pan-mtor inhibitor mln0128 is effective against ...€¦ · shanshan zhang, xinhua song, dan cao,...
TRANSCRIPT
![Page 1: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/1.jpg)
1
Pan-mTOR inhibitor MLN0128 is effective against intrahepatic
cholangiocarcinoma induced in mice by AKT and Yap co-expression
Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, Junjie
Hu, Bin Chen, Mingjie Dong, Maria G. Pilo, Antonio Cigliano, Katja Evert, Silvia
Ribback, Frank Dombrowski, Rosa M. Pascale, Antonio Cossu, Gianpaolo Vidili,
Alberto Porcu, Maria M. Simile, Giovanni M. Pes, Gianluigi Giannelli, John
Gordan, Lixin Wei, Matthias Evert, Wenming Cong, Diego F. Calvisi and Xin
Chen
Table of content
Supplementary Materials and Methods ........................................................................... 2
Fig. S1. ........................................................................................................................... 8
Fig. S2. ........................................................................................................................... 9
Fig. S3. ......................................................................................................................... 10
Fig. S4. ......................................................................................................................... 11
Fig. S5. ......................................................................................................................... 12
Fig. S6. ......................................................................................................................... 13
Fig. S7 .......................................................................................................................... 14
Fig. S8.. ........................................................................................................................ 15
Fig. S9.. ........................................................................................................................ 16
Fig. S10.. ...................................................................................................................... 17
Fig. S11. ....................................................................................................................... 18
Fig. S12. ....................................................................................................................... 19
Fig. S13. ....................................................................................................................... 20
Table S1 ...................................................................................................................... .21
Table S2 ....................................................................................................................... 22
Table S3 ....................................................................................................................... 23
Supplementary references ............................................................................................ 25
![Page 2: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/2.jpg)
2
Supplementary Materials and Methods
Constructs and Reagents
The constructs used for mouse injection, including pT3-EF1α, pT3-EF1α-HA-
myr-AKT (human), pT3-EF1α-YapS127A (human), pT3-EF1α-HA-myr-AKT-
shRaptor, pT3-EF1α-HA-myr-AKT-shLuc, pCMV-Cre and pCMV/sleeping beauty
transposase (SB), were described previously[1-3]. Plasmids were purified using
the Endotoxin free Maxi prep kit (Sigma-Aldrich, St.Louis, MO) before being
injected into the mice. Gemcitabine, purchased from LC Laboratories (Woburn,
MA), was dissolved in Saline to a concentration of 20 mg/ml and stored at -80℃.
Oxaliplatin (LC Laboratories) was dissolved in Saline to a concentration of 2
mg/ml and stored at -20℃. MLN0128 (LC Laboratories) was first dissolved in
NMP (1-methyl-2-pyrrolidinone; Sigma-Aldrich) to make a stock solution of 20
mg/ml and the aliquots were stored at -80℃. It was then 1:100 diluted into 15%
PVP/H2O (PVP: polyvinylpyrrolidone K 30, Sigma-Aldrich; Diluted in H2O at a
15.8:84.2 weight vol−1 ratio). The diluted solution could be stored at 4℃ for 2-3
weeks in the dark and be administered directly. MLN0128 was dissolved in
DMSO for in vitro experiments. Everolimus was dissolved in ethonal to make a 2%
(w/v) stock solution (100x) and stored in -20. Before gavage, stock solution was
diluted with 0.9% NaCl to make a microemulsion.
Histology and immunohistochemistry
![Page 3: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/3.jpg)
3
Liver specimens were fixed in 4% paraformaldehyde and embedded in paraffin.
Sections were done at 5 μm in thickness. Preneoplastic and neoplastic liver
lesions were assessed by two board-certified pathologists (M.E. and F.D.) in
accordance with the criteria by Frith et al.[4]. For immunohistochemistry, antigen
retrieval was performed in 10 mM sodium citrate buffer (pH 6.0) by placement in
a microwave on high for 10 min, followed by a 20-min cool down at room
temperature. After a blocking step with the 5% goat serum and Avidin-Biotin
blocking kit (Vector Laboratories, Burlingame, CA), the slides were incubated
with primary antibodies overnight at 4°C. Slides were then subjected to 3%
hydrogen peroxide for 10 min to quench endogenous peroxidase activity and
subsequently the biotin conjugated secondary antibody was applied at a 1:500
dilution for 30 min at room temperature. The primary antibodies against CK19
(Abcam, Cambridge, MA; 1:150), Vimentin, phosphorylated/activated (p)-AKT,
Yap (Cell Signaling Technology, Danvers, MA; 1:50), α-smooth muscle Actin
(Dako Cytomation, Carpinteria, CA; 1:200) and Ki-67 (Thermo Fisher scientific,
Waltham, MA; 1:150) were used. The immunoreactivity was visualized with the
Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA) and 3,3’-
diaminobenzidine as the chromogen. Slides were counterstained with
hematoxylin. Sirius Red staining was performed according to the standard
instruction. Immunoreactivity for p-AKT was estimated semi-quantitatively:
upregulation of p-AKT was defined when immunolabeling for the latter protein
was stronger in tumors when compared to corresponding surrounding non-
![Page 4: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/4.jpg)
4
neoplastic livers. Nuclear accumulation of the Yap protein was instead used to
determine Yap activation.
Protein Extraction and Western blotting
Frozen mouse liver specimens were homogenized and cultured cell samples
were lysated in Mammalian protein extraction reagent (Thermo Scientific,
Waltham, MA) containing the Complete Protease Inhibitor Cocktail. Protein
concentrations were determined with the Bio-Rad Protein Assay Kit (Bio-Rad,
Hercules, CA) using bovine serum albumin as standard. Aliquots of 40μg lysate
were denatured by boiling in Tris-Glycine SDS Sample Buffer (Invitrogen),
separated by SDS-PAGE, and then transferred onto nitrocellulose membranes
(Invitrogen, Grand Island, NY). Membranes were blocked in 5% non-fat dry milk
in Tris-buffered saline containing 0.1% Tween 20 for 1 hour and probed with
specific antibodies listed in Table S2. Each primary antibody was followed by
incubation with horseradish peroxidase-secondary antibody diluted 1:10,000 for 1
hour and then revealed with the Super Signal West Pico Chemiluminescent
Substrate (Pierce Chemical Co., New York, NY). Equal loading was assessed by
GAPDH and β -Actin Western blotting.
Quantitative reverse transcription real-time polymerase chain reaction
(qRT-PCR)
Total mRNA was extracted from liver tissues using Quick RNA miniprep kit
(Zymo Research, Irvine, CA, USA). mRNA expression was determined by qRT-
![Page 5: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/5.jpg)
5
PCR using SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA)
in an QuantStudio™ 6 Flex system (Applied Biosystems). Expression of each
specific gene mRNA by cells was normalized with the 18S rRNA. Thermal cycling
conditions included an initial hold period at 95°C for 10 minutes, which was
followed by a three-step PCR program of 95°C for 15 seconds, 60°C for 1 min
and 72°C for 30 seconds for a total of 35 cycles. Primers used in this study
included DR5: 5'- CGGGCAGATCACTACACCC -3' (forward) and 5'-
AGTTCCCTTCTGACAGGTACTG -3'(reverse); 18S rRNA: 5'-
CGGCTACCACATCCAAGGAA -3' (forward) and 5'- GCTGGAATTACCGCGGCT
-3'(reverse).
In vitro cell culture, colony forming assay, IC 50 determination and
apoptosis assessment
The HuCCT1 and KMCH human ICC cell lines were used for the in vitro studies.
Cell lines were maintained as monolayer cultures in Dulbecco’s modified Eagle
medium supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island,
NY, USA) and 100 U/ml penicillin, 100 g/ml streptomycin (Gibco). pLKO.1 puro,
shRaptor.1, shRaptor.2 and shRictor were obtained from Addgene. When cells
reached 50-60% confluency in 60 × 15 mm culture dishes, pLKO.1 or
shRaptor/shRictor lentivirus was added into culture medium. 48-72 hours later,
cells were trypsinized and cultured in 100 × 20 mm culture dishes in culture
medium containing puromycin at the concentration of 1ug/ml for HuCCT1 and
5ug/ml for KMCH. After 3 days of selection, cells were used for colony forming
![Page 6: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/6.jpg)
6
assay, and knockdown of Raptor or Rictor was confirmed by immunoblotting. For
colony forming assay, HuCCT1 and KMCH cells transfected with corresponding
lentivirus were plated in 6-well culture plates at a density of 1 × 103 cells per well
in triplicate. 2-3 weeks later, colonies were stained with crystal violet and then
counted for quantification. For IC50 determination, HuCCT1 and KMCH cells
were seeded in 24-well plates and treated with increasing doses of MLN0128 in
triplicate for 48 hours. Then cells were stained with crystal violet. After washed
and dried, stained cells were treated with lysate solution and shaken gently on a
rocking shaker for 20-30 minutes. Diluted lysate solutions were added into 96-
well plates and OD was measured at 590 nm with BioTek ELx808 Absorbance
Microplate Reader. Apoptosis was detected by using the Cell Death Detection
Elisa Plus Kit (Roche Molecular Biochemicals, Indianapolis, IN) following the
manufacturer's instructions. V-ZAD-FMK was purchased from Promega (Madison,
Wisconsin) and used at the concentration of 50 uM at least 2 hours before
MLN0128 treatment.
TUNEL assay
Apoptosis in mice liver tissues was detected with the ApoTag Peroxidase In Situ
Apoptosis Detection Kit (Millipore, Billerica, MA) according to the manufacturer’s
instructions.
CK19 staining quantification
![Page 7: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/7.jpg)
7
At least 4 samples were used from each group. The images of at least 3
randomly selected fields under 40x magnification were taken for each sample.
Quantification analysis was performed by using Image J software and data were
demonstrated as the percentage of positive staining area of the whole area.
Proliferation and apoptosis analysis
Proliferation and apoptosis indices were determined by counting Ki67 and
TUNEL positive cells respectively, on at least 3000 tumor cells per sample.
Microarray analysis
Liver tissues from control FVB/N mice (n=4) and tumor bearing AKT/YapS127A
mice (n=3) were used to isolate mRNA and preparation of probes for
hybridization on the Affymetrix GeneChip® Mouse 1.0 ST arrays following the
manufacturer’s instruction. Array data were normalized using the Robust
Multiarray Average (RMA) approach. The R package biomaRt was used to map
mouse gene symbols and human gene symbols. SAM in the siggenes R package
was used to perform differential expression analysis between the AKT/YapS127A
and wild type samples (fold change > 1.5 and False Discovery Rate <
0.1). The differentially expressed genes published by Gore’s lab were
used. Hypergeometric test was used to test the significance of overlapping
between two datasets. Both up and down-regulated genes overlapped
significantly in the two datasets (up: p value < 1E-200, down: p value < 1E-200).
![Page 8: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/8.jpg)
8
Fig. S1. ICC development in AKT/YapS127A mice.
(A) Time course of ICC development in AKT/YapS127A mice. Gross image, H&E
and CK19 staining of liver tissues from AKT/YapS127A mice at different time
points post hydrodynamic injection. (B) IHC staining of Vimentin and SMA and
Sirius Red staining in AKT/YapS127A mouse liver. LW, liver weight. (Scale bar:
500μm for 40X; 200μm for 100X; 100μm for 200X; 50μm for 400X).
![Page 9: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/9.jpg)
9
Fig. S2. Inhibiting Raptor expression suppresses the clonogenic capacity
of human ICC cell lines.
HuCCT1 (A) and KMCH (B) human ICC cell lines were transfected via lentivirus
with either pLKO.1 or shRaptor. Colony forming assay was performed in triplicate.
Representative photos were shown in the left panel. The colonies were counted
and data are presented as mean ± SE in right upper panel. Inhibition of Raptor
was confirmed by Western blotting (right lower panel). *** P < 0.001.
![Page 10: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/10.jpg)
10
Fig. S3. Inhibiting Rictor expression suppresses the clonogenic capacity of
human ICC cell lines.
HuCCT1 (A) and KMCH (B) human ICC cell lines were transfected via lentivirus
with either pLKO.1 or shRictor. Colony forming assay was performed in triplicate.
Representative photos were shown in left panel. The colonies were counted and
data are presented as mean ± SE in right upper panel. Inhibition of Rictor was
confirmed by Western blotting (right lower panel). *** P < 0.001.
![Page 11: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/11.jpg)
11
Fig. S4. Gemcitabine plus Oxaliplatin is effective in the treatment of early
stage AKT/YapS127A ICC.
(A) Study design. (B) Gross images, H&E staining, CK19 and Ki-67 IHC staining
of livers from vehicle- and Gemcitabine plus Oxaliplatin-treated early stage
AKT/YapS127A mice. (C) Liver weight and survival curve of vehicle- and
Gemcitabine plus Oxaliplatin-treated early stage AKT/YapS127A mice. Liver
weight of vehicle-, MLN0128- and Gemcitabine plus Oxaliplatin-treated early
stage AKT/YapS127A mice. (Scale bar: 200μm for 100X; 100μm for 200X). ** P
< 0.01.
![Page 12: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/12.jpg)
12
Fig. S5. Gemcitabine plus Oxaliplatin has mild efficacy in the treatment of
late stage AKT/YapS127A ICC.
(A) Study design. (B) Gross images, H&E staining, CK19 and Ki-67 IHC staining
of livers from vehicle- and Gemcitabine plus Oxaliplatin-treated late stage
AKT/YapS127A mice. (C) Liver weight and survival curve of vehicle- and
Gemcitabine plus Oxaliplatin-treated late stage AKT/YapS127A mice. (Scale bar:
200μm for 100X; 100μm for 200X). * P < 0.05.
![Page 13: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/13.jpg)
13
Fig. S6. Pancaspase inhibitor V-ZAD-FMK treatment prevents apoptosis by
MLN0128 in KMCH and HuCCT1 human ICC cell lines.
Apoptosis was assessed with the Cell Death Detection Elisa Plus Kit (Roche
Molecular Biochemicals, Indianapolis, IN) following the manufacturer’s protocol in
KMCH (A, B) and HuCCT1 (C, D) ICC cells. Tukey–Kramer test: at least P <
0.001 a, vs control (untreated cells); b, vs DMSO (solvent); c, vs MLN0128.
Apoptosis was determined at 24h (A, C) and 48h (B, D) time points. Experiments
were conducted at least three times in triplicate.
![Page 14: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/14.jpg)
14
Fig. S7. mTOR signaling is effectively suppressed after 5 days of MLN0128
administration at the dose of 1mg/kg.
Western blotting was performed to analyze mTOR signaling in wild-type normal
livers treated with vehicle or 1mg/kg MLN0128 for 5 days. Representative
immunoblotting is shown in left panel and quantified data are shown in right
panel.
![Page 15: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/15.jpg)
15
Fig. S8. MLN0128 leads to stable disease in early stage AKT/YapS127A ICC
mice.
(A) H&E staining of livers and (B) Liver weight of control AKT/YapS127A mice at
3.5 w.p.i. and AKT/YapS127A mice at 6.5 w.p.i. after 3 weeks of MLN0128
treatment. Ctrl, control. (Scale bar: 500μm for 40X).
![Page 16: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/16.jpg)
16
Fig. S9. Western blotting of liver tissues from mice subjected to either
vehicle or MLN0128 treatment for 3 weeks.
Representative immunoblotting in wild-type (WT), vehicle or MLN0128 treated
AKT/YapS127A liver tissues. GAPDH and β-Actin were used as loading controls.
![Page 17: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/17.jpg)
17
Fig. S10. MLN0128 suppresses both mTORC1 and mTORC2 signaling,
leading to apoptosis in AKT/YapS127A ICC.
The results of Western blotting in Figure 7 were quantified to analyze mTORC1
and mTORC2 signaling (A), proliferation (B) and apoptosis (C) in ICC tissues
from control AKT/YapS127A mice 3.5 w.p.i and AKT/YapS127A mice 6.5 w.p.i
after 3 weeks of MLN0128 treatment. (D) qRT-PCR was performed to determine
the gene expression level of DR5. Data are presented as mean ± SE. * P < 0.05;
** P < 0.01.
![Page 18: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/18.jpg)
18
Fig. S11. MLN0128 leads to tumor regression in late stage ICC developed in
AKT/YapS127A mice.
(A) Phenotype of AKT/YapS127A mice before and 1, 2, 3 days after MLN0128
treatment. (B) Gross images and H&E staining of livers from control
AKT/YapS127A mice at 5.5 w.p.i. and MLN0128-treated AKT/YapS127A mice at
different time points. (Scale bar: 500μm for 40X). LW, liver weight.
![Page 19: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/19.jpg)
19
Fig. S12. Comparison between the AKT/YapS127A ICC model and the
AKT/YapS127A/IL-33 ICC model.
(A) H&E, CK19 IHC and Sirius Red staining in AKT/YapS127A and
AKT/YapS127A/IL-33 mouse ICC tissues. (Scale bar: 200μm). (B) Microarray
was performed to detect global gene expression in AKT/YapS127A ICC tissues,
and the de-regulated genes in AKT/YapS127A and AKT/YapS127A/IL-33 were
compared.
![Page 20: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/20.jpg)
20
Fig. S13. MLN0128 has better efficacy than Everolimus for treatment of late
stage AKT/YapS127A ICC.
(A) Gross images, H&E staining, CK19 and Ki-67 IHC staining of livers from
vehicle- and Everolimus-treated late stage AKT/YapS127A mice. (B) Liver weight
and survival curve of vehicle-, MLN0128-, Everolimus- and Gemcitabine plus
Oxaliplatin-treated late stage AKT/YapS127A mice. * P < 0.05; ** P < 0.01.
![Page 21: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/21.jpg)
21
Table S1. Clinicopathological features of intrahepatic cholangiocarcinoma
(ICC) patients.
Variables
No. of patients Male Female
94 62 32
Age (years) <60 >60
42 52
Etiology HBV HCV Hepatolithiasis PSC NA
10 14 22 2 46
Liver cirrhosis Yes No
20 74
Tumor differentiation Well Moderately Poorly
35 32 27
Tumor size (cm) <5 53 >5 41
Tumor number Single 61 Multiple 33
Lymph node metastases Yes 14 No 47 NA 33
Abbreviations: NA, not available; PSC, primary sclerosing cholangitis
![Page 22: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/22.jpg)
22
Table S2. Logistic regression in 94 patients with intrahepatic cholangiocarcinoma. The dependent variable is the presence/absence of nuclear YAP.
Covariates Model 1§ Model 2#
ORs 95% CI of OR
p-value ORs 95% CI of OR
p-value
Age
< 60 1.000 ‒ ‒ 1.000 ‒ ‒
≥ 60 1.250
(0.169 – 9.269)
0.827 0.861 (0.101 –
7.316) 0.891
Gender
Female 1.000 ‒ ‒ 1.000 ‒ ‒
Male 6.310
(0.629 – 63.31)
0.117 8.702 (0.763 –
99.21) 0.081
Cirrhosis
No 1.000 ‒ ‒ ‒ ‒ ‒
Yes 0.000 Not evaluable 0.999 ‒ Not evaluable ‒
Aetiology
HBV 1.000 ‒ ‒ ‒ ‒ ‒
HCV 0.000 Not evaluable 0.999 ‒ ‒ ‒
Hepatolithiasis 0.591
(0.050 ‒ 7.049)
0.677 ‒ ‒ ‒
PSC 0.955
(0.082 ‒ 11.13)
0.970 ‒ ‒ ‒
NA 0.000 Not evaluable 0.999 ‒ ‒ ‒
Tumor size
< 5 1.000 ‒ ‒ 1.000 ‒ ‒
≥ 5 0.244
(0.024 ‒ 2.433)
0.229 0.161 (0.014 –
1.852) 0.143
Tumor number
Single 1.000 ‒ ‒ 1.000 ‒ ‒
Multiple 0.525
(0.071 ‒ 3.912)
0.530 0.405 (0.046 –
3.545) 0.414
Tumor differentiation
Well 1.000 ‒ ‒ ‒ ‒ ‒
Moderately 0.000 Not evaluable 0.999 ‒ ‒ ‒
Poorly 0.000 Not evaluable 0.999 ‒ ‒ ‒
Lymph node metastases
No 1.000 ‒ ‒ ‒ ‒ ‒
Yes 0.000 Not evaluable 0.999 ‒ ‒ ‒
§Each variable individually; #All variables simultaneously (full model); ORs are
not evaluable when the contingency tables contain cells with no patients.
![Page 23: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/23.jpg)
23
Table S3. Logistic regression in 94 patients with intrahepatic
cholangiocarcinoma. The dependent variable is the presence/absence of p-
AKT upregulation.
Covariates Model 1§ Model 2#
ORs 95% CI of
OR
p-value ORs 95% CI of
OR
p-value
Age
< 60 1.000 ‒ ‒ 1.000 ‒ ‒
≥ 60 0.703
(0.280 –
1.769) 0.454
0.331 (0.080 –
1.366)
0.126
Gender
Female 1.000 ‒ ‒ 1.000 ‒ ‒
Male 0.815
(0.309 –
2.150) 0.679
0.827 (0.212 –
3.233)
0.785
Cirrhosis
No 1.000 ‒ ‒ 1.000 ‒ ‒
Yes 0.482
(0.170 –
1.365) 0.169
1.520 (0.357 –
6.467)
0.571
Aetiology
HBV 1.000 ‒ ‒ ‒ ‒ ‒
HCV 1.571 (0.245 –
10.09) 0.634
‒ ‒ ‒
Hepatolithiasis 1.457
(0.271 ‒
7.821) 0.661
‒ ‒ ‒
PSC 0.000 Not evaluable 0.999 ‒ ‒ ‒
NA 0.886 (0.200 ‒
3.916) 0.873
‒ ‒ ‒
Tumor size
< 5 1.000 ‒ ‒ 1.000 ‒ ‒
≥ 5 1.341
(0.533 ‒
3.374) 0.534
1.251 (0.375 –
4.179)
0.715
Tumor number
Single 1.000 ‒ ‒ 1.000 ‒ ‒
Multiple 0.818
(0.321 ‒
2.086) 0.674
0.883 (0.247 –
3.153)
0.848
Tumor differentiation
Well 1.000 ‒ ‒ 1.000 ‒ ‒
Moderately 2.068 (0.663 ‒
6.449) 0.210
1.577 (0.345 –
7.204)
0.557
Poorly 2.110 (0.715 ‒
6.232) 0.176
1.712 (0.415 –
7.058)
0.457
Lymph node
![Page 24: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/24.jpg)
24
metastases
No 1.000 ‒ ‒ 1.000 ‒ ‒
Yes 3.000 (0.598 ‒
15.05) 0.182
2.358 (0.410 –
13.56)
0.337
§Each variable individually; #All variables simultaneously (full model); ORs are
not evaluable when the contingency tables contain cells with no patients.
![Page 25: Pan-mTOR inhibitor MLN0128 is effective against ...€¦ · Shanshan Zhang, Xinhua Song, Dan Cao, Zhong Xu, Biao Fan, Li Che, ... Protein Extraction and Western blotting ... mice](https://reader036.vdocuments.us/reader036/viewer/2022071100/5fd89b4a0cacec203d0bc6a7/html5/thumbnails/25.jpg)
25
Supplementary references
Author names in bold designate shared co-first authorship.
[1]. Tao J, Calvisi DF, Ranganathan S, Cigliano A, Zhou L, Singh S, et al. Activation of beta-catenin and Yap1 in human hepatoblastoma and induction of hepatocarcinogenesis in mice. Gastroenterology 2014;147:690-701. [2]. Marti P, Stein C, Blumer T, Abraham Y, Dill MT, Pikiolek M, et al. YAP promotes proliferation, chemoresistance, and angiogenesis in human cholangiocarcinoma through TEAD transcription factors. Hepatology 2015;62:1497-1510. [3]. Hu J, Che L, Li L, Pilo MG, Cigliano A, Ribback S, et al. Co-activation of AKT and c-Met triggers rapid hepatocellular carcinoma development via the mTORC1/FASN pathway in mice. Scientific reports 2016;6:20484. [4]. Frith CH, Ward JM, Turusov VS. Tumours of the liver. IARC scientific publications 1994:223-269.