pgdocs-#510518-v1-2019 tu000047 cn000004 supporting
TRANSCRIPT
M A Y 2 0 1 9
RECREATIONAL CANNABIS STORE APPLICATION1 0 1 - 3 3 2 0 M a s s e y D r i v e , P r i n c e G e o r g e , B C
Supporting Information for Flora Recreational Cannabis
MAY 2019
FLORA Recreational Cannabis
101-3320 Massey Drive, Prince George, BC
M A Y 2 0 1 9
1
FLORA Recreational CannabisINTRODUCTION
Thank you for considering our application to become one of Prince George’s trusted cannabis retailers. The recreational cannabis industry presents many unique and exciting challenges for all stakeholders involved, including business people, commercial landlords, municipal government and the citizens of Prince George. As long-term residents and business people in BC, our team is committed to building long-lasting value for all of stakeholders in this opportunity.
Through our brand, FLORA Recreational Cannabis, we aim to be Prince George’s leading retailer for recreational cannabis products by hiring expert staff, carefully selecting merchandise, thoughtfully designing the retail environments, and selecting exceptional store locations. We are confident that our thoughtfully selected location will exceed the interests of all stakeholders involved.
We are very hopeful that this application reflects the significant time, energy and resources that our team has committed to this process, and meets the high standards of your evaluation committee.
Table of ContentsEXECUTIVE SUMMARY 2
MANAGEMENT OVERVIEW 3
MISSION, VISION, VALUES 5
FINANCIAL PROFORMA 6
FINANCIAL BALANCE SHEET 8
PROJECT RATIONALE:
• WHY OUR LOCATION IS
BETTER 9
• NEIGHBOURHOOD
STRATEGY 10
• HOURS OF OPERATION 11
• SECURITY MEASURES 12
DESIGN STRATEGY
• SIGNAGE & FACADE 14
• INTERIOR AND EXTERIOR
LIGHTING 16
• DESIGN FOR OUR TARGET
MARKET 17
• PROPOSED MATERIALS 20
EXISTING SITE PHOTOS 21
SITE PLAN 22
FLOOR PLAN 23
COMPLIANCE HISTORY 24
MAY 2019
M A Y 2 0 1 9
2
Executive Summary
“...we have a responsibility to
mandate for safe sales and consumption.”
BUSINESS OPPORTUNITY TARGET MARKET
BUSINESS MODEL AND STRATEGY
With recent federal legalization, the City of
Prince George and our burgeoning company are
presented with a unique opportunity to shape the
future of cannabis sales in the community. As the
first recreational cannabis retailers, we have a
responsibility to fulfill the City of Prince George’s
mandate for safe sales and consumption.
As limited permits are available, it is key that
only the businesses with sound, conservative
strategies be selected to forge forward. As such,
FLORA will focus on education, safe consumption,
and community development.
Since responsible consumption is the foundation
of our business model, we plan to target local
professionals 30+ years of age. We have engaged
the services of various realty, marketing, branding,
and design professionals to craft our business
name, logo, graphic design, interior design, and
proposed location to appeal to this demographic.
The legal cannabis industry is in it’s infancy and
we must rely on strong business fundamentals to
navigate its unknown challenges. Since limited
permits are available here in Prince George and
product sourcing is consistent for all retailers
via the Liquor Distribution Branch, our success
relies on our optimal location, educated staff, and
appealing visual branding. We have secured a
location that has high visibility and accessibility
to our target market, have procedures in place for
staff education, and have implemented design
strategies that appeal to our target market.
We plan to operate the store with a total of 3
employees at all times - 2 facilitating customer
education and sales within the retail area, and 1
managing all operational aspects of the business.
Safe and responsible consumption remains the
foundation of our business model.
MAY 2019
M A Y 2 0 1 9
3
Born and raised in Kelowna, BC, Mathew began his
career as an entrepreneur, owning and operating
several small businesses in the Okanagan.
Mathew has a Bachelor of Arts from UBCO,
a Masters Degree in Business Administration
(MBA) and a Law Degree. In addition to being the
President of Argent Diversified, Mathew is the
managing partner and founder of the Okanagan
Law Firm, Business Law Group, and the owner of
BC based business Speedy Search and Registry.
MATHEW DOBER
Chris brings his passion for business and over 15
years of experience as a serial entrepreneur. Chris
is a licensed Realtor, holds a Bachelor of Science
as well as an MBA, and has lent his expertise
in business to numerous local BC companies.
Among Chris’ many endeavors, he is the founder
and owner of Venture Reality Corp., a Director
for Argent Diversified, and Managing Partner for
Leaseline. Chris has been a great community
contributor having developed Kelowna’s Mission
Villas, a seniors housing project.
CHRIS GROUT
FLORA Recreational Cannabis is owned and managed by Argent Diversified, a British Columbia based
investment fund managing over $30 million in assets. We focus on equity investment in growth-oriented
small to medium-sized BC based businesses and employ more than 150 people within the Province. Our
board is comprised entirely of BC residents, each of whom are actively engaged in the local community
through many business and charitable interests. The Board of Argent provides active management,
consultation, and capital so that our businesses can be assured success. We are hands-on. We have the
capital and experienced board of directors to meet the challenges of the retail cannabis industry and
grow FLORA Recreational Cannabis into a successful business for all stakeholders.
MAY 2019
M A Y 2 0 1 9
4
Raised in BC, Chad began his career as an
entrepreneur, owning and operating several small
businesses in the Kelowna area. After completing
his Master of Science degree, Chris continued
with his entrepreneurial roots developing an
energy company. Chad is currently the managing
partner of Leaseline, and has been involved
in the start-up and acquisition of many small to
medium sized businesses. Chad brings a unique
perspective and good analytical skills from his
experience in science, research, law, and finance.
CHAD LUIDER
Dany has held positions with the Canadian
Forces, a Mineral Exploration Manufacturer, and
founded MBI Drilling Products where as President,
he successfully expanded the company tenfold.
Currently, Dany continues his ownership of MBI,
is the VP & Partner of Pilot Diamond Tools, is a
Partner of Premier Mining Products, as well as a
few local BC businesses. Dany contributes greatly
to the communities he resides holding positions as
a part-time firefighter and volunteer Presidencies
for a number of clubs and committees.
DANY LALIBERTÉ
MAY 2019
M A Y 2 0 1 9
5
Mission
Values
Social ResponsibilityCommunity Safety
Healthy Consumption
Vision
Balanced cannabis consumption
mindful business practices.
Project Inspiration
Project Inspiration
Project Inspiration
To be positive leaders within
interests in the community.
MAY 2019
M A Y 2 0 1 9
6
Financial Proforma
Growth Rate Month 1 Month 2 Month 3 Month 4 Month 5 Month 6 Month 7Flower Unit Sales
Low Grade 3% 1450 1,494 1,538 1,584 1,632 1,681 1,731Mid Grade 5% 2900 3,045 3,197 3,357 3,525 3,701 3,886High Grade 3% 1450 1,494 1,538 1,584 1,632 1,681 1,731
AssumptionControlFactor
MonthlyGrowth Month 1 Month 2 Month 3 Month 4 Month 5 Month 6 Month 7
FlowerLow Grade 7$ 10,150$ 10,455$ 10,768$ 11,091$ 11,424$ 11,767$ 12,120$Mid Grade 10$ 29,000$ 30,450$ 31,973$ 33,571$ 35,250$ 37,012$ 38,863$High Grade 14$ 20,300$ 20,909$ 21,536$ 22,182$ 22,848$ 23,533$ 24,239$
Oil/Tinctures 100 Units to Start 45$ 5% 4,500$ 4,725$ 4,961$ 5,209$ 5,470$ 5,743$ 6,030$Paraphernalia 25$ 2% 500$ 510$ 520$ 531$ 541$ 552$ 563$Seeds 10$ 2% 100$ 102$ 104$ 106$ 108$ 110$ 113$
Total Sales 64,550$ 67,151$ 69,862$ 72,691$ 75,641$ 78,718$ 81,928$
FlowerLow Grade 5$ 7,250$ 7,468$ 7,692$ 7,922$ 8,160$ 8,405$ 8,657$Mid Grade 7$ 20,300$ 21,315$ 22,381$ 23,500$ 24,675$ 25,909$ 27,204$High Grade 10$ 14,500$ 14,935$ 15,383$ 15,845$ 16,320$ 16,809$ 17,314$
Oil 30$ 3,000$ 3,150$ 3,308$ 3,473$ 3,647$ 3,829$ 4,020$Paraphenalia 13$ 250$ 255$ 260$ 265$ 271$ 276$ 282$Seeds 6$ 60$ 61$ 62$ 64$ 65$ 66$ 68$
Cost to Receive Product from BCLDB % of Sales 2% 1,279$ 1,331$ 1,385$ 1,441$ 1,500$ 1,561$ 1,625$
Total Cost of Sales 46,639$ 48,514$ 50,470$ 52,510$ 54,636$ 56,855$ 59,169$
Gross Margin 17,911$ 18,636$ 19,392$ 20,181$ 21,004$ 21,863$ 22,759$
PayrollMgmt $55k annually 60,000$ 5,000$ 5,000$ 5,000$ 5,000$ 5,000$ 5,000$ 5,000$Service 7 days/wk, 12 hrs/day, 2 staff @ $18/hr 3,024$ 3,024$ 3,024$ 3,024$ 3,024$ 3,024$ 3,024$
Payroll Disbursements (CPP, EI, Vac) % of Payroll 13% 1,043$ 1,043$ 1,043$ 1,043$ 1,043$ 1,043$ 1,043$WCB % of Payroll 1.5% 120$ 120$ 120$ 120$ 120$ 120$ 120$
Bookkeeping/Accounting Fixed 1,000$ 1,000$ 1,000$ 1,000$ 1,000$ 1,000$ 1,000$ 1,000$Bank Fees & Payment Processing % of Sales 1.5% 968$ 1,007$ 1,048$ 1,090$ 1,135$ 1,181$ 1,229$Marketing $2k/month, then 2% of sales 2,000$ 2,000$ 2,000$ 2,000$ 2,000$ 2,000$ 2,000$Rent $25/ft gross @ 1200ft 4,500$ 4,500$ 4,500$ 4,500$ 4,500$ 4,500$ 4,500$ 4,500$Utilities Fixed 750$ 750$ 750$ 750$ 750$ 750$ 750$ 750$Insurance Fixed 1,200$ 1,200$ 1,200$ 1,200$ 1,200$ 1,200$ 1,200$ 1,200$Security Fixed 400$ 400$ 400$ 400$ 400$ 400$ 400$ 400$Office Supplies Fixed 150$ 150$ 150$ 150$ 150$ 150$ 150$ 150$Maintenance & Repairs Fixed 250$ 250$ 250$ 250$ 250$ 250$ 250$ 250$Annual Fee Fixed 10,000$ 833$ 833$ 833$ 833$ 833$ 833$ 833$Staff Training Fixed 1,000$ $ $ 1,000$ $ $ 1,000$Amortization Straightline (Tis 10 Years)
Total Expenses 22,239$ 21,278$ 21,319$ 22,361$ 21,405$ 21,452$ 22,500$
Net Income (4,328)$ (2,642)$ (1,926)$ (2,180)$ (401)$ 411$ 259$
Income Taxes 12%
Earnings After Tax
Key Assumptions1. Monthly growth in Year 1 as as set forth in Growth Rate Column2. Annual Growth in sales as set forth in Growth Rate Column for each subsequent year of operations3. Product Costs as set forth in Control Factor Column4. Operations for 12 hours daily, 7 days a week5. Shipping costs of Product from LCDB as set forth in Control Factor Column6. Product Pricing as set forth in Control Factor Column7. Tenant improvement costs included in monthly rent
Sales
Cost of Sales
Expenses
Income
MAY 2019
I I I I I I I I I I
M A Y 2 0 1 9
7
Month 8 Month 9 Month 10 Month 11 Month 12 Total Year 1Year 2Growth Year 2 Total
Year 3Growth Year 3
Year 4Growth Year 4
Year 5Growth Year 5
1,783 1,837 1,892 1,949 2,007 20,578 10% 22,636 5% 23,768 5% 24,957 3% 25,7054,081 4,285 4,499 4,724 4,960 46,160 15% 53,084 7.5% 57,065 7.5% 61,345 5.0% 64,4121,783 1,837 1,892 1,949 2,007 20,578 10% 22,636 5% 23,768 5% 24,957 3% 25,705
Month 8 Month 9 Month 10 Month 11 Month 12 Total Year 1Year 2Growth Year 2 Total
Year 3Growth Year 3
Year 4Growth Year 4
Year 5Growth Year 5
12,483$ 12,858$ 13,243$ 13,641$ 14,050$ 144,049$ 158,454$ 166,377$ 174,696$ 179,936$40,806$ 42,846$ 44,989$ 47,238$ 49,600$ 461,597$ 530,836$ 570,649$ 613,448$ 644,120$24,966$ 25,715$ 26,487$ 27,282$ 28,100$ 288,098$ 316,908$ 332,753$ 349,391$ 359,873$
6,332$ 6,649$ 6,981$ 7,330$ 7,697$ 71,627$ 20% 85,952$ 25% 107,441$ 25% 134,301$ 15% 154,446$574$ 586$ 598$ 609$ 622$ 6,706$ 10% 7,377$ 5% 7,745$ 5% 8,133$ 5% 8,539$115$ 117$ 120$ 122$ 124$ 1,341$ 5% 1,408$ 5% 1,479$ 5% 1,553$ 5% 1,630$
85,277$ 88,771$ 92,417$ 96,222$ 100,192$ 973,418$ 1,100,936$ 1,186,444$ 1,281,520$ 1,348,545$
8,917$ 9,184$ 9,460$ 9,743$ 10,036$ 102,892$ 113,181$ 118,841$ 124,783$ 128,526$28,564$ 29,992$ 31,492$ 33,067$ 34,720$ 323,118$ 371,585$ 399,454$ 429,413$ 450,884$17,833$ 18,368$ 18,919$ 19,487$ 20,071$ 205,784$ 226,363$ 237,681$ 249,565$ 257,052$
4,221$ 4,432$ 4,654$ 4,887$ 5,131$ 47,751$ 57,302$ 71,627$ 89,534$ 102,964$287$ 293$ 299$ 305$ 311$ 3,353$ 3,688$ 3,873$ 4,066$ 4,270$69$ 70$ 72$ 73$ 75$ 805$ 845$ 887$ 932$ 978$
1,692$ 1,761$ 1,834$ 1,910$ 1,989$ 19,307$ 21,843$ 23,544$ 25,437$ 26,768$
61,583$ 64,102$ 66,729$ 69,471$ 72,332$ 703,011$ 794,808$ 855,907$ 923,729$ 971,441$
23,694$ 24,669$ 25,688$ 26,751$ 27,860$ 270,407$ 306,128$ 330,537$ 357,791$ 377,103$
5,000$ 5,000$ 5,000$ 5,000$ 5,000$ 60,000$ 2% 61,200$ 2% 62,424$ 2% 63,672$ 2% 64,946$3,024$ 3,024$ 3,024$ 3,024$ 3,024$ 36,288$ 2% 37,014$ 2% 37,754$ 2% 38,509$ 2% 39,279$1,043$ 1,043$ 1,043$ 1,043$ 1,043$ 12,517$ 12,768$ 13,023$ 13,284$ 13,549$120$ 120$ 120$ 120$ 120$ 1,444$ 1,473$ 1,503$ 1,533$ 1,563$
1,000$ 1,000$ 1,000$ 1,000$ 1,000$ 12,000$ 2% 12,240$ 2% 12,485$ 2% 12,734$ 2% 12,989$1,279$ 1,332$ 1,386$ 1,443$ 1,503$ 14,601$ 16,514$ 17,797$ 19,223$ 20,228$2,000$ 2,000$ 2,000$ 2,000$ 2,000$ 24,000$ 2% 22,019$ 2% 23,729$ 2% 25,630$ 2% 26,971$4,500$ 4,500$ 4,500$ 4,500$ 4,500$ 54,000$ 2% 55,080$ 2% 56,182$ 2% 57,305$ 2% 58,451$750$ 750$ 750$ 750$ 750$ 9,000$ 9,000$ 9,000$ 9,000$ 9,000$
1,200$ 1,200$ 1,200$ 1,200$ 1,200$ 14,400$ 14,400$ 14,400$ 14,400$ 14,400$400$ 400$ 400$ 400$ 400$ 4,800$ 4,800$ 4,800$ 4,800$ 4,800$150$ 150$ 150$ 150$ 150$ 1,800$ 1,800$ 1,800$ 1,800$ 1,800$250$ 250$ 250$ 250$ 250$ 3,000$ 3,000$ 3,000$ 3,000$ 3,000$833$ 833$ 833$ 833$ 833$ 10,000$ 10,000$ 10,000$ 10,000$ 10,000$
$ $ 1,000$ $ $ 4,000$ 4,000$ 4,000$ 4,000$ 4,000$10,435$ 20,870$ 20,870$ 20,870$ 20,870$
21,550$ 21,602$ 22,657$ 21,714$ 21,774$ 272,286$ 286,178$ 292,766$ 299,761$ 305,847$
2,144$ 3,067$ 3,031$ 5,036$ 6,086$ 8,556$ 19,951$ 37,771$ 58,030$ 71,256$
1,027$ 2,394$ 4,533$ 6,964$ 8,551$
7,530$ 17,556$ 33,238$ 51,066$ 62,705$
MAY 2019
I I I I I 11 11 I 11 I 11 I 11 I I
M A Y 2 0 1 9
8
Financial Balance Sheet
Assets
Total Assets 499,700$
Liabilities
Total Liabilities $
Equity
Total Equity 499,700$
MAY 2019
M A Y 2 0 1 9
9
Project Rationale
We want our communities to be safe places for our residents and our visitors while providing a
convenient and well-considered shopping experience for our patrons. Our location, 101-3320 Massey
Drive, is well situated for our target market comprised mainly of working professionals, yet discreet from
tourists enjoying Downtown Prince George. Our Z3 (Retail and Warehouse Zones) location is a long
standing shopping complex, and is considered a destination location catering to local people traveling
by motorized vehicle. It is adequately buffered (via major roadways) from residential, recreational, and
institutional uses, and is surrounded by other retail businesses. The complex has an abundance of
customer parking stalls, is accessible via public transit, and complies with all local codes and bylaws, so
we foresee no effect on traffic congestion in front of our premises.
Regulating cannabis safety means that we must carefully consider its potential impact on children and
youth. This is another reason why we believe our location is well situated. Our store is separated via
major roads or highways from sensitive areas accessible by children such as residential neighbourhoods,
schools, and play zones. It is an area mainly catering to adults; children and adolescents tend to frequent
Pine Centre Mall.
The site is also well lit, popular in the evening due to the nearby fast food restaurants, and benefits
from a regular RCMP presence when they take shift breaks at the nearby Tim Hortons. As such, there is
always a consistent public audience to enhance the perceived security of this location.
WHY OUR LOCATION IS BETTER
MAY 2019
M A Y 2 0 1 9
10
Safety, for our staff, customers and our community,
is at the core of FLORA. A conservative approach
is the only responsible way forward. We highly
respect the importance of Government set
requirements including responsible service
training for staff, worker registration, strict
regulation against exposure to minors by way of
identification methods, disturbance prevention,
incident logs, store design and product security,
cannabis storage and disposal methods, lawful
distribution models, cannabis registers, hours of
sale, pricing structures, and approved advertising.
We have reviewed the Official Community Plan
for the City of Prince George. As contributing
and thoughtful citizens we strive towards the
betterment of the community and respect the
goals outlined within the documents.
We plan to incorporate these guidelines as we
move forward with our project. Our Z3 (Retail and
Warehouse zoning) space is a destination location
catering to local adults traveling by motorized
vehicle. It is adequately buffered from residential,
recreational, and institutional uses, and is
surrounded by other long term retail businesses.
As such, we are well separated from sensitive
areas accessible by children such as residential
neighbourhoods, schools, and play zones.
As outlined previously, we have carefully selected
this location as it has a high level of perceived
security and maintains a strong buffer from
critical locations such as schools and parks. It is
also within a commercial area of town, and has no
impact on any single family residences or quiet
residential neighborhoods.
Smoking and/or other cannabis consumption
methods will not be tolerated within or near
the store. No smoking signs will be posted and
strictly enforced.
[continued next page]
Project RationaleNEIGHBOURHOOD STRATEGY
“A conservative approach is the only responsible way forward.”
MAY 2019
Project Inspiration
M A Y 2 0 1 9
11
Project Rationale
“To promote responsible
standard.”
Our store will contribute to beautifying the
shopping complex with a high end look via our
branding, signage, and interior design strategies.
We have contracted various design consultants
to help us portray our brand and physical location
in a positive and aesthetically pleasing manner.
As required, the windows will be treated in an
attractive way ensuring views into the store
are restricted, and the storefront is well lit to
discourage loitering.
Disturbances by unruly patrons will not be
tolerated and will be managed in a way to
prevent further recurrence. As such, intoxicated
individuals will not be provided service.
We have planned for Government supplied
‘social responsibility materials’ and further
informational displays in key locations within the
store. These will be kept current and promoted
to our customers. Our staff will be trained to
provide further education to our customers on the
responsible use of cannabis products. Staff will
also receive responsible service and sensitivity
training to better manage various customers and
social scenarios.
The complex has an abundance of customer
parking stalls, so traffic congestion should not be
impacted. The site is also popular in the evening
due to the nearby fast food restaurants, and
benefits from a regular RCMP presence when
they take shift breaks at the nearby Tim Hortons.
As such, there is always a consistent public
audience to enhance the perceived security of
this location.
NEIGHBOURHOOD STRATEGY CONT.
HOURS OF OPERATION
To promote responsible consumption, our store
will operate within the outlined Government
standard: 9am – 11pm. Employees will be have a
procedure to efficiently clear the store at closing.
Enforcing strict operating hours is essential for
the promotion of healthy cannabis consumption.
MAY 2019
Project Inspiration
M A Y 2 0 1 9
12
Project RationaleSECURITY MEASURES
prevention.”
Security is of utmost importance to the safety
of our community and surrounding business
community. Our security strategy (outlined
below) will meet and exceed all regulations
for monitoring and theft prevention. We have
engaged the services of our security consultant,
Terracom Systems, to help us with further advice,
system design, and installation.
Security cameras will be installed to provide
full, unobstructed views of the retail sales area,
storage room, and any entrance points. The
security system will also include a professionally
installed and monitored alarm system that
contains:
• Detectors to indicate unauthorized attempts
to tamper with, open, enter or penetrate
perimeter entry points, perimeter windows
and secure cannabis storage room;
• Capability to detect any attempts to tamper
with the system or malfunctions with the
system which will be immediately repaired
by a professional technician;
• Panic/robbery button(s) installed at all point
of sale positions; and
• Fire monitoring systems.
We will ensure security of all entry points by:
The use of 1.5mm (16 gauge) hollow metal doors
with 1.9mm (14 gauge) metal frame and tamper
proof hinges at all entry points other than the
customer entrance;
• Commercial grade non-residential locks
on all access points with secured tamper
proof strike plate and locking device must
penetrate the door frame at minimum
1.25cm;
• Customer entrance security grille or shutters
constructed of commercial grade material
sufficient to secure against unauthorized
access; and
• Perimeter locking devices not on a master
key system.
[continued next page]
MAY 2019
M A Y 2 0 1 9
13
Project RationaleSECURITY MEASURES CONT.
All cannabis product and accessories will be
contained on site within a secure storage
room and locked cabinets. The secure storage
room will meet the following standards for
construction:
• Constructed of Flattened Metal Mesh, EMMA
557.99 style ¾9F, nominal strand thickness
of 0.120” (0.108” to 0.132”) diamond opening
of 0.563” x 1.688” or sheet steel 16ga,
A1008/A1008M (cold rolled) or A1011/A1011M
(hot rolled) or equivalent;
• Mount steel or steel mesh on the outside
(attack side) of the room in the following
manner;
• Support all edges by anti-spread bracing,
studs or corners;
• Align sheet edges at every vertical and
horizontal seam on centre-line of steel
stud or anti-spread bracing; and
• Secure all sheets with screws, welds or
rivets.
• 16 gauge (1.6mm) steel sheet, HR
Commercial quality, ASTM A366, matte
finish, shall extend 1200mm around door
frame on inside of room and attached to the
door frame with screws, welds or rivets;
• Minimum 1.5mm (16 gauge) hollow metal
door not exceeding 36 inches width with
1.9mm (14 gauge) metal frame;
• Commercial grade door lock with locking
device that penetrates door frame at least
1.25cm and tamper proof hinges; and
• 16mm gypsum wall boards on both sides
of the wall (interior optional) attached with
drywall screws.
All product displays will be locked and require
a staff member to provide full service. Smell jars
will be tethered to the counter, and product will
be securely contained within.
FLORA will adhere to the Cannabis Retail Store
Terms and Conditions document regarding
requirements of responsible service training for
staff, worker registration, strict regulation against
exposure to minors by way of identification
methods & entrance signage, disturbance
prevention, incident logs, store design and
product security, cannabis storage and disposal
methods, lawful distribution models, cannabis
registers, hours of sale, pricing structures, and
approved advertising.
MAY 2019
M A Y 2 0 1 9
14
Our conceptual renderings pictured here and on the following page, highlight our exterior signage
strategy. Our signage will be designed to be high quality, imaginative, and innovative. It is our stance that
signage for any cannabis retailer must be tasteful and should not display typical graphics or images of
the cannabis leaf. Using the cannabis leaf motif could attract the wrong clientele, but it could also offend
those opposed to cannabis consumption. As such, our signage will be graphically designed so that it
could easily fit among upscale cosmetic, health food, or clothing boutiques.
We will take a minimalistic and concise approach to the design of our graphics and signage to align with
the local Sign Bylaw. Thereby, consideration will be given to the size and proportion of any individual sign
as part of the overall scheme of building signage and the appearance of the building’s façade. Scale and
architectural expression will not be compromised by size and number of signs. Our signs will be easily
identified by those with visual impairments through adequate size and contrast. To reduce the possibility
of minors entering our store we will display signage informing all patrons that they must be 19+ years to
enter. As required, we will apply for a sign permit in the future prior to signage manufacture and install.
[continued next page]
SIGNAGE
MAY 2019
M A Y 2 0 1 9
15
We plan to install a new graphic within the existing illuminated wall mounted box sign. This will provide
a unified look with the adjacent businesses operating within the building. To ensure compliance with the
Sign Bylaw, the illuminated sign will not exceed standards for coverage.
Additionally, we will install an aesthetically pleasing graphic pattern on the windows and door to conceal
all glass storefront windows and doors to restrict viewing into the premises from the exterior. Our logo,
age restriction sign, as well as hours of operation will be tastefully combined with these graphics so to
eliminate the need for additional signage clutter. The combined total of permanent signs will not exceed
2 (logo on door plus the logo on the awning) as limited by the Sign Bylaw.
To prevent illegal consumption of cannabis products, no-smoking signs will also be posted inside and
outside of our store.
SIGNAGE CONT.
MAY 2019
M A Y 2 0 1 9
16
Interior lighting will include a mix of general and feature fixtures. The feature lighting will be soft and airy with a natural touch. See the image below. Since the store will be completely secure while restricting views from the exterior, interior night lights will not be installed.
The location will benefit from existing evenly distributed security lights shining downwards over the storefront as well as over the front entrance. We plan to add sconce lighting on either side of the front entry for added security, general illumination, and to help prevent nighttime loitering.
INTERIOR AND EXTERIOR LIGHTING
MAY 2019
M A Y 2 0 1 9
17
Since responsible consumption is the foundation of our business model, we plan to target local professionals 30+ years of age. To do this we plan to focus on three key design factors: location, branding, and interior design.
We have secured a Z3 (Retail and Warehouse) location within an existing shopping complex. As previously
mentioned, this is a destination location catering to local adults traveling by motorized vehicle as they
frequent surrounding service and retail businesses for their daily needs.
To provide the shopping experience our local customers demand, our location is purposefully designed to have excellent flow, organization and easy access to educational information. Our product selection will be paired down to high quality items typically preferred by our patrons. We aim for FLORA to provide a unique, more personal shopping experience contrasting from what you may find in large retail locations.
public and private space.”
Our visual branding consultants have crafted a logo and visual strategy that has purposefully aligned itself with lifestyle cosmetic, health food, or clothing boutiques. It is minimalist, yet approachable. The leaf logo is not the typical three-pronged style associated with marijuana, but a stylistic leaf shape arranged in a triangle. Our wordmark and colour palette are clean, simple, and modern aiming to appeal to our local patrons.
The layout of our store focus’ on security and a strong separation of public and private space. Using a screen to restrict immediate views to cannabis products upon entering is conservative and intentional. Aesthetically, the design of our store incorporates a mix of natural elements and industrial materials, including an abundance of living plants to promote a calming and relaxed atmosphere.
DESIGN FOR OUR TARGET MARKET
MAY 2019
M A Y 2 0 1 9
18
BrBrBrananandididingng CCononceceptpt -- NNotot SSStotorere SSpepepeeeeeciciciciciciciciciciciciciciciciciciccificficficficficficficficficficficfificficficficficficficficcficc
BBBBrBBBrBrBrBrBBrBBBBBBBBBBrBBrBrrrBrBBrBrBBBBBBBBB ananananananaanannnanaanananannnndidididdididddddiiididdddidiingngngnngngngngngnggnnnnngngnnnnnnngnn CCCCCCCCConononononnnnnoonnnononncecececececececeececec ptptptptptptpttttptptppttt --- NNNNNNNNNNNNNNNNNotototototoototototttotoo SSSSSSSSSSSSStototototottotottooorererrrrreerrererereere SSSSSSSSSSSSSSSSpepepepepepeepepepeepepecccciciiccciccciccccciccccccciiificficficcc
MAY 2019
FLORA Rcdr,1t10n,1I ( ann,1bis
M A Y 2 0 1 9
19
BBrBrBrBBBBBBBrBrBBrBranananananananandididididddididididididdingngngnggnngnggngngngng CCCCCCCCCCCCCCCCConononononcecececcce tptptpttttttttttttpttptptpttt -- NNN toto SSStottorere SSSpepeeeepeeeeeeeeecicicificficccccficccccccc
BrBranandididididididididididiiidingngngngngngngngngnnggngngn CCCCCCCCCononononononononcecececececeeceptptptptptptpttttptptttpttt --- NNNNNNNNNotototototo SSSSSSStttotttoototottttttoottottt rerere SSSpepeciificfificfi
MAY 2019
M A Y 2 0 1 9
20
PROPOSED MATERIALS
We have been working with a registered interior designer to develop the layout, interior design, and
exterior design of the space. We are aiming for a high end, minimalist style with both natural and
industrial materials as well as live plants to promote a calming and relaxed atmosphere.
PPerfrfooratatedd MMetetalalall
FLORA Green Paint FinishFLORA Green Paint Finish
AgAgAgAgAgAgAgAggA grgrgrgrgrgrgrgrgggrg egegegegegegeggegegegggatatatatatatatattaaa ee e ee eee e CoCoCoCoCoCoCoCCCCCCoooCCConcncncncncncnccncncnccrererererererrererrrreetetetetetetettetetete FFFFFFFFFFlololololololollooororororororooror
LLLLiLiLLL veeveve IIIIIIIIIIIIndndndndndndndndndndndnddndndnddnddndndddndnnndddooooooooooooooooooooooooooooooooooooooooooooooooo rrrr r r rr r r rr rr r PlPlPlPlPPlPlPlPlPlllPlllPllPlllPllPlPlPllllPlllllananananananananananannanaannnantststststtsssstssttsssstsss
LiLiLiLiLimememememe WWWWWasasasasashehehehehed ddd d WoWoWoWoWoododododod FFFFFinininininisissshhhhh
BlB acacacckekekekeenenennnned d d d StStS eeeeeeeeeeelllll
LeLeLeLeLeLeLeLL atatatatattataaaaa hehehehehehehehhh r rr r r r DeDeDeDeDeeeeDetatatataatatatattaaaililililillilillsssssssss GrGrGrGrGrGrGrGrGrGrGrreeeeeeeeeeeeeee nn TrTTrTrTrTrTrrTrrTri-i-i-ii-iii-ii-LeLeLLLLeLLL aff SSShahahahahahahaapepepeepepepepeep TTTTTTTTTililililillilileeeeee
FeFeFeataturu e LiLiLivivivivvinngnn Lighting
ClClClClClClClCCCCCC ayayayayayayy WWWWWWWWWWWWWWWalalalalalalalaaaaa l l l l ll lll FiFiFiFiFiFiFiFiFiFiiiiiiininininininininininiiiniishshshshshshshsssssshsshshh
MAY 2019
22
3320
Site
Pla
n
legend
- proposed entrance to 'Flora Recreational Cannabis' - entrances to surrounding bussinesses
# reference to neighbouring bussiness' name
neighbouring business names: 1. Proposed Flora Recreational Cannabis 2. Westwood Dental Centre 3. Prince George Family Chiropractic 4. VapouRevolution - Vape Shop 5. Princess Auto - Auto Parts Retail 6. Tim Hortons
w: hotchdesign.co
eru~VP~ I I~ l~I I
full height walls are required for separation and no connecting doors between the cannabis retail store and
the neighbouring business
----------' •'
❖ l ,
/,
I
I
I
~
a o ............ ·-
MASSEY DRIVE
n
IN TE R IO R DES I G N Flora Recreational Cannabis because good design
101- massey dr. prince george, be
Site Plan
Neighouring Businesses
i 3=
date
scale
drawn by
feb. 15, 2019
nts
re
= ' -1
w 2: a: • •
i w ~
2 of 5 sheet no.
Floo
r Pl
an
23
3320
13'-0" new sconce I , , , .. v~• 11 '._'..!. kw [3964mm]
lighting either side of entrance
for additional visibility and
security
GL~IT 90 ~ V> 0 Q 3 ~ (1)
::J :E -g
l public
customer education area
and display of responsible
consumption materials
E 111G
( ~- retail area I ):( ~
lV --./ 0 ......_ Q Q [12~-~~m]'
only unlocked when fire alarm is signaled to meet
code requirements
w: hatchdesign.ca
~1 E No - co
£2.
~~◊~~ I I~ l~I I
5'-6"):( GLS [1676]
-~ E JI~ ):( l ):( r--.. N
GLS _J_ S.R:. J I~ ~r-1$.R-.D-. -1
C')o
GLS
GLS ~ ):(
S.R.D.
[s.R.D.
[s.R.D.
):( SMK
):(
):(
S.R.D.
GLS
N ........
~ N C')
):(
):(
P~S !PNC . ):(
)I(
):(
)I(
POS ]?NC):(
):(
~ C ii, ii, [
§ cg 0 :, a. a.
i -<
19'-4" [5892mm]
~
SMK ~
~ FIR
SMK
14'-8" [4470]
INTERIOR DESIGN Flora Recreational Cannabis because good design
101- massey dr. prince george, be lot: d, di: 8170, pl: 23659, PID: 008-446-335 floor plan
~
~1(0 " -q--0 " ,-q-LI") ~
~-I PN
E ~1E _, N -o N ll)
:::2.
E ~1E _, N -o N ll)
:::2.
date
scale
drawn by
general notes 1. total area of the space is 1959sq/ft [182 sq/m]
2. maximum allowed travel distance 25m; 20m maximum travel achieved
3. opaque windows c/w interior security shutters or bars {non-visibile from street)
legend new door
ex1st1ng base building wall
= to remain
/1 existing base building door to remain
)::, downlight
~ feature pendant light
CJ security camera
c:s;;:J general illumination
POS point of sale
KP keypad
DC door contact
PIR motion detector
SMK smoke detector
GLS glass break
PNC 24hr panic button
feb. 15th, 2018
1 /8''= 1 '-0" lof5 re
sheet no.
M A Y 2 0 1 9
24
Compliance HistoryFLORA Recreational Cannabis is a brand new company emerging due to recent legalization in our
Country, Province, and Municipality. We have no prior experience in the cannabis industry, and have
had no retail dealings, from any location physical or virtual.
We have always believed that actively engaging an illegal marketplace, is not only criminal, but bad
business strategy. In our opinion, any company who has ignored the basic rule of legality has shown a
great disrespect to our community and our patrons. Prior to legalization, securing safe product was not
guaranteed, so purchasers were then exposed to great health risks, possibly unknowingly.
As law abiding, responsible professionals, we expect that the majority of our target market are new
users of cannabis products. As such they trust us to provide safe, reliable products and to pass on expert
knowledge regarding safe consumption. With Government regulation, we can now ensure our products
are safely derived and obtained, and our staff are well trained to provide the information our customers
need to enjoy recreational cannabis products responsibly.
MAY 2019