Indian Journal of Experimental Biology Vol. 40, October 2002, pp. 1137-1142

peR based molecular technique for identification and discrimination of quarantined and non-quarantined Tilletia sps.

Avinash Mishra, U S Singh*, Reeta Goel** & Anil Kumar\jl

Department of Molecul ar Biology & Genetic Engineering,**Depanment of Microbiology, College of Basic Sciences & Humaniti es,

* Department of Plant Pathology, College of Agriculture, G .B. Pant University of Agriculture & Technology, Pantnagar 263 145 , India

Received 10 July 2001 .. revised 18 July 2002

Polymerase chain reaction (PCR) based RAPD profiles, in conjunction with six primers, of Kamal bunt of wheat and rice bunt exhibiting distinct polymorphic DNA. A total of 84 RAPD loci were observed on polyacrylamide gel for both Til­letia sps. Out of 84, 16 loci were found monomorphic, while other 68 loci were unique. Usefulness of random primers was also checked with other seed borne fungal pathogens of wheat and rice. None of primers gave amplification with Mag­naporthe grisea, a causative agent of rice blast. However, distinct RAPD profiles were obtained with Alternaria triticilla, Fllsarillm monaliJorme, Hellllinthosporillll1 sativulIl and Rhizoctonia solani. These six arbitrary primers could distinguish T. indica , a quarantine fungal pathogen from a non-quarantine fungal pathogen, T. barc/ayana . The two Tilletia sps. could be discriminated not only on the basis of distinct RAPD profiles, but also by presence of few unique gene fragments amplified using all six primers.

Prevalence of different diseases in wheat (Triticum aestivum) growing areas has been noticed a few years ago. Frequent occurrence of diseases of wheat in epi­phytotic proportions, especially rusts and smuts have serious consequences. Karnal bunt (KB) of wheat, caused by Tilletia indica (syn. Neovossia indica) is an important disease of northwestern plains of India. The disease spread has also been reported in Mexico l and Arizona state of America2. Other countries like United States, Canada, Russia and China, are also under the threat of spreading this disease. After reporting of KB at Arizona State in March 1996, USDA has placed T. indica as a quarantine pest. European and Mediterra­nean Plant Protection Organization (EPPO) has rec­ommended a list of Al quarantine in 1995, contained 46 orfanism and T. indica is one of these. Kehlenbeck et at. have analyzed the risk of T. indica to Germany and also pointed to the risk of contamination of seeds from grain that has, previously, been stored in the same premises. Because of fear of Karnal bunt spread, wheat from other countries is only accepted after de­claring the wheat lots, which are having zero toler­ance limits against Karnal bunt.

Bunt disease of rice is caused by non-quarantine fungus, Tilletia bardayana. Both pathogens are hav­ing more or less same teliospore texture but different in sizes. Similarity in teliospore configuration makes

IjICorrespondent author-Fax- 91- 5944-33473; E.mail: ak~upta2k@rediffmail.com

it difficult to differentiate KB teliospore from the teliospores of rice bunt. The presence of rice bunt teliospores in wheat lots sometimes is confused with KB teliospores which causes the rejection of wheat lots and hence export of wheat is affected. To over­come the problems in export, a pin-point diagnosis of KB pathogen is required. Molecular markers have inherent advantages over morphological and bio­chemical markers. Molecular markers are discrete non-deleterious characters that are unaffected by envi­ronment and free of epistatic interactions.

DNA markers generated by random amplified polymorphic DNA (RAPD) have been proven to be useful not only for studying genetic and phylogenetic relationship in a wide range of organisms4

.5

, but also for differential diagnosis of seed borne pathogens of wheat. Frederick et at. 6 have developed PCR based tool for identification and differentiation of different species of Tilletia. They mainly focused on differen­tiation of T. indica and T. walkeri based on PCR amplification of mitochondrial gene specific sequences using unique Taqman system. However, in the present study attempts were made to develop a RAPD molecular technique as diagnostic tool to distinguish Karnal bunt from rice bunt.

Materials and Methods Culture of pathogens-Cultures . of Alternaria

triticina, Fusarium monal!forme, Helminthosporium

1138 INDIAN J EXP BIOL, OCTOBER 2002

sativum, Magnaporthe grisea, Tilletia barclayana, Tilletia indica and Rhizoctonia solani were obtained from the Department of Plant Pathology of the Uni­versi ty and were maintained on solid medium [Potato dextrose agar, Hi-Media; (PDA)] at 22° ±2°C. The cultures were respectively transferred to broth me­dium for profuse and confluent mycelial growth. A loopful pathogens were inoculated in petri plates con­taining S per cent of PDA, incubated in BOD incuba­tor at 22° ± 2°C and then harvested after 7 days for morphological studies of hyphal growth.

DNA eXlraction-A modified procedure cetyl trimethyl ammonium bromide (CT AS) method7 used for DNA extraction as recommended for slow grow­ing fungus Tilletia8

• DNA was purified as described by Sam brook et al.9

Random primers used-Thirteen primers (seven decamers, two microsatellites and two sets 20-22 mers primers) were obtained from Banglore Genei, Banglore, India (Table 1) with their codes which have been used in the present study . Out of these primers, six primers, A4, AS, A6, C7, A8 and A9, showed am­plification and were used for RAPD analysis.

Polymerase chain reaction-PCR was carried out in 2S f.!1 of a solution containing lOng of genomic DNA, 200f.!M each of dNTPs; 3U, Taq polymerase; 10 mM, Tris-CI; I.S mM, MgCh; SO mM, KCI ; 0.01 %, gelatin and 0.21 .. IM, random primers. Amplifi­cation was performed in Perkin-Elmer model 480 thermal cycler. PCR conditions used as described by Mishra et ai. 10 for T. indica. After amplification, 10f.!1 of amplicons was eletrophoresed on I.S% agarose gel as well as on l.2% acrylamide gel in T AE buffer

(pH, 8.0). Better result were observed on acrylamide gel electrophoresis.

Result and Discussion The harvested fungal pathogens from potato dex­

trose agar medium were subjected to morphological studies like mycelial color, pattern and growth rate (Fig. 1). Morphologically, T. indica, Alternaria triticina and Fusarium monaliforme showed white mycelial color, Helminthosporium sativum myceli al mat was black, Magnaporlhe grisea and Rhizoctonia solani were brown, while T. barclayana was initially white which turned black on subsequent growth. Rhizoctonia exhibited very fast growth and Fusarium showed fast growth rate, while Alternaria and Tilletia sp. showed medium growth. HelminthosporiulIl and Magnaporthe were slow growi ng fungi. Growth pat­tern of fungus was also examined. Tilletia sp., HelminthosfJorium and Alternaria showed regular, Rhizoctonia showed irregular and dense, Mag­naporthe showed regular but diffused, irregu lar and aggregate pattern was shown by Fusarium.

A national su rvey of wheat producing regions in the US was initiated to determine the extent of T. in­dica infection. In order to confirm that teliospore found in wheat seed samples, T. illdica specific prim­ers derived from mitochondrial DNA sequence analy­sis were used for polymerase chain reaction 11.12. The primers were developed to distingu ish T. indica from rice bunt (T. barclayana; a non-quarantine fungus). They tested the specificity of their mitochondrial primers against Tilletia sp., the wheat bunts T. contro­versa, T. tritici and T. laevis, and members of T. fusca

Table 1- Primers and their codcs used for PCR amplirication

Primer No. Code used in thc Primer sequcnce GC% prescnt study

Primer-Ol TI (CAT)s 33.3

Pri mer -02 A2 (GATA)4 2S .0

Primer-03 G3 ACCGCGAAGG 70.0

Primer-04 A4 GTCGCCGTCA 70.0

Primer-OS G5 TCTGGTGACC 60.0

Primer-06 A6 CCGCATCCTA 60.0

Primer-07 C7 CAGGCCCTTC 70.0

Primer-08 A8 GTGTGCCCCA 70.0

Primer-09 A9 TCGTTCCGCA 60.0

Pri mer-I 0 TIO TCCCCTTGGATGAGAAGGTT SO.O

Primer-II Til AGAAGTCTAACTCCCCCCTCT S2.0

Pri mer - 12 TI2 TTTTCCCTCTCTCCIIIIIICA 40.0

Pri mer -13 TI3 AGCAAAGACAAAGTAGGCTTCC SO.O

MISHRA et al.: MOLECU LAR TECHNIQUE FOR IDENTIFICATION OF TlLLETIA SPS. 11 39

complex, a group of smut infecting wild bromus and vulpia species. Frederick et al. 6 have designed five sets of peR primers specific to T. indica and three sets were designed specifically for T. walkeri based on nucleotide difference within mitochondrial DNA region. They have developed a fluorogenic 5' nucle­ase peR assay using TaqMan system for detection and discrimination of T. indica and T. walkeri. Pimen­tel et al. 13 have distinguished T. indica teliospores from T. barclayana based on morphological charac­teristics. They have established genetic variability among T. barclayana, T. indica and allied species on the basis of RFLP and RAPD. They could not di stin­guish between T. indica and T. barclayana isolates collected from India and Pakistan .

Arbitrary DNA primers which were used to gener­ate randomly amplified polymorphic DNA (RAPD) fragments, could provide a fingerprint profile for any particular target genome and diversity among patho­gen within short time span I 4

.IS

. DNA markers gener­ated by RAPD have been proven to be useful for

studying genetics and phylogenetic relationships in a wide range of organisms4,s, 16. Recently , RAPD tech­nique has been used to detect genetic polymorphi sm in Karnal bunt pathogens 10 and other Tilletia Sp.1 7 us­ing different sets of primers.

Utility of peR as a specific and sensitive assay for plant pathogen identification is well documented IS,

Amplification of genomic DNA of fungal pathogens of wheat and rice was conducted with all six primers and RAPD profiles exhibiting di stinct fragments for these pathogens. Distinct RAPD profiles are consid­ered informative because these fragments are poly­morphic and can be clearly and unambiguously scored. RAPD profiles for all fungi, showing 19.5 fragments per primer in the range of 0.05 to 5.1 kb. Out of 13 primers, 6 primers were found to be suitable for peR amplification using genomic DNA of KB . Hence, only six primers were taken for peR ampli fi­cation of rice bunt and related fungal pathogens. Am­plification was conducted, and both faint and intense bands were scored. These bands are reproducible in

Fi g. 1- Mycelial growth of scven different fun gal pathogens of wheat and rice grown on solid potato dextrose agar. [~Altemaria trilicilla; b-Fusarium l11onalifonlle; c - Magnap0rlh e grisea; d - Hell11il1 lhosporiul11 sativul11; c -Rhizoclonia solani ; f - Tilletia barc/ayana; and g- Tillelia indica]

1140 INDIAN J EXP BIOL, OCTOBER 2002

independent runs. The total number of bands ampli­fied from the six primers was 117 in polyacrylamide gel. All bands were polymorph ic for one or more pathogens and none of them was monomorphic in all fungal pathogens.

Total number of bands resolved in agarose gel with six primers was S4. All bands were polymorphic for one or more pathogens. The size of amplified prod­ucts ranged between 5.1 and 0.05kb. No primers gave any amplicons with Magnaporthe, whi le funga l DNA of Rhizoctonia got amplification with only primer AS and no amplification was produced with other prim­ers. The total scored bands of seven funga l pathogens using six primers has been presented in Table 2.

Total 13 RAPD loci were scored on polyacryla­mide gel, out of which nine were polymorphic with primer A4. The product size ranged from 200 bp to 2.27 kb. Three unique bands were scored for Fusa­rium (at 600bp), Helminthosporium (at 700 bp), and T. indica (at less than 300 bp). Primer G5 gave 19 RAPDs and all were poly morphic and size ranged from 2.0-0.2 kb. Four unique bands were scored. T. barclayana showed two unique bands at less than 2 kb, T. indica showed at 500 bp and Fusarium showed at less than 500 bp. Total 27 amplicons, ranged be­tween 3.5 and 0.03 kb, were observed with primer A6. Eleven unique bands were found. Alternaria showed two bands at 900 and 30 bp respective ly, Hell11 in­thosporium showed three bands initially at 5 kb, T.

Table 2-Amplified markers of fungal pathogens of wheat and rice, detected by using six random primers

Primer code __ ---'A-'-<gOLa"--ro:.cs-=-e ... g.:;.;cel ____ Po.:....l.Lya'-'c...;.,ry'-I'-.am---'.id-=-e ... g,,-cl_ Total Polymorphic Total Polymorphic Bands Bands Bands Bands

A4 17 17 13 13

G5 17 17 19 19

A6 13 13 27 27

C7 14 14 19 19

A8 12 12 20 20

A9 II II 19 19

indica also showed three bands between 0.2 and 0.3 kb and T. barclayana also showed three unique bands at near 0.1 and less than 0. 1 kb. Nineteen polymor­ph ic bands, size ranged between 20.1 and 0.5 kb, were scored with primer C7. This primer could distin­guished Fusarium from rest of the pathogens, as a thick unique band was present at O.S kb. Total 20 RAPDs were reso lved with primer AS and size ranged between 1 and 0.5 kb. Thi s primer could distinguished T. barclayana, Rhizoctonia, Hell11inthosporiul11, Fusa­rium and Alternaria as a band present at 0.1 kb, a thick band at 0.5kb, two bands at 1 and between 0 .6-0.5 kb, a unique band near to 0. 1 kb and two unique bands at 0.6 and 0.2kb respectively. It was the only primer among all RAPD primers that showed amplicons with Rhizoctonia. Nineteen amplified loci were detec ted with primer A9. All markers were polymorphic and

(f\b) Mi\l 2 3 4 5 G

21.2 5. 1 ~

~:B 1.90

ML (K b J

.1

Fig. 2-RAPD profile of scvcn fungal pathogen of wheat and rice generated by primer A 6 and C 7 on acrylamide gel. Lane (MA.)- Marker A. Hind III / Eco R I doublc digested, Lane (1-7)­Amplification with primer A 6; Lane (8-14)- Amplification with primer C 7; Lane (ML)- Marker 100 bp DNA ladder [Lane(l&8)­Alternaria tnllclI1a; Lane(2&9)- Fusarium monali!orme; Lane(3& 10)- Helminrhosporiu11l sativlIl1l; Lane( 4& 11)- Mag­naporthe grisea; Lane(5& 12)- Rhizoctonia solani; Lane(6& 13)­Tilletia indica and Lane(7&14)- Tilletia barclayana]

Table 3-Comparative RAPD profi ling analysis for discrimination of T. indica and T. barclayana

Primer code Total Polymorphic Bands unigue to KB RAPD loci bands No. of Bands Size (bp)

A4 IS 8 2 600 & 300 bp

G5 12 7 3 900,700 & 500 bp

A6 22 18 12 750, 7 bands ranged between 700-300 bp, 4 bands 300-100 bp & 100

C7 16 13 9 I kb, 800(3bands), 500, 400, 350 & ISO (2 bands)

A8 14 II 5 900, 500, 200, 100 & < I 00 bp A9 I I II 4 850, 800, 650 & 100 bp

MISHR A et al.: MOLECULA R T ECHNIQUE FOR IDENTI FICATION OF TlLLETIA SPS. 11 4 1

a b a h a b a b a b a b

1 2 3 4 5 6 Fig. 3-RAPD profi le of T. il/dica and T. barc!ayal/a ge nerated by d iffe re nt six arbi tary pri mers o n po lyacrylamide gel. (Amplification with primers A4 , G5, A6, C7 , A8 and A9 were shown by 1, 2,3,4,5, and 6 respec ti ve ly. ILane(a)- T. il/dica and Lane(b)- T. barclayal/o; Unique bands of KB have been 5ho\\ n by arrows)

their size ranged from 1.5 to 0 .03 kb. Total three unique bands were produced with Alternaria, Fusa­riul11 and T. indica at 1.5,0. 1 and 0.05 kb respec ti vely (Fig. 2) .

Our result showed that T. indica can be readily dis­tinguished from T. barclayana using PCR with six primers. (Fi g. 3). Total 84 RAPD loci were observed between T. indica and T. barclayana. Out of 84, 16 loci were found monomorphic , where rest 68 loc i were unique. In the case of T. indica 5, 7 , 16, II, 8, and 4 amplicons were found with primer no. A4, G5 , A6, C7 , A8 and A9 respectively, while 8,9 ,8 ,7 , 11 and 7 amplicons were observed with their respecti ve prim­ers as A4, G5, A6, C7 , A8 and A9 in the case of T. barclayana. With primer A4, 11 RAPD loci were present out of these 3 were monomorphic rest were unique. In the case of primer G5 , 12 RAPD loci were observed in which four were monomorphic and rest were unique. Primer A6 gave 22 RAPD loci out of which 3 were monomorphic, while rest were unique. Sixteen RAPD loci with 3 monomorphic (i.e. 13 unique) and 14 RAPD loci with 5 monomorphic (i.e. 11 unique) bands were detected with primer C7 and A8 respecti vely. All 11 RAPD loc i were found unique in the case of primer A9. Thus with the help of unique

RAPD loci , we can eas ily distingui sh T. indica from T. barclayana (Table 3) . Results of the present study showed that PCR technology was reliable for differenti ating T. indica from T. barclayana at the level of myceli al growth.

RAPD products are simple to interpret the genetic polymorphi sm among Karnal bunt pathogen when compared with isozyme analys is t 9

. PCR assay used in the present study is dependent on presence or absence of a single DNA fragment. The assay can di stingui sh T. indica from T. barclayana, a non-quarantine fun­gus and will be useful in the international trade of wheat for plant quarantine regulations and seed certi­fication aspects.

References I Fue ntes-Dav il a G, Bunt and smut disease o f wheat-Con­

cept and methods o f disease manageme nt in Kam al bUill, ed­ited by R.D Wilco Xon and Saari (C IMMYT, Mexico, D.F.) 1996,326.

2 Ykema R E. Fo lyd J P, Palm M E & Peterson G L, First re­port o f Kam al bunt of wheat in Uni ted States, Pia III Dis, 80 ( 1996) 1207.

3 Kehlenbeck H, Ma lle G & Unger J G, Zur analyse des ri si­kos und der fo lgen e iner einschlepping YM Tilletia il/dica (sy n. Neo vossia indica) nach Deutschland, Nachrichtenbl Dent , PjlaI/ZO/lSc!l/Itz. 49 ( 1997) 65 .

1142 INDIAN J EXP BIOL, OCTOBER 2002

4 Crowhurst R. N, Hawithome B T, Rikkerink E H A & Tem­pletonn M 0 , Differenti ation of FusariulIl solalli r. sp. Cu­curbitae race I and 2 by Random amplification of polymor­phic DNA, Curl' Gellet, 20 ( 1991) 391.

5 Guthrie PAL, Magill C W, Fredenksen R A & Odvody G N, Random amplified polymorphic DNA markers-A system for identification and diffe rentiating isolates of Colleto­triclllllll gramillicola, Phytopathology, 82 ( 1992) 832.

6 Fredcrick R 0 , Snyder R E, Tooly P W, Schaad Y B, Peter­son G L, Bonde M R, Schaad N W & Knoor 0 A, Identifica­tion & differenti ation of Tilletia illdica & T walkeri using the polymerase chain reac ti on , Phytopathology, 90 (2000) 95 I.

7 Murray M G & Thompson W F, Rapid isolation of hi gh mo­lecular weight plant DNA, Nucleic Acid Res, 8 ( 1980) 432 1.

8 Mi shra Avinash, Garg G K, Singh N K & Anil Kumar, Eval .at ion of suitable method for isolation of high molecular weight DNA from slow growing fungus, Tilletia illdica. 111 -diall J Agri Biochelll , (200 I) (In press).

9 Sambrook J, Fritschy E F & Mani atis T. Molecular c101l­

illg -A laboratory mallllal, 2nd edition, Vol. 3 (Cold Spring Harbor Laboratory, Cold Spring Harbor. New York), 1989.

10 Mishra Avinash, Anil Kumar, Garg G K & Sharma Indu, De­termination of genetic variability among isolates of Tilletia illdica using random ampl ified pol ymorphic DNA anal ysis, Plallt Cell Biotech Mol Bioi, I ( I &2) (2000) 29 .

II Ferreira MAS V, Tolley P V, Hatz iloukas E, Castm G & Schaad N W , Isolation of a spec ies-specifi c mitochondrial

DNA sequence for ident ification of Tillet ia , the Kamal bunt of wheat fungus, Appl Ellviron Microbiol, 62 (1996) 87.

12 Smith 0 P, Peterson G L, Beck R J, Schaad N W & Bonde M R, Development of a PCR- based method for identificati on of Tilletia illdica, causal agent of Kamal bunt of Wheat , Phyto­pathology, 86 ( 1996) I 15.

13 Pimentel M, Carris L M, levy L & Meyer R J, Geneti c va ri ­ability among isolates of Tilletia barclayalla, T illdica and allied species, Mycologia , 90 (6) ( 1998) 10 17.

14 Welsh J & Mc Cleand, Fingerprinting genomes using PCR with arbitrary primers, Nuc.'eic Acid Res, 24 ( 1990) 72 13.

15 Williams J G K, Kubelik A R, Li vak K J, Rafalsk i J A & Tingey S V, DNA polymorphism amplified by arbitrary arc useful as genetic markers, Nucleic Acid Res, 18 (1990) 653 1.

16 Goodwin P H & Annis S L, Rapid identification of genct ic variation and pathotype of LaplOsphaeria maculall .\' by ran­dom amplified polymorphic DNA assay, Appl Ell viroll Mi­crobiol, 57 (199 1) 2484.

17 Shi Y L, Loomis P, Christi an 0, Carris L M & Lcung H. Analys is of the genet ic relationship among wheat bunt fungi using RAPD and ribosomal DNA markcrs, Phytopathology, 86 ( 1996) 3 I I.

18 Henson J M & French R, The polymerase chain reacti on and plant di sease diagnosis, Allllu Rev Phytopathol, 3 1 ( 1993) 8 1.

19 Bonde M R, Peterson G L & MaSlUmato T T, The use of isozymcs to idcnt ify teliospores of Tilletia illdica, Phytopa­thology, 79 ( 1989) 596.