pharmacogenetics hype or hope?. cdd course june 8, 2006 2 lecture overview drug discovery path...
Post on 20-Jan-2016
214 views
TRANSCRIPT
![Page 1: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/1.jpg)
Pharmacogenetics Pharmacogenetics
Hype or Hope?Hype or Hope?
![Page 2: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/2.jpg)
2CDD Course June 8, 2006
Lecture OverviewLecture Overview
• Drug Discovery Path– What are the problems?– What are the causes?
• What is genetic variance?– What is the driving force and how does it lead to disease?– How do we measure it?
• Genetic variance in Drug response: pharmacogenetics– How do we measure it?– Are there any examples?– How do we apply it?– Is it feasible? Technically and economically?
• Outlook for the future
![Page 3: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/3.jpg)
3CDD Course June 8, 2006
First: what is the definition of First: what is the definition of Pharmacogenetics?Pharmacogenetics?
• Pharmacogenetics:
– The genetics of drug response– The patient’s point of view, what a patient does with the drug
• Pharmacogenomics:
– The study of drug-induced gene expression– The drug’s point of view, what a drug does to the patient
![Page 4: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/4.jpg)
Drug Discovery PathDrug Discovery Path
![Page 5: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/5.jpg)
5CDD Course June 8, 2006
Intermezzo: Intermezzo: The Drug Discovery Pathway The Drug Discovery Pathway
and its problemsand its problems
TargetDiscovery
Lead Discovery
Lead Optimization
ExploratoryDevelopment
FullDevelopment Market
00 22 44 7766 1212 141499No. of years:No. of years:
1 NCE:1 NCE: 14 years14 years
USD 800 millionUSD 800 million
No. of projects:No. of projects:5757 1414 88 4.54.5 22 113636 2222
90% attrition
No. of compounds:No. of compounds:300.000300.000 1515 4-54-5 2-32-3 1-21-2 11
Data based on several leading pharmaData based on several leading pharma{Brown, 2003, Drug Disc. Today 8, 23}{Brown, 2003, Drug Disc. Today 8, 23}
Phase I, IIa Phase III, IV
![Page 6: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/6.jpg)
6CDD Course June 8, 2006
First human dose to First patient
dose
First patient dose to First pivotal
dose
First pivotal dose to First
submission
First submission to First launch
Su
cces
s r
a te
Year of entry into phaseCurrent success rate
1994
-96
1995
-97
1996
-98
1997
-99
1998
-00
1999
-01
1994
-96
1995
-97
1996
-98
1997
-99
1998
-00
1999
-01
1994
-96
1995
-97
1996
-98
1997
-99
1998
-00
1999
-01
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
1994
-96
1995
-97
1996
-98
1997
-99
1998
-00
1999
-01
Trends in success rates by Trends in success rates by phasephase
CMR success rates CMR success rates methodologymethodology
![Page 7: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/7.jpg)
7CDD Course June 8, 2006
Reasons for attritionReasons for attritionAttrition as a result of Drug safety and efficacy mainly caused
by:
• Unexpected differences with animal models used in pre-clinical research– Animal disease models poorly match (especially in immunological
diseases and CNS) – Animal toxicology and metabolism can differ significantly from
humans• Unexpected variance in the human population with regard
to drug metabolism and efficacy.– Varying degrees of genetic predisposition– Currently difficult to anticipate on (lack of information on
cause/effect to steer prediction)
![Page 8: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/8.jpg)
What is genetic variance?What is genetic variance?
![Page 9: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/9.jpg)
9CDD Course June 8, 2006
Genetic variationGenetic variation
Egg production (6 weeks)
Meat production (6 weeks)
On average, one human to another differs ~0.1% On average, one human to another differs ~0.1% (=~3.2 10(=~3.2 106 6 nucleotides)nucleotides)
![Page 10: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/10.jpg)
10CDD Course June 8, 2006
D.simulans & D.yakubaD.simulans & D.yakuba
20%
36,000,000 differences
600,000 aa differences
![Page 11: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/11.jpg)
11CDD Course June 8, 2006
1%
34,000,000 nucleotide differences290,000 amino acid differences
![Page 12: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/12.jpg)
12CDD Course June 8, 2006
0.1%
3,400,000 nucleotide differences12,800 amino acid differences
![Page 13: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/13.jpg)
13CDD Course June 8, 2006
Variance, some definitionsVariance, some definitions• Gene unit of hereditary information that occupies a fixed
position (locus) on a chromosome. Genes achieve their effects by directing the synthesis of proteins.
• Allele An appearance of a gene on either of the 2 chromosomes, or: one member of a pair or series of genes that occupy a specific position on a specific chromosome.
• Haplotype A combination of polymorphisms or genes or other genetic landmarks on one chromosome of anindividual
• Genotype The total genetic makeup of an individual
![Page 14: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/14.jpg)
14CDD Course June 8, 2006
Definition of a Definition of a PolymorphismPolymorphism
• polymorphism= the inheritance of genes in different forms termed alleles
• alleles have different DNA sequences
• polymorphic locus: the frequency of the most common allele is less than 99%.– 1 allele in 100 alleles– 100 alleles =50 people– 1 person in 50 (2%) is heterozygous
![Page 15: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/15.jpg)
15CDD Course June 8, 2006
Types of Polymorphisms,Types of Polymorphisms,Sequence variationSequence variation
• Single Nucleotide Polymorphism (SNP): GAATTTAAG
GAATTCAAG• Simple Sequence Length
Polymorphism (SSLP): NCACACACAN • Also known as CA-repeat NCACACACACACACAN• NCACACACACACAN
• Insertion/Deletion: GAAATTCCAAGGAAA[ ]CCAAG
![Page 16: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/16.jpg)
16CDD Course June 8, 2006
Genome structural Genome structural variationvariation
Feuk et al. Nature Reviews Genetics 7, 85–97 (2006)
In addition, variation in active genes is now found to be much higher than originally anticipated
![Page 17: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/17.jpg)
17CDD Course June 8, 2006
Other types of variationOther types of variation
• DNA methylation sites
• Epigenetic control
• ?
![Page 18: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/18.jpg)
18CDD Course June 8, 2006
What’s the difference What’s the difference between a SNP and a between a SNP and a
mutation?mutation?• None!
• We generally say a mutation is disease (phenotype) related
• SNPs and mutations are just a sign of variance, constant mutation rate with evolutionary consequences
![Page 19: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/19.jpg)
19CDD Course June 8, 2006
Constant mutation rate Constant mutation rate
• Negative selection
• Neutral
• Positive selection
![Page 20: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/20.jpg)
20CDD Course June 8, 2006 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
Sickle cellallele in Africa
1–5%5–10%10–20%
P. Falciparummalaria in Africa
Malaria
Normal red blood cellsSickled red blood cells
Heterozygote Advantage: Sickle Heterozygote Advantage: Sickle cell trait confers resistance to cell trait confers resistance to
MalariaMalaria
![Page 21: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/21.jpg)
21CDD Course June 8, 2006
Another exampleAnother example
• Lactose intolerance
• Study in the Finish population
• Demonstrated that actually this is the wild type, whereas lactose tolerance is caused by a recent mutation
![Page 22: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/22.jpg)
22CDD Course June 8, 2006
Co-Co-evolutionevolution
North-Central Europe
PCA using cattle diversity1st component derived from the allele frequencies of cattle genes
PCA using cattle diversity1st component derived from the allele frequencies of the human lactose persistence genes
![Page 23: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/23.jpg)
23CDD Course June 8, 2006
Mendelian vs. complex diseasesMendelian vs. complex diseasesoror
Monogenic vs. Polygenic Monogenic vs. Polygenic inheritanceinheritance
![Page 24: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/24.jpg)
24CDD Course June 8, 2006
Genetic variance Genetic variance measurementsmeasurements
• These days most commonly performed by measuring the Single Nucleotide Polymorphisms (SNPs)
![Page 25: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/25.jpg)
25CDD Course June 8, 2006
SNPsSNPs
Paternal allele: CCCGCCTTCTTGGCTTTACA
Maternal allele: CCCGCCTTCTCGGCTTTACA
Paternal allele : CCCGCCTTCTTGGCTTTACA
Maternal allele : CCCGCCTTCTTGGCTTTACA
![Page 26: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/26.jpg)
26CDD Course June 8, 2006
Distribution of SNPs for 1630 Distribution of SNPs for 1630 Genes (Genaissance HapFocus Genes (Genaissance HapFocus
DB)DB)
4.15.7 5.8 4.5 6.1
0
1
2
3
4
5
6
7
8
9
10
Coding 5' UTR 5' Upstream Intron 3' UTR
SN
Ps
per
kb
of
DN
A
![Page 27: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/27.jpg)
27CDD Course June 8, 2006
Gene SNPs01
01
01
01
01 ~15 SNPs per gene
215 combinations
Genaissance principle in a Genaissance principle in a nutshellnutshell
HAP™ Markers: gene HAP™ Markers: gene haplotypeshaplotypes
ChromosomeLocus of Gene
Exons
Promoters
SNPs
PairedHaplotypes
0 1 0 0 1
1 0 1 1 0
~18 haplotypes per gene
![Page 28: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/28.jpg)
28CDD Course June 8, 2006
Mendelian inheritance vs Mendelian inheritance vs non-Mendelian inheritancenon-Mendelian inheritance
Example: autosomal dominant inheritance Example: Asthma in the Icelandic population
![Page 29: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/29.jpg)
29CDD Course June 8, 2006
Different methods to Different methods to measure variance and measure variance and
inheritanceinheritance• Family based
– Traditional linkage analysis– Allele sharing: IBS/IBD
• Population based– Case-Control study– Transmission disequilibrium test (TDT)– Sibling control
![Page 30: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/30.jpg)
30CDD Course June 8, 2006
LD vs Risk RatiosLD vs Risk RatiosLinkage describes the phenomenon whereby allele at neighboring loci are close to one another on the same chromosome, they will be transmitted together more frequently than chance. LOD score : Z(q) = log10 [L(q) / L(1/2)]
Two basic hypotheses are tested:
H0: free recombination, q = 1/2
H1: linkage, q < 1/2
where q is the recombination fractionand L is a likelihood function
lod score > 3: evidence of linkagelod score > 3: evidence of linkage
2 < lod score < 3: suggestive evidence of linkage2 < lod score < 3: suggestive evidence of linkage
-2 < lod score < 2: uninformative of linkage -2 < lod score < 2: uninformative of linkage
lod score < -2: exclusion of linkagelod score < -2: exclusion of linkage
Recurrence Risk Ratio (λ)Recurrence Risk Ratio (λ)
Frequency in relatives of affected personFrequency in relatives of affected person
λλr r = -------------------------------------------------------= -------------------------------------------------------
Population frequencyPopulation frequency
r denotes the degree of relationshipr denotes the degree of relationship
Disease λ s
Cystic fibrosis 500 Type I diabetes 15 schizophrenia 8.6 Type II diabetes 3.5
![Page 31: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/31.jpg)
Genetic Variance in Drug Genetic Variance in Drug ResponseResponse
![Page 32: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/32.jpg)
32CDD Course June 8, 2006
“…“…more than 90% of more than 90% of drugs only work in 30-50% drugs only work in 30-50%
of people.” of people.”
Allen D. Roses GlaxoSmithKlineAllen D. Roses GlaxoSmithKline
![Page 33: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/33.jpg)
33CDD Course June 8, 2006
Where do drugs interact with Where do drugs interact with proteins?proteins?
•
Goldstein et al. Nature Rev. Gen. 4, 937 (2003)
![Page 34: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/34.jpg)
34CDD Course June 8, 2006
Pharmacogenetic Basis for Pharmacogenetic Basis for
Differences in Medicine Differences in Medicine ResponseResponse
• Patients may have altered drug efficacy or greater risk of drug-related adverse events stemming from polymorphisms in:– genes encoding the drug target– genes encoding drug metabolizing enzymes– genes related to drug clearance mechanisms– genes causally linked to the disease and hence
causally related to drug efficacy – genes causally linked to mechanisms
underlying adverse events
![Page 35: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/35.jpg)
35CDD Course June 8, 2006
2000In the US the cost of problems linked to drug
use in the ambulatory setting exceeded $US177 billion in the year 2000
Rodriguez-Monguio R et al 2003 Pharmacoeconomics 21(9):623-50
2000In the US the cost of problems linked to drug
use in the ambulatory setting exceeded $US177 billion in the year 2000
Rodriguez-Monguio R et al 2003 Pharmacoeconomics 21(9):623-50
197328% of hospitalized patients had adverse drug reactions
Miller Am J Hosp Pharm 30:584-592
197328% of hospitalized patients had adverse drug reactions
Miller Am J Hosp Pharm 30:584-592
197917% of hospitalized children had adverse drug-attributed events
Mitchell AA et al Am J Epid
110: 196-204
197917% of hospitalized children had adverse drug-attributed events
Mitchell AA et al Am J Epid
110: 196-204 1994
2,216,000 serious adverse drug reactions in hospitalized patients
Lazarou et al 1998; 279: 1200-1205
19942,216,000 serious adverse drug reactions in hospitalized patients
Lazarou et al 1998; 279: 1200-1205 1995
Drug-related morbidity & mortality estimated at $76.6 billion
Johnson & Bootman Arch Intern Med 1995; 155: 1949-56
Adverse Drug Reactions Adverse Drug Reactions Incidence and CostIncidence and Cost
![Page 36: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/36.jpg)
36CDD Course June 8, 2006
Cytochrome P450 Cytochrome P450 enzymesenzymes
Four phenotypes identified:– Poor metabolizer: lack the functional
enzyme (7%)– Intermediary metabolizers: heterozygous
for one deficient allele or carry two alleles that cause reduced activity
– Extensive metabolizers: two normal alleles– Ultra rapid metabolizers: multiple gene
copies (5,5%)
![Page 37: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/37.jpg)
37CDD Course June 8, 2006
Meyer, Nature Reviews Genetics 2004
![Page 38: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/38.jpg)
38CDD Course June 8, 2006
The consequences of outlier cytochrome The consequences of outlier cytochrome P450 CYP2D6-dependent drug P450 CYP2D6-dependent drug
metabolism. metabolism.
![Page 39: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/39.jpg)
39CDD Course June 8, 2006
Other examples of Other examples of metabolizing enzymesmetabolizing enzymes
![Page 40: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/40.jpg)
40CDD Course June 8, 2006
These associations were compiled from the literature by using the keywords „pharmacogenetics“ OR pharmacogenomcis“, „association study“ AND „drug response“, „polymorphism“ AND „drug response“.
Goldstein et al. Nature Rev. Gen. 4, 937 (2003)
![Page 41: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/41.jpg)
Any examples?Any examples?
![Page 42: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/42.jpg)
42CDD Course June 8, 2006
Some Products where PGx Some Products where PGx makes a differencemakes a difference
![Page 43: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/43.jpg)
43CDD Course June 8, 2006
Biotech examplesBiotech examples
• Anti cancer drug Herceptin (MoAb)ERBB2 is a 185-kda (mw) tyrosine kinase receptor that might be
overexpressed in 25–30% of human breast cancers.
overexpression of erbb2 is associated with enhanced tumour aggressiveness and a high risk of relapse and death effective treatment was shown in patient over expressing ERBB2
• Anti TNF (Infliximab)SNP in the promotor seems to be associated with reduced
response with Infliximab (more TNF compensates for anti-TNF
![Page 44: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/44.jpg)
44CDD Course June 8, 2006
2 Adrenergic Receptor2 Adrenergic Receptor
• G Protein-coupled receptor expressed throughout the body• Receptor for catecholamines (epinephrine and norepinephrine)• Drug target in the treatment of heart failure and asthma• Also thought to play a role in obesity and possibly diabetes
![Page 45: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/45.jpg)
45CDD Course June 8, 2006
Function of ADRB2 VariantsFunction of ADRB2 Variants
• Ile164, Gly16 and the Gly16/Gln27 combination are associated with depressed exercise performance in heart failure (Wagoner et al., 2000)• Gly16 associated with nocturnal asthma (OR 3.8)• Gly16 associated with increased agonist-promoted downregulation of ADRB2• Glu27 markedly associated with obesity (OR 10), Glu27 homozygotes had 50% larger fat cells
![Page 46: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/46.jpg)
46CDD Course June 8, 2006
ADRB2 HaplotypesADRB2 Haplotypes
13 SNPs found in 12 haplotypes out of 8,192 possible haplotypesDivergence between ethnic groups
![Page 47: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/47.jpg)
47CDD Course June 8, 2006
Phylogeny of ADRB2 HaplotypesPhylogeny of ADRB2 Haplotypes
• Based only on the multi-ethnic panel• Some haplotypes related to others by recombination
![Page 48: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/48.jpg)
48CDD Course June 8, 2006
Functional Analysis of ADRB2 Haplotype PairsFunctional Analysis of ADRB2 Haplotype Pairs
• Mean responses by haplotype pair varied by >2-fold• Response significantly related to haplotype pair• Response not related to individual SNPs• Note that the 2/4 haplotype pair has a B2AR agonist response halfway between that of the 2/2 pair and the 4/4 pair
FEV = Forced Expiration Volume
![Page 49: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/49.jpg)
49CDD Course June 8, 2006
Expression Analysis of ADRB2 HaplotypesExpression Analysis of ADRB2 Haplotypes
![Page 50: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/50.jpg)
How do we apply it?How do we apply it?
![Page 51: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/51.jpg)
51CDD Course June 8, 2006
Genetic Marker = Genetic Marker = BiomarkerBiomarker
• A genetic marker is a predictive biomarker
• The predictive power of a genetic marker is determined by the strength of the underlying genetics in a disease and drug response
• The value lies in focused therapies and focused clinical development
![Page 52: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/52.jpg)
52CDD Course June 8, 2006
Mendelian Mendelian (Monogenic) (Monogenic)
Disorders/Drug Disorders/Drug response response
Compared With Compared With
Complex Complex (Polygenic)(Polygenic)
Disorders/Drug Disorders/Drug responseresponsePeltonen and McKusick. Science. 2001;291:1224-1229.
![Page 53: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/53.jpg)
53CDD Course June 8, 2006
GenotypingGenotyping
1.Candidate gene(s)• Develop SNP genotypes and haplotypes for each
implicated gene(s)• Genes selected based on
– Biological paradigms– Knowledge of disease pathogenesis– Genomic data mining
2.Total genome analysis• Screen patients (and controls) in attempt to identify
a genomic region containing the drug response gene(s)
– Use positional cloning to isolate and characterize the underlying gene
![Page 54: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/54.jpg)
54CDD Course June 8, 2006
DiseaseResponder
ControlNon-responder
Allele 1 Allele 2
Marker A is associated with Phenotype
Marker A:
Allele 1 =
Allele 2 =
Human Genetic Association Human Genetic Association Study DesignStudy Design
![Page 55: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/55.jpg)
55CDD Course June 8, 2006
Disease PopulationN=500
Matched Control PopulationN=500
122~3,000,000 common SNPs across genome
• Representing every gene
P v
alu
e
1 22
Informatics to ID gene(s) mapped to associated SNP
Regions of association
Chromosomal Location
Whole Genome Whole Genome AssociationsAssociations
![Page 56: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/56.jpg)
56
Blocks vs BinsBlocks vs Bins
![Page 57: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/57.jpg)
57
Block Tags vs Bin TagsBlock Tags vs Bin Tags
• 6 Bin Tags• 4 Haplotype Tags
![Page 58: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/58.jpg)
58
Gene X ExampleGene X Example
Source SNPs Bins Bins missedHapMap 40 23^ 5Perlegen 40 15' 13Journals 9 8 20
Total 66* 28*
^ - 19 haplotype tags for these 23 bins.‘ - Equals 16 HapMap bins.* - Includes 1 AA SNP (MAF = 0.05) from Genaissance not seen in the other three sources.
NB – There are approximately 300 SNPs across the gene genomic interval in dbSNP and the PG Genetics Database.
![Page 59: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/59.jpg)
59
Selection ConsiderationsSelection Considerations
Sources Effect on protein Extent of LD (D’ vs r2)
True measure of gene size Number and length of bins/blocks
Tag bins or tag haplotypes SNP coverage in gaps between bins/blocks Power
Number of SNPs Allele Frequency
![Page 60: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/60.jpg)
60
Power CalculationPower Calculation
![Page 61: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/61.jpg)
61
Selection ConsiderationsSelection Considerations
Sources Effect on protein Extent of LD (D’ vs r2)
True measure of gene size Number and length of bins/blocks
Tag bins or tag haplotypes SNP coverage in gaps between bins/blocks Power
Number of SNPs Allele Frequency
![Page 62: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/62.jpg)
62
X gene structure 02012006X gene structure 02012006
CA
CHB/JPT
rs1799914J/C 10%
+198
rs486779826%
J/C 46%+2203
rs68640%
J/C 15%+1402
rs1251822213%
J/C 24%+2934
rs70374832%
J/C 38%+4067
BOTH
rs216863114%
-5900
rs68599703%
-9891
rs6878159J/C 26%
-6299
rs2674023%
-13001
rs247102038%
J/C 17%-18794
rs26740546%
-14450
rs1355077J/C 39%-20211
rs1496133J/C 44%-23178
rs2644645J/C 35%-26084
rs686272128%
-25710
rs17065069J/C 15%-25300
![Page 63: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/63.jpg)
63
CA
JPT/CHB
BOTH
Y gene structure 02072006Y gene structure 02072006
rs34607633%
J/C 35%-8042
rs180904913%
J/C 32%+2161
rs259496638%
+24552
rs34607018%
+3151
rs346078 33% +27116
rs101811130%
J/C 31%-1202
rs12629094J/C 7%-45787
rs762575624%
J/C 27%-51007
rs34759435%
J/C 32%-51196
rs124884104%
-54972
rs187495922%
J/C 36%-53464
rs34759640%
J/C 41%-41217
rs1191505016%
J/C 30%-35491
rs6773737J/C 27%-35402
rs4660646J/C 14%
-9553
rs2606731J/C 27%
-9109
rs347606J/C 20%-36418
rs4684787 29% +279141
rs9876898 18% +267237
rs17534941 4% +127798
rs7621218 J/C 36% +141289
rs7623889 4% +176663rs9818393 J/C 14% +208944
rs7623147 3% +219309
rs11128552 16% J/C 38% +239231rs2442793 5% +246971
rs2443706 16% +249781rs2447607 38% +251303
rs3856794 20% +261381
rs2344826 11% +261903
rs2594992 J/C 35% +60273
rs3816380 15% +81249rs1375204 6% +86992
rs12630869 J/C 6% +89530
rs9310379 37% +133419
rs4684776 J/C 43% +142499
rs9848833 J/C 8% +145801rs11707842 22% +172140rs9816564 J/C 37% +174573
rs13081468 5% +28029
rs2606757 J/C 38% +57439rs17034276 J/C 8% +58075
![Page 64: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/64.jpg)
64
CYP2D6 gene structure 02092006CYP2D6 gene structure 02092006
CA
CHB/JPT
rs962001810%
+77761
rs1058172N/S%+3266
rs3915951N/S%+3158
rs11568728N/S%+1848
rs1058164SYN%+1662
BOTH
rs482207510%
+176388
rs600256148%
+179744rs5751188
6%J/C 44%+180908
rs600256033%
+182062
rs962353133%
+7250rs5758589
45%J/C 35%+8412
rs106275331%
J/C 6%+146137
rs2743467J/C 26%+24430
rs2070903J/C 20%+21998
rs4467371J/C 42%+16878
rs112603J/C 30%-149135rs9611766
20%J/C 32%-149689
rs599613520%
-102508
rs121658468%
-110348
rs80506J/C 34%-150190
rs13487148%
-113766rs5758686
24%J/C 24%-116427
rs13487347%
J/C 39%-118616
rs575123219%
-25354
rs93063568%
-28140rs738257
24%-30348
rs17002868J/C 22%-45516
rs21426956%
-42298
rs48221008%
-143836
rs13488324%
J/C 38%-132537
rs81426734%
-57303
rs4822079J/C 14%+144336
rs1333095%
+140342
rs133330J/C 18%+129492
rs13333724%
J/C 13%+122253
![Page 65: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/65.jpg)
Is it feasible? Are there risks?Is it feasible? Are there risks?How can we calculate the benefits?How can we calculate the benefits?
![Page 66: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/66.jpg)
66CDD Course June 8, 2006
Genetic Pedigree of World Genetic Pedigree of World PopulationsPopulations
Adapted from Cavalli-Sforza and Feldman. Nat Genet. 2003
![Page 67: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/67.jpg)
67CDD Course June 8, 2006
Haplotype block Haplotype block differences among differences among
populationspopulations
![Page 68: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/68.jpg)
68CDD Course June 8, 2006
SNPs in different SNPs in different populationspopulations
![Page 69: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/69.jpg)
69CDD Course June 8, 2006
Effect of sampling in Effect of sampling in association studiesassociation studies
![Page 70: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/70.jpg)
70CDD Course June 8, 2006
Genotyping children with Genotyping children with ALLALL
From : Veenstra et al., AAPS Pharmsci 2000;
![Page 71: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/71.jpg)
71CDD Course June 8, 2006
A simple Health A simple Health Economics ModelEconomics Model
BCG report, 2001
![Page 72: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/72.jpg)
72CDD Course June 8, 2006
What is the prevalence of What is the prevalence of the the
genetic variant?genetic variant?• Genetic testing is essentially a screening strategy• Thus, the frequency of the variant allele in the
population being tested will be a critical factor • Example:
– prevalence of a genotype is 0.5%, – 200 patients must be tested to identify 1 patient with a
variant allele, on average
• Sensitivity enhanced by methods used in CEA– e.g., calculating an incremental cost effectiveness ratio
From : Veenstra et al., AAPS Pharmsci 2000;
![Page 73: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/73.jpg)
73CDD Course June 8, 2006
Hypothetical AnalysisHypothetical Analysis
• Varied the following parameters:– cost of the test ($5 to $250)– mortality due to severe myleosuppression (5% to 25%)– prevalence of patients with a TPMT (thiopurine s-
methyltransferase ) deficient genotype (0.3%, 0.5%, and 1.0%)
• These 3 parameters are representative of 3 of the dimensions that affect the cost-effectiveness of genetic testing: – economic (cost of test)– genetic (genotype prevalence)– clinical (mortality of myleosuppression)
From : Veenstra et al., AAPS Pharmsci 2000;
![Page 74: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/74.jpg)
74CDD Course June 8, 2006
Genotype prevalence Genotype prevalence 0.3%0.3%
25% 21% 17% 13% 9%5%
$5
$80
$150
$225
$0
$50,000
$100,000
$150,000
Incremental cost-effectiveness ratio
($/QALY)
Attributable mortality of severe myleosuppresion
Cost of test
Deficient genotype prevalence 0.3%
100000-150000
50000-100000
0-50000
QALY, equivalent to 1 year of perfect health
From : Veenstra et al., AAPS Pharmsci 2000;
![Page 75: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/75.jpg)
75CDD Course June 8, 2006
Genotype prevalence Genotype prevalence 1.0%1.0%
25% 21% 17% 13% 9%5%
$5
$80
$150
$225
$0
$50,000
$100,000
$150,000
Incremental cost-effectiveness ratio
($/QALY)
Attributable mortality of severe myleosuppression
Cost of test
Deficient genotype prevalence 1.0%
100000-150000
50000-100000
0-50000
From : Veenstra et al., AAPS Pharmsci 2000;
![Page 76: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/76.jpg)
76CDD Course June 8, 2006
Ethical issues to consider:Ethical issues to consider:AnonymizationAnonymization
Copy,Copy,
RELABEL,RELABEL,
Remove SID 123 and Remove SID 123 and personal identifiers personal identifiers
((eg eg DOB)DOB)
AnonymizedAnonymizedGenomicGenomicAnalysisAnalysis
Anonymized Samples
Anonymized Data
123
Sample
123
Clinical dataSecure Data in
PharmacogenomicsDatabase
XYZ
XYZ
new tube,new tube,
remove SID 123,remove SID 123,
RELABELRELABEL
DELETE LINK
LINK
123~XYZ … …… …… …X
Subject 123 at Study Site
XYZ
Secure Sample Storage
New Random ID (XYZ) Generated in Secure File
LINK
123~XYZ … …… …… …
![Page 77: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/77.jpg)
77CDD Course June 8, 2006
Predicting Treatment Predicting Treatment response and outcomeresponse and outcome
• Each individual has a unique genetic make-up
• During the course of live our environment shapes our disease risk and drug response
• Pharmacogenetics aims at:– Predicting the treatment efficacy for improved
therapy– Avoiding potential health risks due to side effects– Speed up drug discovery by patient stratification
![Page 78: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/78.jpg)
78CDD Course June 8, 2006
What areas will benefit most What areas will benefit most from Pharmacogenetics?from Pharmacogenetics?
• Therapeutic areas where treatment response prediction is a question of life and death, e.g. cancer and psychiatric diseases
• Therapeutic areas where little is know about the disease mechanisms and mechanism of action of a drug, e.g. psychiatric disorders
![Page 79: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/79.jpg)
79CDD Course June 8, 2006
Pharmacogenetics and Pharmacogenetics and CNSCNS
• There’s a need for better classification of psychiatric disorders
• Modern life science approaches deliver endophenotypes:– Genetics/genomics– Proteomics– Imaging– Etc.
![Page 80: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/80.jpg)
80CDD Course June 8, 2006
AlleleGene Genotype PhenotypeEndophenotpye
EndophenotypesEndophenotypes
![Page 81: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/81.jpg)
81CDD Course June 8, 2006
Pharmacogenetics and Pharmacogenetics and imagingimaging
The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphismFigure 1. Statistical maps of t-transformed hippocampal volume differences derived by optimized voxel-based morphometry in met relative to val/val-BDNF carriers thresholded at p = 0.05 (corrected) in coronal, sagittal, and axial views, showing bilateral significant hippocampal volume reduction in met-BDNF carriers
Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102
![Page 82: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/82.jpg)
82CDD Course June 8, 2006Copyright ©2004 Society for Neuroscience
Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102
Figure 2. Mean differences ({+/-}SEM) in hippocampal volume reduction in met-BDNF carriers relative to val/val-BDNF subjects within regions of statistical significance (p = 0.05) as shown in Figure 1
The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphism
![Page 83: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/83.jpg)
83CDD Course June 8, 2006Copyright ©2004 Society for Neuroscience
Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102
Figure 3. Statistical gray matter maps of the entire brain showing volume reductions of met-BDNF carriers in comparison to val/val-BDNF have been transformed from MNI space in Talairach space and converted to z-scores
The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphism
![Page 84: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/84.jpg)
Outlook for the futureOutlook for the future
Hype or Hope ?Hype or Hope ?
![Page 85: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/85.jpg)
85CDD Course June 8, 2006
PGx efforts in the worldPGx efforts in the world
![Page 86: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/86.jpg)
86CDD Course June 8, 2006
PGx alliances and PGx alliances and numbersnumbers
![Page 87: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/87.jpg)
Commercial collaborations Commercial collaborations based on pharmacogeneticsbased on pharmacogenetics
![Page 88: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/88.jpg)
88CDD Course June 8, 2006
Clinical data integration and Clinical data integration and personalized medicinepersonalized medicine
Source: IBM
![Page 89: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/89.jpg)
89CDD Course June 8, 2006
Integration of discplinesIntegration of discplines
Source: IBM
![Page 90: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/90.jpg)
90CDD Course June 8, 2006
What do we still need?What do we still need?
• Better disease classification based on endophenotypes
• Better (low level) data integration• Better analysis methods (taking gene-
gene interactions into account• Better statistical methods• Better trained computational scientists
in the field of Molecular Medicine
![Page 91: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic](https://reader036.vdocuments.us/reader036/viewer/2022062519/56649d245503460f949fa8e7/html5/thumbnails/91.jpg)
91CDD Course June 8, 2006
Thank you for listeningThank you for listening