pcr detection of fusarium oxysporum f. sp. radicis...

457

http://journals.tubitak.gov.tr/agriculture/

Turkish Journal of Agriculture and Forestry Turk J Agric For(2013) 37: 457-467© TÜBİTAKdoi:10.3906/tar-1203-71

PCR detection of Fusarium oxysporum f. sp. radicis-lycopersici and races of F. oxysporum f. sp. lycopersici of tomato in protected tomato-growing areas of the eastern

Mediterranean region of Turkey

Ayşegül ÇOLAK1,*, Mehmet BİÇİCİ2

1Biological Control Research Station, Adana, Turkey2Department of Plant Protection, Faculty of Agriculture, Çukurova University, Adana, Turkey

* Correspondence: [email protected]

1. IntroductionIn covered tomato-growing areas in the eastern Mediterranean region, it was previously known that the wilt disease caused by Fusarium oxysporum f. sp. lycopersici (Sacc.) W.C. Snyder & H.N. Hans (FOL) was of prime importance. Later, crown and root-rot diseases caused by F. oxysporum f. sp. radicis-lycopersici Jarvis & Shoemaker (FORL) were encountered more frequently (Yücel and Çınar 1989; Can et al. 2004).

F. oxysporum has spread worldwide and is phylogenetically diverse. The species is well known as a mycotoxin producer, and so its precise identification is of prime concern (Irzykowska et al. 2012). The 2 important formae speciales of F. oxysporum, FOL and FORL, display epidemiological, genetic, and symptomatological differences (Rowe et al. 1977; Menzies et al. 1990). Since FORL and FOL can coexist in tomato-growing greenhouses, mixed infections in 1 greenhouse, or even in 1 tomato plant, are very probable (Rosewich et al. 1999; Balmas et al. 2005). The Fusarium wilt caused by FOL can be prevented through growing resistant tomato cultivars and soil disinfection by some chemicals. However, commercial tomato cultivars resistant to the crown and root rot caused by FORL have not been developed yet (Jones et al. 1991; Ozbay et al. 2004). FORL causes monocyclic and polycyclic infections on tomato plants

in one cropping season (Rekah et al. 2001). FORL causes 90% of crop losses with repeated infections that result in microconidia spreading, especially in the same growing season in greenhouses (Hajlaoui et al. 2001; Hibar 2002). Since disinfected greenhouse soil can be recolonized with FORL, crown and root rot disease control is difficult. On the other hand, while FOL only affects solanaceous plants, FORL is able to infect a total of 37 plant species and varieties belonging to Solanaceae, Leguminosae, Cucurbitaceae, and Chenopodiaceae (Rowe 1980; Menzies et al. 1990). Therefore, some weeds, as well as the tomato crops, should be considered in crown and root rot control. Finally, it is essential to make a clear distinction between these 2 formae speciales, because their control relies on their significant differences in terms of the sensitivity of host tomato cultivars and their epidemiological behavior.

Differentiation of Fusarium pathogens is not easy. Traditionally, a morphological and physiological features assessment was used as a basic identification method. However, the formae speciales and races of F. oxysporum are very difficult to discriminate this way (Nelson et al. 1983; Burgess et al. 1994). As a result, the complexity of identification of these 2 formae speciales causes difficulties in controlling the diseases caused by them (Katan et al. 1997; Rosewich et al. 1999; Gale et al. 2003). Although tester plants have been widely used for the discrimination

Abstract: Fusarium crown and root rot (caused by Fusarium oxysporum f. sp. radicis-lycopersici, FORL) and Fusarium wilt (caused by Fusarium oxysporum f. sp. lycopersici, FOL) are the most important diseases to affect tomatoes in protected growing conditions in the eastern Mediterranean region of Turkey. These diseases cause significant yield losses in this region. Polymerase chain reaction (PCR) studies were used to characterize 87 isolates from Adana and Mersin provinces, representative of different locations. Among them, 60% and 40% of the plants were determined to have FORL and FOL, respectively. FORL and FOL race 3 are the dominant pathogens in this region. Some differences between morphological identification and molecular detection (PCR) were observed.

Key words: Fusarium oxysporum f. sp. lycopersici, Fusarium oxysporum f. sp. radicis-lycopersici, PCR detection, tomato

Received: 30.03.2012 Accepted: 22.12.2012 Published Online: 16.07.2013 Printed: 02.08.2013

Research Article

458

ÇOLAK and BİÇİCİ / Turk J Agric For

of the special forms and races of F. oxysporum, molecular techniques for rapid and reliable identification have come to the fore in recent years (Garibaldi 1975; Woo et al. 1996).

Many molecular techniques are used as practical and reliable methods for identification of fungi. Molecular markers have recently become technically easy to use, readily yielding informative and conclusive results in the identification of the species and subspecies of fungi. Essentially, there are 2 techniques for DNA marking. The first is restriction fragment length polymorphism (RFLP), based on DNA hybridization, and the other, based on polymerase chain reaction (PCR), includes random amplified polymorphic DNA, amplified fragment length polymorphism, simple sequence repeats, sequence related amplified polymorphism, translation elongation factor 1-α, and b-tubulin gene sequencing (Geiser et al. 2004; O’Donnell et al. 2009; Irzykowska et al. 2012). Although each technique provides a valuable view into the species, using PCR with primers specifically chosen for the taxonomy level is the most widely used approach (Sambrook et al. 1989; Assigbetse et al. 1994; Darling and Brickell 1994; Kistler 1997; Summerell et al. 2001; Kuramae and Souza 2002; Hernandez 2004; Mulè et al. 2004).

For this reason, the causal agents of the disease isolates were obtained for field investigation from tomato plants showing typical wilting or the symptoms of crown and root rot from the protected tomato-growing areas of the eastern Mediterranean region of Turkey. The present study is focused on FORL and FOL distribution in tomato greenhouses. The principal aims of the study were to check specific primer sets for formae speciales and races of F. oxysporum discrimination, to compare the accuracy of morphological and molecular identification, and to

estimate the frequency and severity of FORL and FOL in tomato greenhouses.

2. Materials and methods2.1. Fungi isolation and culture maintenance Samples of tomato plants displaying disease symptoms were collected from tomato-growing greenhouses of some districts in Adana (Yüreğir, Seyhan, Karataş, Ceyhan) and Mersin (Silifke, Erdemli, Adanalıoğlu, Kazanlı, Tarsus), provinces in the eastern Mediterranean region of Turkey, between November 2007 and April 2008. Some causal agent isolates of the diseases from tomato plants that showed typical wilting or crown and root rot symptoms were thus obtained through sample collections in tomato greenhouses (Ozbay et al. 2004; Hibar et al. 2007).

Symptoms caused by FORL include crown and root rot, with chocolate-brown discoloration of the vascular system 25–30 cm above the soil line, brown rot of the cortex and xylem, and stunted and quickly wilted plants. Pinkish sporulation of the pathogen on exposed necrotic lesions on stem can be intensive (Figure 1). Symptoms of FOL include the yellowing of older leaves, often on only one side of the plant. The leaflets on one side of a petiole frequently turn yellow before those on the other side, and browning of the vascular system is characteristic for the disease, which can be used for its identification (Figure 2).2.2. Identification based on morphological featuresThe 87 isolates of Fusarium oxysporum used in this study, each from different greenhouses, were recovered from tomato plants showing typical FORL or FOL and are listed in Table 3. The roots of the tomato plants were washed thoroughly with tap water to remove adhering

a b c d

Figure 1. Disease symptoms of F. oxysporum f. sp. radicis-lycopersici: a, b) chocolate-brown discoloration of the vascular system and crown-root rot (Adana/AY-5 isolate, 2008); c, d) light orange-pink sporulation on stem of severely diseased tomato plant (Mersin/KZ-3 isolate, 2007).

459


soil particles. To isolate the fungus, infected plant tissues were first given a surface disinfection with 1.0% sodium hypochloride for 2–3 min. Next, disinfected tissues of 3–4 mm in length were placed on petri dishes including 2.0% potato dextrose agar (PDA) and incubated at 25 °C for 5 days (Katan et al. 1991). Identification based on the morphological and cultural characterization of F. oxysporum isolates was conducted according to some characteristics of macroconidia, microconidia, phialides, existence of chlamydospore, and colony growth traits. A single-spore isolation on PDA was then made from all the

region isolates, which were then stored at 4 °C for use in PCR studies (Booth 1971; Nelson et al. 1983).

F. oxysporum isolates were also used for laboratory studies to determine the development of the colony, color, phialide, chlamydospore, and micro- and macroconidia in terms of microscopic features. Mycelium features were assessed on a PDA medium and carnation leaf agar (CLA) using light microscopy. For this purpose, isolates belonging to FORL and FOL race 3, found in 5 different regions as dominant, were identified by PCR. Each isolate was then planted in different PDA and CLA media, 10 dishes each, and incubated for 10 days at 25 °C. Following the incubation period, the isolates were identified based on their morphological characteristics and microscopic features (Booth 1971; Nelson et al. 1983; Burgess et al. 1994; Leslie and Summerell 2006).2.3. DNA extraction and PCR assayGenomic DNA of F. oxysporum was isolated from single-spore fungal cultures growing on PDA medium using a Sigma DNA (G2N70-70 prep) miniprep extraction kit. The effectiveness of DNA isolation was checked in 0.8% agarose gel electrophoresis. To determine the formae speciales of FOL (race 1, 2, or 3) or FORL, PCR was performed with the specific primer sets uni, sp13, sp23, and sprl as described by Hirano and Arie (2006). Primers were synthesized by İontek (Adana, Turkey) (Table 1). The uni primer set amplifies 670–672 bp fragments from all isolates (FOL and FORL). The sp13 primer set amplifies 445 bp fragments for FOL races 1 and 3, while the sp23 primer set amplifies 518 bp fragments for FOL races 2 and 3. With the sprl primer set, a fragment of 947 bp was amplified specifically from FORL but not from the FOL isolates (Table 2).

The PCR reaction mixture (25 µL) contained 18 µL of Master Mix (1.25 µL of 0.2 mM each dNTP mix, 5 µL Taq (10X), 2 µL (2.5 mM) MgCl2, 0.2 µL (1 U) Taq DNA polymerase, 9.55 µL distilled water), 1 µL (0.5 mM) each of the primers, and 5 µL of genomic DNA (10 ng). A GeneAmp 9700 thermocycler (Eppendorf Mastercycler Gradient PCR Thermocycler) was used for PCR amplifications.

a b

c d

Figure 2. Isolates obtained from tomato greenhouses in Mersin/Yenitaşkent province: a, b) symptoms of FORL, with strong wilting and brown discoloration at the soil line (YT-4 isolate); c, d) symptoms of FOL, with yellowing of the older leaves on one side of the plant and the leaflets (YT-10 isolate).

Table 1. Specific primer sets of PCR analyses (Hirano and Arie, 2006).

Primer Sequence (5’3’) Fragment (bp)

uni-f ATCATCTTGTGCCAACTTCAG670–672 bp (FO)

uni-r GTTTGTGATCTTTGAGTTGCCAsp13-f GTCAGTCCATTGGCTCTCTC

445 bp (FOL races 1 and 3)sp13-r TCCTTGACACCATCACAGAGsp23-f CCTCTTGTCTTTGTCTCACGA

518 bp (FOL races 2 and 3)sp23-r GCAACAGGTCGTGGGGAAAAsprl-f GATGGTGGAACGGTATGACC

947 bp (FORL)sprl-r CCATCACACAAGAACACAGGA

460


The PCR conditions for all primers were set at the initial denaturation temperature of 94 °C for 5 min, followed by 45 cycles of 94 °C for 1 min, annealing at 61 °C for 1 min, and elongation at 72 °C for 2 min, with a final extension at 72 °C for 10 min (Hirano and Arie 2006). All PCR reaction products were electrophoresed in a 2% agarose gel, stained with ethidium bromide, and visualized under UV light.

3. ResultsThe PCR analyses of the formae speciales and races of 87 Fusarium oxysporum isolates obtained from the Adana and Mersin greenhouse tomatoes were found to be accurate and reliable. The isolates of the whole region were analyzed with the uni primer set, confirming the presence of F. oxysporum, and the sprl primer set, confirming the presence of FORL (Figure 3). Isolates for which specific fragments did not amplify with the sprl primer were amplified by sp13 (FOL races 1 and 3) and sp23 (FOL races 2 and 3) primer sets. Identification of regional isolates

based on symptomatological estimation and PCR analyses is shown in Table 3.

The electrophoresis of PCR products obtained for isolates belonging to Erdemli (EM-2, EKY-3, EKR-3), Adanalıoğlu (AO-2, AO-22), Kazanlı (KZ-4), Tarsus (Tarsus-1), and Silifke (S-17) in Mersin and isolates from Karataş (AK-1) and Yüreğir (AY-5) in Adana where intensive tomato growing is practiced are given in Figures 3–7. The PCR analyses of the EM-2 and EKR-3 isolates belonging to the greenhouses in Erdemli indicated that the EM-2 gave fragments with uni (672 bp) and sp23 (518 bp) specific primer sets for FOL race 2. EKY-3 isolates were determined as FOL race 1 with specific primer sets uni (672 bp) and sp13 (445 bp) (Figure 4).

The tomato isolates from AO-2 greenhouses in Adanalıoğlu were observed to amplify fragments with uni (672 bp), sp13 (445 bp), and sp23 (518 bp), indicating FOL race 3, and AO-22 isolates were identified as FORL based on PCR products obtained with uni and sprl primers (Figure 4). The KZ-4 isolate belonging to a Kazanlı tomato greenhouse in the province of Mersin formed specific fragments with uni, sp13, and sp23 specific primers, indicating FOL race 3. The Tarsus-1 isolate obtained from the greenhouses in Tarsus gave PCR products with uni and sprl primers and was identified as FORL (Figure 5).

The S-17 isolate of Silifke formed fragments on uni, sp13, and sp23 primers and was identified as FOL race 3. The AY-5 isolate of the Adana/Yüreğir greenhouse and the EKH-23 isolate of the Mersin-Erdemli Kocahasanlı greenhouse were detected to be FORL, forming fragments with the uni and sprl primers (Figure 6). The EÜ-1 isolate from Üçtepe, Erdemli, was observed to form fragments on the uni, sp13, and sp23 primers and was identified as FOL race 3; the S-14 (from Silifke) isolate was observed to form fragments on the uni and sprl primers and was identified as FORL; and the S-28 (from Silifke) isolate amplified fragments with uni and sp23 primers and was identified as FOL race 2 (Figure 7).

As a result of this study, among the 87 isolates, 60% (52 isolates) were determined to be FORL and 40% (35 isolates) to be FOL. The isolates of FOL were divided as follows: 34% (30 isolates) FOL race 3, 5% (4 isolates) FOL race 2, and 1% (1 isolate) FOL race 1 (Table 3). According to PCR results, among the 13 isolates from Adana (15%), 7 were identified as FORL and 6 as FOL race 3 (Figures 5 and 6). On the other hand, among the 74 isolates from Mersin (85%), 45 isolates were determined to be FORL, 24 isolates FOL race 3, 4 isolates FOL race 2, and 1 isolate FOL race 1 (Table 1; Figure 8). FORL and FOL race 3 are thus the dominant pathogens in this region. The most infestations of FOL race 3 were found in Erdemli (10 isolates), Silifke (5 isolates), and Yenitaşkent and Ceyhan (3 isolates each). In contrast, FORL was found most often in Erdemli (12

Table 2. Assessment of F. oxysporum ID (FORL or FOL races) based on the results of PCR with specific primer sets (Hirano and Arie, 2006).

Primer Sets

uni sprl sp13 sp23

FORL + + - -FOL race 1 + - + -FOL race 2 + - - +FOL race 3 + - + +

M 1 2 3 4 5 6 M

500 bp

1000 bp 947 bp 672 bp

Figure 3. Electrophoretic separation of PCR products using the uni and sprl primers to determine F. oxysporum isolates in tomato plants greenhouses in Adana/Karataş (AK-1 isolate), Erdemli/Kocahasanlı (EKH-2 isolate), and Erdemli/Türbe (ET-3 isolate). M: molecular marker (100 bp); 1, 2: EKH-2 isolate; 3, 4: ET-3 isolate; 5, 6: AK-1 isolate; 1, 3, 5: uni primer (672 bp); 2, 4, 6: sprl primer (947 bp).

461


isolates), Adanalıoğlu (11 isolates), and Silifke (9 isolates). Some differences were observed between the

identification results based on the symptomatological assessment and the results from PCR. In the investigations based on symptomatological and morphological features, 61 of the 87 isolates (70%) were identified as FORL and 26 (30%) as FOL, while PCR results indicated that 52 (60%) of the isolates were FORL and 35 (40%) were FOL (Figure 9). The macroscopic and microscopic identification of FORL and FOL race 3, belonging to 5 different locations in the region as the dominant species, were made in PDA and CLA media. The colony colors of the FORL isolates were identified on the upper surface as white and light to dark violet colors in PDA. However, in the center of

the lower surface, a prominent dark violet was especially observed (Figure 10). FOL race 3 in PDA media was determined to be white in the upper surface of colonies and mostly white and slight pale pink in the lower surface (Figure 11). Colonies of FORL isolates in CLA media had macroconidia lengths of 32.5–57.5 µm and microconidia lengths of 12–20 µm, while those belonging to race FOL 3 isolates had macroconidia of 27.5–50 µm long and microconidia of 10.5–15 µm long (Booth 1971; Nelson et al. 1983; Windels 1992; Summerell et al. 2001; Balali and Iranpoor 2006; Leslie and Summerell 2006; Ciampi et al. 2008). Two forms of F. oxysporum displayed the same morphological features in the attempt to identify their macroscopic and microscopic properties (Table 4).

Erdemli Erdemli Adanalıoğlu Adanalıoğlu EKY-3 EM-2 AO-2 AO-22 FOL 1 FOL 2 FOL 3 FORL

M uni sp13 sp23 sprl uni sp13 sp23 sprl uni sp13 sp23 sprl uni sp13 sp23 sprl M

947 bp 672 bp 518 bp 445 bp

Figure 4. Agarose gel electrophoresis PCR products using 4 specific primer sets to detect F. oxysporum isolates. M: molecular marker (100 bp); EKY-3: FOL race 1; EM-2: FOL race 2; AO-2: FOL race 3; AO-22: FORL; uni primer: 672 bp; sp13 primer: 445 bp; sp23 primer: 518 bp; sprl primer: 947 bp.

M 1 2 3 4 5 6 7 8 M

947 bp 672 bp 518 bp 445 bp

M 1 2 3 4 5 6 7

947 bp

672 bp

445 bp 518 bp

Figure 5. Agarose gel electrophoresis PCR products in region of Mersin/Kazanlı (KZ-4), Mersin/Erdemli (EKR-3), and Mersin/Tarsus (Tarsus-1). M: molecular marker (100 bp); 1, 2, 3: KZ-4 isolate in FOL race 3 (1: uni, 2: sp13, 3: sp23); 4, 5, 6: EKR-3 isolate in FOL race 2 (4: uni, 5: sp13, 6: sp23); 7, 8: Tarsus-1 isolate in FORL (7: uni, 8: sprl).

Figure 6. Agarose gel electrophoresis PCR products in region of Silifke (S-17), Adana/Yüreğir (AY-5), and Kocahasanlı/Erdemli (EKH-23). M: Molecular marker (100 bp); 1, 2, 3: S-17 isolate in FOL race 3; 4, 5: AY-5 isolate in FORL; 6, 7: EKH-23 isolate in FORL; 1, 4, 6: uni primer (672 bp); 2: sp13 primer (445 bp); 3: sp23 primer (518 bp); 5, 7: sprl primer (947 bp).

462


4. Discussion In the present study, the identification of 87 F. oxysporum isolates originating from tomato greenhouses in the provinces of Adana and Mersin in the eastern Mediterranean region using symptomatological and PCR methods was undertaken.

As a result of this study, FORL and FOL race 3 were, for the first time, identified through a symptomatological and molecular method (PCR) to be the most common pathogens in tomato greenhouses in this region. Differences were observed in diagnosis conducted with conventional methods and the PCR results. These 2 races are difficult to differentiate morphologically. Furthermore, since these races may cause disease symptoms on the same host tomato plant at the same time, they are sometimes confused with each other. The previously conducted race and vegetative conformity group (VCG) identification has not been sufficient in determining these F. oxysporum forms. Particularly in VCG identification, while some formae speciales conform to only one VCG, others may belong to many VCGs. For this reason, although VCG identification may be beneficial, it cannot be utilized as a universal method in identifying formae speciales or isolates that are not pathogenic (Attitalla et al. 2004). However, due to the greater accuracy and reliability of PCR for identification purposes, putting into practice the

diagnosis of the disease as a result of this method will be quicker and easier.

Results obtained indicated that all FORL and FOL isolates were highly pathogenic on tomato plants in the area. In the present study, of the 13 F. oxysporum isolates obtained from the greenhouses in the province of Adana, 7 isolates were identified as FORL and the remaining 6 as FOL, while of the 74 F. oxysporum isolates obtained from the greenhouses in the province of Mersin, 45 isolates were identified as FORL and the remaining 29 as FOL. The fact that the wastes of harvest are dumped into the irrigating canals around the greenhouses in Adanalıoğlu, Yenitaşkent, and Kocahasanlı, districts of Mersin where covered tomato growing is intensively practiced, the same diseases have frequently been encountered in nearby greenhouses. For this reason, the probability that F. oxysporum, which has the capacity to stay alive in soil and in plant wastes in the form of chlamydospores for many years, will cause problems in these areas and lead to huge economic losses is high. Poor conditions in greenhouses; problems in heating; the accumulation of water inside greenhouses; the fact that plant wastes from the soil in greenhouses are not removed efficiently and become a source of inoculum when they are dumped around greenhouses; growing of the same type of tomato in the same greenhouse every year; poor practices in the disinfection of greenhouse construction, which cause FORL microconidia to proliferate; and the occurrence of repeated infections are particularly thought to be the major causes of the increase in FORL infections. Another reason why FORL was increasing in the region was that other plant families in addition to Solanaceae were observed as hosts (Menzies et al. 1990). Furthermore, a resistant variety of tomato has not been developed against FORL yet and the widely accepted and commercially resistant varieties of tomato are not sufficiently able to fight off FORL. For this reason, urgent measures must be taken to prevent the spread of the disease in the provinces

M 1 2 3 4 5 6 7 8 9 10 M

947 bp 672 bp 518 bp 445 bp

Figure 7. Agarose gel electrophoresis PCR products in the region of Erdemli/Üçtepe (EÜ-1) and Silifke (S-14 and S-28). M: molecular marker (100 bp); 1, 2, 3: EÜ-1 isolate in FOL race 3; 3, 4: S-14 isolate in FORL; 6, 7, 8: S-28 isolate in FOL race 2; 9: healthy control; 10: DNA-free; 1, 4, 6: uni primer (672 bp); 2, 7: sp13 primer (445 bp); 3, 8: sp23 primer (518 bp); 5: sprl primer (947 bp).

0

10

20

30

40

50

FOL 1 FOL 2 FOL 3 FORL

Adana

Mersin

Figure 8. Results of molecular identification of F. oxysporum isolates originating from Adana and Mersin provinces.

463


Table 3. Formae speciales and races of F. oxysporum separation obtained by symptomatological assessment and PCR analyses.

Isolate name Location SymptomatologicalFOL or FORL Results of PCR

AS-1 Seyhan/Adana FORL FORLAS-3 Seyhan/Adana FORL FORLAS-6 Seyhan/Adana FOL FOL 3AY-2 Yüreğir/Adana FORL* FOL 3*AY-4 Yüreğir/Adana FOL FOL 3AY-5 Yüreğir/Adana FORL FORLAK-1 Karataş/Adana FORL FORLAC-2 Ceyhan/Adana FORL FORLAC-3 Ceyhan/Adana FOL FOL 3AC-5 Ceyhan/Adana FOL FOL 3AC-6 Ceyhan/Adana FORL FORLAC-7 Ceyhan/Adana FORL FORLAC-9 Ceyhan/Adana FOL FOL 3AO-1 Adanalıoğlu/Mersin FORL FORLAO-2 Adanalıoğlu/Mersin FORL FOL 3AO-3 Adanalıoğlu/Mersin FORL FORLAO-4 Adanalıoğlu/Mersin FORL FORLAO-5 Adanalıoğlu/Mersin FORL FORLAO-6 Adanalıoğlu/Mersin FORL FORLAO-7 Adanalıoğlu/Mersin FORL FORLAO-8 Adanalıoğlu/Mersin FORL FORLAO-9 Adanalıoğlu/Mersin FORL FORL

AO-12 Adanalıoğlu/Mersin FORL FORLAO-13 Adanalıoğlu/Mersin FORL FORLAO-16 Adanalıoğlu/Mersin FOL FOL 3AO-22 Adanalıoğlu/Mersin FORL FORLKZ-1 Kazanlı/Mersin FORL FORLKZ-2 Kazanlı/Mersin FORL FORLKZ-3 Kazanlı/Mersin FORL FORLKZ-4 Kazanlı/Mersin FORL FOL 3KZ-5 Kazanlı/Mersin FORL FORLYT-1 Yenitaşkent/Mersin FOL FOL 3YT-2 Yenitaşkent/Mersin FORL FORLYT-4 Yenitaşkent/Mersin FORL FORLYT-5 Yenitaşkent/Mersin FORL FORLYT-8 Yenitaşkent/Mersin FOL FOL 3

YT-10 Yenitaşkent/Mersin FOL FOL 3YT-12 Yenitaşkent/Mersin FORL FORLYT-13 Yenitaşkent/Mersin FORL FORLEM-2 Merkez/Erdemli FOL FOL 2ET-1 Türbe/Erdemli FOL FOL 3ET-3 Türbe/Erdemli FORL FOL 3ET-4 Türbe/Erdemli FORL FORL

464


Table 3. (continued).

ET-7 Türbe/Erdemli FORL FORLEKY-1 Koyuncu/Erdemli FORL FORLEKY-3 Koyuncu/Erdemli FOL FOL 1 EKY-4 Koyuncu/Erdemli FORL FORLEKY-5 Koyuncu/Erdemli FORL FORLEKY-6 Koyuncu/Erdemli FOL FOL 3EKH-2 Kocahasanlı/Erdemli FORL FOL 3EKH-3 Kocahasanlı/Erdemli FOL FOL 3EKH-3 Kocahasanlı/Erdemli FOL FOL 3EKH-4 Kocahasanlı/Erdemli FORL FORL

EKH-12 Kocahasanlı/Erdemli FOL FOL 3EKH-14 Kocahasanlı/Erdemli FOL FOL 3 EKH-18 Kocahasanlı/Erdemli FOL FOL 3EKH-19 Kocahasanlı/Erdemli FORL FOL 3EKH-22 Kocahasanlı/Erdemli FORL FORL EKH-23 Kocahasanlı/Erdemli FORL FORLEKH-24 Kocahasanlı/Erdemli FORL FORL

EY-1 Yüksek/Erdemli FORL FORL EY-2 Yüksek/Erdemli FORL FORLEY-3 Yüksek/Erdemli FORL FORL EÜ-1 Üçtepe/Erdemli FOL FOL 3EÇ-1 Çiriş/Erdemli FORL FOL 3EÇ-2 Çiriş/Erdemli FORL FORL

EKR-1 Karakeşli/Erdemli FOL FOL 3EKR-3 Karakeşli/Erdemli FOL FOL 2

Tarsus-0 Tarsus/Mersin FORL FORL Tarsus-1 Tarsus/Mersin FORL FORLTarsus-4 Tarsus/Mersin FOL FOL3Tarsus-6 Tarsus/Mersin FORL FORL

S-2 Atik/Silifke FORL FORLS-4 Atik/Silifke FORL FORLS-6 Arkum/Silifke FORL FORLS-7 Arkum/Silifke FORL FORLS-9 Arkum/Silifke FORL FORL

S-10 Arkum/Silifke FORL FORLS-13 Arkum/Silifke FORL FORLS-14 Atayurt/Silifke FORL FORLS-17 Atayurt/Silifke FORL FOL 3S-20 Atayurt/Silifke FORL FORLS-22 Atayurt/Silifke FORL FOL 3S-24 Kabasakallı/Silifke FOL FOL 2S-28 Kurtuluş/Silifke FOL FOL 2S-29 Kurtuluş/Silifke FOL FOL 3S-34 Karadereli/Silifke FOL FOL 3S-35 Karadereli/Silifke FOL FOL 3

*Isolates identified differently by symptomatological and PCR results are given in bold.

465


of Adana and Mersin. Dealing with the wilt disease caused by FOL could be possible through developing resistant varieties of tomato and improving disinfection practices of the soil. Moreover, if irrigation, fertilization, and similar cultivation practices were improved, the disease could be kept within tolerable limits (Yücel and Çınar 1989; Takahashi et al. 2005). However, as mentioned in the present study, since the FOL 3 race is dominant in the region, growing the varieties of tomato that are resistant to this disease will particularly decrease the rate of infection.

Consequently, the development and utilization of the tomato varieties resistant to this specific form and race identified in this region will be more appropriate. Today, breeding programs are mostly focused on developing resistant varieties, since this method is the most effective in dealing with the diseases that cause huge economic losses. In this respect, the identification of formae speciales and races of F. oxysporum in the greenhouses in the eastern Mediterranean area will promote the development of the varieties of tomato that are resistant to these diseases.

26

61

35

52

0

10

20

30

40

50

60

70

FOL FORL

SymptomatologicalPCR

Figure 9. The results of symptomatological and PCR identification of isolates from screened region of Turkey.

Table 4. Morphological characteristic features of FORL and FOL race 3 in PDA and CLA media.

Parameters FORL FOL race 3

Color of colony (PDA) Upper surface: white – light to dark violetLower surface: dark violet

Upper surface: whiteLower surface: white and slightly pale pink

Features of microconidia (CLA)Abundant,

oval-ellipsoid, nonseptate,12–20 µm

More than macroconidia,oval-ellipsoid, nonseptate,

10.5–15 µm

Features of macroconidia (CLA)

Abundant,4–5 septa

32.5–57.5 µm Apical cell: slightly curved-hooked

Basal cell: foot-shaped

Less than microconidia, 3–4 septa, rarely 5 septa,

27.5–50 µm, apical cell and basal cell the same as in FORL

Features of chlamydospore (CLA) Globose, abundant, single or pairs Globose, abundant, single or pairsFeatures of phialide (CLA) Short monophialide Short monophialide

Figure 10. F. oxysporum f. sp. radicis-lycopersici (AK-1 isolate) colony growth in PDA medium: a) colony growth of upper surface in PDA, b) colony growth of lower surface in PDA.

a b

Figure 11. Colony growth of F. oxysporum f. sp. lycopersici races in PDA medium: a) FOL race 1 (EKY-3 isolate); b) FOL race 2 (EKR-3 isolate); c) FOL race 3 (S-17 isolate).

a c b

466


References

Assigbetse KB, Fernandez M, Dubois MP, Geiger JP (1994) Differentiation of Fusarium oxysporum f. sp. vasinfectum races on cotton by random amplified polymorphic DNA (RAPD) analysis. Phytopathology 84: 622–626.

Attitalla IH, Fatehi J, Levenfors J, Brshammar S (2004) A rapid molecular method for differentiating two special forms (lycopersici and radicis-lycopersici) of Fusarium oxysporum. Mycological Res 108: 787–794.

Balali GR, Iranpoor M (2006) Identification and genetic variation of Fusarium species in Isfahan, Iran, using pectic zymogram technique. Iranian J Sci Tech 30: 91–102.

Balmas V, Scherm B, Di Primo P, Rau D, Marcello A, Migheli Q (2005) Molecular characterisation of vegetative compatibility groups in Fusarium oxysporum f. sp. radicis-lycopersici and f. sp. lycopersici by random amplification of polymorphic DNA and microsatellite-primed PCR. Eur J Plant Pathol 111: 1–8.

Boot C (1971) The Genus Fusarium. Commonwealth Mycological Institute, Kew, Surrey, UK.

Burgess LW, Summerell BA, Bullock S, Gott KP, Backhouse D (1994) Laboratory Manual for Fusarium Research. University of Sydney, Sydney, Australia.

Can C, Yucel S, Korolev N, Katan T (2004) First report of fusarium crown and root rot of tomato caused by Fusarium oxysporum f.sp. radicis-lycopersici in Turkey. Plant Pathol 53: 814–814.

Ciampi L, Nissen J, Venegas E, Fuentes R, Costa M, Schöbitz R, Alvarez E, Alvarado P (2008) Identification of two species of Fusarium link that cause wilting of colored callas (Zantedeschia aethiopica (L.) Spreng.) cultivated under greenhouse conditions in Chile. Chilean J Agri Res 69: 516–525.

Darling DC, Brickell PM (1994) Nucleic Acid Blotting: The Basics. Oxford University Press Inc., New York.

Gale LR, Katan T, Kistler HC (2003) The probable center of origin of Fusarium oxysporum f. sp. lycopersici VCG 0033. Plant Dis 87: 1433–1438.

Garibaldi A (1975) Race differentiation of Fusarium oxysporum f. sp. dianthi (Prill. et Del.) Snyd. et Hans. Meded Fac Land Rijksuniv Gent 40: 531–537.

Geiser DM, Jimenez-Gasco M, Kang S, Makalowska I, Veeraraghavan N, Ward TJ, Zhang N, Kuldau GA, O’Donnell K (2004) Fusarium ID v. 1.0: a DNA sequence database for identifying Fusarium. Eur J Plant Pathol 110: 473–479.

Hajlaoui MR, Hamza N, Gargouri S, Guermech A (2001) Apparition en Tunisie de Fusarium oxysporum f. sp. radicis-ycopersici, agent de la pourriture des racines et du collet de la tomate. OEPP/EPPO Bull 31: 505–507 (in French).

Hernandez P (2004) Development and use of genomic tools for cereal introversion breeding. In: Genetic Variation for Plant Breeding (Eds. J Vollmann, P Grausgruber, P Ruckenbauer). BOKU University of Natural Resources and Applied Life Sciences, Vienna, Austria, pp. 49–51.

Hibar K (2002) La fusariose du collet et des racines de la tomate: Pathogenicite et moyens de lutte. Memoire de Diplome d’Etudes Approfondies en Protection des Plantes et Environnement. Ecole Superieure d’Horticulture et d’Elevage de Chott Mariem, Chott Meriem, Tunisa (in French).

Hibar K, Edel-Herman V, Steinberg CH, Gautheron N, Daami-Remadi M, Alabouvette C, Elmahjoub M (2007) Genetic diversity of Fusarium oxysporum poppulations isolated from tomato plants in Tunisia. J Phytopathology 155: 136–142.

Hirano Y, Arie T (2006) PCR-based differentiation of Fusarium oxysporum ff. sp. lycopersici and radicis-lycopersici and races of F. oxysporum f. sp. lycopersici. J Gen Plant Path 72: 273–283.

Irzykowska L, Bocianowski J, Waskiewicz A, Weber Z, Golinski P, Karolewski Z, Kostecki M, Irzykowski W (2012) Genetic variation of Fusarium oxysporum isolates forming fumonisin B1 and moniliformin. J Appl Gen 53: 237–247.

Jones JP, Stall RE, Zitter TA (1991) Compendium of Tomato Diseases. American Phytopathological Society, St Paul, MN, USA.

Katan T, Shlevin E, Katan J (1997) Sporulation of Fusarium oxysporum f. sp. lycopersici on stem surfaces of tomato plants and aerial dissemination of inoculum. Phytopathology 87: 712–719.

Kistler HC (1997) Genetic diversity in the plant-pathogenic fungus Fusarium oxysporum. Phytopathology 87: 474–479.

Kuramae EE, de Souza NL (2002) Variabilidade genetica entre formae speciales de Fusarium oxysporum e raças 1 e 2 de Fusarium oxysporum f. sp. lycopersici atraves de RAPD e sequencias de regioes ITS e rDNA. Acta Scient 24: 1481–1485 (in Portuguese with English abstract).

Leslie JF, Summerell AB (2006) The Fusarium Laboratory Manual. Wiley-Blackwell, New York.

Menzies JG, Koch C, Seywerd F (1990) Additions to the host range of Fusarium oxysporum f. sp. radicis-lycopersici. Plant Dis 74: 569–572.

Mulè G, Susca A, Stea G, Moretti A (2004) Specific detection of the toxigenic species Fusarium proliferatum and F. oxysporum from asparagus plants using primers based on calmodulin gene sequences 2004. FEMS Microbiol Lett 230: 235–240.

Nelson PE, Toussoun TA, Marasas WFO (1983) Fusarium Species: An Illustrated Manual for Identification. Pennsylvania State University Press, University Park, PA, USA.

O’Donnell K, Gueidan C, Sink SL, Johnston PR, Crous P, Glenn AE, Riley RT, Zitomer NC, Colyer P, Waalwijk C, Van Der Lee T, Moretti A, Kang S, Kim H, Geiser DM, Juba J, Baayen RP, Cromey MG, Bithel S, Sutton DA, Skovgaard K, Ploetz R, Kistler HC, Elliott M, Davis M, Sarver BA (2009) A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex. Fungal Gen Biol 46: 936–948.

Ozbay N, Newman SE, Brown WM (2004) Evaluation of Trichoderma harzianum strains to control crown and root rot of greenhouse fresh market tomatoes. Acta Hort 635: 79–85.

467


Rekah Y, Shitienberg D, Katan J (2001) Population dynamics of Fusarium oxysporum f. sp. radicis-lycopersici in relation to the onset of Fusarium crown and root rot of tomato. Eur J Plant Pathol 107: 367–375.

Rosewich UL, Pettway RE, Katan T, Kistler HC (1999) Population genetic analysis corroborates dispersal of Fusarium oxysporum f. sp. radicis-lycopersici from Florida to Europe. Phytopathology 89: 623–630.

Rowe RC (1980) Comparative pathogenicity and host ranges of Fusarium oxysporum isolates causing crown and root rot of greenhouse and field-grown tomatoes in North America and Japan. Phytopathology 70: 1143–1148.

Rowe RC, Farley JD, Coplin DL (1977) Airborne spore dispersal and recolonization of steamed soil by Fusarium oxysporum in tomato greenhouses. Phytopathology 67: 1513–1517.

Sambrook E, Fritsch F, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.

Summerell BA, Leslie JF, Backhouse D, Bryden WL, Burgess LW (2001) Fusarium: Paul E Nelson Memorial Symposium. APS Press, St Paul, USA.

Takahashi H, Shimizu A, Arie T, Rosmalawati S, Fukushima S, Kikuchi M, Hikichi Y, Kanda A, Takahasi A, Kiba A, Ohnishi K, Ichinose Y, Taguchi F, Yasuda C, Kodama M, Egusa M, Masuta C, Sawada H, Shibata D, Hori K, Watanabe Y (2005) Catalog of Micro-Tom tomato responses to common fungal, bacterial, and viral pathogens. J Gen Plant Pathol 71: 8–22.

Windels CE (1992) Fusarium. In: Methods for Research on Soilborne Phytopathogenic Fungi (Eds. LL Singleton, JD Mihail, CM Rush). APS Press, St Paul, MN, USA, pp. 115–129.

Woo SL, Zoina A, Del Sorbo G, Lorito M, Nanni B, Scala F, Neviello C (1996) Characterization of Fusarium oxysporum f. sp. phaseoli by pathogenic races, VCGs, RFLPs and RAPD. Phytopathology 86: 966–973.

Yücel S, Çınar A (1989) Domates Fusarium solgunluğuna (Fusarium oxysporum Schlecht, f.sp. lycopersici (Sacc.) Snyd. and Hans) karşı biyolojik kontrolde antagonistlerin ve toprak solarizasyon uygulamasının etkileri. Türk Tarım ve Orman Der 13: 1372–1393 (in Turkish).

pcr detection of fusarium oxysporum f. sp. radicis...

Documents