oral colonization by entamoeba gingivalis and trichomonas … · 2020. 7. 16. · 3 44 abstract 45...

1

Oral colonization by Entamoeba gingivalis and Trichomonas tenax: PCR-1

based study in health, gingivitis, and periodontitis 2

Running title: Oral parasites as risk factors for periodontal disease 3

4

Authors 5

Alaa’ Yaseena, Azmi Mahafzaha,b, Deema Dababsehc, Duaa Tayemc, Ahmad A. Hamdanc,d, 6

Esraa Al-Fraihata,b, Yazan Hassonac,d, Gülşen Özkaya Şahine,f, Julien Santi-Roccag and Malik 7

Sallama,b,e,# 8

Affiliations 9

aDepartment of Pathology, Microbiology and Forensic Medicine, School of Medicine, the 10

University of Jordan, Amman, Jordan. Postal code: 11942. 11

bDepartment of Clinical Laboratories and Forensic Medicine, Jordan University Hospital, 12

Amman, Jordan. Postal code: 11942. 13

cSchool of Dentistry, the University of Jordan, Amman, Jordan. 14

dDepartment of Oral and Maxillofacial Surgery, Oral Medicine and Periodontology, Jordan 15

University Hospital, Amman, Jordan. 16

eDepartment of Translational Medicine, Faculty of Medicine, Lund University, Malmö, 17

Sweden. Postal code: 22100. 18

fDepartment of Clinical Microbiology, Laboratory Medicine, Skåne University Hospital, Lund, 19

Sweden. 20

gScience and Healthcare for Oral Welfare, Toulouse, France. 21

22

. CC-BY-NC-ND 4.0 International licenseIt is made available under a is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. (which was not certified by peer review)

The copyright holder for this preprint this version posted July 18, 2020. ; https://doi.org/10.1101/2020.07.16.20155861doi: medRxiv preprint

NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.

https://doi.org/10.1101/2020.07.16.20155861

http://creativecommons.org/licenses/by-nc-nd/4.0/

2

#Corresponding author (to whom requests for reprints should be made): 23

Malik Sallam, M.D., Ph.D. Department of Clinical Laboratories and Forensic Medicine, 24

Jordan University Hospital, Queen Rania Al-Abdullah Street-Aljubeiha/P.O. Box: 13046, 25

Postal code: 11942. Amman, Jordan. Tel: +962 79 184 5186. E-mail: [email protected], 26

ORCID ID: 0000-0002-0165-9670. 27

28

Running title length: 54 characters with spaces, (limit: 54 characters with spaces). 29

Abstract word count: 250 words, (limit: 250 words). 30

Importance word count: 112 words, (limit: 150 words). 31

Manuscript word count: 4832 words 32

33

34

35

36

37

38

39

40

41

42

43



https://doi.org/10.1101/2020.07.16.20155861


3

ABSTRACT 44

The etiology of periodontitis needs further investigation, as is the place of gingivitis in its 45

pathophysiology. A few studies linked the oral colonization by parasites (Entamoeba gingivalis 46

and Trichomonas tenax) to the disease and its severity. The aim of this study was to estimate 47

the prevalence of these oral parasites among healthy individuals, gingivitis and periodontitis 48

patients in Jordan. The study was conducted by active enrolment of participants at Jordan 49

University Hospital. The participants answered a questionnaire that included items related to 50

possible risk factors for periodontal disease. Saliva and dental plaque samples were collected. 51

The detection of oral parasites was done using conventional PCR and microscopic examination 52

of wet mounts. The study population comprised a total of 237 individuals divided into three 53

groups: healthy (n=94), gingivitis (n=53), and periodontitis (n=90). PCR results revealed that 54

the overall prevalence of E. gingivalis was 71.7% compared to 12.2% for T. tenax. The 55

periodontal disease group had higher prevalence of E. gingivalis and T. tenax compared to the 56

healthy group (p<0.001). Increasing age was associated with higher prevalence of E. gingivalis 57

(p=0.008) and T. tenax (p=0.019), in the entire study population. The number of cases of 58

colonization detected by microscopic observation was lower for any of the oral parasites, as 59

compared to diagnosis by PCR (40.7% vs. 71.7%, p<0.001 for E. gingivalis and 4.3% vs. 60

12.2%, p=0.007 for T. tenax). The higher prevalence of oral parasites among patients with 61

periodontal disease might point to their potential contribution in the disease and its severity. 62

63

64

65

66

67



https://doi.org/10.1101/2020.07.16.20155861


4

IMPORTANCE 68

Periodontal disease has a high prevalence globally, with adverse effects on the quality of life 69

for affected individuals. Despite the presence of several studies that investigated the role of 70

oral parasites in periodontal disease, reliable conclusions about this matter remained elusive 71

mainly due to utilization of microscopy in parasite detection. The current study provides new 72

insights into the epidemiology and prevalence of the two oral parasites (Entamoeba gingivalis 73

and Trichomonas tenax) in patients with various stages of periodontal disease in comparison 74

to healthy adults. In addition, we describe the potential role of oral colonization by parasites as 75

a risk factor for development of periodontal disease and its severity using a molecular-based 76

approach. 77

78

79

80

81

82

83

84

85

86

87

88

89



https://doi.org/10.1101/2020.07.16.20155861


5

Introduction 90

In recent years, the role of microbiota in establishing and maintaining a healthy status among 91

humans has been demonstrated by molecular methods (1-3). The oral microbiota was no 92

exception, and its disruption has been shown to result in a various range of oral diseases 93

including gingivitis and periodontitis (4, 5). This disruption in oral microbiota is termed 94

dysbiosis, in contrast to eubiosis defined as the complex interactions of different resident 95

microbes that result in an equilibrium to maintain the healthy state of the ecologic niche, which 96

is the oral cavity in this case (4-7). 97

Periodontal disease represents a state of chronic inflammation in gingiva, bone and supporting 98

ligaments (8, 9). The physiologic healthy state of gingiva can be defined as the total absence 99

or minimal levels of clinical inflammation of the periodontium with normal support (no loss 100

affecting attachment or bone) (10, 11). The identification of plaque‐induced gingivitis relies on 101

the presence of bleeding on probing with an intact periodontium and/or visible inflammation 102

and this condition can be reversed back to a healthy state if managed properly (11, 12). 103

Periodontitis results in destruction of the periodontal ligament, cementum and alveolar bone. 104

Inflammation and microbiota of periodontitis can be cured but tissues are not healed back to 105

their initial volume, organization, and shape, thus necessitating continuous maintenance of 106

good oral hygiene (11, 13-15). 107

Despite the lack of accurate and recent estimates of its prevalence, periodontal disease is 108

considered among the most common conditions affecting all age groups with predilection for 109

the elderly (6, 16). As of 2010, the prevalence of periodontitis was 47% among adults aged 30 110

and above in the United States, while the global prevalence of severe periodontitis was 11%, 111

with higher estimates for gingivitis (17-19). In addition, periodontitis is considered an 112

important cause of teeth loss in older adults, which adversely affects the quality of life (20). 113



https://doi.org/10.1101/2020.07.16.20155861


6

The underlying etiology and pathogenesis of periodontal disease has been linked to microbial 114

dysbiosis (21, 22). However, the exact specific roles of different microbes in the dental plaque 115

that lead to the development of periodontal disease remains an enigma (7, 23). In addition, the 116

initiating factors for microbial dysbiosis in the oral cavity remains unclear and the study of 117

these factors is a subject for ongoing research (5). 118

Several factors have been linked to an increased incidence of periodontal disease and these can 119

be divided into non-modifiable and modifiable factors (24). Examples of the former include 120

aging, genetic predisposition, and osteoporosis, whereas the later include smoking, diabetes 121

mellitus, psychological stress, alcohol consumption and poor oral hygiene (24-31). 122

The role of the parasitic fraction of the oral microbiome, namely: Entamoeba gingivalis and 123

Trichomonas tenax, is considered among the proposed models regarding the contributing 124

factors to the development of periodontal disease (32, 33). Several studies aimed to investigate 125

parasitic oral colonization among healthy individuals and those with periodontal disease with 126

remarkably variable results (34-41). Such variability can be related to adoption of different 127

approaches for parasite detection, the existence of previously unknown genetic variants of oral 128

parasites, in addition to limitations of small sample sizes, and possible bias in selection of study 129

subjects among others as reviewed recently (42, 43). 130

Thus, the objective of the current study was to examine potential differences of the two 131

reference methods for oral parasite detection (microscopy vs. PCR), which might help to 132

explain the differences observed between studies. In addition, we aimed to investigate the 133

prevalence of both parasites in health and periodontal disease, to check for possible regional 134

specificities in Jordan. Also, we aimed to better define the place of gingivitis in the 135

physiopathology of periodontal disease using parasite colonization. Finally, we aimed to 136

identify the variables that might be associated with increased likelihood of harboring these 137

parasites in health and disease. 138



https://doi.org/10.1101/2020.07.16.20155861


7

Results 139

Study population 140

The total number of study participants who were eligible to be included in the final analysis 141

was 237, distributed as follows: healthy group (n=94, 39.7%), gingivitis group (n=53, 22.4%) 142

and periodontitis group (n=90, 38.0%, Table 1). Significant differences among the three study 143

groups were found for the following factors: the median age of the healthy group was younger 144

compared to the two other groups combined (24 vs. 44 years, p<0.001, Mann-Whitney U test 145

[M-W]). The periodontitis group had an older median age compared to the two other groups 146

(p<0.001, Kruskall-Wallis test [K-W], Table 1). The percentage of smokers in the healthy 147

group was lower in comparison to the disease group with ex-smokers excluded (31.9% vs. 148

50.3%, p=0.004, χ2 test). The monthly income was the lowest among the periodontitis group 149

and the highest among the healthy group (p<0.001, K-W). In addition, the periodontitis group 150

had the lowest overall level of dental care (p<0.001, K-W) and the highest body mass index 151

(BMI) levels (p=0.003, K-W, Table 1). 152

The prevalence of oral parasites in the study population 153

To estimate the overall prevalence of E. gingivalis and T. tenax, the conventional PCR results 154

were available from the 237 individuals of the three groups for final analysis. The overall 155

prevalence of E. gingivalis among the entire study population was 71.7% (95% confidence 156

interval [CI]: 65.7% to 77.1%), while the overall prevalence for T. tenax was 12.2% (95% CI: 157

8.6% to 17.1%). 158

Concurrent detection of the two oral parasites (dual colonization) was detected in 26 study 159

subjects yielding a prevalence of 11.0% (95% CI: 7.6% to 15.6%). Among the 29 study subjects 160

with T. tenax colonization, E. gingivalis was also present in 26 individuals (89.7%). 161



https://doi.org/10.1101/2020.07.16.20155861


8

Divided by the study groups, the prevalence of E. gingivalis was the highest among the 162

periodontitis group (n=80, 88.9%) compared to gingivitis (n=45, 84.9%) and healthy group 163

(n=45, 47.9%). The difference was statistically significant upon comparing the healthy group 164

to gingivitis and periodontitis groups (p<0.001 for both comparisons, χ2 test). However, the 165

difference was not significant upon comparing the gingivitis group with the periodontitis group 166

(p=0.603, χ2 test). For T. tenax, the prevalence increased starting from 3.2% in the heathy 167

group, to 5.7% in the gingivitis group and ending in 25.6% in the periodontitis group. The 168

difference was not significant by comparing the healthy and gingivitis groups (p=0.668, χ2 test), 169

but significant results were noticed upon comparing the periodontitis group to healthy and 170

gingivitis groups (p<0.001 and 0.003 respectively for the two comparisons, χ2 test). 171

Factors associated with higher prevalence of oral parasites in the whole study 172

population 173

The entire study population comprised 122 males and 115 females. T. tenax was detected more 174

frequently among males compared to females (16.4% vs. 7.8%, p=0.044, χ2 test). In addition, 175

E. gingivalis and dual colonization showed the following gender prevalence, that lacked 176

statistical significance (74.6% vs. 68.7%; 14.8% vs. 7.0%, p=0.314; p=0.055, χ2 test). 177

For both oral parasites E. gingivalis and T. tenax, higher prevalence of colonization was found 178

among the study subjects with the lowest income (p<0.001 for E. gingivalis, p=0.010 for T. 179

tenax, χ2 test). No previous history of dental care was associated with higher prevalence of E. 180

gingivalis (p<0.001, χ2 test), whereas higher levels of colonization by T. tenax was associated 181

with Non-Jordanian nationality (p=0.010, χ2 test) and higher BMI (p=0.012, χ2 test). 182

The bleeding index levels were higher among study subjects positive for E. gingivalis and T. 183

tenax (mean: 0.53 vs. 0.20, and 0.73 vs. 0.39, respectively p<0.001, M-W). For the plaque 184

index, significant difference was only found among individuals positive for E. gingivalis 185



https://doi.org/10.1101/2020.07.16.20155861


9

(mean: 0.79 vs. 0.55, p<0.001, M-W). The following factors did not give significant differences 186

in colonization by either of the two oral parasites: smoking, smoking exposure through pack-187

year evaluation, history of diabetes, family history of gum disease, alcohol use and 188

osteoporosis. 189

Factors associated with higher prevalence of oral parasites in each study group 190

The analysis of the variables associated with higher prevalence of colonization by oral parasites 191

divided by the three groups revealed the following significant results: In the healthy group, E. 192

gingivalis was detected in 100.0% of the individuals with uncontrolled diabetes compared to 193

75.0% among those with controlled diabetes and 42.5% among those without history of 194

diabetes (p=0.012, χ2 test). In the periodontitis group, all study subjects with non-Jordanian 195

nationality were positive for T. tenax (n=4) compared to 22.1% among Jordanians (p<0.001, 196

χ2 test) and individuals with BMIs higher than 25 had a prevalence of E. gingivalis of 93.4% 197

compared to 78.6% among individuals with BMIs less than 25 (p=0.039, χ2 test) and a similar 198

pattern was observed for T. tenax with 10.7% among individuals with BMIs less than 25 vs. 199

32.8% among individuals with BMIs higher than 25 (p=0.027, χ2 test). 200

Association of oral parasites with periodontal disease severity 201

Data on the type of periodontal disease (localized vs. generalized) was available from 130 study 202

subjects. The localized type comprised 18 individuals as opposed to 112 individuals with 203

generalized periodontal disease. T. tenax was only detected among individuals with generalized 204

periodontal disease compared to its total absence among those with localized periodontal 205

disease (19.6% vs 0.0%. p=0.039, χ2 test) and no dual colonization was detected either in the 206

localized group compared to generalized group (p=0.051, χ2 test). Despite the higher 207

prevalence of both oral parasites in individuals with advanced stage and grade of disease, no 208

statistical significance was detected. 209



https://doi.org/10.1101/2020.07.16.20155861


10

210

Comparing the accuracy of microscopic examination to molecular detection for oral 211

parasites 212

To assess the sensitivity of microscopic examination of wet mounts in the evaluation of 213

colonization by oral parasites to molecular detection using conventional PCR, we compared 214

the rate of positivity for each method. Microscopic examination detected E. gingivalis in 94 215

out of 231 (40.7%) specimens analyzed using this method compared to positivity rate of 71.7% 216

using PCR (p<0.001, χ2 test) and missing a total of 76 cases. For T. tenax, microscopic 217

examination detected only 10 out of 231 (4.3%) specimens compared to 12.2% using PCR 218

(p=0.002, χ2 test) and missing a total of 19 cases. Stratified by the study group, the largest 219

proportion of missed cases of E. gingivalis was noticed among healthy group (73.3%) 220

compared to gingivitis group (40.5%) and periodontitis group (26.0%, p<0.001, linear-by-221

linear test for association [LBL]). For T. tenax, all cases were missed in the healthy and 222

gingivitis groups, while the missing rate was 56.5% in the periodontitis group (p=0.066, LBL). 223

Risk factors for periodontal disease in the study population 224

The majority of risk factors for periodontal disease that were previously reported in various 225

studies were tested in this work (e.g. dental care level, smoking, DM, etc.). To analyse the 226

patterns associated with higher likelihood of having periodontal disease as a whole and per 227

disease state (gingivitis and periodontitis), we conducted multinomial logistic regression 228

analysis using variables that were classified into dichotomous outcomes as follows: For age 229

(more than 38 years vs. less than or equal to 38 years, [38 years was the median age for the 230

whole population]), gender (male vs. female), nationality (Jordanian vs. non-Jordanian), BMI 231

(more than or equal to 25 vs. less than 25), monthly income (less than 500 JD vs. more than or 232

equal to 500 JD), dental care (no dental care vs. any form of dental care), smoking (smoker vs. 233



https://doi.org/10.1101/2020.07.16.20155861


11

non-smoker, [ex-smokers were excluded]), DM (controlled or non-controlled DM vs. non-234

diabetic), family history (present vs. absent), subjective evaluation of stress (more stressed if 235

the score is 0-4 vs. less stressed if the score is more than 5), alcohol use (consumer vs. non-236

consumer, [ex-consumers were excluded]), osteoporosis (present vs. absent), E. gingivalis by 237

PCR (positive vs. negative) and T. tenax by PCR (positive vs. negative). 238

For the health vs. disease groups, the most significant risk factors for development of 239

periodontal disease in the current study was colonization by E. gingivalis (p<0.001, odds ratio 240

[OR]=5.8). Other significant risk factors included monthly income that is less than 500 JD, 241

lack of dental care and higher levels of stress evaluated using the questionnaire (Tables 2, 3 242

and 4). In gingivitis compared to healthy individuals, significant risk factors included lack of 243

dental care, colonization by E. gingivalis and low monthly income, while for periodontitis vs. 244

healthy individuals, colonization by each oral parasite was an independent risk factor for the 245

disease (p=0.007, OR=5.2 for E. gingivalis and p=0.009, OR=10.1 for T. tenax, Tables 2, 3 and 246

4). 247

248

249

250

251

252

253

254

255



https://doi.org/10.1101/2020.07.16.20155861


12

Discussion 256

Gingivitis and periodontitis are inflammatory conditions that can also be viewed as infectious 257

diseases (44). In the oral microbiome, the role of the bacterial fraction in periodontitis has been 258

studied extensively with accumulating evidence pointing to its contribution to the etiology of 259

the disease (45). However, the minority fraction of protozoa was not studied to a similar level 260

compared to its bacterial counterpart (32, 43, 46, 47). Thus, more studies are warranted to 261

evaluate the potential role of the human oral “protozoome” in health and disease. 262

In the current study, we investigated the prevalence and risk factors for oral colonization by 263

the currently known human oral parasites, E. gingivalis and T. tenax, for the first time in Jordan. 264

The importance of this work is related to the following aspects: First, periodontal disease 265

(gingivitis and periodontitis) has a high prevalence among individuals of different age groups, 266

which poses significant risks to public health, including various infections and potential tooth 267

loss (6, 16, 20). Second, some key elements regarding the etiology and pathophysiology of 268

periodontal disease have not been disentangled yet, hence more research is needed to decipher 269

these unresolved elements (5, 7, 23). Third, despite the uncertainties regarding the specific 270

roles of different microorganisms in periodontal disease, the accumulating evidence points to 271

conspicuous differences in the oral microbiome between health and disease and the role of oral 272

parasites in both states is yet to be clearly delineated (43). Fourth, a few studies on the 273

epidemiology of oral parasites originated from the Middle East and North Africa (MENA) 274

region, including studies from Egypt, Iran, Iraq and Saudi Arabia, without relying on molecular 275

detection for estimating the burden of these oral parasites in the countries of the region (35, 37-276

39, 48, 49). Thus, we aimed to build on the previous work that had the same objective, while 277

attempting to avoid some limitations of the previously published reports. For example, in this 278

study, each sample was based on a mixture of saliva and dental plaques as opposed to relying 279

on one of them solely for parasite detection. The advantage of this sampling approach is related 280



https://doi.org/10.1101/2020.07.16.20155861


13

to improving the sensitivity of detection as oral parasites can be found in either one of these 281

sites (50). Also, we relied on contemporaneous use of the two reference methods currently 282

applied for oral parasite detection (34, 43). In addition, we tried to improve the sensitivity of 283

molecular detection in this study through using silica column-based DNA extraction method, 284

which can help to remove PCR inhibitors and we adopted sensitive PCR protocols that were 285

previously validated (34, 51, 52). 286

The main result of the study was the finding of a profoundly higher prevalence of E. gingivalis 287

(87.4%) among individuals with periodontal disease, compared to those in the healthy group 288

(47.9%) using the PCR method. For T. tenax, the estimates were much lower and significant 289

differences were found moving from 3.2% in the healthy group to 18.2% among individuals 290

with periodontal disease. To assess reproducibility of these results, a limited number of studies 291

were found (34, 36, 43, 53, 54). The comparisons were further complicated by the reliance of 292

a majority of the previous studies on microscopic detection methods (examination of wet 293

mounts or permanent stained smears) (35, 37-41). In the current study, a significant number of 294

colonization cases by the two oral parasites was missed upon using the microscopic approach. 295

One possible explanation for this discrepancy is the subjectivity of the microscopic approach 296

which depends on the skills and experience of the examiner, number of the fields examined, 297

method of microscopy used (light vs. phase-contrast), use of staining, nature of mounting 298

media, and the lag time between sampling and examination (particularly for wet mount 299

examination which depends on the viability of oral parasites, since motility is one of the 300

decisive defining features for diagnosis) (34). 301

Despite the variability in results of the previously published reports, two recurring patterns 302

were observed and were in line with our results. First, the observation of an increase in the 303

prevalence of both oral parasites moving from health to gingivitis and reaching the highest 304

levels in periodontitis (43). Second, the generally higher prevalence of E. gingivalis in 305



https://doi.org/10.1101/2020.07.16.20155861


14

comparison to T. tenax in both health and disease. Interestingly, a significant association 306

between the presence of T. tenax and periodontal disease severity was also found which was 307

manifested in its total absence in localized disease. This result should be interpreted with 308

extreme caution taking into account the limited number of individuals with localized disease 309

that were included in the study (n=12). However, Marty et al hinted to the potential existence 310

of an association between oral colonization by T. tenax and severity of periodontal disease, 311

thus, our observation might not appear as an unforeseen result (33, 47). Since the current 312

consensus is the belief that the role of microbial communities rather than single microbes are 313

implicated in the development of periodontal disease, it appears that the significant differences 314

observed in this study among different groups and for the two oral parasites is genuine and the 315

potential pathogenic roles of these oral parasites should be dissected continuously similar to 316

recent work by Bao et al (21, 55). 317

In the few studies that used the same molecular approach (conventional PCR), for identification 318

of oral parasites, a couple reported a prevalence of E. gingivalis that was consistent with our 319

results (34, 54, 56). Bonner et al reported a slightly lower prevalence of 33.3% for E. gingivalis 320

among healthy individuals whereas Garcia et al results were close at 48.6%. In the two other 321

remaining studies, E. gingivalis was not detected at all among healthy individuals, however, 322

these two studies suffered from two shortcomings. First, they used different sets of primers that 323

might resulted in missing some cases particularly those with possible low parasite loads. 324

Second, the two studies included smaller sample sizes (12 and 20 samples) (36, 53). For 325

periodontitis, results were available from three studies only, and the prevalence of E. gingivalis 326

ranged from 26.9% to 80.6% (34, 36, 54). Three studies that used PCR for the detection of T. 327

tenax, reported higher prevalence among individuals with periodontitis (39, 47, 57, 58). 328

However, the reported prevalence in these studies varied considerably (26.9% vs. 40.0% and 329

70.0%), which might be related to the differences in the study populations. Another explanation 330



https://doi.org/10.1101/2020.07.16.20155861


15

might be the presence of regional specificities in this type of colonization since we found a 331

statistically significant higher prevalence of T. tenax among the study subjects of non-Jordanian 332

countries of origin (all where from other MENA countries). 333

Analysis of different individual variables for possible association with increased likelihood of 334

harbouring the oral parasites was futile to say the least. Patterns in the whole population 335

differed when analysis was done by stratification into the three individual groups, and also no 336

specific patterns were consistently found in other studies (37, 58, 59). However, an interesting 337

observation that can be seen in this study is that colonization by oral parasites per se appeared 338

to be an independent risk factor for periodontal disease. Indirect indicators of a lower socio-339

economic status (low income and absence of previous dental care) appeared to have the most 340

obvious association with higher prevalence of oral parasites besides the increasing age 341

irrespective of the individual group (which might be related to an increased likelihood of 342

exposure). The known risk factors for periodontitis were not necessarily associated with higher 343

prevalence of oral parasites, which makes us inclined to propose that the presence of oral 344

parasites may not merely be a marker of the disease and might rather play a larger role that has 345

not been appreciated yet. 346

Limitations of the current work were inevitable and included difficulty in matching different 347

groups (health and disease), particularly for age and income levels, which precluded 348

conducting the study in a case-control type. The application of quantitative PCR could have 349

resolved association between the parasite load and periodontal disease, especially for E. 350

gingivalis, and this should be considered in any future work trying to link oral parasites in 351

health and disease, especially with availability of an experimentally validated protocol for such 352

an aim (60). Also, the strain variability particularly for E. gingivalis was not covered 353

completely in this work since we did not use the ST2 primers aimed at the detection of the 354

second currently known variant of E. gingivalis and this clear limitation should be considered 355



https://doi.org/10.1101/2020.07.16.20155861


16

by assessing the prevalence of the other strain in the future studies (42, 54, 56). For the negative 356

samples we did not rule out inhibition of PCR completely, which can make our results an 357

underestimation of the true prevalence. 358

To conclude, the higher prevalence of human oral parasites in periodontal disease compared to 359

healthy individuals appears to be more than a mere marker for the disease and might also be 360

associated with disease severity and potential for progression. Thus, the dogmatic view of these 361

oral parasites as commensals needs to be re-evaluated and their role cannot be neglected in 362

light of the results of this study that supplement the recent articles that pointed to similar links. 363

It is recommended to conduct future studies with the same molecular approach since the sole 364

use of microscopy can lead to significant underestimation of the true prevalence of these oral 365

parasites. Future studies are needed to assess the molecular epidemiology of these oral parasites 366

and to test whether variations in strains that do exist, have a significant contribution in health 367

and disease (61). Regional specificity for T. tenax appeared to be existent in Jordanian 368

population and other studies in different geographic locations with different living standards 369

might reveal if such specificity is genuine, or if it is only a spurious correlation involving an 370

underlying factor. 371

372

373

374

375

376

377

378



https://doi.org/10.1101/2020.07.16.20155861


17

Materials and Methods 379

Study design 380

The project was a prospective study with active enrolment of potential participants that took 381

place during July 2019 to December 2019 at Jordan University Hospital (JUH). We sought to 382

recruit study subjects from the following three categories: (1) Individuals with healthy gums 383

(will be referred to as “healthy group” in the rest of manuscript), (2) Individuals with gingivitis 384

(in this work, the term “gingivitis” will be applied to plaque‐induced gingivitis, rather than 385

non‐dental‐biofilm induced forms of gingivitis) and (3) individuals with periodontitis. The 386

individuals with gingivitis and those with periodontitis (the disease group) were recruited from 387

Periodontics Outpatient Clinics at JUH whereas healthy controls were recruited by active 388

approach of the JUH staff that included dentists, laboratory technicians, nurses and students at 389

the University of Jordan. 390

Study participants 391

Each healthy individual was included in the study if the following criteria were met altogether: 392

(1) Healthy gingiva on periodontal examination, (2) Bleeding index of less than 10%, and (3) 393

No previous history of periodontal diseases. The criteria for the individuals with gingivitis and 394

periodontitis were: (1) Diagnosis of the gum disease for the first time, and (2) No previous 395

history of exposure to any kind of periodontal therapy (scaling or root planing). The presence 396

of one of the following criteria resulted in non-inclusion of the potential participant in the study: 397

(1) Pregnant woman, (2) Previous history of periodontal treatment, (3) Non‐dental‐biofilm 398

induced forms of gingivitis, (4) Presence of dental implants, and (5) Orthodontics treatment. 399

Paper-based questionnaire on possible risk factors for periodontal disease 400

Data from the study participants were collected using a paper-based questionnaire that 401

comprised 17 different items (Supplementary File 1). The study participants’ data included: 402



https://doi.org/10.1101/2020.07.16.20155861


18

age, gender, body mass index (BMI), monthly income, and dental care level, history of 403

smoking, alcohol consumption, diabetes mellitus, family history of gum disease and 404

medications history. In addition, nine questions were used to assess the stress-related factors, 405

with each positive response given a single point yielding a stress score that ranged from nil to 406

nine. 407

Ethical considerations 408

This study was approved by the School of Medicine and the School of Graduate Studies, 409

University of Jordan. Ethical approval was obtained from the Institutional Review Board (IRB) 410

at JUH (Ref. No. 239/2019). A written and signed informed consent was obtained from all 411

individuals who agreed to participate in the study following full explanation of the study 412

objectives and the procedure of obtaining the samples. In addition, the work was conducted 413

according to the principles of good clinical practice that have their origin in the declaration of 414

Helsinki and all individual data were treated with confidentiality. 415

Classification of study subjects into healthy, gingivitis or periodontitis groups 416

The diagnosis of gingivitis and periodontitis was based on diagnostic guidelines that were set 417

by the 2018 new classification scheme for periodontal and peri-implant diseases and conditions 418

(11). The details are provided in (Supplementary File 2). 419

Specimen collection and microscopic examination 420

Salivary and dental plaque specimens were obtained from each study subject. Supra-gingival 421

plaque was removed then the sample was taken from the deepest periodontal pocket. Dental 422

plaque samples were collected using the UNC periodontal probe (15 mm). For participants 423

with furcation involvement, the sample was taken using Nabers probe from the furcation. For 424

each participant, the salivary and dental plaque specimens were mixed together in a sterile tube. 425

A single drop of the mixture was used for immediate wet mount examination using wide-field 426



https://doi.org/10.1101/2020.07.16.20155861


19

light microscopy, while the tubes were stored at −20ºC for DNA extraction and amplification. 427

For wet mount examination, the entire cover slip was inspected with 10× objective through a 428

zigzag path to ensure scanning the sample entirely and the suspicious objects (based mainly 429

the criteria defined by Bonner et al.) were examined at 40× objective (34). 430

DNA extraction and amplification 431

DNA purification was done using QIAamp DNA Mini Kit (QIAGEN) according to 432

manufacturer’s instructions. Briefly, the saliva/dental plaque specimens were brought to room 433

temperature and mixed well, followed by adding 20 μL of proteinase k to a total of 200 μL of 434

the specimen. If the specimen volume was less than 200 μL, we added a proper volume of 435

phosphate buffered saline to reach a final volume of 200 μL. This was followed by adding 200 436

μL of buffer AL to the sample/proteinase k and vortexing for until a homogenous solution was 437

formed. The mixture was then incubated at 56 °C for ten minutes. After that, 200 μL absolute 438

ethanol was added to the lysed sample a mixed by vortexing for 15 seconds followed by its 439

transfer into QIAamp Mini spin column. This was followed by centrifugation at 6000 × g for 440

one minute. Washing steps followed using buffers AW1 and AW2 and DNA elution was done 441

using 200 μL of buffer AE and centrifugation at 6000 × g for one minute. 442

For the detection of oral parasites, two sets of PCR primers were used. For E. gingivalis, we 443

used the same set of primers utilized by Bonner et al. with minor modification of the reverse 444

primer as follows: forward primer (5′-AGGAATGAACGGAACGTACA-3′) and reverse 445

primer (5′-CCATTTCCTTCTTCTATTGTTTMAC-3′) with a product size of 203 bases(34). 446

For T. tenax, we used the same set of primers utilized by Kikuta et al. as follows: PT3 forward 447

primer (5′-AGTTCCATCGATGCCATTC-3′) and PT7 reverse primer (5′-448

GCATCTAAGGACTTAGACG -3′) with product size of 776 bases (52). The PCR mix 449

comprised 5 μL of the DNA eluate, 5 μL of 5×FIREPol Master Mix (Solis BioDyne), 1 μL of 450

each primer and 13 μL of DNase/RNase free water. The steps of PCR were as follows: Initial 451



https://doi.org/10.1101/2020.07.16.20155861


20

denaturation for 3.5 minutes at 94°C, 40 cycles of 1 minute at 94°C for denaturation, 1 minute 452

at 60°C for primer annealing, 1 minute at 72°C for elongation, a final elongation step for 5 453

minutes at 72°C (34, 52, 62). 454

A volume of 6 µL of the final product was assessed using for 2% agarose gel electrophoresis 455

for evaluation of the DNA product sizes. Proper positive and negative extraction and PCR 456

controls were used to ensure the quality of DNA extraction and PCR and to rule out 457

contamination. Positive controls were taken from periodontitis patients who were positive for 458

E. gingivalis and T. tenax by microscopy and that yielded the correct band sizes, while the 459

negative control was nuclease-free water. The housekeeping gene actin beta (ACTB) with 460

accession number (NG_007992.1) was used to assess PCR inhibition of the sample and to 461

ensure the efficiency of the DNA extraction procedure with the following primers: forward 5’ 462

GTCCTGTGGCATCCACGAAA 3’ and reverse 5’ AGTGAGGACCCTGGATGTGAC 3’ 463

and PCR product size of 265 bases. 464

Statistical analysis 465

Data generated from the study were cleaned using Microsoft Excel and uploaded to IBM SPSS 466

Statistics 22.0 for Windows. Chi-squared test (χ2 test), Mann-Whitney (M-W), Kruskall-Wallis 467

(K-W) and linear-by-linear test for association (LBL) tests were used when appropriate and the 468

statistical significance was considered for p<0.050. To analyse the patterns associated with 469

higher likelihood of having periodontal disease as a whole and per disease state (gingivitis and 470

periodontitis), we conducted multinomial logistic regression analysis using variables that were 471

classified into dichotomous outcomes. Confidence intervals of percentages (95% CI) were 472

calculated using modified Wald method through GraphPad calculator available freely online 473

through the following link: https://www.graphpad.com/quickcalcs/ConfInterval1.cfm 474

475



https://www.graphpad.com/quickcalcs/ConfInterval1.cfm

https://doi.org/10.1101/2020.07.16.20155861


21

Acknowledgments 476

We would like to thank all the individuals who agreed to participate in the study. In addition, 477

we would like to thank the Staff of the Department of Dentistry and the Department of Clinical 478

Laboratories and Forensic Medicine at JUH for their help and support. Special thanks to Dr. 479

Omar Alkaradsheh, Dr. Nicola Barghout, Dr. Mais Al-Ashqar and Dr. Belal Al-Azab for 480

facilitating sample collection and laboratory work. 481

Competing interests 482

We declare that we have no competing interests nor conflicts of interests. 483

Funding 484

This study was supported by funding from the Deanship of Academic Research at the 485

University of Jordan with ref. No. (126/2019/19) granted on 30th January 2019. The Deanship 486

of Academic Research at the University of Jordan as the funding body, had no role in study 487

design, data collection and analysis, decision to publish, or preparation of the manuscript. 488

Author Contributions 489

Conceptualization: AY, AM, GÖŞ, JSR and MS 490

Funding acquisition: AM 491

Supervision: AM, JSR and MS 492

Data collection: AY, DD and DT 493

Sample collection: AY, DD and DT 494

Laboratory work: AY 495

Data analysis and interpretation: All authors 496

Statistical analysis: MS 497



https://doi.org/10.1101/2020.07.16.20155861


22

Prepared tables: MS 498

Writing - original draft: MS 499

Writing - review & editing: All authors 500

501

502

503

504

505

506



https://doi.org/10.1101/2020.07.16.20155861


23

References 507

1. Cho I, Blaser MJ. 2012. The human microbiome: at the interface of health and disease. 508

Nat Rev Genet 13:260-70. doi:10.1038/nrg3182. 509

2. Tsuji H, Matsuda K, Nomoto K. 2018. Counting the Countless: Bacterial Quantification 510

by Targeting rRNA Molecules to Explore the Human Gut Microbiota in Health and 511

Disease. Front Microbiol 9:1417. doi:10.3389/fmicb.2018.01417. 512

3. Siqueira JF, Jr., Rocas IN. 2017. The Oral Microbiota in Health and Disease: An 513

Overview of Molecular Findings. Methods Mol Biol 1537:127-138. doi:10.1007/978-514

1-4939-6685-1_7. 515

4. Lourenco TG, Heller D, Silva-Boghossian CM, Cotton SL, Paster BJ, Colombo AP. 516

2014. Microbial signature profiles of periodontally healthy and diseased patients. J Clin 517

Periodontol 41:1027-36. doi:10.1111/jcpe.12302. 518

5. Lamont RJ, Koo H, Hajishengallis G. 2018. The oral microbiota: dynamic communities 519

and host interactions. Nat Rev Microbiol 16:745-759. doi:10.1038/s41579-018-0089-520

x. 521

6. Kinane DF, Stathopoulou PG, Papapanou PN. 2017. Periodontal diseases. Nat Rev Dis 522

Primers 3:17038. doi:10.1038/nrdp.2017.38. 523

7. Darveau RP. 2010. Periodontitis: a polymicrobial disruption of host homeostasis. Nat 524

Rev Microbiol 8:481-90. doi:10.1038/nrmicro2337. 525



https://doi.org/10.1101/2020.07.16.20155861


24

8. Di Benedetto A, Gigante I, Colucci S, Grano M. 2013. Periodontal disease: linking the 526

primary inflammation to bone loss. Clin Dev Immunol 2013:503754. 527

doi:10.1155/2013/503754. 528

9. Kononen E, Gursoy M, Gursoy UK. 2019. Periodontitis: A Multifaceted Disease of 529

Tooth-Supporting Tissues. J Clin Med 8. doi:10.3390/jcm8081135. 530

10. Lang NP, Bartold PM. 2018. Periodontal health. J Periodontol 89 Suppl 1:S9-S16. 531

doi:10.1002/JPER.16-0517. 532

11. Caton JG, Armitage G, Berglundh T, Chapple ILC, Jepsen S, Kornman KS, Mealey 533

BL, Papapanou PN, Sanz M, Tonetti MS. 2018. A new classification scheme for 534

periodontal and peri-implant diseases and conditions - Introduction and key changes 535

from the 1999 classification. J Periodontol 89 Suppl 1:S1-S8. doi:10.1002/JPER.18-536

0157. 537

12. Trombelli L, Farina R, Silva CO, Tatakis DN. 2018. Plaque-induced gingivitis: Case 538

definition and diagnostic considerations. J Periodontol 89 Suppl 1:S46-S73. 539

doi:10.1002/JPER.17-0576. 540

13. American Academy of P. 2011. Comprehensive periodontal therapy: a statement by the 541

American Academy of Periodontology *. J Periodontol 82:943-9. 542

doi:10.1902/jop.2011.117001. 543



https://doi.org/10.1101/2020.07.16.20155861


25

14. Lertpimonchai A, Rattanasiri S, Arj-Ong Vallibhakara S, Attia J, Thakkinstian A. 2017. 544

The association between oral hygiene and periodontitis: a systematic review and meta-545

analysis. Int Dent J 67:332-343. doi:10.1111/idj.12317. 546

15. Zimmermann H, Zimmermann N, Hagenfeld D, Veile A, Kim TS, Becher H. 2015. Is 547

frequency of tooth brushing a risk factor for periodontitis? A systematic review and 548

meta-analysis. Community Dent Oral Epidemiol 43:116-27. doi:10.1111/cdoe.12126. 549

16. Tonetti MS, Jepsen S, Jin L, Otomo-Corgel J. 2017. Impact of the global burden of 550

periodontal diseases on health, nutrition and wellbeing of mankind: A call for global 551

action. J Clin Periodontol 44:456-462. doi:10.1111/jcpe.12732. 552

17. Jin LJ, Lamster IB, Greenspan JS, Pitts NB, Scully C, Warnakulasuriya S. 2016. Global 553

burden of oral diseases: emerging concepts, management and interplay with systemic 554

health. Oral Dis 22:609-19. doi:10.1111/odi.12428. 555

18. Eke PI, Dye BA, Wei L, Thornton-Evans GO, Genco RJ, Cdc Periodontal Disease 556

Surveillance workgroup: James Beck GDRP. 2012. Prevalence of periodontitis in 557

adults in the United States: 2009 and 2010. J Dent Res 91:914-20. 558

doi:10.1177/0022034512457373. 559

19. Nazir MA. 2017. Prevalence of periodontal disease, its association with systemic 560

diseases and prevention. Int J Health Sci (Qassim) 11:72-80. 561



https://doi.org/10.1101/2020.07.16.20155861


26

20. Griffin SO, Jones JA, Brunson D, Griffin PM, Bailey WD. 2012. Burden of oral disease 562

among older adults and implications for public health priorities. Am J Public Health 563

102:411-8. doi:10.2105/AJPH.2011.300362. 564

21. Mira A, Simon-Soro A, Curtis MA. 2017. Role of microbial communities in the 565

pathogenesis of periodontal diseases and caries. J Clin Periodontol 44 Suppl 18:S23-566

S38. doi:10.1111/jcpe.12671. 567

22. Sudhakara P, Gupta A, Bhardwaj A, Wilson A. 2018. Oral Dysbiotic Communities and 568

Their Implications in Systemic Diseases. Dent J (Basel) 6. doi:10.3390/dj6020010. 569

23. Hajishengallis G. 2015. Periodontitis: from microbial immune subversion to systemic 570

inflammation. Nat Rev Immunol 15:30-44. doi:10.1038/nri3785. 571

24. Van Dyke TE, Sheilesh D. 2005. Risk factors for periodontitis. J Int Acad Periodontol 572

7:3-7. 573

25. Masumoto R, Kitagaki J, Fujihara C, Matsumoto M, Miyauchi S, Asano Y, Imai A, 574

Kobayashi K, Nakaya A, Yamashita M, Yamada S, Kitamura M, Murakami S. 2019. 575

Identification of genetic risk factors of aggressive periodontitis using genomewide 576

association studies in association with those of chronic periodontitis. J Periodontal Res 577

54:199-206. doi:10.1111/jre.12620. 578

26. Reynolds MA. 2014. Modifiable risk factors in periodontitis: at the intersection of aging 579

and disease. Periodontol 2000 64:7-19. doi:10.1111/prd.12047. 580



https://doi.org/10.1101/2020.07.16.20155861


27

27. Wang CJ, McCauley LK. 2016. Osteoporosis and Periodontitis. Curr Osteoporos Rep 581

14:284-291. doi:10.1007/s11914-016-0330-3. 582

28. Liu F, Wen YF, Zhou Y, Lei G, Guo QY, Dang YH. 2018. A meta-analysis of emotional 583

disorders as possible risk factors for chronic periodontitis. Medicine (Baltimore) 584

97:e11434. doi:10.1097/MD.0000000000011434. 585

29. Koo HS, Hong SM. 2018. Prevalence and Risk Factors for Periodontitis Among 586

Patients with Metabolic Syndrome. Metab Syndr Relat Disord 16:375-381. 587

doi:10.1089/met.2018.0003. 588

30. Hong M, Kim HY, Seok H, Yeo CD, Kim YS, Song JY, Lee YB, Lee DH, Lee JI, Lee 589

TK, Ahn HS, Ko YH, Jeong SC, Chae HS, Sohn TS. 2016. Prevalence and risk factors 590

of periodontitis among adults with or without diabetes mellitus. Korean J Intern Med 591

31:910-9. doi:10.3904/kjim.2016.031. 592

31. Borojevic T. 2012. Smoking and periodontal disease. Mater Sociomed 24:274-6. 593

doi:10.5455/msm.2012.24.274-276. 594

32. Bonner M, Fresno M, Girones N, Guillen N, Santi-Rocca J. 2018. Reassessing the Role 595

of Entamoeba gingivalis in Periodontitis. Front Cell Infect Microbiol 8:379. 596

doi:10.3389/fcimb.2018.00379. 597

33. Marty M, Lemaitre M, Kemoun P, Morrier JJ, Monsarrat P. 2017. Trichomonas tenax 598

and periodontal diseases: a concise review. Parasitology 144:1417-1425. 599

doi:10.1017/S0031182017000701. 600



https://doi.org/10.1101/2020.07.16.20155861


28

34. Bonner M, Amard V, Bar-Pinatel C, Charpentier F, Chatard JM, Desmuyck Y, Ihler S, 601

Rochet JP, Roux de La Tribouille V, Saladin L, Verdy M, Girones N, Fresno M, Santi-602

Rocca J. 2014. Detection of the amoeba Entamoeba gingivalis in periodontal pockets. 603

Parasite 21:30. doi:10.1051/parasite/2014029. 604

35. Ghabanchi J, Zibaei M, Afkar MD, Sarbazie AH. 2010. Prevalence of oral Entamoeba 605

gingivalis and Trichomonas tenax in patients with periodontal disease and healthy 606

population in Shiraz, southern Iran. Indian J Dent Res 21:89-91. doi:10.4103/0970-607

9290.62821. 608

36. Trim RD, Skinner MA, Farone MB, Dubois JD, Newsome AL. 2011. Use of PCR to 609

detect Entamoeba gingivalis in diseased gingival pockets and demonstrate its absence 610

in healthy gingival sites. Parasitol Res 109:857-64. doi:10.1007/s00436-011-2312-9. 611

37. Ibrahim S, Abbas R. 2012. Evaluation of Entamoeba gingivalis and Trichomonas tenax 612

in patients with periodontitis and gingivitis and its correlation with some risk factors. 613

Journal of baghdad college of dentistry 24:158-162. 614

38. Hassan SS, Madkour GG, Henin RW, Gad SWF, El-Aal AAA. 2019. Is Entamoeba 615

Gingivalis a Risk Factor for Periodontal Diseases? A Case-Control Study. Perio J 3:18-616

28. 617

39. Athari A, Soghandi L, Haghighi A, Kazemi B. 2007. Prevalence of oral trichomoniasis 618

in patients with periodontitis and gingivitis using PCR and direct smear. Iranian Journal 619

of Public Health:33-37. 620



https://doi.org/10.1101/2020.07.16.20155861


29

40. Al-hamiary AK, Kezar MY, Al-Khafaji YA. 2011. Prevalence of Oral Protozoa in 621

Periodontitis and Gingivitis Patients Whose Attended to Clinics Periodontics, Dentistry 622

College\Babylon Univ. IASJ 3:179-184. 623

41. Yazar S, Cetinkaya U, Hamamci B, Alkan A, Sisman Y, Esen C, Kolay M. 2016. 624

Investigation of Entamoeba gingivalis and Trichomonas tenax in Periodontitis or 625

Gingivitis Patients in Kayseri. Turkiye Parazitol Derg 40:17-21. 626

doi:10.5152/tpd.2016.4351. 627

42. Garcia G, Ramos F, Martinez-Hernandez F, Hernandez L, Yanez J, Gaytan P. 2018. A 628

new subtype of Entamoeba gingivalis: "E. gingivalis ST2, kamaktli variant". Parasitol 629

Res 117:1277-1284. doi:10.1007/s00436-018-5798-6. 630

43. Julien Santi-Rocca. 2020. The Protozoome of the Periodontal Sulcus: From Health to 631

Disease.,, p pp 113-131. In Nancy Guillen. (ed), Eukaryome Impact on Human Intestine 632

Homeostasis and Mucosal Immunology, doi:https://doi.org/10.1007/978-3-030-44826-633

4_9. Springer, Cham. 634

44. Cekici A, Kantarci A, Hasturk H, Van Dyke TE. 2014. Inflammatory and immune 635

pathways in the pathogenesis of periodontal disease. Periodontol 2000 64:57-80. 636

doi:10.1111/prd.12002. 637

45. Teles R, Teles F, Frias-Lopez J, Paster B, Haffajee A. 2013. Lessons learned and 638

unlearned in periodontal microbiology. Periodontol 2000 62:95-162. 639

doi:10.1111/prd.12010. 640



https://doi.org/10.1101/2020.07.16.20155861


30

46. Deng ZL, Szafranski SP, Jarek M, Bhuju S, Wagner-Dobler I. 2017. Dysbiosis in 641

chronic periodontitis: Key microbial players and interactions with the human host. Sci 642

Rep 7:3703. doi:10.1038/s41598-017-03804-8. 643

47. Bisson C, Dridi SM, Machouart M. 2019. Assessment of the role of Trichomonas tenax 644

in the etiopathogenesis of human periodontitis: A systematic review. PLoS One 645

14:e0226266. doi:10.1371/journal.pone.0226266. 646

48. Ismail KA, Jastaniyyah MA, Al-Nemari NA, Al-Ghamdi HM, Al-Hamed RA. 2017. 647

Detection of Trichomonas tenax (T. tenax) in bad oral hygiene Saudi patients in Taif 648

city. International Educational Applied Scientific Research Journal 2. 649

49. el Hayawan IA, Bayoumy MM. 1992. The prevalence of Entamoeba gingivalis and 650

Trichomonas tenax in periodontal disease. J Egypt Soc Parasitol 22:101-5. 651

50. Rashidi Maybodi F, Haerian Ardakani A, Fattahi Bafghi A, Haerian Ardakani A, 652

Zafarbakhsh A. 2016. The Effect of Nonsurgical Periodontal Therapy on Trichomonas 653

Tenax and Entamoeba Gingivalis in Patients with Chronic Periodontitis. J Dent (Shiraz) 654

17:171-6. 655

51. Schrader C, Schielke A, Ellerbroek L, Johne R. 2012. PCR inhibitors - occurrence, 656

properties and removal. J Appl Microbiol 113:1014-26. doi:10.1111/j.1365-657

2672.2012.05384.x. 658



https://doi.org/10.1101/2020.07.16.20155861


31

52. Kikuta N, Yamamoto A, Fukura K, Goto N. 1997. Specific and sensitive detection of 659

Trichomonas tenax by the polymerase chain reaction. Lett Appl Microbiol 24:193-7. 660

doi:10.1046/j.1472-765x.1997.00379.x. 661

53. Kikuta N, Yamamoto A, Goto N. 1996. Detection and identification of Entamoeba 662

gingivalis by specific amplification of rRNA gene. Can J Microbiol 42:1248-51. 663

doi:10.1139/m96-161. 664

54. Garcia G, Ramos F, Maldonado J, Fernandez A, Yanez J, Hernandez L, Gaytan P. 2018. 665

Prevalence of two Entamoeba gingivalis ST1 and ST2-kamaktli subtypes in the human 666

oral cavity under various conditions. Parasitol Res 117:2941-2948. 667

doi:10.1007/s00436-018-5990-8. 668

55. Bao X, Wiehe R, Dommisch H, Schaefer AS. 2020. Entamoeba gingivalis Causes Oral 669

Inflammation and Tissue Destruction. J Dent Res 670

doi:10.1177/0022034520901738:22034520901738. doi:10.1177/0022034520901738. 671

56. Dubar M, Zaffino ML, Remen T, Thilly N, Cunat L, Machouart MC, Bisson C. 2020. 672

Protozoans in subgingival biofilm: clinical and bacterial associated factors and impact 673

of scaling and root planing treatment. J Oral Microbiol 12:1693222. 674

doi:10.1080/20002297.2019.1693222. 675

57. Mehr AK, Zarandi A, Anush K. 2015. Prevalence of Oral Trichomonas tenax in 676

Periodontal Lesions of Down Syndrome in Tabriz, Iran. J Clin Diagn Res 9:ZC88-90. 677

doi:10.7860/JCDR/2015/14725.6238. 678



https://doi.org/10.1101/2020.07.16.20155861


32

58. Bracamonte-Wolf C, Orrego PR, Munoz C, Herrera D, Bravo J, Gonzalez J, Varela H, 679

Catalan A, Araya JE. 2019. Observational cross-sectional study of Trichomonas tenax 680

in patients with periodontal disease attending a Chilean university dental clinic. BMC 681

Oral Health 19:207. doi:10.1186/s12903-019-0885-3. 682

59. Albuquerque Júnior RLCd, Melo CMd, Santana WAd, Ribeiro JL, Silva FA. 2011. 683

Incidence of Entamoeba gingivalis and Trichomonas tenax in samples of dental biofilm 684

and saliva from patients with periodontal disease. RGO Revista Gaúcha de Odontologia 685

(Online) 59:35-40. 686

60. Zaffino M, Dubar M, Debourgogne A, Bisson C, Machouart M. 2019. Development of 687

a new TaqMan PCR assay for the detection of both Entamoeba gingivalis genotypes. 688

Diagn Microbiol Infect Dis 95:114886. doi:10.1016/j.diagmicrobio.2019.114886. 689

61. Cembranelli SB, Souto FO, Ferreira-Paim K, Richinho TT, Nunes PL, Nascentes GA, 690

Ferreira TB, Correia D, Lages-Silva E. 2013. First evidence of genetic intraspecific 691

variability and occurrence of Entamoeba gingivalis in HIV(+)/AIDS. PLoS One 692

8:e82864. doi:10.1371/journal.pone.0082864. 693

62. Kucknoor AS, Mundodi V, Alderete J. 2009. Genetic identity and differential gene 694

expression between Trichomonas vaginalis and Trichomonas tenax. BMC Microbiol 695

9:58. doi:10.1186/1471-2180-9-58. 696

697

698



https://doi.org/10.1101/2020.07.16.20155861


Table 1. Characteristics of the study population divided by the three study groups

Individual group Healthy Gingivitis Periodontitis P-value

6

Characteristic N5 (%) N (%) N (%)

94 (39.7) 53 (22.4) 90 (38.0)

Median age in years (SD1) 24 (13.5) 36 (14.5) 48 (10.9) <0.001

Gender

Male 40 (42.6) 29 (54.7) 53 (58.9) 0.075

Female 54 (57.4) 24 (45.3) 37 (41.1)

Nationality

Jordanian 88 (93.6) 48 (90.6) 86 (95.6) 0.498

Non-Jordanian 6 (6.4) 5 (9.4) 4 (4.4)

Alcohol consumption

Yes 5 (5.3) 1 (1.9) 2 (2.2) 0.921

No 89 (94.7) 52 (98.1) 88 (97.8)

Smoking

Non-smoker 63 (67.0) 26 (49.1) 42 (46.7)

0.012 Smoker 30 (31.9) 27 (50.9) 45 (50.0)

Ex-smoker 1 (1.1) 0 3 (3.3)

Income

Less than 500 JD2

15 (16.0) 29 (55.8) 70 (77.8)

<0.001 500-1000 JD 36 (38.3) 17 (32.7) 19 (21.1)

More than 1000 JD 43 (45.7) 6 (11.5) 1 (1.1)

Dental care level

None 23 (24.5) 37 (71.2) 71 (78.9)

<0.001 Annual inspection 6 (6.4) 4 (7.7) 3 (3.3)

Regular monitoring and 33 (35.1) 3 (5.8) 4 (4.4)



https://doi.org/10.1101/2020.07.16.20155861


Irregular monitoring and 32 (34.0) 8 (15.4) 12 (13.3)

BMI3

Less than 20 9 (9.7) 6 (11.3) 6 (6.7)

0.003 20-25 41 (44.1) 21 (39.6) 22 (24.7)

25-30 25 (26.9) 17 (32.1) 29 (32.6)

More than 30 18 (19.4) 9 (17.0) 32 (36.0)

Osteoporosis

Yes 4 (4.3) 6 (11.5) 7 (8.1) 0.271

No 88 (95.7) 46 (88.5) 79 (91.9)

Diabetes4

No 80 (85.1) 50 (94.3) 76 (84.4)

0.194 Yes, latest HbA1c ≤ 7.0 12 (12.8) 2 (3.8) 9 (10.0)

Yes, latest HbA1c > 7.0 2 (2.1) 1 (1.9) 5 (5.6)

1SD: Standard deviation,

2JD: Jordanian Dinar,

3BMI: Body mass index,

4HbA1c:

Glycosylated hemoglobin levels to estimate glycemic control, 5N: Number,

6P-value:

Calculated using Kruskal Wallis test.



https://doi.org/10.1101/2020.07.16.20155861


Table 2. Potential risk factors for periodontal disease upon comparing the healthy individuals

vs. those with periodontal disease (gingivitis or periodontitis)

Potential risk factors for periodontal disease

vs. healthy individuals

P value9

OR10

95% CI11

Entamoeba gingivalis by PCR (positive vs.

negative)1

<0.001 5.84 2.18-15.66

Monthly income (less than 500 JD vs. more

than or equal to 500 JD)2

<0.001 5.43 2.18-13.50

Dental care (no dental care vs. any form of

dental care)

0.001 4.45 1.89-10.50

Subjective evaluation of stress (more stressed

vs. less stressed)3

0.006 3.87 1.47-10.20

Trichomonas tenax by PCR (positive vs.

negative)

0.077 4.05 0.86-19.07

Age (more than 38 years vs. less than or equal to

38 years)4

0.180 2.01 0.73-5.54

Osteoporosis (present vs. absent) 0.466 1.90 0.34-10.63

Smoking (smoker vs. non-smoker)5

0.181 1.82 0.76-4.38

Gender (male vs. female) 0.461 1.40 0.57-3.47

Family history (present vs. absent) 0.656 1.25 0.48-3.26

Nationality (Jordanian vs. Non-Jordanian) 0.904 1.13 0.17-7.67



https://doi.org/10.1101/2020.07.16.20155861


BMI (more than or equal to 25 vs. less than 25)6

0.754 0.86 0.35-2.16

Alcohol use (consumer vs. non-consumer)7 0.395 0.35 0.03-3.87

DM (controlled or non-controlled DM vs. non-

diabetic)8

0.053 0.26 0.07-1.02

1PCR: Conventional polymerase chain reaction,


3Subjective evaluation

of stress: using a nine-item questionnaire, 4Age: The median age for the entire study

population was 38 years, 5Smoking: Ex-smokers were excluded from analysis (n=4),

6BMI:

Body mass index, 7Alcohol use: Ex-users of alcohol were excluded from analysis (n=3),

8DM: Diabetes mellitus. Significant results are shown in bold,

9P-value: Calculated using

multinomial logistic regression and likelihood ratio tests, 10

OR: Odds ratio, 11

CI: Confidence

interval.



https://doi.org/10.1101/2020.07.16.20155861


Table 3. Risk factors for gingivitis and compared to healthy individuals in the current

study population

Potential risk factors for gingivitis vs. healthy

individuals

P value9

OR10

95% CI11


dental care)

0.001 5.78 2.13-15.70


negative)1

0.002 5.79 1.86-18.02



0.010 3.87 1.39-10.84


diabetic)3

0.078 0.21 0.04-1.19

Subjective evaluation of stress (more stressed vs.

less stressed)4

0.115 2.38 0.81-6.97


Smoking (smoker vs. non-smoker)5

0.311 1.66 0.62-4.40


Alcohol use (consumer vs. non-consumer)6

0.452 0.38 0.03-4.69


0.528 0.73 0.27-1.97


Age (more than 38 years vs. less than or equal to

38 years)8

0.798 0.86 0.27-2.76



https://doi.org/10.1101/2020.07.16.20155861



negative)

0.903 0.88 0.11-7.11


1PCR: Conventional polymerase chain reaction,


3DM: Diabetes

mellitus, 4

Subjective evaluation of stress: using a nine-item questionnaire, 5Smoking: Ex-

smokers were excluded from analysis (n=4), 6Alcohol use: Ex-users of alcohol were excluded

from analysis (n=3), 7BMI: Body mass index,

8Age: The median age for the entire study

population was 38 years. Significant results are shown in bold, 9P-value: Calculated using

multinomial logistic regression and likelihood ratio tests, 10

OR: Odds ratio, 11

CI: Confidence

interval.



https://doi.org/10.1101/2020.07.16.20155861


Table 4. Risk factors for periodontitis and compared to healthy individuals in the

current study population.

Potential risk factors for periodontitis vs.

healthy individuals

P value1

OR2

95% CI3



<0.001 7.70 2.65-22.33

Subjective evaluation of stress (more stressed

vs. less stressed)5

0.001 6.36 2.12-19.14


negative)6

0.007 5.21 1.58-17.25


negative)

0.009 10.09 1.77-57.53

Age (more than 38 years vs. less than or equal

to 38 years)7

0.011 4.43 1.40-14.05


dental care)

0.014 3.68 1.30-10.40


diabetic)8

0.102 0.28 0.06-1.29

Smoking (smoker vs. non-smoker)9 0.162 2.09 0.74-5.87


Alcohol use (consumer vs. non-consumer)10

0.416 0.17 0.01-12.59





https://doi.org/10.1101/2020.07.16.20155861



0.917 1.06 0.37-3.06


1P-value: Calculated using multinomial logistic regression and likelihood ratio tests,

2OR:

Odds ratio, 3CI: Confidence interval,


5Subjective evaluation of stress:

using a nine-item questionnaire, 6PCR: Conventional polymerase chain reaction,

7Age: The

median age for the entire study population was 38 years, 8DM: Diabetes mellitus,

9Smoking:

Ex-smokers were excluded from analysis (n=4), 10

Alcohol use: Ex-users of alcohol were

excluded from analysis (n=3), 11

BMI: Body mass index. Significant results are shown in

bold.



https://doi.org/10.1101/2020.07.16.20155861


oral colonization by entamoeba gingivalis and trichomonas … · 2020. 7. 16. · 3 44 abstract 45...

Documents