THE JOURNAL OP BIOLOGICAL CHEMRTRY @ 1989 by The American Society for Biochemistry and M01ecu)ar Biology, Inc.

Val. 264, No. 11, Issue of April 15, pp. 6214-6219.1989 Printed in U.S.A.

Structural Requirements of the RNA Precursor for the Biosynthesis of the Branched RNA-linked Multicopy Single-stranded DNA of Myxacuccu~ xanthus”

(Received for publication, November 2,1988)

Mei-Yin Hsu, Sumiko Xnouye, and Masayori Xnouye From the DeDartment of Biochemistm, Robert Wood Johnson Medical School at Rutgers, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854

A precursor RNA molecule (pre-msdRNA} of approx- imately 375 bases is considered to form a stable see- ondary structure which serves as a primer as well as a template to synthesize the branched RNA-linked mul- ticopy single-stranded DNA (msDNAf of Myxococcr68 xanthus. When %base mismatches were introduced into the stem structure immediately upstream of the branched rG residue to which msDNA is linked by a 2’,5‘-phosphodiester linkage, the production of msDNA was almost completely blocked. However, if additional $-base substitutions were made on the other strand to resume the complementary base pairing, msDNA production was restored, being consistent with the proposed model of msDNA synthesis. We also found that the branched rG residue of pre-msdRNA could not be replaced with either rC or rA, while the 5’ end (de) of msDNA which is linked to the branched rG could be substituted with a dG residue. Together with several other mutations, the structural requirements of pre- msdRNA are discussed with respect to the meehanism of msDNA biosynthesis

Myxococcus xant-hus, a myxobacterium, contains a novel satellite DNA called msDNA’ ~multicopy single-stranded DNA (Yee et al., 1984)). We have shown that msDNA is wideiy distributed among various myxobacteria as a complex with RNA (Dhundale et al., 1985) and that it exists at a level of 500-700 copies/cell in both Stigmatella aurantiaca (Furui- chi et al., 1987a, 1987b) and M. xanthus (Dhundale et ai., 1987). These msDNAs consist of single-stranded DNA of 163 and 162 bases for S. aurantiaca and M. xanthus, respectively. In addition, they are covalently linked at their 5’ ends to a branched RNA (msdRNA) of 76 and 77 bases, respectively, by a 2’,5’-phosphodiester linkage at the 2’ position of the 19th and 20th rG residue, respectively (Furuiehi et ai., 1987a, 198% Dhundale et ai., 1987).

We have found that msdRNA is derived from a much longer precursor molecule (pre-msdRNA) which is likely to form a stable stem-and-loop structure (Dhundale et at., 1987). We have proposed a novel mechanism for msDNA synthesis in which the stem-and-loop structure serves as a primer as well as a template to form the branched RNA-linked msDNA. In this work, we attempted to prove the model by creating various

*This work was supported by Public Wealth Service Grant GM26843. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact,. ’ The abbreviations used are: msDNA, multicopy single-stranded DNA; kb, kilobase pair(s).

____l-

muta~ons in the pre-msdRNA structure. We found that base mismatches in the stem structure immediately upstream of the branched rG residue almost completely blocked msDNA synthesis, being consistent with the proposed model. We also found that the branched rG residue is essential, whereas the 5’ end dC residue of msDNA can be replaced with another residue. Together with several other mutations, the structural requirements of pre-msdRNA are discussed with respect to the mechanism of msDNA synthesis.

EXPERIMENTAL PROCEDURES

rich& coliC6W ( ~ a c ~ m a n n , 1972),3M83 (Vieira and Messing, 1982), Bacterial Strain, Culture Media, and PI T r a ~ ~ u c t i o n - E s c ~ -

and JA221/PIcIrlOOCM (Miller, 1972) were used. These E. coli cells harboring plasmids were grown in L-broth (Miller, 1972) with the addition of appropriate antibiotics. M. xanthus DZFl was grown in CYE medium (Campos et al., 1978) a t 30 “C and M. ranthus MI112 in CYE with streptomycin (200~g/ml). M. xanthua MI112-transduced PI phage carrying the wild type or mutated msd-msr region was grown in CYE with streptomycin (200 pg/ml) plus kanamycin sulfate (50 gg/ml). P1 transduction was performed as described by Avery and Kaiser (1983). Screening for the deletion mutations for the msd- msr region and for site-specific recombinants between the attB and attP sites was performed as described by Teintze et al. (1988).

Plasmid Construction and DNA Manipulation-DNA manipula- tions were performed as described by Maniatis et at. (1982). Plasmid pMYll2 (Fig. M f consists of the 5.4-kb P1 incompatibility region, the 17.5-kb Sall fragment (Yee et al., 1984) in which the 2.5-kb SmaI- BamHI fragment was replaced with 2.3-kb fragment containing the strep~mycin-resistant gene (Furuichi et al., 1984) in pUCl9 (Vieira and Messing, 1982). By P1 transduction, pMY112 was introduced into M. zanthw D m 1 to obtain strain MI112 (stf msd+ msr+).

In order to reintroduce the wild type or a mutated msd-msr region into strain MI112, plasmid pMXlO1 (Fig. 18) was constructed as follows: the 2.95-kb SmaI fragment carrying the attP site from MX- 8 (Orndorff et al., 1983) and a 1.5-kb RNA fragment containing the gene for kanamycin resistance from Tn5 (Beck et at., 1982) were first cloned in pPlincEk (Shimkets et al., 1983). After treatment with the Klenow enzyme, the blunt-ended 5.0-kb Sari-BarnHI fragment en- compassing the msd-msr region was cloned into the H i d 1 site of pUC7 and resulting plasmid was designated as pMSSB (see Fig. 1B). Various md-nsr mutations were isolated by oligonucleotide-directed site-specific mutagenesis (Inouye and Inouye, 1987) using pMSSB. Oligonucleot~des used for site-specific mutagenesis are listed in Table I. After mutagenesis, the 5.0-kb fragment encompassing the msd-msr region was excised by EcoRI and inserted into the unique EcoRI site of pMX101. The resulting plasmid was introduced into strain MI112 by PI transduction, and the plasmid DNA was inserted at the attB site by site-specific recombination between the attB and attP sites. The insertion of the plasmid DNA at the attB site was confirmed by Southern blot hybridization (Southern, 1975). The analysis revealed that in all cases only one copy of the plasmid was introduced into the chromosome (data not shown). msDNAs were prepared by the method of Birnboim and Doly (1979) developed for plasmid DNA preparation.

RNA Isolation and Primer Extension-Total RNA was prepared from a 10-ml culture by the method described by Maniatis et ai. (1982). A synthetic oligonucleotide, 5 ’ - C A C T C C ~ G A C ~ T C T C T ~ G ~

6214

Structural Requirements for mDNA Biosynthesis 6215

P 1 inc

B

PI inc

EcoRl

str‘

MXR-attP

I EcoRl EcoRI

MXS-attP

FIG. 1. Structures of plasmids used. A, structure of pMY112. The apen region, the hatched region, the dotted region, and the cross- hatched region represent: pUCI9 DNA, Plinc DNA, the M. xanthus DNA fragment encompassing the msd-msr region, and the gene for streptomycin resistance, respectively. The msd-msr region was re- pIaced with the DNA fragment containing the gene for streptomycin resistance (stf). B, the structures of pMXlOl and pMS001. The open region, the hatched region, the dotted region, and the cross-hatched region represent pUCI9 DNA, Plinc DNA, the M. xanthus DNA containing the at tP site for myxophage MX8, and the gene for kanamycin resistance from Tn5, respectively. In pMS001, the 5-kb EcoRI fragment containing the wild type msd-msr region was inserted into the unique EcoRI site of pMX101.

3’, which corresponds to the sequence complementary to the sequence from residue 73 to 90 of the RNA sequence in Fig. 2 was labeled with [-p3’P]ATP at the 5’ end by using T4 polynucleotide kinase. The labeled oligonucleotide was then used for the primer extension using total RNA preparations as template. The primer extension reaction was performed with the use of avian myeloblastosis virus reverse transcriptase as described by Shelness and Williams (1984), and the sample was loaded to a sequencing gel to estimate the level of pre- msdRNA production.

Materials-Restriction enzymes were from Boehringer Mannheim or New England BioLabs. T4 DNA ligase was from Bethesda Re- search Laboratory. T4 polynucleotide kinase and avian myeloblasto- sis virus reverse transcriptase were from Boehringer Mannheim. Bacterial alkaline phosphatase was from Worthington. Antibiotics

TABLE I List of oligonucleotides used for mutagenesis

ms-11: 5’-GCACCACGATCTTACC ms-12 5”GGGAAAGCAAGTCCATCTTAC

16-mer

ms-13: 5”CGGAGTGCAAGTGCCTGAGCG 21-mer

ms-14: 5”GTGCATCAACCTGAGCG 21-mer

ms-15: 5”GTGCATCACCCTGAGCG 17-mer 17-mer

ms-16: 5’-AAAGCACCAGCCTCCATCTTAC 22-mer ms-xbal: 5’-CCGGCTCTAGACTCCTAGG ms-xba3: 5”GGAGAGAGTCTAGAACAGG“

19-mer 19-mer

By using this oligonucleotide, an XbaI site was introduced within the msd region as shown in Fig. 2. However, this site does not completely match with the sequence of the oligonucleotide. The reason for this unexpected XbaI site is not known at present.

were from Sigma. All nucleotides were from Boehringer Mannheim, and [ C Y - ~ ~ P J ~ C T P and [y-32P]ATP were from Amersham Corp.

RESULTS AND DISCUSSION

Base Mismatches Immediately Upstream of the Branched rG Residue-In our proposed model for msDNA biosynthesis, the precursor RNA molecule for msdRNA (pre-msdRNA con- sisting of approximately 375 bases) forms a stable secondary structure as shown in Fig. 2 (Dhundale et al., 1987). In this model, msDNA synthesis is initiated from the 2‘ position of the rG residue at position 96 (circled in Fig. 2), immediately after the first stem (stem a), and proceeds along the other strand as a template by an enzyme having reverse transcrip- tase activity. The single-stranded DNA synthesis starts from position 307 and continues into the second RNA stem struc- ture (stern b) . It stops at position 146,9 bases before the stable stem-and-loop structure I1 within the central bulge forming msDNA of 162 bases (from the solid triangle at the opposite side of the branched rG residue to the other solid triangle in Fig. 2). During or after msDNA synthesis, pre-msdRNA is processed and cleaved at the sites indicated by open triangles (see Fig. 2), leaving msdRNA of 77 bases attached to the 5‘ end of msDNA at the 20th branched rG by a 2‘,5’-phospho- diester linkage.

To prove this model, we examined the effects of base mismatches in the first stem structure (stem a) on the syn- thesis for msDNA. For this purpose, the msd-msr region was mutated in such a way as to introduce 3-base mismatches immediately upstream of the branched rG residue in the secondary structure of pre-msdRNA. Oligonucleotide-di- rected, site-specific mutagenesis using double-stranded plas- mid DNA (Inouye and Inouye, 1987) was carried out on a plasmid DNA harboring the msd-msr region. After confirming the mutation by DNA sequencing, the mutatedDNA fragment was reintegrated back to the M. xanthus chromosome. This procedure is briefly summarized in Fig. 3. First, a msd-msr deletion strain of M. xanthus (Amsd Amsr) was constructed by replacing the 2.5-kb msd-msr region of the chromosome with a 2.3-kb streptomycin resistance gene as described under “Experimental Procedures.” The deletion of the msd-msr region was confirmed by Southern blot hybridization (South- ern, 1975), and the newly constructed streptomycin-resistant strain was designated as strain MI112. In the next step, a DNA fragment containing the wild type msd-msr region or a mutated msd-msr region was reintegrated back into the chro- mosomal DNA of strain MI112 (see Fig. 3). In this case, the DNA fragment contains not only the msd-msr region but also the 2.95-kb attachment site (attP) of myxophage MX8 (Orn- dorff et al., 1983) and a gene for kanamycin resistance. When these plasmids were introduced into the strain MI112 by P1 transduction (Shimkets et al., 1983), the DNA fragment was integrated into the chromosome by site-specific recombina- tion between attP and attB (bacterial counterpart for attP,

6216 Structural Requirements for m D N A Biosynthesis I1

3 ’ a b

FIG. 2. Secondary structure of pre-msdRNA. The secondary structure was proposed previously (Dhundale et al., 1987). Nucleotides are numbered from the 5‘ end of pre-msdRNA as determined previously (Dhundale et al., 1987). The branched rG residue at position 96 is circled. The first stem structure is designated as stern a and the second stem as stem b. Open triangles indicate the sites where the RNA is cleaved after msDNA synthesis. Solid triangles indicate the initiation site (residue 307) and the termination site (residue 146) for msDNA synthesis.

FIG. 3. Procedure for the con- struction of mutants of msDNA syn- thesis. Plasmid pMY112 was con- structed as described under “Experimen- tal Procedures” and is shown in Fig. lA. It contains the 17.5-kb SalI fragment from the M. ranthus chromosome from which the msd-msr region was replaced with a gene for streptomycin resistance. Plasmid pMY112 DNA is introduced into the wild type M. ranthus cells (strain DZF1) by P1 transduction, and as a result of double crossing-over be- tween homologous regions at both sides of the str gene, a deletion mutant of the msd-msr region (strain MI112 str+ Amsd Amsr) is constructed. In the next step, plasmid pMSOO1 (Fig. 1B) is introduced into strain MI112 by P1 transduction. This plasmid contains a gene for kana- mycin resistance, the attP site (the at- tachment site from myxophage MX8) and a wild type msd-msr region. This plasmid DNA is integrated into the chro- mosomal DNA of strain MI112 by site- specific recombination between attP and attB (the chromosomal counterpart for attP). This results in the construction of a new strain, which is str’ kan’ msd+ msr’. This procedure is also carried out for pMSOOl harboring mutations in the

plasmid pMSOOl is described under “Ex- msd-msr region. The construction of

perimental Procedures” and in Fig. 1B.

pMY112 plasmid DNA

f msr

attB

P1 transduction - double crossing-over

an6

pMSOOl kan - .1 msd

P1 transduction - sitespecific recombination

str

msd - msr J Teintz et al., 1988). Such strains were screened for kanamycin resistance, and the existence of the msd-msr region was then confirmed by Southern blot hybridization (see the detailed procedure under “Experimental Procedures”).

The 3-base mismatch mutations immediately upstream of the branched rG residue were designed as shown in Fig. 44. In the ms-12 mutation, the &base sequence, 5‘-UGG-3’, on the lower strand was altered to 5’-ACU-3’ so that the branched rG residue (circled in Fig. 4A) is no longer at the end of the stem structure. In order to construct the ms-12 mutation, the 3-base sequence, 5’-TGG-3’, immediately up-

chromosomal DNA

msr

stream of the msd gene was altered to 5’-ACT-3’. A similar 3-base mismatch mutation was also constructed on the upper strand. In the ms-13 mutation, 5’-UCA-3’ immediately up- stream of the branched rG residue was changed to 5’-AGU- 3’. It should be noted that in contrast to the ms-12 mutation, the ms-13 mutation locates downstream of the msd region or within the msr region and that they are 213 bases apart from each other in the msd-msr region. In a third mutant, both mutations, ms-12 and ms-13, were combined together so that base pairings at the mutated sequence are resumed (ms-12:13; see Fig. 4A). These mutated msd-msr DNA fragments were

Structural Requirements for msDNA Biosynthesis 6217

A

b "" G C A U C A J

I 1 1 . 1 I "" C G U G G U G G U A G A A U G G - - - - -

I C I I C

I i _ " G U i

G C A A - G C A U C A ' I l l I l l " _ C G U G G U G G U A G A A - - C G U

' C A G G U A G A A -

I C I

i - - G C A A G U '

I I I I I I " C G U U C A G G U A G A A U G G - - - - -

(u-12 : 13)

B

I

0 - C (1us-15) y , A (IUS-14)

- - G C A U C A '

" C G U G G U G G U A G A A U G G - - I 1 1 . 1 I

t ("11)

C I A I G

ir I C

" G C A U C A J

- - C G U G G U G G U A G A A U G G - - I 1 1 . 1 I

I I A

- - G C A U C A @ C C U ? :c

- - ~ b : ; ; h 1 ~ G G u A , A A " G G - -

("16)

FIG. 4. Mutations in pre-msdRNA. Only the region around the branched rG residue (residue 96 in Fig. 2) is shown. A, construction of mutations ms-12, ms-13, and ms12:13; B, ms-11, ms-14, and ms- 15; C, ms-16.

reintegrated back into the msd-msr deletion strain (strain MIllZ), and the production of msDNA was then examined.

Fig. 5A shows msDNA synthesis in the original wild type strain (strain DZFl), the msd-msr deletion strain (strain MI112), and the strain MI112 harboring the wild type msd- msr region integrated at the MX8 phage attachment site (strain MI112::msd+msr+). msDNA production was no longer observed in strain MI112 (lane 2, Fig. 5A). msDNA production was resumed, however, when the wild type msd-msr region

FIG. 5. Production of msDNA in various mutants. msDNA preparations from various strains were analyzed by electrophoresis on a 5% polyacrylamide gel. The gels were stained with ethidium bromide. A: lune S, pBR322 DNA digested with MspI as molecular weight marker; lane I , DNA preparation from strain DZFl (wild type); lane 2, DNA preparation from strain MI112 (str' Amsd Amsr); lane 3, DNA preparation from strain MI112 transduced with plasmid pMSOOl harboring the msd+ msr+ region (see Fig. 3). B: lane S, pBR322 DNA digested with HaeIII as molecular weight marker; lane I , DNA preparation from strain MI112 transduced with plasmid by pMSOOl harboring the wild type msd-msr region; lane 2, DNA prep- aration from mutant ms-13; lune 3, DNA preparation from mutant ms-12; lane 4, DNA preparation from strain MI112::ms-1213. The positions of msDNA (Ms) and mrDNA (Mr) are indicated by arrows.

was reintroduced into strain MI112 (lane 3, Fig. 5A). However, the amount of msDNA synthesized in the new strain (strain MI112::msd+msr+) was approximately one-eighth of the wild type (lane 1, Fig. 5A). The reason for the reduction of msDNA synthesis in strain MIllZ::msd+msr+) is unknown at present.

The synthesis of msDNA in the base mismatch mutants is shown in Fig. 5B. No production of msDNA was observed in either ms-12 (lane 2) or ms-13 (lane 3). However, when both mutations were combined, msDNA synthesis was found to be recovered to approximately 50% of wild type synthesis (lane 1). The fact that the ms-12 (or ms-13) mutation can be suppressed by another independent mutation, ms-13 (or ms- 12), indicates that the two mutations separated by 213 bases on the M. xanthw chromosome are interacting with each other. This further indicates that there is no specific sequence requirement immediately upstream of the branched rG resi- due except to maintain the secondary structure as previously proposed (Dhundale et al., 1987). In addition, it should be noted in Fig. 5B that the production of mrDNA, another independent species of msDNA in M. xanthw (Dhundale et al., 1988)) was not affected by mutations in the msd-msr region, serving as an internal control.

Specificity of Initiation of m D N A Synthesis-The synthe- sis of msDNA is considered to be primed from the 2' position of the rG residue (position 96; circled in Figs. 2 and 4) at the end of the first stem (stern a, see Fig. 2). Using the lower

6218 Structural Requirements for m D N A Biosynthesis

strand as template, a dC residue complementary to the rG residue (position 307 shown by a solid triangle in Fig. 2 or the rG residue in boldface in Fig. 4B) is incorporated as the 5’ end of msDNA forming a 2’,5’-phosphodiester linkage be- tween the rG residue at position 96 and the dC residue. After this event, msDNA synthesis proceeds using the lower strand as template. In order to examine the specificity of msDNA priming reaction, the branched rG residue was substituted with either rA (ms-14) or rC (ms-15). Neither mutation could produce msDNA (data not shown), suggesting that an rG residue is essential for the priming reaction at the 2‘ position. The results obtained from mutations ms-12 and ms-13 are also consistent with this specificity since the rU residue in the case of ms-12 and the rA residue in the case of ms-13 each became the first residue of the upper strand immediately after the first stem was unable to prime msDNA synthesis (see Fig. 4-41.

In the ms-11 mutation (see Fig. 4B), the rG residue in the lower strand (position 307) was replaced with an rC residue. This mutation had no effect on the production of msDNA (data not shown) indicating that there is no stringent require- ment for the 5’ end of msDNA to be dC in contrast to the stringent requirement for the branched rG residue from which msDNA synthesis is primed. We also constructed a 4-base insertion mutant (ms-16), as shown in Fig. 4C, in order to further examine the stringent requirement of the branched rG residue. In this mutation, the 4-base sequence, 5‘-AGGC- 3‘, was inserted in the lower strand immediately after the first stem structure (between residues 308 and 309). As a result, the stem structure is extended by 4 bases, and the branched rG residue (circled by a solid line in Fig. 4C) becomes sequestered in the stem structure. However, the rG residue at position 100 (circled by a dotted line in Fig. 4C), 4 bases downstream of the branched rG residue, now becomes the first residue after the stem structure without changing the template sequence. When msDNA production was examined by acrylamide gel electrophoresis followed by ethidium bro- mide staining, no msDNA was detected (data not shown). This result suggests that in addition to the stringent require- ment of the rG residue for the priming of msDNA synthesis, there is another requirement for the priming reaction from the 2’ position of the rG residue, which is most likely the distance between the primer rG residue and the stem-and- loop structure I (see Fig. 2). In mutant ms-16, this spacing is reduced from 6 bases to 2 bases, which may cause severe steric hindrance for the priming enzyme. It should be noted that an extremely small amount of msDNA (less than 0.01% of msDNA produced in the control cells) was detected in mutant ms-16 by Southern blot hybridization. However, due to the small amount produced, it was not determined which rG residue (residue 96 or the newly inserted rG residue) was used for the priming reaction.

Existence of Pre-msdRNAs in Various Mutants-The ina- bilities of various mutants described above to produce msDNA may be due to reduction of the amount of pre-msdRNA in these cells. Such reduction may be caused by the mutations in the msd-msr region at the level of transcription (or pro- duction of msdRNA) and/or at the level of the pre-msdRNA stability in the cell. In order to quantitate the amounts of pre- msdRNAs in various mutant cells, the total RNA fraction was extracted and used for primer extension. On the basis of the base sequence of the primer used for the primer extension experiment, the length of the fully extended DNA was ex- pected to be 90 bases long (Dhundale et al., 1987). Fig. 6 demonstrates that all cell extracts produced the 90-base DNA (indicated by an arrow) as a major product and that there

144-.

11

9

1

FIG. 6. Primer extension of pre-msd RNAs from various mutants. The primer extension reaction was performed as described under “Experimental Procedures.” After stopping the extension re- action, samples were mixed with formamide dye mixture, heated at 90 “C for 2 min, and then analyzed on an 8% polyacrylamide-8 M urea sequencing gel. Lane 1, pBR322 DNA digested by MspI as molecular weight marker and labeled at the 3‘ ends by the DNA polymerase I Klenow fragment. Lane 2, DNA sample from strain MI112 transduced with plasmid pMSOOl harboring the msd+ msr+ region. Lanes 3-8 are DNA samples from mutants ms-11, ms-12, ms- 13, ms-12:13, ms-15, and ms-16, respectively. The primer extension reaction was not performed for mutant ms-14. The position of the major product 90-base is indicated by an arrow.

FIG. 7. Production of the truncated msDNA. The msDNA preparations were analyzed as described in Fig. 5. Lane S, pBR322 DNA digested by MspI as molecular weight marker; lane 1, msDNA preparation from strain MI112 transduced with plasmid pMSOOl harboring the msd+ msr+ region; lane 2, msDNA preparation from strain MI112 transduced by plasmid pMSOO1 harboring a deletion mutation, A(ms-xbal:ms-xba3). The positions of msDNA and mrDNA are indicated by arrows, and the position of the truncated msDNA is indicated by an arrow with the letter a.

were no significant differences in the amounts of the 90-base DNA between them. Thus, one can conclude that those cells which were unable to produce msDNA (ms-12 (lane 3), ms-13 (lane 4), ms-15 (lane 6), and ms-16 (lane 7‘)) were producing as much pre-msdRNA as those cells producing msDNA (wild type (lane I ) , ms-11 (lane Z), and ms-12:13 (lane 5) ) . These results clearly rule out the possibility that the inability of msDNA synthesis in strains harboring ms-12, ms-13, ms-15, and ms-16 mutations was due to reduced amounts of pre- msdRNA in these cells.

Structural Requirements for m D N A Biosynthesis 6219

Requirement of the Stem Structure in msDNA-The second stem-and-loop structure of pre-msdRNA (stem b in Fig. 2) serves as the template. We examined the requirement of this stem structure by removing more than half of the stem struc- ture. This was achieved by introducing two XbaI sites in the msd region. As a result, the primary structure of pre-msdRNA was changed as indicated in Fig. 2. For the ms-xba3 mutation, the sequence 5’-UCUUGG-3’ (the boxed sequence in the upper strand in Fig. 2) was changed to 5’-UCUAGA-3’, and for the ms-xbal mutation, 5’-CGUAGUG-3’, (the boxed se- quence in the lower strand of stem b) to 5’-UCUAGACU-3’, where the XbaI sequences are boxed, with an arrow for the cleavage site. Both mutations had no effect on the production of msDNA (data not shown). These mutated DNAs were individually digested with XbaI and EcoRI. The EcoRI-XbaI fragment encompassing the 5’ end of the ms-xbal mutant and the XbuI-EcoRI fragment encompassing the 3‘ end of the ms-xba3 mutant were isolated and ligated into the unique EcoRI site of pMX101. This resulted in the removal of a fragment of 81 bases from the stem b structure to produce a stem of 55 bases (cleavage sites by XbaI are indicated by arrows in Fig. 2). The mutated msd region which had the 81- base deletion within the msd region was then introduced into strain MI112 by the same method described in Fig. 3. The newly constructed strain (MI112::msd A(ms-xbal:ms-xba3)) was then examined for the production of msDNA. As shown in Fig. 7, lune 2, this strain did not produce the full-sized msDNA. Instead, it produced a new species of msDNA which migrated between msDNA and mrDNA as shown by an arrow. The density of the band corresponding to the truncated msDNA is approximately one-half that of msDNA, indicating that the deletion mutation did not affect the efficiency of msDNA production. From these results one can conclude that the upper half of the second stem structure is not essential for the msDNA production.

Mechanism of the msDNA Synthesis-As previously pro- posed (Dhundale et al., 1987), msDNA synthesis is considered to proceed by at least two distinct reactions: 1) the activation of the 2”OH group of the branched rG residue (position 96, Fig. 2) for the priming reaction and 2) the reverse transcrip- tion of the pre-msdRNA into msDNA. A single reverse tran- scriptase may be able to proceed both reactions. Alternatively, there may be a specific enzyme for the activation of the 2‘- OH group of the rG residue at position 96 to allow the reverse transcriptase to initiate msDNA synthesis. It is also possible that the activation reaction may be autocatalytic, i.e. occur- ring without the aid of enzymatic function of a protein as in the case of the self-splicing of pre-mRNA (see a review by Cech, 1987). In either case, the activation reaction appears to be specific to rG, and the strict requirement of the secondary structure around the branched rG residue may indicate that the pre-msdRNA molecule is folded into a unique secondary structure which enables the rG residue to be activated for priming msDNA synthesis.

For the second reaction, a reverse transcriptase is required which transcribes pre-msdRNA as the template using the activated 2’-OH group of the branched rG residue at position 96 (Fig. 2) as the primer. The first deoxyribonucleotide linked to the 2”OH group of the rG residue appears to be determined by the base of the template; because of the rG residue at position 307 (Fig. 2), a dC residue is incorporated at the 5‘ end of msDNA. The present results demonstrate that in

contrast to the rG residue at position 96, there is no stringent requirement at position 307 allowing a dG residue as another 5’ end residue of msDNA.

The results with the ms-16 mutation suggest that the dis- tance between the branched rG residue and the stem-and- loop structure in the central bulge (structure I, Fig. 2) may be important for the initiation of msDNA synthesis. It is also interesting to note that the reverse transcriptase appears to be able to synthesize msDNA synthesis regardless of the structure of stem b (Fig. 2) and to terminate its synthesis at position 146. Since both msDNA and truncated msDNA consist of a DNA of a distinct size (see Fig. 7), the termination mechanism of msDNA synthesis appears to be very stringent. The fact that mrDNA, another species of msDNA in M. xanthus, has a similar stem-and-loop structure as structure II of msDNA (see Fig. 2; Dhundale et al., 1988) may indicate that these secondary structures serve as the signal for the termination of msDNA synthesis.

Recently, a cell-free system for msDNA synthesis has been established in our laboratory. This cell-free system strongly suggests the existence of reverse transcriptase activity in M. xanthus.2 Characterization of this enzymatic activity will shed light on the exact molecular mechanism of msDNA synthesis.

Acknowledgments-We are grateful to Dr. Bert Lampson for his critical reading of this manuscript and to Jorge Vallejo-Ramirez for his excellent technical assistance.

REFERENCES Avery, L., and Kaiser, D. (1983) Mol. & Gen. Genet. 191,99-109 Bachman, B. J. (1972) Bacteriol. Reu. 36,525-557 Beck, E., Ludwig, G., Auerswald, E. A., Reiss, B., and Schaller, H.

Birnboim, H. C., and Dols, J. (1979) Nucleic Acid Res. 7. 1513-1523 (1982) Gene (Amst.) 19 , 327-336

Campos, J. M., Geisselsoder, J., and Zusman, D. R. (1978) J. Mol. Biol. 119, 167-178

Cech, T . R. (1987) Science 236, 1532-1539 Dhundale, A. R., Furuichi, T., Inouye, S., and Inouye, M. (1985) J.

Bacterwl. 164,914-917 Dhundale, A., Lampson, B., Furuichi, T., Inouye, M., and Inouye, S.

(1987) Cell 51,1105-1112 Dhundale, A., Inouye, M., and Inouye, S. (1988) J. Biol. Chem. 2 6 3 ,

Furuichi, T., Komano, T., and Nisioka, T. (1984) J. Bacteriol. 158 ,

Furuichi, T., Dhundale, A., Inouye, M., and Inouye, S. (1987a) Cell

Furuichi, T., Inouye, S., and Inouye, M. (1987b) Cell 4 8 , 55-62 Inouye, S., and Inouye, M. (1987) in Synthesis and Applications of

DNA and RNA (Narang, S., ed) pp. 181-204, Academic Press, Orlando, FL

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Omdorff, P., Stellwag, E., Starich, T. , Dworkin, M., and Zissler, J. (1983) J. Bacteriol. 154 , 772-779

Shelness, G. S., and Williams, D. L. (1984) J. Biol. Chem. 259,9929- 9935

Shimkets, L. J., Gill, R. E., and Kaiser, D. (1983) Proc. Natl. Acad. Sci. U. S. A. 8 0 , 1406-1410

Southern, E. M. (1975) J. Mol. Biol. 98, 503-517 Teintze, M., Inouye, M., and Inouye, S. (1988) J. Biol. Chen. 263,

Vieira, J., and Messing, J. (1982) Gene (Amst.) 19 , 259-268 Yee, T., Furuichi, T., Inouye, S., and Inouye, M. (1984) Cell 38,203-

9055-9058

997-1004

48,47-53

1199-1203

209

* Lampson, B. C., Inouye, M., and Inouye, S. (1989) Cell, in press.