P

TIa

b

a

ARAA

KEMPA

1

tTtetiba

moo

F0

(

h0

Molecular Immunology 60 (2014) 8–13

Contents lists available at ScienceDirect

Molecular Immunology

j ourna l ho me pa g e : www.elsev ier .com/ locate /mol imm

hagocytic activity of LPS tolerant macrophages

hais Martins de Limaa,∗, Sandra Coccuzzo Sampaiob, Ricardo Petronia, Patrícia Brigatteb,rineu Tadeu Velascoa, Francisco Garcia Sorianoa

Emergency Medicine Department, Medical School, University of São Paulo, São Paulo, BrazilLaboratory of Pathophysiology, Butantan Institute, São Paulo, SP, Brazil

r t i c l e i n f o

rticle history:eceived 4 February 2014ccepted 19 March 2014vailable online 13 April 2014

eywords:ndotoxin toleranceacrophages

hagocytosisntimicrobial activity

a b s t r a c t

Endotoxin tolerance is defined as a reduced capacity of the host to respond to LPS activation follow-ing a first exposure to this stimulus. It affects all leukocytes and regarding macrophages, most studiesfocus on the reduced ability of these cells to secrete pro-inflammatory cytokines. Therefore, we evalu-ated other macrophages functions (fungicidal capacity, reactive oxygen species production and antigenpresentation) in cells from tolerant mice. We have performed a tolerance model in our laboratory thatdoes not stimulate directly the place from where the cells will be removed (peritoneal cavity). Mousereceived subcutaneous injections of LPS in the scruff for 5 days and we analyze the capacity of perit-oneal macrophages to phagocyte using three different receptors: Fc, C3b and mannose receptors. Wefound a reduction in the phagocytosis of erythrocytes and Candida albicans related to the Fc and mannosereceptors. These differences can be due to a macrophage reprogramming, as demonstrated by alteredexpression of cytokines and chemokines. Despite this reduction in phagocytosis capacity, macrophages

from tolerant animals exhibited enhanced hydrogen peroxide production and expression of antigen pre-sentation molecules, suggesting that their ability to combat an infection is improved. In summary, ourdata indicates that LPS tolerance drives macrophages from a predominant release of proinflammatorymediators that amplify inflammation and host damage toward a better killing and antigen presentationstate.

. Introduction

Lipopolysaccharide (LPS) is the major component of gram nega-ive bacteria and one of the most potent inducers of inflammation.oll-like receptor 4 (TLR4) is essential for the recognition of dis-inct bacterial cell wall components (Medzhitov et al., 1997; Beutlert al., 2001; Akira et al., 2006), including LPS. The TLR4 activa-ion caused by endotoxin with subsequent cytokine productions, in principle, beneficial for the organism, but when this processecame dysregulated can lead to life-threatening syndromes suchs sepsis and septic shock (Martin et al., 2003).

In the evolutionary context, control of over-exuberant inflam-

ation in order to maintain cell function is important to

rganism. Stress adaptation, which is also known by a variety ofther terms (such as tolerance, desensitization, conditioning and

∗ Corresponding author at: Laboratório da Disciplina de Emergências Clínicas,aculdade de Medicina da Universidade de São Paulo, Av. Dr. Arnaldo 455, sala 3187,1246-913 São Paulo, Brazil. Tel.: +55 11 30617227; fax: +55 11 30617170.

E-mail addresses: thaismlima@gmail.com, thais@emercli.fm.usp.brT.M. de Lima).

ttp://dx.doi.org/10.1016/j.molimm.2014.03.010161-5890/© 2014 Elsevier Ltd. All rights reserved.

© 2014 Elsevier Ltd. All rights reserved.

reprogramming), is a common response found in nature, whichinvolves a primary exposure of a cell or organism to a stress-ful stimulus, eliciting a subsequent adaptive response (Cavaillonand Adib-Conquy, 2006; Cavaillon et al., 2003a; Van Epps, 2006;Wheeler et al., 2008). One of the classic examples of such a pro-tective mechanism is endotoxin tolerance (ET), a phenomenon inwhich cells or organisms exposed to low concentrations of endo-toxin (e.g. LPS) enter into a transient unresponsive state and areunable to respond to further challenges with endotoxin in the samemagnitude (Dobrovolskaia and Vogel, 2002).

Early studies showed that mouse macrophages as well as humanmonocytes exposed to suboptimal levels of LPS show diminishedpro-inflammatory response both in vitro and in vivo (Mengozziand Ghezzi, 1993; Takasuka et al., 1991; Medvedev et al., 2000).However, little effects on functional parameters, such as phago-cytic ability or reactive oxygen species production are available inthe literature. Initial reports showed that LPS preconditioning sig-nificantly inhibited bacterial phagocytosis and clearance, resulting

in increased mortality (Mason et al., 1997). Recently, some studiesshowed that tolerance to LPS protects against bacterial infections(Wheeler et al., 2008; Melo et al., 2010; Murphey et al., 2008;Mendes et al., 2011).

lar Im

rioan

dbicfrrdepiac

2

2

tUt

2

sLfo

2

ipeacma

2

c31zadit1

2

aT

T.M. de Lima et al. / Molecu

This discrepancy concerning functional parameters may beelated to the tolerance model (intravenous or intraperitonealnjections of LPS, dose and duration of tolerance induction), typef phagocytic stimulus (gram negative or gram positive bacteria)nd phagocytosis evaluation method (flow cytometry, bead inter-alization) used.

We have performed a tolerance model in our laboratory thatoes not stimulate directly the place from where the cells wille removed (peritoneal cavity). Mouse received subcutaneous

njections of LPS in the scruff for 5 days and we analyze theapacity of peritoneal macrophages to phagocyte using three dif-erent receptors: Fc, C3b and mannose receptors. We found aeduction in the phagocytosis of erythrocytes and Candida albicanselated to the Fc and mannose receptors. These differences can beue to a macrophage reprogramming, as demonstrated by alteredxpression of cytokines and chemokines. Despite this reduction inhagocytosis capacity, macrophages from tolerant animals exhib-

ted enhanced hydrogen peroxide production and expression ofntigen presentation molecules, suggesting that their ability toombat an infection is improved.

. Materials and methods

.1. Animals

Male Balb/c mice weighing between 20 and 25 g were used inhis study. The study was approved by the Ethical Committee of theniversity of São Paulo Medical School (#331/06). All animals were

reated according to institutional rules for laboratory animal care.

.2. Induction of LPS tolerance

Mice were randomized into 2 groups: the naïve group receivedubcutaneous (s.c.) injections in the scruff of 0.2 ml saline, while thePS-tolerant group received repeated LPS injections (1 mg/kg, s.c.)or 5 days (Escherichia coli 026:B6 Sigma). The mice were sacrificedn the 8th day.

.3. Peritoneal cell preparation

Animals were killed in a CO2 chamber and their peritoneal cav-ty was washed with 5 ml of cold phosphate-buffered saline (PBS),H 7.4. After a gentle massage of the abdominal wall, the periton-al fluid, containing resident cells, was collected. Cell viability wasssessed by the Trypan blue exclusion test (>95%). Total peritonealells were determined in a Neubauer’s chamber. For all measure-ents, samples of individual animals were used. The assays were

lways performed in duplicates.

.4. Phagocytic activity of peritoneal macrophages

Approximately 2 × 105 of total cells were placed onto glassoverslip inside 24 well plates and left to adhere for 30 min at7 ◦C. The coverslips were washed with PBS and incubated in RPMI640 medium containing opsonized sheep erythrocytes, opsonizedymosan or non-opsonized C. albicans, for 40 min, at 37 ◦C, in antmosphere containing 5% CO2. The percentage of phagocytosis wasetermined in smears stained with a panchromatic dye by exam-

nation under light microscopy, counting the percentage of cellshat had phagocytized more than three particles (van Furth et al.,970).

.4.1. Phagocytosis of opsonized sheep erythrocytesA suspension of sheep erythrocytes was diluted in PBS (0.5%)

nd mixed (v/v) with rabbit antiserum against sheep erythrocytes.he mixture was then incubated for 30 min at 37 ◦C. The opsonized

munology 60 (2014) 8–13 9

erythrocytes were centrifuged twice at 184 × g for 10 min and sus-pended with RPMI 1640 medium for the phagocytosis assay.

2.4.2. Phagocytosis of opsonized zymosanThe zymosan particles (Zymosan A, Sigma Chem. Co., USA) were

mixed with 2 ml normal rat serum and incubated for 30 min at 37 ◦Cfor opsonization. The opsonized zymosan particles were then cen-trifuged at 184 × g for 10 min washed with PBS and suspended inRPMI 1640 medium for the phagocytosis assay. The number of par-ticles per cover slip were of approximately 2 × 106 (Sampaio et al.,2006).

2.4.3. Phagocytosis of C. albicansC. albicans (ATCC Y-537) were cultured in 20% Sabouraud’s dex-

trose broth at 30 ◦C, for 1 day. The fungi were suspended in RPMI1640 medium for the phagocytosis assay. The number of parti-cles per cover slip were of approximately 2 × 106. For fungicidalactivity determination the coverslips were stained with a panchro-matic dye and examined under light microscopy. In this method,live yeast becomes blue and dead ones do not stain. The fungicidalactivity was determined as the score sum of 100 counted cells, asestablished by (Herscowitz et al., 1981) and described below:

Result Score

No of cells without dead C. albicans ×0No of cells with 1 or 2 dead C. albicans ×1No of cells with 3 or 4 dead C. albicans ×2No of cells with more than 4 dead C. albicans ×3

2.5. Hydrogen peroxide (H2O2) production

Hydrogen peroxide production by peritoneal cells was mea-sured using Amplex® Red Hydrogen Peroxide Assay kit (MolecularProbes, Invitrogen) as described by the manufacturer. We used1 × 105 cells per well, stimulated or not with 20 nM PMA. Cellswere incubated with AmplexRed® reagent and HRP (0.1 U/ml) inthe dark for 1 h at 37 ◦C. After this period, the absorbance was mea-sured at 560 nm on a plate reader. The concentration of H2O2 wasdetermined from a standard curve prepared in parallel.

2.6. Flow cytometry

Flow cytometry analysis was performed using a Guava 8HT (Mil-lipore, USA). Peritoneal cells from control and tolerant mice werecollected and labeled with anti-mouse antibodies (BioLegend) forcell surface markers: CD80 and CD86. After cell membrane perme-abilization with saponin, cells were intracellular labeled for TNF-�,IFN-� and IL-10 with specific antibodies (BioLegend).

2.7. Real time PCR

mRNA expression of macrophage polarization markers wasevaluated by real-time RT-PCR. Total RNA was extracted using Tri-zol reagent as described by the manufacturer (Invitrogen). Briefly,cells were lysed using 1 ml Trizol reagent. After 5 min of incuba-tion at room temperature, 200 �l of chloroform was added to thetubes and centrifuged at 12,000 × g. The aqueous phase was trans-ferred to another tube, and the RNA was pelleted by centrifugation(12,000 × g) with cold ethanol and dried in air. RNA pellets wereeluted in RNase-free water and treated with DNase I. RNAs werethen stored at −70 ◦C until to the time of the experiment. RNAintegrity was assessed by 260/268 nm ratio. Real-time PCR was per-formed in a 15 �l reaction mixture containing 7.5 �l 2× SYBR Green

Reaction Mix (Invitrogen), 0.3 �l each primer, 0.3 �l Super ScriptIII RT/Platinum Taq Mix (10 pmol/�l), 0.15 �l ROX Reference Dyeand 5 �l sample (20 ng/�l) in water. The reactions were performedin a StepOneTM equipment (Applied Biosystems) using the primers

10 T.M. de Lima et al. / Molecular Immunology 60 (2014) 8–13

0

1

2

3

4

TolerantControl

x 10

6 cells

*

Fig. 1. Quantitative analysis of leukocytes in tolerance. Peritoneal cells from naiveopt

d((

3

tpc

4

4

pt((

c(ma(p6

4

dt

Fig. 2. Effect of tolerance in phagocytic capacity by different receptors. Macrophagesattached to glass coverslips were incubated with opsonized sheep erythrocytes (A),

H2O2 production of peritoneal cells from tolerant mice washigher in basal conditions (0.10 ± 0.09 vs 1.28 ± 0.56 �M, controland tolerant, respectively) as well as after stimulation with PMA

C. albicans killing

Control Tolerant0

50

100

150

Scor

e

r tolerant mice were collected and counted in Newbauer chamber. Tolerant miceresented increased macrophage numbers. N = 10 each group. *p < 0.05, control vs.olerant mice.

escribed below. Quantification was performed by 2-DDCT methodPfaffl, 2001; Livak and Schmittgen, 2001), using ß-2 microglobulinB2M) as housekeeping gene.TNF� sense: CTAACAGTCCATGCCATTGGTNF� antisense: CATCCAGTCCATGCCATACTIL-6 sense: CGGAGAGGAGACTTCACAGAGIL-6 antisense: GGTAGCATCCATCATTTCTTTGMCP-1 sense: ACCTGGATCGGAACCAAATGAGMCP-1 antisense: GAAGTGCTTGAGGTGGTTGTGGCCR2 sense: TCTTGGAATGACACACTGCTGCCCR2 antisense: CTCACTCGATCTGCTGTCTCCCARGINASE sense: GGAAGAGTCAGTGTGGTGCTGGARGINASE antisense: CAGGAGAAAGGACACAGGTTGCTGF-� sense: GGAGACGGAATACAGGGCTTTCTGF-� antisense: CGGTTCATGTCATGGATGGTG�2M sense: CATGGCTCGCTCGGTGACC�2M antisense: AATGTGAGGCGGGTGGAACTG

. Statistical analysis

Comparisons between experimental and control groups wereested by t test. The alpha level (significance level related to therobability of rejecting a true hypothesis) was set at 0.05. Signifi-ant differences were compared using Tukey’s test.

. Results

.1. Phagocytic activity

Our endotoxin tolerance model does not stimulate directly thelace from where the cells were removed (peritoneal cavity), yethe number of cells were significantly higher in tolerant mice1.6 ± 0.4 vs 3.7 ± 0.06 × 106 cells, control and tolerant respectively)Fig. 1).

We analyzed the capacity of peritoneal macrophages to phago-yte using three different receptors: Fc, C3b and mannose receptorsFig. 2). Phagocytosis of IgG coated erythrocytes was diminished in

acrophages from tolerant mice (41.4 ± 2.7% vs 26.3 ± 2.2%, controlnd tolerant, respectively), as well as phagocytosis of C. albicans24.5 ± 3.1% vs 17 ± 1.1%, control and tolerant, respectively). Thehagocytosis of opsonized zymosan was not altered (70.8 ± 3.6% vs3.7 ± 4.1%, control and tolerant, respectively).

.2. Fungicidal activity of macrophages

Fungicidal activity was determined by counting the number ofead C. albicans inside macrophages from control and endotoxinolerant mice. As shown in Fig. 3, macrophages form tolerant mice

opsonized zymosan (B) or non-opsonized C. albicans (C) as described in Section2. Tolerance alters specifically Fc and mannose receptors mediated phagocytosis.N = 10 each group. *p < 0.05, control vs. tolerant mice.

presented enhanced fungicidal activity (100.8 ± 17.2) when com-pared to control (74.3 ± 20.1).

4.3. H2O2 production

Fig. 3. Fungicidal activity of peritoneal macrophages. The amount of dead Candidaalbicans was determined after staining the coverslips with a panchromatic dye andexamination under light microscopy. N = 10 each group. *p < 0.05, control vs. tolerantmice.

T.M. de Lima et al. / Molecular Im

0

1

2

3

4

5

6

7

8

PMAvehicle

µM H

2O2

control Tolerant

*

*

Fig. 4. Hydrogen peroxide production of peritoneal macrophages. Cells attached tog(c

((

4

ocCec

4

iveac

4

C

Fie

lass coverslips were stimulated with PMA (20 nM) and incubated with AmplexRedInvitrogen) for 1 hours to determine H2O2 production. N = 10 each group. *p < 0.05,ontrol vs. tolerant mice.

0.25 ± 0.07 vs 6.02 ± 1.63 �M, control and tolerant, respectively)Fig. 4).

.4. Antigen presentation

We assessed CD80 and CD86 expression by flow cytometry inrder to evaluate cells ability to present antigens to other leuko-ytes. As shown in Fig. 5, tolerant mice presented larger number ofD80+ (32.55 ± 6.17 vs 105.27 ± 15.66 × 106 cells, control and tol-rant, respectively) and CD86+ (47.31 ± 5.25 vs 79.72 ± 13.31 × 106

ells, control and tolerant, respectively) cells.

.5. Cytokine production

Flow cytometry analysis showed that tolerant mice presentedncreased percentage of monocytes expressing IFN-� (1.93 ± 0.22s 3.75 ± 0.73, control and tolerant, respectively) (Fig. 6). No differ-nce was observed when TNF-� (3.45 ± 0.54 vs 2.67 ± 0.62, controlnd tolerant, respectively) and IL-10 (35.22 ± 7.11 vs 30.2 ± 2.03,ontrol and tolerant, respectively) were evaluated.

.6. Gene expression of cytokines and chemokines

We analyzed gene expression of TNF-�, IL-6, TGF-�, arginase,CR-2, MCP-1 just after obtaining cells form peritoneal cavity. Cells

0

20

40

60

80

100

120

140

CD86+CD80+

x 10

6 cel

ls

control tolerant

*

*

ig. 5. Antigen presentation ability. Number of cells expressing molecules involvedn antigen presentation (CD80 and CD86) were determined by flow cytometry. N = 10ach group. *p < 0.05, control vs. tolerant mice.

munology 60 (2014) 8–13 11

from tolerant mice exhibited higher expression of arginase, CCR-2and MCP-1 (Fig. 7).

5. Discussion

The ability of monocytes and macrophages to phagocytizemicroorganisms and subsequently kill them is an important pri-mary function of these cells as first line of defense. Althoughsome aspects of macrophage function have already been shownto be modulated by endotoxin tolerance (Melo et al., 2010), in thiswork we compared its effect in the phagocytic ability mediatedby three different receptors. The intracellular pathways involvedin particle ingestion during phagocytosis and the arrangement ofcytoskeletal proteins on the phagosome surface depends on thephagocytic receptor involved, being these mechanisms distinct foringestion of IgG- and complement-opsonized particles (Allen andAderem, 1996). Our results showed that tolerance alter specificallyFc and mannose receptors signaling cascade. It has been previ-ously shown that LPS can inhibit the activity of these receptors.Sundaram et al. showed that LPS can suppress phagocytosis ofimmunoglobulin G-opsonized sheep red blood cells (SRBCs) byperitoneal macrophages, and this effect was not via the produc-tion of cytokines (IL-1, IL-6, TNF-� or IFN-�/�), but due to alteredthe distribution of microfilaments and microtubules (Wonderlinget al., 1996; Sundaram et al., 1993). Shepherd et al. observed thatmacrophages treated with LPS alone showed a reduction in man-nose receptor activity of 40% at the highest concentration of LPS(100 ng/ml), with no change in synthesis or turnover rate (Shepherdet al., 1990).

Inhibition of phagocytosis has been described in the initialstudies published regarding endotoxin tolerance and phagocyto-sis (Mason et al., 1997; Wang et al., 2003). However, recent dataclaim that endotoxin tolerance in fact enhance bacterial clearanceand decreases mortality of mice challenged with CLP (Wheeleret al., 2008; Murphey and Sherwood, 2008). These studies per-formed colony formation units counting and did not evaluatephagocytic capacity specifically. Our data of fungicidal activity andreactive oxygen species production corroborate with these results,as macrophages from tolerant mice exhibited higher productionof H2O2, thus are able to destroy microorganisms more efficiently.The protection provided by LPS tolerance against mortality in ourprevious study (Melo et al., 2010) may be partially explained bythese results and confirms that tolerance induces an effective hostresponse.

Macrophages have many tools, like cytokines and chemokines,that attract and activate leukocytes to infection sites (Cavaillonet al., 2003b). We observed that monocytes from tolerant miceexhibited increased intracellular concentrations of IFN-�. IFN-�plays a major role in the biology of the monocyte/macrophagelineage by activating antimicrobial activity, increasing killing ofintracellular pathogens, and antigen processing and presentationto lymphocytes through induction of MHC antigens (Young andHardy, 1995). IFN-� increases reactive oxygen species productionin phagocytes through stimulation of mRNA and protein expressionof NADPH oxidase components (Marchi et al., 2013; Weening et al.,1996; Jendrossek et al., 1993). The increased production of H2O2detected in macrophages from tolerant mice may be related to thehigher content of IFN-� found in the cells, but this mechanism stillneeds confirmation.

The expression of other inflammatory cytokines andchemokines were evaluated by real-time PCR. Expression of

MCP-1 and its receptor, CCR2, were up-regulated in these cells. Themonocyte chemoattractant protein-1 (MCP-1/CCL2) is a memberof the C-C chemokine family, and a potent chemotactic factor formonocytes (Deshmane et al., 2009). CCL2 is produced by many cell

12 T.M. de Lima et al. / Molecular Immunology 60 (2014) 8–13

012345

TolerantControl

% o

f mac

roph

ages

INF-γ+

0

1

2

3

4

5

TolerantControl

% o

f mac

roph

ages

TNF-α+

0

10

20

30

40

50

TolerantControl

% o

f mac

roph

ages

IL-10+

*

F TNF-�v

totempiiIepApTt2fsAo

t

Fmg

ig. 6. Intracellular cytokine content. Percentage of macrophages producing IFN-�,

s. tolerant mice.

ypes, but monocyte/macrophages are found to be the major sourcef CCL2 (Yoshimura et al., 1989). CCL2 has been demonstratedo recruit monocytes into foci of active inflammation (Ajuebort al., 1998) and the up-regulation observed in macrophagesay explain the increased number of mononuclear cells in the

eritoneum of tolerant mice. Up-regulation of MCP-1 and CCR2s related to the classically activated M1 macrophages, but othermportant cytokines present in this phenotype, such as TNF-� andL-6 did not have their expression altered. We also evaluated thexpression of proteins related to the alternatively activated M2henotype, and found an increase in arginase-1 (Arg-1) expression.rg-1 is an enzyme that inhibits NO production and allows them toroduce ornithine, a precursor of hydroxyproline and polyamines.herefore, divergent expression of Arg-1 and iNOS has contributedo the dichotomous nomenclature of macrophages (Sharda et al.,011). We could not detect iNOS expression in macrophagesrom naïve and tolerant mice (data not shown). The absence oftimulation of TNF-�, IL-6 and iNOS, combined with the increase inrg-1 suggests that macrophages accumulated in the peritoneum

f tolerant mice present a M2-like phenotype.

In addition, we analyzed the expression of the surface pro-eins CD80 and CD86, markers of activated macrophages capable

0

2

4

6

8

10

12

14

TGFβ TNFαIL6MCPCCR2ARG

Rela

�ve

expr

essi

on

Control Tolerant

**

*

*

ig. 7. Gene expression of macrophage polarization markers. mRNA levels of severalarkers of macrophage polarization were determined by real-time PCR. N = 10 each

roup. *p < 0.05, control vs. tolerant mice.

and IL-10 were determined by flow cytometry. N = 10 each group. *p < 0.05, control

of antigen presentation. CD80/86 are proteins that provide co-stimulatory signals necessary for T cell activation and survival. Theyare the ligand for two different proteins on the T cell surface: CD28(for autoregulation and intercellular association) and CTLA-4 (forattenuation of regulation and cellular disassociation) (Bluestone,1995). Some studies have demonstrated that monocyte expressionof CD80 and CD86 are differentially regulated in sepsis (Nolan et al.,2008). Specifically, sepsis was associated with an increase in CD80expression, while there appeared to be a downregulation of con-stitutive CD86 expression. Tolerant mice exhibited larger numberof both CD80+ and CD86+ cells, indicating that these animals maypresent a more efficient adaptive immune response.

6. Conclusion

In summary, our data indicates that the changes in macrophagesinduced by LPS tolerance can drive them from a predominantrelease of proinflammatory mediators that amplify inflammationand host damage toward a better killing and antigen presentationstate. Tolerance seems to be a pre-preparation that put immunesystem in alert, enhancing macrophage ability to activate otherleukocytes and act effectively against infection, without exacerbat-ing inflammation.

Conflicts of interest

The authors have no conflicts of interest to report.

Funding

This study was supported by FAPESP 2009/15185-0 grant.

Acknowledgements

The authors are grateful to the technical assistance of Ger-aldo Gomes Sobrinho and Suely Kubo Ariga. All authors read andapproved the final manuscript.

References

Ajuebor, M.N., Flower, R.J., Hannon, R., Christie, M., Bowers, K., Verity, A., Perretti,M., 1998. Endogenous monocyte chemoattractant protein-1 recruits monocytesin the zymosan peritonitis model. J. Leukoc. Biol. 63 (1), 108–116.

lar Im

A

A

B

B

C

C

C

D

D

H

J

L

M

M

M

M

M

M

M

T.M. de Lima et al. / Molecu

kira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity.Cell 124 (4), 783–801.

llen, L.A., Aderem, A., 1996. Mechanisms of phagocytosis. Curr. Opin. Immunol. 8(1), 36–40.

eutler, B., Du, X., Poltorak, A., 2001. Identification of toll-like receptor 4 (Tlr4) asthe sole conduit for LPS signal transduction: genetic and evolutionary studies. J.Endotoxin. Res. 7 (4), 277–280.

luestone, J.A., 1995. New perspectives of CD28-B7-mediated T cell costimulation.Immunity 2 (6), 555–559.

availlon, J.M., Adib-Conquy, M., 2006. Bench-to-bedside review: endotoxin toler-ance as a model of leukocyte reprogramming in sepsis. Crit. Care 10 (5), 233.

availlon, J.M., Adrie, C., Fitting, C., Adib-Conquy, M., 2003a. Endotoxin tolerance: isthere a clinical relevance? J. Endotoxin. Res. 9 (2), 101–107.

availlon, J.M., Adib-Conquy, M., Fitting, C., Adrie, C., Payen, D., 2003b. Cytokinecascade in sepsis. Scand. J. Infect. Dis. 35 (9), 535–544.

eshmane, S.L., Kremlev, S., Amini, S., Sawaya, B.E., 2009. Monocyte chemoattractantprotein-1 (MCP-1): an overview. J. Interferon Cytokine Res. 29 (6), 313–326.

obrovolskaia, M.A., Vogel, S.N., 2002. Toll receptors, CD14, and macrophage acti-vation and deactivation by LPS. Microbes Infect. 4 (9), 903–914.

erscowitz, H.B., Holden, H., Bellanti, J., Ghafar, A., 1981. Manual of MacrophageMethodology. Marcel Dekker, New York, pp. 299.

endrossek, V., Damm, U., Liese, J., Belohradsky, B.H., Gahr, M., 1993. Is the IFN-gamma-induced enhancement of superoxide production in CGD-phagocytescaused by increased expression of the p47-phox cytosolic protein. Immunode-ficiency 4 (1–4), 187–190.

ivak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-delta delta c(t)) method. Methods 25 (4),402–408.

archi, L.F., Sesti-Costa, R., Ignacchiti, M.D., Chedraoui-Silva, S., Mantovani, B., 2013.In vitro activation of mouse neutrophils by recombinant human interferon-gamma: increased phagocytosis and release of reactive oxygen species andpro-inflammatory cytokines. Int. Immunopharmacol. 18 (2), 228–235.

artin, G.S., Mannino, D.M., Eaton, S., Moss, M., 2003. The epidemiology of sep-sis in the United states from 1979 through 2000. N. Engl. J. Med. 348 (16),1546–1554.

ason, C.M., Dobard, E., Summer, W.R., Nelson, S., 1997. Intraportal lipopolysaccha-ride suppresses pulmonary antibacterial defense mechanisms. J. Infect. Dis. 176(5), 1293–1302.

edvedev, A.E., Kopydlowski, K.M., Vogel, S.N., 2000. Inhibition oflipopolysaccharide-induced signal transduction in endotoxin-tolerizedmouse macrophages: dysregulation of cytokine, chemokine, and toll-likereceptor 2 and 4 gene expression. J. Immunol. 164 (11), 5564–5574.

edzhitov, R., Preston-Hurlburt, P., Janeway, C.A., 1997. A human homologue ofthe drosophila toll protein signals activation of adaptive immunity. Nature 388(6640), 394–397.

elo, E.S., Barbeiro, D.F., Gorjão, R., Rios, E.C., Vasconcelos, D., Velasco, I.T., Szabo,C., Curi, R., de Lima-Salgado, T.M., Soriano, F.G., 2010. Gene expression repro-gramming protects macrophage from septic-induced cell death. Mol. Immunol.

47 (16), 2587–2593.

endes, M.E., Baggio-Zappia, G.L., Brunialti, M.K., Fernandes, L.M.a., Rapozo, M.M.,Salomao, R., 2011. Differential expression of toll-like receptor signaling cascadesin LPS-tolerant human peripheral blood mononuclear cells. Immunobiology 216(3), 285–295.

munology 60 (2014) 8–13 13

Mengozzi, M., Ghezzi, P., 1993. Cytokine down-regulation in endotoxin tolerance.Eur. Cytokine Netw. 4 (2), 89–98.

Murphey, E.D., Sherwood, E.R., 2008. Pretreatment with the gram-positive bacterialcell wall molecule peptidoglycan improves bacterial clearance and decreasesinflammation and mortality in mice challenged with Pseudomonas aeruginosa.Microbes Infect. 10 (12–13), 1244–1250.

Murphey, E.D., Fang, G., Sherwood, E.R., 2008. Endotoxin pretreatment improvesbacterial clearance and decreases mortality in mice challenged with Staphylo-coccus aureus. Shock 29 (4), 512–518.

Nolan, A., Weiden, M., Kelly, A., Hoshino, Y., Hoshino, S., Mehta, N., Gold, J.A., 2008.CD40 and CD80/86 act synergistically to regulate inflammation and mortality inpolymicrobial sepsis. Am. J. Respir. Crit. Care Med. 177 (3), 301–308.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Res. 29 (9), e45.

Sampaio, S.C., Alba-Loureiro, T.C., Brigatte, P., Landgraf, R.G., Dos Santos, E.C., Curi, R.,Cury, Y., 2006. Lipoxygenase-derived eicosanoids are involved in the inhibitoryeffect of crotalus durissus terrificus venom or crotoxin on rat macrophagephagocytosis. Toxicon 47 (3), 313–321.

Sharda, D.R., Yu, S., Ray, M., Squadrito, M.L., De Palma, M., Wynn, T.A., Morris, S.M.,Hankey, P.A., 2011. Regulation of macrophage arginase expression and tumorgrowth by the Ron receptor tyrosine kinase. J. Immunol. 187 (5), 2181–2192.

Shepherd, V.L., Abdolrasulnia, R., Garrett, M., Cowan, H.B., 1990. Down-regulationof mannose receptor activity in macrophages after treatment with lipopolysac-charide and phorbol esters. J. Immunol. 145 (5), 1530–1536.

Sundaram, R., O’Connor, M., Cicero, M., Ghaffar, A., Gangemi, J.D., Mayer, E.P., 1993.Lipopolysaccharide-induced suppression of erythrocyte binding and phagocy-tosis via Fc gamma RI, Fc gamma RII, Fc gamma RIII, and CR3 receptors in murinemacrophages. J. Leukoc. Biol. 54 (1), 81–88.

Takasuka, N., Tokunaga, T., Akagawa, K.S., 1991. Preexposure of macrophages to lowdoses of lipopolysaccharide inhibits the expression of tumor necrosis factor-alpha MRNA but not of IL-1 beta MRNA. J. Immunol. 146 (11), 3824–3830.

Van Epps, H.L., 2006. Ignoring endotoxin. J. Exp. Med. 203 (5), 1137.van Furth, R., Hirsch, J.G., Fedorko, M.E., 1970. Morphology and peroxidase cyto-

chemistry of mouse promonocytes, monocytes, and macrophages. J. Exp. Med.132 (4), 794–812.

Wang, J.H., Doyle, M., Manning, B.J., Blankson, S., Wu, Q.D., Power, C., Cahill, R.,Redmond, H.P., 2003. Cutting edge: bacterial lipoprotein induces endotoxin-independent tolerance to septic shock. J. Immunol. 170 (1), 14–18.

Weening, R.S., de Klein, A., de Boer, M., Roos, D., 1996. Effect of interferon-gamma,in vitro and in vivo, on MRNA levels of phagocyte oxidase components. J. Leukoc.Biol. 60 (6), 716–720.

Wheeler, D.S., Lahni, P.M., Denenberg, A.G., Poynter, S.E., Wong, H.R., Cook, J.A., Zin-garelli, B., 2008. Induction of endotoxin tolerance enhances bacterial clearanceand survival in murine polymicrobial sepsis. Shock 30 (3), 267–273.

Wonderling, R.S., Ghaffar, A., Mayer, E.P., 1996. Lipopolysaccharide-induced sup-pression of phagocytosis: effects on the phagocytic machinery. Immunophar-macol. Immunotoxicol. 18 (2), 267–289.

Yoshimura, T., Yuhki, N., Moore, S.K., Appella, E., Lerman, M.I., Leonard, E.J.,

1989. Human monocyte chemoattractant protein-1 (MCP-1). Full-length CDNAcloning, expression in mitogen-stimulated blood mononuclear leukocytes, andsequence similarity to mouse competence gene JE. FEBS Lett. 244 (2), 487–493.

Young, H.A., Hardy, K.J., 1995. Role of interferon-gamma in immune cell regulation.J. Leukoc. Biol. 58 (4), 373–381.