± SEM,

n=4. *p <.05; **p <.01, vector only A549-5S-5 vs G6PD-knockdown A549-5.8,

A549-5.18 or A549-5.20 epithelial cells.

Fig. 3 Cell surface CD13 receptor expression in G6PD-deficient and normal

31

fibroblasts, as well as in G6PD-knockdown epithelial A549 and their vector only

control. The amount of surface receptor CD13 of G6PD-deficient fibroblasts (HFF1),

normal fibroblasts (HFF3), G6PD-knockdown epithelial cell line (A549-5.8,

A549-5.18 & A549-5.20) and their control cells (A549-5S-5) was determined by flow

cytometry (A and C), and by western blot (B and D) as described in Experimental

procedures.

Fig. 4 Elevated viral particle production in G6PD-deficient cells as indicated by

plaque assay. 0.1 M.O.I. of viruses were used for infection and plaque assay was

applied for measurement of virus titer. (A) Viral particle production as visualized by

plaque formation was higher in G6PD-deficient fibroblasts (HFF1) at 24 h

post-infection comparing to normal fibroblasts (HFF3). (B) Virus production was

found to be higher in HFF1 than in HFF3, especially at 24h post-infection. (C)

Similar data were found that viral particle production was higher in

G6PD-knockdown A549 (A549-5.8, A549-5.18 and A549-5.20) than in their control

(A549-5S-5). Data are the means ± SEM, n=4. *p <.05; **p <.01, HFF1 vs HFF3,

vector only A549-5S-5 vs G6PD-knockdown A549-5.8 or A549-5.18 or A549-5.20

epithelial cells at 0.1 M.O.I. of HCoV 229E.

32

Fig. 5 Amelioration of virus-induced cell death and viral gene expression by

ectopic expression of G6PD. HFF1 cells were infected with control (LEIN), or

G6PD-expressing retroviruses (LGIN & LKGIN). Expression of G6PD activity by

activity assay (A), CD13 and G6PD protein (B) by western blot are shown. (C) Cell

viability of LEIN, LGIN & LKGIN after infection with HCoV 229E at different

M.O.I. for 72h was shown. (D) After 8h post-infection viral gene expression

(nucleocapsid expression) as determined by Q-PCR is significantly decreasing in

G6PD over-expressed cells (LGIN & LKGIN) comparing to their control (LEIN).

Data are the means ± SEM, n=4. *p <.05; **p<.01, LGIN or LKGIN vs LEIN

fibroblasts.

Fig. 6 ROS production of G6PD-knockdown epithelial cells (A549-5.8) and

control cells (A549-5S-5) in basal condition and after virus-infection. A549 cells

were loaded with 20�µM DCF-DA for 30 min after exposure to 0 (basal condition) or

0.1 M.O.I. of HCoV 229E after 48 h post-infection. Fluorescence was measured using

Flow cytometry.

Fig. 7 Protective effect of antioxidants against virus infection at 48 h

post-infection in G6PD-knockdown cells pretreated with antioxidant 5 h before

33

viral infection. (A) A consistent protective effect by antioxidant lipoic acid (LA)

against virus-induced cell death was observed. (B) ROS production following virus

infection was attenuated by antioxidant (0.1 mM LA) pre-treatment. (C) Viral gene

(nuclecapsid) expression of antioxidant-pretreatment cells and control cells was

determined by Q-PCR after 2, 4, 6, 8 and 10 h post-infection with HCoV 229E

infection.

34

A

B C

Fig. 1

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100

HFF1 PDL12 (48 h p.i.)HFF3 PDL12 (48 h p.i.)

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100

HFF1 PDL12 (72 h p.i.)HFF3 PDL12 (72 h p.i.)

* * *

* * *

M .O .I.

0.0 0.5 1.0 1.5 2.0

Cel

l via

bilit

y(%

of u

ninf

ecte

d co

ntro

l)

20

40

60

80

100

HFF1 PDL12 (72 h p.i.)HFF3 PDL12 (72 h p.i.)

35

A B C D E

Fig. 2

CellA549-5S-5A549-5.8 A59-5.18 A549-5.20

G6P

D a

ctiv

ity (I

U/m

g)

0.0

0.5

1.0

1.5

2.0

2.5

** **

**

G6PD

Actin

A549 A549 A549 A549

-5S-5 -5.8 -5.18 -5.20

72 h post-infection

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100

A549-5S-5A549-5.8A549-5.18A549-5.20

** ** **

48 h post-infection

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100 A549-5S-5A549-5.8A549-5.18A549-5.20

** ** **

24 h post-infection

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100

A549-5S-5A549-5.8A549-5.18A549-5.20

* * *

36

A B

C D

Fig. 3

HFF1 (G6PD-deficient)

(PDL12)

HFF3 (control) (PDL12)

� � � � �

� � � � �

�� � � �

� � � � �

� � � � �

�� � � �

CD13

Actin

HFF1 HFF3 PDL 12

� � � � � � �

� � � � � �

�� � � � �

� � � � � � �

� � � � � �

�� � � � �

� � � � � � �

� � � � � �

�� � � �

� � � � � � �

� � � � � �

�� � � � �

A549-5.18 A549-5.20 (G6PD knockdown) (G6PD knockdown)

A549-5S-5 A549-5.8 (control) (G6PD knockdown) A549 A549 A549 A549

-5S-5 -5.8 -5.18 -5.20

CD13

Actin

37

A B

HFF1

HFF3

C

Fig. 4

Cell

HFF1 HFF3

Pla

que

form

atio

n un

it (P

FU*1

05 /ml)

0

5

10

15

20

25

30

3524 h postinfection48 h postinfection

*

CellA549-5S-5 A549-5.8 A549-5.18 A549-5.20

Pla

que

form

atio

n un

it (P

FU

*107 /m

l)

0

10

20

30

40

50

60 24 h postinfection48 h postinfection

** **

**

38

A B

C D

Fig. 5

Cell

LEIN LGIN LKGIN

G6P

D a

ctiv

ity (

IU/m

g)

0.0

0.2

0.4

0.6

0.8

1.0

** **

G6PD

Actin

LEIN LGIN LKGIN

CD13

M.O.I.

0.00 0.02 0.04 0.06 0.08 0.10 0.12

Cel

l via

bilit

y (%

of u

ninf

ecte

d co

ntro

l)

0

20

40

60

80

100 LEIN PDL40 (72 h p.i.)LGIN PDL40 (72 h p.i.)LKGIN PDL40 (72 h p.i.)

** **

*

Time (Post-infection, h)

0 2 4 6 8 10 12

Rel

ativ

e vi

ral g

ene

expr

essi

on

0

1000

2000

3000

4000

5000

6000

7000

LEINLGINLKGIN

** **

**

**

39

Virus infection

A549-5S-5 A549-5.8

Virus infection

Normal condition

Normal condition

Fig 6

40

A549-5S-5

A549-5.8

w/o antioxidant

w/o antioxidant

with antioxidant

with antioxidant

A B

C

Fig. 7

Cells

A549-5S-5 A549-5.8 A549-5.18 A549-5.20

Cel

l via

bilit

y(%

of u

ninf

ecte

d co

ntro

l)

40

50

60

70

80

90

100Control0.01 mM LA0.1 mM LA

Time (Post-infection, hour)

0 2 4 6 8 10 12

Rel

ativ

e vi

ral g

ene

expr

essi

on

0

1000

2000

3000

4000

5000

6000

7000

8000

A549-5S-5A549-5.8A549-5S-5 with LA pretreatmentA549-5.8 with LA pretreatment