pcr is another in vitro dna synthesis reaction the twist in this case is that the reaction is...
TRANSCRIPT
![Page 1: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/1.jpg)
![Page 2: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/2.jpg)
PCR is another in vitro DNA synthesis reactionThe twist in this case is that the reaction is repeated 25-30 times so that the DNA between
the primers is amplified
![Page 3: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/3.jpg)
The first PCR cycle:The sequence between the two primers will be
amplified
![Page 4: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/4.jpg)
Four cycles of PCR
![Page 5: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/5.jpg)
Copy number of the sequence between the primers increases exponentially
![Page 6: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/6.jpg)
SEQUENCIAMENTO DE DNA
Profa. Dra. Maria Aparecida Fernandez
Depto de Biologia Celular e Genética
Universidade Estadual de Maringá
![Page 7: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/7.jpg)
Structure of dideoxynucleotide triphosphates
![Page 8: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/8.jpg)
Dideoxy DNA sequencing is an in vitro DNA synthesis reaction with a twist
DNAP requires a template and a primer
The [ddNTP] determines the distribution of chain lengths produced.
The primer is labeled so the DNA fragments synthesized can be detected by autoradiography.
![Page 9: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/9.jpg)
![Page 10: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/10.jpg)
TGGCTCGGCCTCAAGTCGAGGTTATCAGATCTGCAACTCAA
Alto peso molecular
Baixo peso molecular
Filme de raio X
Auto-radiograma
Leitura manual
![Page 11: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/11.jpg)
Automated DNA Sequencing
![Page 12: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/12.jpg)
Reação de seqüênciamentoReação de seqüênciamento
![Page 13: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/13.jpg)
Fragmentos amplificados na reação de seqüênciamentoFragmentos amplificados na reação de seqüênciamento
![Page 14: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/14.jpg)
Typical output of an automated sequencer
![Page 15: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/15.jpg)
Eletroforese no seqüênciamentoEletroforese no seqüênciamento
![Page 16: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/16.jpg)
![Page 17: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/17.jpg)
Captura do fluorescente e processamento da informaçãoCaptura do fluorescente e processamento da informação
![Page 18: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/18.jpg)
![Page 19: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/19.jpg)
![Page 20: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/20.jpg)
Seqüenciador automáticoSeqüenciador automático
![Page 21: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/21.jpg)
![Page 22: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/22.jpg)
![Page 23: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/23.jpg)
![Page 24: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/24.jpg)
![Page 25: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/25.jpg)
![Page 26: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/26.jpg)
![Page 27: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/27.jpg)
![Page 28: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/28.jpg)
![Page 29: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/29.jpg)
Conjunto
de
16 capilares
![Page 30: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/30.jpg)
![Page 31: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/31.jpg)
![Page 32: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/32.jpg)
![Page 33: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/33.jpg)
![Page 34: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/34.jpg)
Panorama no momento da corrida
![Page 35: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/35.jpg)
Análise preliminar pós corrida
![Page 36: PCR is another in vitro DNA synthesis reaction The twist in this case is that the reaction is repeated 25-30 times so that the DNA between the primers](https://reader036.vdocuments.us/reader036/viewer/2022062512/552fc110497959413d8c5b3a/html5/thumbnails/36.jpg)
ELETROFEROGRAMAS