1 / 120

Human Risk Assessment for Rat Liver Tumors Induced by a Constitutive Androstane

Receptor Activator Momfluorothrin

March, 2018

Yu Okuda

Graduate School of

Environmental and Life Science

(Doctor’s Course)

OKAYAMA UNIVERSITY, JAPAN

2 / 120

Contents

Executive summary 3

Introduction 5

Chapter 1: Mode of action (MOA) analysis for rat hepatocellular tumors produced by

the synthetic pyrethroid momfluorothrin: evidence for Constitutive Androstane

Receptor (CAR) activation and mitogenicity in male and female rats

Introduction 11

Materials and Methods 15

Results 26

Discussions 41

Chapter 2: Evaluation of human relevancy for rat hepatocellular tumors induced by

momfluorothrin.

2-1: Utility analysis of novel humanized chimeric mice with human hepatocytes for

human risk assessment treated with CAR activator, Sodium Phenobarbital (NaPB)

Introduction 55

Materials and Methods 58

Results 66

Discussions 74

2-2: Analysis for the human relevancy for rat hepatocellular tumors induced by

momfluorothrin using cultured rat and human hepatocytes and humanized chimeric

mice

Introduction 78

Materials and Methods 80

Results 89

Discussions 99

Conclusions 106

Acknowledgments 107

References 108

3 / 120

Executive Summary

Many chemicals have been shown to produce tumors in rats and mice, especially

liver is the most common target organ affected. Momfluorothrin, a new pesticide

developed by Sumitomo Chemical Co. Ltd., induced hepatocellular tumors in the rat

two-year bioassay and which is a close structural analogue of pyrethroid insecticide

metofluthrin. The metofluthrin also induced rat liver tumors and results from the mode

of action (MOA) analysis showed constitutive androstane receptor (CAR)-mediated

MOA. Therefore, the MOA for momfluorothrin-induced rat hepatocellular tumors is

also predicted to be the CAR-mediated MOA as it is for metofluthrin. A series of MOA

analysis was conducted based on the International Programme on Chemical Safety

(IPCS) framework to evaluate the human cancer risks of momfluorothrin in the present

research.

The IPCS framework composed of the following three questions. Question 1 is to

establish an animal MOA for momfluorothrin-induced rat liver tumors, question 2 is to

demonstrate the qualitative differences in the key events between rats and humans, and

question 3 is to demonstrate the quantitatively differences in either kinetic or dynamic

factors between rats and humans.

In chapter 1, to establish the animal MOA for rat hepatocellular tumors induced by

momfluorothrin, a series of in vivo and in vitro MOA analysis were conducted using

wild type (WT) and CAR knockout (KO) rats or RNA interference (RNAi) technique.

As a result of MOA analyses, defined key events (i.e. CAR activation, hepatocellular

proliferations) and associative events (hepatic cytochrome P450 (CYP) 2B induction,

increased liver weights, hepatocellular hypertrophy) in the CAR-mediated MOA were

4 / 120

identified in WT rats with strong dose-dependency and temporal consistency. In further

studies using CAR KO rats and RNAi technique, it was elucidated that hepatocellular

proliferation and CYP2B activity induced by momfluorothrin were depend on CAR

activation. Thus, a plausible MOA for momfluorothrin-induced rat liver tumor

formation have been established as CAR activated MOA and the answer to question 1 in

the IPCS framework is yes.

In chapter 2, to evaluate of human relevancy for rat hepatocellular tumors induced

by momfluorothrin, some in vitro and in vivo assays were conducted using human

culture hepatocytes and chimeric mice with human hepatocytes. In rat and human

hepatocyte studies with momfluorothrin, CYP2B gene expression was significantly

increased in both hepatocytes but replicative DNA synthesis was only increased in rat

and not in human hepatocytes. This conclusion is strongly supported by the chimeric

mouse study, where no increase in replicative DNA synthesis in human hepatocytes was

also observed. As examination of the available data demonstrates that the MOA for

momfluorothrin-induced rat liver tumor formation is qualitatively not plausible for

humans and the answer to question 2 is yes. In addition, no stimulation of replicative

DNA synthesis by NaPB and metofluthrin was demonstrated in chimeric mice with

human hepatocytes.

In conclusion, these data suggested that CAR activators including momfluorothrin

have no carcinogenic risk for humans.

5 / 120

Introduction

I. Cancer bioassay

The current standard for evaluation of possible carcinogenic activity of a chemical

in humans is the two-year bioassay in rodents, usually rats and mice. These animal

cancer bioassays have been used for more than a half century to determine whether

pesticides, pharmaceuticals, consumer products, industrial chemicals, food additives

and other products might cause cancer or other health problems in humans. Inherent in

rodent-based assessments was the assumption that the observation of tumors in

laboratory animals could be meaningfully extrapolated to identify potential human

carcinogens (Cohen, 2010; Boobis et al., 2006). However, some of them have been

identified rodents-specific tumors throughout mechanism studies have brought together

a fuller biological understanding of how chemicals induce neoplasia in animal studies

(Whysner, Ross, and Williams 1996; Holsapple et al., 2006; Meek et al., 2014; Elcombe

et al., 2014; Corton et al., 2014). Therefore, it is necessary to evaluate and extrapolate

appropriately the human cancer risks from positive results of rodent carcinogenicity

study.

II. IPCS Framework for analyzing the relevance of a cancer MOA for human

In the early 2000s, as an analytical tool to provide a means of evaluating

systematically the data available on specific carcinogenic response to a chemical in a

transparent manner, frameworks for analyzing the MOAs by which chemicals produce

tumors in laboratory animals and the relevance of such tumor data for human risk

assessment have been developed by the IPCS and by the International Life Sciences

Institute (ILSI) (Boobis et al., 2006, 2008; Cohen et al., 2004; Meek et al., 2003;

6 / 120

Sonich-Mullin et al., 2001). An MOA has been defined as a “biologically plausible

sequence of key and associative events leading to an observed effect supported by

robust experimental observations and mechanistic data” (Boobis et al., 2006). In terms

of the human relevance of an animal carcinogenic MOA, there are three questions to

consider (Boobis et al., 2006) before reaching a conclusion (Fig. 1).

Figure 1. IPCS general scheme illustrating the main steps in evaluating the human relevance of

an animal MOA for tumor formation (Figure is modified from Boobis et al., 2006).

The questions have been designed to enable an unequivocal answer yes or no, but

recognizing the need for judgment regarding sufficiency of weight of evidence (WoE).

Answers leading to the left side of the diagram indicate that the WoE is such that the

MOA is not considered relevant to humans. In contrast, answers leading to the right side

of the diagram indicate either that the WoE is such that the MOA is likely to be relevant

to humans.

7 / 120

III. Rats cancer bioassay in Momfluorothrin

Many chemicals have been shown to produce tumors in rats and mice. Analysis of

rodent bioassay data demonstrates that for both the rat and the mouse liver is the most

common target organ affected (Huff et al., 1991; Gold et al., 2001). In our recent case,

Epsilon-Momfluorothrin (CAS# 1065124-65-3; 2,3,5,6-Tetrafluoro-4-

(methoxymethyl)benzyl(Z)-(1R,3R)-3-(2-cyanoprop-1-enyl)-2,2-dimethylcyclopropane

carboxylate, referred to as momfluorothrin in this report, Figure 2A) was also induced

hepatocellular tumors in the rat carcinogenicity study.

Figure 2. Chemical structures of momfluorothrin (A) and metofluthrin (B).

Momfluorothrin was developed as a type I synthetic pyrethroid insecticide consisting of

two main isomers (RTZ: RTE ratio is 9:1) for use to treat crawling insects in both indoor

residential settings and outdoor commercial/residential/barn settings. A summary of the

results of 2-year bioassay using male and female Wistar rats fed diet containing

momfluorothrin at 0, 200, 500, 1500, and 3000 ppm are shown in Table 1. The

8 / 120

incidences of the total number of animals with hepatocellular adenomas and/or

carcinomas were 2, 0, 4, 12, and 33% for males, and 0, 0, 2, 2, and 10% for females,

respectively. The combined incidence of hepatocellular adenoma and carcinoma was

significantly increased in male and female rats given 3000 ppm momfluorothrin, with a

non statistically significant increase being observed in male rats given 1500 ppm. The

incidences of hepatocellular adenoma, carcinoma, and combined in males given 1500

and 3000 ppm were equivalent to or higher than the maximum incidence of the

historical control data, and the combined incidence of female rats given 3000 ppm was

within the historical control data, but incidence of carcinoma was equivalent to the

maximum incidence of the historical control data. Overall, treatment with

momfluorothrin in rats for 2 years produced hepatocellular tumours in males at 1500

and 3000 ppm (73 and 154 mg/kg/day) and in females at 3000 ppm (182 mg/kg/day)

(ECHA, 2014).

This research report was summarized based on the published data from Okuda et al.,

2017a, 2017b, and Yamada et al., 2014.

9 / 120

Table 1. Summary of liver alterations in rats treated with momfluorothrin in the 2-year tumorigenicity study.

Sex Males Females

Dose levels of momfluorothrin (ppm) 0 200 500 1500 3000 0 200 500 1500 3000

Organ weight

104 weeks Relative liver weights 1.00 1.04 1.08 1.22** 1.66** 1.00 0.99 1.05 1.20** 1.46**

Light microscopy (incidence)

104 weeks Hepatocellular hypertrophy 1/51 1/51 0/51 5/51 14/51** 0/51 0/51 0/51 3/51 10/51**

Preneoplastic or neoplastic findings (incidence and %)

104 weeks Eosinophilic cell foci 0/51

(0%)

2/51

(4%)

3/51

(6%)

3/51

(6%)

20/51**

(39%)

2/51

(4%)

0/51

(0%)

2/51

(4%)

5/51

(10%)

9/51*

(18%)

Hepatocellular adenomas 1/51

(2%)

0/51

(0%)

2/51

(4%)

4/51

(8%)

8/51*

(16%)

0/51

(0%)

0/51

(0%)

1/51

(2%)

1/51

(2%)

4/51

(8%)

Hepatocellular carcinomas 0/51

(0%)

0/51

(0%)

0/51

(0%)

4/51

(8%)

9/51**

(18%)

0/51

(0%)

0/51

(0%)

0/51

(0%)

0/51

(0%)

1/51

(2%)

Combined hepatocellular

adenomas/carcinomas

1/51

(2%)

0/51

(0%)

2/51

(4%)

6/51

(12%)

17/51**

(33%)

0/51

(0%)

0/51

(0%)

1/51

(2%)

1/51

(2%)

5/51*

(10%)

Historical control data a Average Range (min - max) Average Range (min - max)

Eosinophilic cell foci 6.55% 0.0 - 44.0% 7.42% 0.0 - 56.0%

Hepatocellular adenomas 2.54% 0.0 - 8.0% 2.80% 0.0 - 10.2%

Hepatocellular carcinomas 0.47% 0.0 - 2.8% 0.32% 0.0 - 2.0%

Combined hepatocellular adenomas/carcinomas 3.01% 0.0 - 10.0% 3.12% 0.0 - 12.0%

Note. Data are unpublished but refereed to ECHA (2014). For histopathology, data represent the number of animals with the lesion/total number of animals examined and incidence is shown in parentheses.

Values of relative liver weight are presented as fold of the control at each dose level.

Values significantly different from control (0 ppm) are: * p < 0.05, ** p < 0.01. Values within shaded areas indicate toxicologically significant change.

a: Historical control data on liver tumors on 104-weeks studies in RccHanTM:WIST, Wistar Hannover rats compiled from 104 weeks bioassays performed at Harlan Laboratories Ltd. Itingen/Switzerland.

Table is adapted from Okuda et al., (2017a).

10 / 120

Chapter 1

MOA analysis for rat hepatocellular tumors produced by the synthetic pyrethroid

momfluorothrin: evidence for CAR activation and mitogenicity in male and female

rats

11 / 120

Introduction

Postulated MOA for rodent liver tumors formation by momfluorothrin

According to the Cohen (2010), there are two ways that a chemical can alter the

incidence of cancer: (1) by damaging DNA directly or (2) indirectly by increasing the

number of DNA replications resulting in an increase in the spontaneous errors in DNA.

Several MOAs which have been identified for liver carcinogenesis both in humans and

in rodent models are shown in Table 2. MOAs that have evidence of human relevance

are highlighted in bold letters (e.g. DNA-reactive carcinogens (genotoxic compound),

estrogen receptor activation, increased cytotoxicity, infections, and metal overload).

While, there are a number of MOAs with no relevance to humans, including peroxisome

proliferation, enzyme induction, statine-mediated alterations in liver metabolism, and

increased apoptosis (Cohen, 2010; Cohen and Arnold, 2011).

12 / 120

Momfluorothrin is clearly not genotoxic, being negative in a variety of in vivo and

in vitro genotoxicity assays (Ames test, in vitro chromosomal aberration test, in vitro

gene mutation assay, unscheduled DNA synthesis (UDS) assay and mouse micronucleus

test) (ECHA, 2014). Moreover, momfluorothrin is a close structural analogue of the

type I pyrethroid insecticide metofluthrin (Fig. 2B) and high doses of metofluthrin have

also been shown to produce hepatocellular tumors in rats (Deguchi et al., 2009). Results

in in vivo and in vitro MOA studies, metofluthrin induced hepatic CYP2B subfamily

enzymes as a surrogate marker of CAR and hepatocellular replicative DNA synthesis in

rats (Deguchi et al., 2009; Hirose et al., 2009; Kushida et al., 2016; Yamada et al., 2009,

2015). From a read-across approach, the MOA for rat hepatocellular tumors induced by

momfluorothrin was postulated the same as that of metofluthrin, that is CAR-mediated

MOA. This MOA is similar to that of certain other non-genotoxic agents which are

CAR activators, such as phenobarbital (PB) (Carmichael et al., 2011; Holsapple et al.,

2006; Osimitz and Lake, 2009) which can produce liver tumors in rats and mice (IARC,

2001; Whysner et al., 1996).

Key and associative events in the CAR-activated MOA

In CAR-activated MOA, many key events (i.e. an empirically observable causally

precursor step to the adverse outcome that is itself a necessary element of the MOA)

and associative events (i.e. biological processes that are themselves not causal necessary

key events for the MOA, but are reliable indicators or markers for key events) have

been identified (Elcombe et al., 2014). Key events are required events for the MOA, but

often are not sufficient to induce the adverse outcome in the absence of other key events.

Associative events can often be used as surrogate markers for a key event in a MOA

13 / 120

evaluation or as indicators of exposure to a xenobiotic that has stimulated the molecular

initiating event or a key event.

In a recent evaluation of the MOA for PB-induced rodent liver tumor formation, key

events in the MOA were considered to be CAR activation, altered gene expression

specific to CAR activation, increased cell proliferation, and the development of altered

hepatic foci leading to liver tumor formation; whereas associative events included the

induction of CYP enzymes (in particular the CYP2B subfamily enzymes), liver

hypertrophy (increased liver weight and hepatocellular hypertrophy) and inhibition of

apoptosis (Elcombe et al., 2014). If a key event (or events) is an essential element for

carcinogenesis, it must precede the appearance of the tumors (Cohen and Arnold, 2016).

A scheme of key and associative events in the postulated MOA for

momfluorothrin-induced rat hepatocellular tumor formation is shown in Figure 3. To

determine whether this postulated MOA (CAR activated MOA) is correct, in vivo and in

vitro experiments were conducted following the IPCS framework against the modified

Bradford Hill considerations (Meek et al., 2014; Sonich-Mullin et al., 2001) which are:

1. Postulated MOA.

2. Key events; associated critical parameters.

3. Dose-response relationships.

4. Temporal association.

5. Strength, consistency, and specificity of association of key events and tumor

response.

6. Biological plausibility and coherence.

7. Possible alteration MOAs.

8. Uncertainties, Inconsistencies, and data gaps.

14 / 120

9. Conclusion about the MOA.

These obtained experimental and analytical data have already been published from

Toxicological Sciences (Okuda et al., 2017a).

Figure 3. Schematic representation of key and associative events in the proposed MOA for

momfluorothrin-induced rat hepatocellular tumor formation. The MOA for

momfluorothrin-induced rat liver tumor formation is postulated to involve activation of the CAR,

which results in a pleiotropic response including the stimulation of CYP2B subfamily enzymes,

hepatocellular hypertrophy and increased hepatocellular proliferation. Although hepatocyte labeling

index values, determined as 5-bromo-2´-deoxy-uridine (BrdU) labeling index, may return toward

control levels with continued momfluorothrin treatment, the number of cell replications in treated

animals will be enhanced due to the increased total number of hepatocytes per animal. The continued

stimulation of cell proliferation may lead to tumor formation as a result of critical errors being

produced during cell replication and/or to the enhanced proliferation of spontaneously initiated

pre-neoplastic hepatocytes (Cohen and Arnold, 2011; Schulte-Hermann et al., 1983). Prolonged

treatment results in the formation of altered hepatic foci and liver tumors. Figure is adapted from

Okuda et al., (2017a).

15 / 120

Materials and Methods

Chemicals

Test chemicals were obtained from the following manufacturers: momfluorothrin

(Lot no. 9CM0109G; purity 95.7%; storage condition, cold storage) and

epsilon-metofluthrin (Lot no.100702; purity 98.8%; storage condition, cold storage;

referred to as metofluthrin in this article) were provided by Sumitomo Chemical Co.,

Ltd. (Tokyo, Japan); phenobarbital-Na (NaPB; Lot no.AWJ4960; purity 98.0%; storage

condition, room temperature) was purchased from Wako Pure Chemical Industries, Ltd.

(Osaka, Japan).

Animals and husbandry

All experiments were performed in accordance with The Guide for Animal Care

and Use of Sumitomo Chemical Co., Ltd.

HarlanRccHanTM:WIST (Wistar strain) rats aged 9 weeks were purchased from

Japan Laboratory Animals, Inc., Hanno Breeding Center (Saitama, Japan) as this was

the strain of rats used in the 2-year cancer bioassay. In addition, CAR KO rats with a

Crl:CD (SD) genetic background aged 10 weeks and wild-type Crl:CD (SD) rats (WT)

aged 11 weeks were purchased from SAGE labs, Inc. (Boyertown, Pennsylvania, 19512,

USA) and Charles River Japan, Inc., Hino Breeding Center (Shiga, Japan), respectively.

SD genetic background CAR KO rats were used as Wistar background KO rats were not

available. Similar responses to momfluorothrin in the liver of wild type rats of both

strains were observed in the present study (described later). Prior to the MOA analysis,

BrlHan:WIST@Jcl(GALAS) (Wistar strain) rats aged 4 weeks were purchased from

16 / 120

CLEA Japan, Inc., Fuji Breeding Center (Shizuoka, Japan) and used in the toxicity

screening study at the early stage of development of this chemical; liver samples from

the BrlHan:WIST@Jcl(GALAS) rats were subjected to the global gene expression

profile analysis and the data are presented in this paper.

Animals were acclimatized to laboratory conditions for 7 days prior to treatment in

the in vivo assay. During the course of the study, the environmental conditions in the

animal room were set to maintain a temperature range of 22-26°C and a relative

humidity range of 40 - 70, with frequent ventilation (more than 10 times per hour) and

a 12 hour light (8:00 - 20:00)/ 12 hour dark (20:00 - 8:00) illumination cycle. A

commercially available pulverized diet (CRF-1; Oriental Yeast Co., Ltd, Tokyo) and

filtered tap water were provided ad libitum throughout the study. The animals were not

fasted overnight prior to sacrifice in the present MOA studies, but they were fasted in

the toxicity screening study.

Design for in vivo studies using Wistar rats

In the present MOA study, three different experiments were conducted for

evaluating time-course, dose-dependency and reversibility. Male and female rats (ten

animals/dose/sex) fed diets containing momfluorothrin at 0 (control) and 3000 ppm (the

highest dose in the 2-year bioassay, a tumor inducing dose level) for 7 and 14 days to

evaluate the time-course of changes. For evaluation of the dose-dependency,

momfluorothrin was administered at 0, 200, 500, 1500, and 3000 ppm to both sexes (ten

animals/dose/sex) for 7 days; these levels were consistent with those of the 2-year

bioassay. Furthermore, the reversibility of hepatic effects was evaluated in male rats (ten

animals/dose) by cessation of treatment for 7 days after 7-days treatment with

17 / 120

momfluorothrin at 0 and 3000 ppm.

Design for in vivo studies using CAR KO rats

Male Crl:CD (SD) (WT) and CAR KO rats (five animals/group, respectively) were

fed diets containing momfluorothrin at 0 or 3000 ppm for 7 days to clarify whether the

hepatocellular proliferation involved CAR activation. As shown below, since

momfluorothrin treatment at 3000 ppm for 7 days significantly increased CYP2B

activity, liver weight and replicative DNA synthesis in male Wistar rats, the same

treatment time was selected for this experiment. This model has been quite recently

developed and only limited data have been published (Chamberlain et al., 2014). Thus,

two additional CAR-mediated MOA liver tumor inducers NaPB (1000 ppm) (Rossi et

al., 1977) and metofluthrin (1800 ppm) (Yamada et al., 2009) were examined in the

present study to confirm reliability of the CAR KO rat model. Administration of PB in

drinking water (500 ppm, the corresponding daily intake was of 39.5 mg/kg/day in

males and of 46.7 mg/kg/day in females) caused liver adenomas in male and female

Wistar rats (Rossi et al., 1977). In this study, treatment of 1000 ppm NaPB in diet

revealed a similar range of daily intake (approximately 50 mg/kg/day, see Table 5).

Although we consider that eight to ten rats per group is preferred for reliable

evaluation of BrdU labeling under the study conditions we used, due to limitation of the

number of the CAR KO rat availability, five animals per group were used in the present

study. Since small numbers of animals were used (5 rats/group), to observe any

expected CAR-mediated alterations (even a tendency) in the WT animals, two sets of

experiments (5 rats/group in each experiment) were conducted in the WT rats.

18 / 120

Observations and tissue sampling

Mortality, body weights, and food consumption were monitored throughout the

studies. For evaluation of replicative DNA synthesis, Alzet minipumps (Model 2ML1;

Alzet Corporation, Palo Alto, CA, USA) containing BrdU (a structural analog of

thymidine that incorporates into nuclear DNA and is used as a surrogate marker of cell

proliferation (Wood et al., 2015), Sigma Company, St Louis, MO, USA) with a release

rate of 200 μg/hour, were implanted in the subcutaneous tissue of rats under isoflurane

anesthesia on the day prior to 4 days of the scheduled euthanization to avoid the effects

of a palatability problem at the early phase of the study. After 7- or 14-day treatment

period, rats were sacrificed under deep anesthesia by isoflurane without prior fasting on

the morning of day 8 or 15, and then livers were excised quickly and weighed. Some

liver tissue was stored in RNA stabilization solution (Ambion, Austin, TX, USA) at

-80°C until analyzed for gene expression. The remaining liver tissue was processed for

hepatic CYP enzyme activity analysis, histopathology, and cell proliferation

measurement.

Liver histopathology

Segments of livers from all surviving animals were fixed in buffered 4%

paraformaldehyde or 10% neutral buffered formalin, embedded in paraffin, sectioned,

stained with hematoxylin and eosin, and examined by light microscopy. In addition, the

left lateral lobe in the control and treatment groups was prefixed by perfusing 2.5%

glutaraldehyde in 0.2 M phosphate buffer (pH 7.4) using a syringe for 2 animals/group

in Wistar rats. The sample blocks were post-fixed in 2% osmium tetroxide, dehydrated,

and embedded in epoxy resin. Ultra-thin sections were prepared, stained with uranyl

19 / 120

acetate and lead citrate, and examined by JEM-1400 transmission electron microscopy

(JEOL, Tokyo, Japan).

Hepatocyte replicative DNA synthesis from BrdU-labeling indices

Hepatocyte replicative DNA synthesis was determined in the livers from all

surviving animals by an immunohistochemical method using BrdU monoclonal

antibody (Deguchi et al., 2009; Yamada et al., 2014). BrdU labeling was analyzed

microscopically in a blinded manner with more than 2000 hepatocytes per rat being

evaluated. A small section of duodenum from each animal was also processed to serve

as a control for confirming systemic availability of BrdU and immunohistochemical

staining.

Quantitative real-time polymerase chain reaction of the selected genes

Using liver samples from male Wistar rats treated with momfluorothrin at 3000

ppm for 7 and 14 days, hepatic CYP1A2, CYP2B1/2, CYP3A1, CYP3A2, and CYP4A1

mRNA expression levels were analyzed by quantitative real-time PCR. Hepatic

CYP2B1/2 and CAR mRNA levels were also analyzed in samples from the in vitro

RNAi experiment using rat hepatocytes and in in vivo study of CAR KO rats,

respectively. Total RNA from hepatocytes was extracted using Isogen solution (Nippon

Gene) and RNeasy Mini Kit (Qiagen) with on-column DNase treatment to avoid

genomic DNA contamination. Total RNA was quantified by UV analysis at 260 nm and

280 nm using a UV spectrometer (NanoDrop 2000, Thermo Fisher Scientific). The total

RNA solution was stored at -80 ºC until required for complementary DNA (cDNA)

generation. cDNA was prepared from total RNA by reverse transcription using the High

20 / 120

Capacity cDNA Reverse Transcription Kit for reverse transcription polymerase chain

reaction (RT-PCR) (Applied Biosystems) according to the kit supplier's instructions.

The reaction mixture (20 µL) containing 10x RT Buffer containing total RNA (10 – 100

ng) (2 µL), 25x dNTP mix (0.8 µL), 10x RT Random Primers (2 µL), 20U/µL RNase

Inhibitor (1 µL) and 50U/µL MultiScribe Reverse Transcriptase (1 µL) in diethyl

pyrocarbonate-treated water was incubated at 25 ºC for 10 min, 37 ºC for 120 min and

85 ºC for 5 min. The cDNA solution was stored at -80 ºC until required for real-time

PCR assays. The primer and probe sets are shown in Table 3.

21 / 120

Table 3. Primer and prove set.

Species Target

mRNA Forward Primer Reverse Primer Probe

Product

size Rat CYP1A2 GAAGCCCAGAACCTGTGAACA CCGATGTCTCGGCCATCTT CAGGCCTGGCCACGCTTCTCC 70bp

CYP2B1/2 GCTCAAGTACCCCCATGTCG ATCAGTGTATGGCATTTTACTGCGG Not used 109bp

CYP3A1 AGTCGTCCTGGTGCTCCTCTAC CCCAGGAATCCCCTGTTTCT ATTTGGGACCCGCACACATGGACT 73bp

CYP3A2 AAACCACCAGCAGCACACTCT CAGGGCCCCATCGATCTC TCTTGTATTTCCTGGCCACTCACCCTGA 95bp

CYP4A1 TCCAGGTTTGCACCAGACTCT TCCTCGCTCCTCCTGAGAAG CCCGACACAGCCACTCATTCCTGC 67bp

GAPDH GCTGCCTTCTCTTGTGACAAAGT CTCAGCCTTGACTGTGCCATT TGTTCCAGTATGATTCTACCCACGGCAAG 129bp

Mouse Cyp2b10 CAGGTGATCGGCTCACACC TGACTGCATCTGAGTATGGCATT Not used 70bp

GAPDH TGTGTCCGTCGTGGATCTGA CCTGCTTCACCACCTTCTTGA CCGCCTGGAGAAACCTGCCAAGTATG 77bp

Human CYP2B6 TTGTTCTACCAGACTTTTTCACTCATC GGAAAGTATTTCAAGAAGCCAGAGA TCTGTATTCGGCCAGCTGTTTGAGCTC 83bp

GAPDH GACACCCACTCCTCCACCTTT CATACCAGGAAATGAGCTTGACAA CTGGCATTGCCCTCAACGACCA 79bp

22 / 120

Hepatic microsomal CYP enzyme activity

Hepatic microsomal CYP enzyme activity was determined in selected liver samples

such as from the dose-response study. A portion of liver (approximately 0.5 g) was

homogenized in 4 volumes of 154 mM KCl containing 50 mM Tris/HCl buffer pH7.4

using a Potter-type Teflon-glass homogenizer. Whole liver homogenates were

centrifuged at 9,000 × g for 20 min at 4 °C to separate S9 fractions. The protein content

of the S9 fractions was determined using the DC protein assay kit (Bio-Rad, CA)

employing bovine serum albumin as standard (Bradford, 1976). CYP2B activity was

determined as 7-pentoxyresorufin O-depentylase (PROD) activity by fluorometric

analysis using the specific substrate for CYP2B enzyme. The reaction mixture (200 µL)

consisted of 3 µM 7-pentoxyresorufin, 10 µM dicoumarol, 1 mM NADPH, 1 µL S9

fraction in 100 mM Tris/HCl buffer pH7.4 in 96-well microplates. After incubation for

10 min at 37 ºC, the reaction was stopped by addition of 100 µL acetonitrile. The

fluorescence of the sample was measured with a microplate reader (Saffire II, Tecan)

with an excitation wavelength of 550 nm and an emission wavelength of 589 nm.

Enzyme activity was calculated from the fluorescence of a standard curve of the

resorufin product.

Evaluation for CAR involvement on the MOA for CYP2B1/2 mRNA induction in

cultured rat hepatocytes using the RNAi technique

The assay was basically conducted as previously described (Deguchi et al., 2009).

On day 0, primary cultured hepatocytes were obtained from a single male rat per

experiment (HarlanRccHanTM:WIST rats, at the age of 9 weeks) by a modified

two-step collagenase digestion method. Rat liver was perfused and hepatocytes were

23 / 120

dispersed from digested liver and washed with William’s E medium (GIBCO) three

times by centrifugation. The hepatocytes were cultured in supplemented 2 mL William’s

E medium (5% fetal bovine serum [GIBCO], 100 U/ml penicillin [Nakaraitesque],

100g/ml streptomycin [Nakaraitesque], 2 mM L-glutamine [Nakaraitesque], 0.1M

insulin [Sigma-Aldrich], 1M dexamethasone [Sigma-Aldrich], 0.2mM ascorbic acid

[Sigma-Aldrich], and 10 mM nicotinamide [Sigma-Aldrich] ) in a six-well plate coated

with collagen I (AsahiTechnoGlass), at a density of approximately 4 x 105 cells/well,

and allowed to attach for 3 hours at 37 ºC in a humidified chamber. After 3 hours, the

culture dishes were gently swirled and fresh medium was added after removing

unattached hepatocytes.

On day 1, cells were rinsed and supplemented with serum/antibiotics free medium

(2 mL). siRNA (1 g) for CAR (sense strand:

5’-GCUCACACACUUUGCAGAUAUCAAU-3’, antisense strand:

5’-AUUGAUAUCUGCAAAGUGUGUGAGC-3’, Hayashi-Kasei Co., Ltd.) or negative

control (NC; Stealth RNAi Negative Control with Medium GC, Code No.; 12935-300,

Invitrogen), and 1 L of MATra-si Reagent (IBA) were each diluted with 200L of

serum/antibiotics free medium according to the manufacturer’s instructions, and the two

solutions were gently mixed. After 20 min, the transfection mixtures (200L) were

added to the cells, and the culture plates were placed on a magnet plate (IBA) for 15

min. After 4 hours, the medium was changed to the supplemented Williams E medium

containing serum and antibiotics.

Following the transfection (on day 1), hepatocytes were treated with 50 M of

NaPB and 100 M of momfluorothrin in medium for 2 days. A concentration of 50 M

of NaPB was selected as this concentration has previously been shown to induce

24 / 120

CYP2B-dependent enzyme activity in cultured rat hepatocytes (Deguchi et al., 2009;

Hirose et al., 2009). Medium was changed on a daily basis thereafter. The control group

was treated in the same manner without test chemical. The experiment was examined

using three wells for each group. On day 3, hepatocytes were washed with

phosphate-buffered saline (PBS) and the total RNA was extracted using Isogen (Nippon

Gene, Japan). During the experiment, no cytotoxicity was observed visually and there

was no change in expression levels of the housekeeping gene

(glyceraldehyde-3-phosphate dehydrogenase, GAPDH).

Global gene expression analysis

Since detailed MOA for momfluorothrin-induced liver tumor production was

evaluated for the key and associate evens in the current MOA studies, the additional

data of global gene expression analysis in the general toxicity study of momfluorothrin

may not be essential for prediction of the MOA for momfluorothrin-induced liver tumor

production. However, in the general toxicity studies, animals are usually fasted prior to

euthanization to avoid confounding by possible variation of food consumption. In

contrast, since it is well known that fasting alters the cytochrome P450 profile affecting

drug/chemical metabolism (Maronpot et al., 2010; Sohn and Fiala, 1995), the data of

global gene expression analysis in the general toxicity study with fasting may provide

valuable information for considering newly postulated MOA of other compounds at the

point of departure of the MOA study. The analysis was determined in livers from male

BrlHan:WIST@Jcl(GALAS) rats (4 animals per groups) treated with momfluorothrin at

0 and 3000 ppm for 2 weeks; the animals were treated under the same conditions as in

the MOA studies described above, excepting for fasting prior to euthanization. Details

25 / 120

of the analytical methods are shown in Supplementary materials. The gene expression

data can be downloaded from the National Center for Biotechnology Information Gene

Expression Omnibus (Accession No. GSE94738;

http://www.ncbi.nlm.nih.gov/geo/info/linking.html.). The obtained gene expression data

were subjected to hierarchical clustering analysis with GeneSpring GX 13.1 software

(Agilent Technologies). Clustering was conducted with the probe sets, whose expression

was known to be changed in our reference data; carbon tetrachloride (CCl4) and

thioacetamide as cytotoxic compounds (Abe et al., 2014; Manibusan et al., 2007),

clofibrate as a peroxisome proliferator-activated receptor alpha (PPARα) activator

(Corton et al., 2014), and NaPB as a CAR activator (Elcombe et al., 2014) for 2 weeks.

Statistical analysis

For comparison among multiple groups, if the variables exhibited a normal

distribution by the Bartlett-test, the Dunnett-test was applied for a comparison of the

treated groups with the control group. The Steel-test was applied instead of the

Dunnett-test when the data did not exhibit a normal distribution. For comparison

between two groups, the F-test was applied to compare treated groups with the control

group. If the variance was homogeneous, Student’s t-test was used. If the variance was

heterogeneous, the Aspin-Welch-test was used. Two-tailed tests were employed for

evaluation except for BrdU labeling index and BrdU labeling index was evaluated by

one-tail test with p≤0.05 and 0.01 as the levels of significance.

26 / 120

Results

Analysis for selected hepatic CYP mRNA levels

In the MOA studies, the effect of momfluorothrin on some selected CYP mRNA

levels were determined in the livers of male Wistar rats treated with momfluorothrin at

3000 ppm for 7- and 14 days (Fig. 4). While hepatic CYP2B1/2 mRNA levels were

significantly increased after 7 and 14-day treatment (18- and 16-fold, respectively),

CYP3A1 and CYP4A1 mRNA levels were only marginally increased after 7- or 14-day

treatment (less than 1.5-fold). No significant changes were observed in CYP1A2 and

CYP3A2 mRNA levels. These findings suggested that momfluorothrin activates CAR

but not either Aryl hydrocarbon receptor (AhR) or PPARα.

Figure 4. Selected hepatic CYP mRNA expression levels in Wistar male rats treated with

momfluorothrin. Male Wistar rats were treated with momfluorothrin at 0 (control) and 3000 ppm for 7

and 14 days and selected hepatic CYP mRNA expression levels were examined by RT-PCR. Data are

presented as fold increase to control as mean ± SD (N=6). Values statistically different from control are:

*p<0.05; ** p<0.01. Figure is adapted from Okuda et al., (2017a).

27 / 120

Evaluation of CAR involvement in CYP2B induction in cultured rat hepatocytes

using the RNAi technique

To confirm whether hepatic CYP2B induction (i.e. CYP2B1/2 mRNA) by

momfluorothrin involves CAR activation, the effect of CAR knockdown by the RNAi

technique on CYP2B induction by momfluorothrin was investigated in a rat cultured

hepatocyte system. A concentration range finding experiment with 5 - 1000 M

momfluorothrin demonstrated that CYP2B1/2 mRNA was significantly increased at 100

M and higher concentrations with the peak effect being observed at 100 M (2.6-fold

of control) (Fig. 5A). Subsequent experiments were performed with 100 M

momfluorothrin.

When rat hepatocytes were treated with CAR-siRNA together with either 50 M

NaPB or 100 M momfluorothrin, CAR mRNA levels were significantly suppressed by

80% and 81% of each negative CAR-siRNA control (NC) in NaPB and momfluorothrin

treated groups, respectively (Fig. 5B and 5C). Under the CAR-suppressed condition,

CYP2B1/2 mRNA levels in NaPB and momfluorothrin-treated groups were also

reduced, respectively, by 67% (close to statistical significance, p=0.070) and 68% (close

to statistical significance, p=0.067) compared with each NC (Fig. 5D and 5E). In

addition, the data from CAR KO mice (Yamamoto et al., 2004) and rat cultured

hepatocytes with CAR siRNA (Deguchi et al., 2009) demonstrated that CAR activation

is necessary to induce CYP2B mRNA by NaPB. Therefore, these findings demonstrate

that momfluorothrin is also a CAR activator bacause CYP2B1/2 mRNA was induced

CAR dependently as well as NaPB.

28 / 120

Figure 5. Relative CAR (B, C) and CYP2B1/2 (D, E) mRNA expression levels in cultured

hepatocytes treated with 50 μM NaPB (B, D) and 100 μM momfluorothrin (C, E). The

concentration of momfluorothrin was determined based on the range finding study (A) and 100 µM

momfluorothrin selected for the siRNA studies (B to E). NC means control siRNA as a negative

control. NaPB + NC (B, D) and momfluorothrin + NC (C, E) are shown as percentage of control

siRNA (NC) values. Data are presented as mean values±SD (N=3). For part A, values significantly

different from control are: *p<0.05; **p<0.01. For parts B-E, values significantly different between

untreated and NC treated hepatocytes are *p<0.05 and between NC and either 50 M NaPB or 100

M momfluorothrin are ##

p <0.01. Figure is adapted from Okuda et al., (2017a).

29 / 120

In vivo momfluorothrin time-course study in Wistar rats

To investigate the time course of momfluorothrin-induced hepatic effects, male and

female rats were treated with 0 (control) and 3000 ppm momfluorothrin for 7 and 14

days. The data from this in vivo study are summarized in Table 4. There were no severe

toxicities such as death or marked suppression of body weight and food consumption up

to 14 days. As shown in Fig. 6A, relative liver weights were significantly increased to a

similar extent in both sexes after 7 and 14 days treatment. While replicative DNA

synthesis was also significantly increased after 7- and 14-days treatment in both sexes,

the increase in replicative DNA synthesis was less marked after 14 days than after 7

days in both sexes (Fig. 6B).

30 / 120

Table 4. Summary of liver alterations in rats treated with momfluorothrin in the MOA studies.

Sex Males Females

Momfluorothrin dose (ppm) 0 200 500 1500 3000 0 200 500 1500 3000

Time-cause

study

7 days treatment Absolute liver weights 1.00 ND ND ND 1.12** 1.00 1.08 1.05 1.07 1.11*

Relative liver weights 1.00 ND ND ND 1.17** 1.00 1.09* 1.04 1.10** 1.16**

Replicative DNA synthesis 1.00 ND ND ND 5.30** 1.00 1.15 1.17 1.69* 2.79**

CYP1A2 mRNA 1.00 ND ND ND 0.72 ND ND ND ND ND

CYP2B1/2 mRNA 1.00 ND ND ND 17.78** ND ND ND ND ND

CYP3A1 mRNA 1.00 ND ND ND 1.37* ND ND ND ND ND

CYP3A2 mRNA 1.00 ND ND ND 0.93 ND ND ND ND ND

CYP4A1 mRNA 1.00 ND ND ND 1.17 ND ND ND ND ND

PROD activity ND ND ND ND ND 1.00 0.88 1.00 1.88* 6.18*

Hepatocellular hypertrophy 0/10 ND ND ND 4/10* 0/10 0/10 0/10 0/10 3/10

Proliferation of SER 0/2 ND ND ND 0/2 ND ND ND ND ND

14 days treatment Absolute liver weights 1.00 ND ND ND 1.24** 1.00 ND ND ND 1.05

Relative liver weights 1.00 ND ND ND 1.26** 1.00 ND ND ND 1.12*

Replicative DNA synthesis 1.00 ND ND ND 1.90* 1.00 ND ND ND 1.65*

CYP1A2 mRNA 1.00 ND ND ND 0.79 ND ND ND ND ND

CYP2B1/2 mRNA 1.00 ND ND ND 16.44** ND ND ND ND ND

CYP3A1 mRNA 1.00 ND ND ND 1.28 ND ND ND ND ND

CYP3A2 mRNA 1.00 ND ND ND 0.97 ND ND ND ND ND

CYP4A1 mRNA 1.00 ND ND ND 1.30* ND ND ND ND ND

PROD activity ND ND ND ND ND 1.00 ND ND ND 6.88*

Hepatocellular hypertrophy 0/10 ND ND ND 8/10** 0/10 ND ND ND 0/10

Proliferation of SER 0/2 ND ND ND 0/2 ND ND ND ND ND

Dose-depen

dency study

7 days treatment Absolute liver weights 1.00 1.01 1.05 1.08 1.09* 1.00 1.08 1.05 1.07 1.11*

Relative liver weights 1.00 1.01 1.05 1.10** 1.14** 1.00 1.09* 1.04 1.10** 1.16**

Replicative DNA synthesis 1.00 1.13 1.17 1.77* 2.47** 1.00 1.15 1.17 1.69* 2.79**

PROD activity 1.00 0.60 0.80 1.20 2.80** 1.00 0.88 1.00 1.88* 6.18*

Hepatocellular hypertrophy 0/10 0/10 0/10 0/10 2/10 0/10 0/10 0/10 0/10 3/10

Recovery

study

7 days treatment

+7 days recovery

Absolute liver weights 1.00 ND ND ND 1.04 ND ND ND ND ND

Relative liver weights 1.00 ND ND ND 1.05 ND ND ND ND ND

PROD activity 1.00 ND ND ND 1.28 ND ND ND ND ND

Hepatocellular hypertrophy 0/10 ND ND ND 0/10 ND ND ND ND ND

Note. Values excluding histopathological findings are presented as fold of the control at each dose level. For hepatocellular hypertrophy, data represent the number of animals with the lesion/total number of animals examined. Values significantly

different from control (0 ppm) are: * p < 0.05, ** p < 0.01. Values within shaded areas indicate toxicologically significant change. For female, combined time-cause and dose-dependency studies was conducted. Thus, the female data of the 7-day

treatment in the time-course study are adopted from those of the dose-dependency study. So, data of the control and 3000 ppm groups were repeatedly presented. PROD: 7-pentoxyresorufin O-depentylase, SER: smooth endoplasmic reticulum, ND; not

determined. Table is adapted from Okuda et al., (2017a).

31 / 120

Figure 6. Time-course effects on liver of Wistar rats treated with momfluorothrin. Relative liver

weights (A) and hepatocyte replicative DNA synthesis (B) were determined in livers of male and

female Wistar rats (N=10/group) treated with 0 (control) and 3000 ppm momfluorothrin for 7 or 14

days. Data are presented as mean values±SD. Values statistically significant from control are: *p <

0.05; **p < 0.01. Figure is adapted from Okuda et al., (2017a).

32 / 120

In vivo momfluorothrin dose-dependency and reversibility study in Wistar rats

Male and female Wistar rats were treated with 0 (control), 200, 500, 1500 and 3000

ppm momfluorothrin for 7 days. The selected data are presented in Table 4. Significant

decreased body weight gains were observed at 1500 and 3000 ppm on day 3 due to

palatability problems, however, these recovered to control levels by the end of the

treatment period.

At the two highest momfluorothrin dose levels (1500 and 3000 ppm), relative liver

weight (Fig. 7A) and replicative DNA synthesis (Fig. 7B) were significantly increased

in both male and female rats. A small non dose-dependent increase in relative liver

weight was also observed in female rats given 200 ppm momfluorothrin (Fig. 7A).

PROD activity was also statistically significantly increased in both sexes at 1500 and

3000 ppm (except for males at 1500 ppm) (Fig. 7C). Increased PROD activity in males

at 1500 ppm was a marginal change without statistical significance (1.2-fold of control).

At 3000 ppm in both sexes, hepatocellular hypertrophy was observed in 2 and 3 of 10

animals in males and females, respectively (Table 4). In contrast, male and female rats

administered 200 and 500 ppm revealed no treatment related changes in hepatocyte

replicative DNA synthesis, hepatocellular hypertrophy and PROD activity.

All of the effects on liver weight, hepatocellular hypertrophy and PROD activity

observed after 7 days of treatment with momfluorothrin returned to control levels upon

cessation of treatment for 7 days (Table 4). The reversibility of the effect of

momfluorothrin on hepatocyte replicative the DNA synthesis was not examined.

33 / 120

Figure 7. Dose-dependency of alterations in the Wistar rat liver treated with momfluorothrin.

Relative liver weights (A), hepatocyte replicative DNA synthesis determined as BrdU labeling index

(B), and hepatic PROD activity (C) were evaluated using male and female Wistar rat livers treated

with momfluorothrin at 0, 200, 500, 1500, and 3000 ppm for 7 days. Data are presented as the mean

values±SD; 10 animals/dose/sex for A and B, 6 animals/dose/sex for C. Values statistically

significant from control are: *p < 0.05; **p < 0.01.

Figure is adapted from Okuda et al., (2017a).

(A)

(B)

(C)

34 / 120

In vivo momfluorothrin study in WT and CAR KO rats

The hepatic effects of momfluorothrin were investigated in an in vivo study using a

CAR KO rat model, which has only recently become commercially available. Male WT

and CAR KO rats were given 0 (control) and 3000 ppm momfluorothrin for 7 days. In

addition, the effects of 1800 ppm metofluthrin and 1000 ppm NaPB at, two known

CAR-mediated MOA liver tumor inducers, were also investigated. The data are

presented in Table 5. In the first experiment with WT rats, two of five animals treated

with momfluorothrin showed severe toxicity due to a palatability problem as evidenced

by marked decrease of body weights accompanied by considerable suppression of food

consumption. However, there was individual variation of sensitivity to this palatability

problem; the other 3 rats showed no such severe toxicities. These toxicities of

momfluorothrin were also observed in the second experiment with WT rats and CAR

KO rats, but the toxicity was less than those in the first experiment with WT rats.

Under such conditions, NaPB, metofluthrin (except in the first experiment, where a

1.6-fold increase was observed) and momfluorothrin significantly increased CYP2B1/2

mRNA levels in WT rats suggesting CAR functionally responded in WT rats; but not in

CAR KO rats, indicating that this CAR KO rat model is reliable (Fig. 8A and 8B, Table

5). Replicative DNA synthesis was evaluated with groups of 5 rats in two separate

experiments in WT rats. NaPB significantly increased (8.1 fold control) or increased

(8.4 fold control) replicative DNA synthesis in the first and second experiments with

WT rats, respectively; whereas metofluthrin increased (3.9 fold control) or significantly

increased (4.1 fold control) and momfluorothrin significantly increased (3.1 fold control

after excluding 2 animals with bad health condition in the first experiment) or increased

(8.7 fold control) in the first and second experiments with WT rats, respectively.

35 / 120

Table 5. Summary of findings of the 7-day treatment study in WT and CAR KO Sprague Dawley rats

WT rats CAR KO rats

1st experiment

(Animal No.1-5)

2nd

experiment

(Animal No.6-10)

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Number of animals tested 5 5 5 5 5 5 5 5 5 5 5 5

Test Item Intake (mg/kg/day) - 50.1 88.3 84.4 - 52.5 84.8 110.9 - 50.2 77.1 123.2

Death of animals 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5

Final Body Weight (g) 431.3±19.0 447.7±23.3 448.8±18.6 396.8±20.9* 451.0±18.3 442.7±10.5 432.8±18.8 418.8±24.8* 454.9±30.4 472.1±20.9 447.7±32.2 456.7±16.6

Total Body Weight Gain (g) 21.4±14.9 25.3±10.9 25.7±8.2 -15.7±24.1* 27.9±7.8 32.8±10.3 23.6±9.1 0.3±13.4** 23.1±7.3 40.6±15.6 18.2±8.9 21.8±5.8

Food Consumption at

termination of treatment

(g/animal/day)

129.1±14.4 a 153.8±5.3* 149.0±3.0 82.3±31.1 147.2±19.7 159.3±3.9 140.1±7.8 107.0±11.8** 148.5±6.6 160.7±13.9 139.8±20.3 135.2±11.8

Liver Weight Absolute (g) 13.78±0.88 18.03±0.89** 17.10±1.00** 13.61±1.92 15.57±0.47 18.08±1.26** 15.76±0.84 14.39±1.72 16.12±0.82 17.36±1.51 16.86±1.80 17.24±1.19

(fold control) 1.00 1.31 1.24 0.99 1.00 1.16 1.01 0.92 1.00 1.08 1.05 1.07

Relative (g/body weight×100) 3.20±0.20 4.03±0.23** 3.82±0.31** 3.42±0.35 3.46±0.17 4.09±0.30** 3.64±0.19 3.43±0.28 3.55±0.14 3.68±0.24 3.76±0.16 3.77±0.17

(fold control) 1.00 1.26 1.19 1.07 1.00 1.18 1.05 0.99 1.00 1.04 1.06 1.06

CYP2B1/2 mRNA level

(% of control average)

100±47 31341±15125** 156±36 5416±2616* 100±16 24273±6593** 192±62* 2483±1636* 100±35 112±14 115±12 99±10

(fold control) 1.00 313.41 1.56 54.16 1.00 242.73 1.92 24.83 1.00 1.12 1.15 0.99

Replicative DNA synthesis (%) 0.90±0.53 7.28±5.53* 3.50±3.57 1.74±1.56 b 0.50±0.33 4.20±5.82 2.06±1.47* 4.36±6.35 3.56±1.38 3.70±2.24 1.78±0.93* 5.34±3.71

(fold control) 1.00 8.09 3.89 1.93 b 1.00 8.40 4.12 8.72 1.00 1.04 0.50 1.50

Due to limitation in the availability of the CAR KO rats, only five animals per dose could be used. For evaluation of replicative DNA synthesis, we consider that the numbers of animals per dose is sufficient although more optimal numbers would be

eight to ten rats per dose. Since small number of animals examined (N=5) may result in an increased coefficient of variation (CV) and decreases the statistical power of the assay a second, experiment using wild type rats was conducted.

a: For the control group of the 1st experiment, food consumption was calculated by excluding two of the five animals due to severe diet spillage.

b: For the momfluorothrin group of the 1st experiment, two of five animals had severe toxicity as evidenced by marked suppression of body weight with decreased food consumption. When data of these two toxic animals are excluded, replicative DNA

synthesis is 2.77 ± 0.96 (N=3). This value is 3.1-fold of control and statistically significant (p<0.01) compared to control, and is presented in Figure 5C as the data of the 1st experiment of wild-type rats.

Significantly different from control (F-test/Student t, or Welch test) : * p<0.05, ** p<0.01. Table is adapted from Okuda et al., (2017a).

36 / 120

Table 5. Summary of findings of the 7-day treatment study in WT and CAR KO Sprague Dawley rats (continued)

WT rats CAR KO rats

1st experiment

(Animal No.1-5)

2nd

experiment

(Animal No.6-10)

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Control NaPB

1000 ppm

Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

Number of animals tested 5 5 5 5 5 5 5 5 5 5 5 5

Histopathology: Liver

Hypertrophy, hepatocyte,

centrilobular

± 0/5 1/5 5/5 0/5 0/5 1/5 4/5 0/5 0/5 0/5 0/5 0/5

+ 0/5 4/5 0/5 0/5 0/5 4/5 0/5 0/5 0/5 0/5 0/5 0/5

Hypertrophy, hepatocyte, diffuse ± 0/5 0/5 0/5 4/5$ 0/5 0/5 0/5 3/5 0/5 0/5 0/5 0/5

Increased vacuole, glycogen-like,

hepatocyte, diffuse

± 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 1/5 0/5 0/5

Infiltration, mononuclear, focal ± 3/5 3/5 4/5 3/5 4/5 4/5 2/5 3/5 4/5 3/5 4/5 2/5

Vacuolation, hepatocyte, focal ± 0/5 1/5 0/5 0/5 0/5 1/5 0/5 0/5 0/5 0/5 0/5 0/5

Vacuolation, hepatocyte,

centrilobular

± 0/5 1/5 0/5 0/5 0/5 1/5 0/5 0/5 0/5 0/5 0/5 0/5

Necrosis, hepatocyte, focal ± 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 1/5

For histopathology, data represent the number of animals with the lesion/total number of animals examined. Grade of histopathology: ±, Slight; +, Mild; 2+, Moderate; 3+, Severe.

Significantly different from control (Wilcoxon rank sum test): $ p<0.05, $$ p<0.01. Table is adapted from Okuda et al., (2017a).

$$ $$ $$ $

37 / 120

In contrast to the WT rats, these chemicals did not produce any significant increases

in replicative DNA synthesis in the CAR KO rats (Fig. 8C, Table 5). Increased liver

weights and/or hepatocellular hypertrophy were also observed in WT rats treated with

NaPB, metofluthrin or momfluorothrin, while no such effects were observed in the CAR

KO rats treated with these chemicals even at similar intakes of test agents between WT

and CAR KO rats (Table 5). Taken together, these data demonstrate that the induction

replicative DNA synthesis in rats treated with NaPB, metofluthrin and momfluorothrin

is mediated through CAR.

When responses to momfluorothrin between Wistar rats (Table 4) and SD rats (Table

5, WT rats in the CAR KO rat study) were compared, both strains responded

qualitatively similarly to momfluorothrin, as demonstrated by increases in CYP2B1/2

mRNA levels and replicative DNA synthesis. Quantitatively, the increases in CYP2B1/2

mRNA levels was greater in SD rats, with the increases being 40-fold (mean of 2

experiments with 54-fold and 25-fold increases) and 18-fold in SD and Wistar rats,

respectively. However, for replicative DNA synthesis the response was equivalent in

both SD and Wistar rats, the increases being 5.3-fold (mean of 2 experiments with

1.93-fold and 8.72-fold increases) and 5.3-fold, respectively. Overall, these findings

demonstrate that SD rats are responsive to momfluorothrin and hence that SD CAR KO

rats may be employed to evaluate the CAR-dependency of the hepatic effects of

momfluorothrin.

38 / 120

Figure 8. Effect of 1000 ppm NaPB, 1800 ppm metofluthrin and 3000 ppm momfluorothrin on

CYP2B1/2 mRNA expression levels (A and B) and replicative DNA synthesis (C) in WT and

CAR KO rats. Data are presented as mean values±SD (5 animals/group) with two experiments

being performed in WT rats. For the momfluorothrin group in the first experiment, two of five

animals revealed severe toxicity as evidenced by severe suppression of body weight with decreased

food consumption. When data of the two toxic animals are excluded, replicative DNA synthesis is

2.77 ± 0.96 (N=3). This value is 3.1-fold of control and statistically significant (p < 0.01) compared

to control, and thus that value is plotted in this figure. Values statistically significant from control

are: *p < 0.05; **p < 0.01. Figure is adapted from Okuda et al., (2017a).

39 / 120

Hepatic global gene expression and CYP mRNA levels

Since this analysis was conducted prior to the present MOA studies, as described in

the Methods section, the study conditions were not completely the same as the present

MOA studies. However, the data obtained is useful in helping establish the MOA for

momfluorothrin-induced liver tumor formation. The global gene expression profile

analysis were conducted in the liver of male Wistar rats treated with momfluorothrin at

3000 ppm for 14 days. Numbers of probe sets with 1.5-fold alterations compared to

control group were 107 as up-regulation and 268 as down-regulation. Of these, some

overlapped with genes altered after 14-day treatment with a CAR activator NaPB (1000

ppm): up-regulated gene were Akr7a3, Aldh1a1, Aldh1a4, App, Atpif1, Ces2, Cd14,

Cyp2b2/Cyp2b15, Ephx1, Ddc, Gsta2, Gstm1, RGD1562732_predicted, Snx10,

Udpgtr2 and Zdhhc2; down-regulated genes were Atf5, Eif4g2, C4bpb, Ciapin1,

LOC678772, Nrd1, Oat, Spetex-2G, Srebf1 and Zdhhc23. The result of hierarchical

clustering analysis showed that the gene expression pattern of the liver from rats treated

with momfluorothrin at 3000 ppm was clustered most closely to that of NaPB (Fig. 9).

40 / 120

Figure 9. Hierarchical clustering analysis in Wistar male rats treated with momfluorothrin.

Data are shown for clofibrate at 2500 ppm (a) and at 300 mg/kg bw/day (b), carbon tetrachloride at

100 mg/kg bw/day (c), thioacetamide at 200 ppm (d) and 15 mg/kg bw/day (e), momfluorothrin at

3000 ppm (f), and NaPB at 1000 ppm (g - k) and at 100 mg/kg bw/day (l). Wistar (a, d, f, g, i, and j),

Crj:CD (SD) (b, c, e, and l), or F344 (h and k) male rats (3 or 4 animals/dose) were treated with test

substances for 14 days.

41 / 120

Discussions

In two-year carcinogenicity study, the incidence of hepatocellular tumors was

increased in both male and female rats treated with higher dose of momfluorothrin. To

assess the human relevance of these rat liver tumors, a series of mechanism study was

conducted by using WT and KO rats or RNAi technique to elucidate the MOA for rat

hepatocellular tumors induced by momfluorothrin and discussed with nine of the

modified Bradford Hill considerations as below.

1. Postulated MOA for momfluorothrin-induced rat liver tumor formation

Metofluthrin, a close structural analogue to momfluorothrin, also increased

hepatocellular tumors in rats. The MOA for tumor formation by metofluthrin in rats was

shown to be similar to that of the prototypic CAR activator phenobarbital (Kushida et

al., 2016; Yamada et al., 2009, 2015). This MOA involves activation of CAR, which

results in a pleiotropic response including the stimulation of altered gene expression

specific to CAR activation, hepatocellular hypertrophy and increased hepatocellular

proliferation. Prolonged treatment results in the formation of altered hepatic foci and

liver tumors. Activation of CAR, increased cell proliferation and the development of

altered hepatic foci are considered to be key events in the MOA for tumor formation by

such compounds as they constitute necessary steps in the MOA (Elcombe et al., 2014).

The induction of CYP2B enzymes and liver hypertrophy (both morphological changes

and increases in liver weight) are considered as associative events and as such represent

reliable markers of CAR activation (Elcombe et al., 2014). Based on a close structural

analogue, metofluthrin, the MOA for momfluorothrin-induced rat liver tumor formation

42 / 120

was postulated to also involve activation of CAR. The MOA data was summarized in

Table 4 and 5 and the validity of this hypothesis was discussed below.

2. MOA data

Activation of the nuclear CAR (Key event #1)

CYP2B enzyme induction in rodent liver involves activation of CAR (Deguchi et

al., 2009; Wei et al., 2000; Yamamoto et al., 2004). To probe the role of CAR in the

MOA for momfluorothrin-induced rat liver tumor formation, the RNAi technique was

employed. CAR-siRNA was used to reduce CAR mRNA levels in order to examine

CAR involvement on the effect of momfluorothrin on CYP2B1/2 mRNA induction in

Wistar rat hepatocytes, employing a similar experimental design to that previously used

in the metofluthrin study (Deguchi et al., 2009). NaPB was employed as a positive

control for these studies. The treatment of Wistar rat hepatocytes with CAR-siRNA

significantly reduced CAR mRNA in the presence of either NaPB and momfluorothrin,

resulting in a reduction in the magnitude of induction of CYP2B1/2 mRNA levels by

both compounds (close to significant, p=0.07) (Fig. 5D and 5E). These findings

demonstrate that momfluorothrin induces CYP2B1/2 mRNA through CAR in Wistar rat

hepatocytes and hence momfluorothrin is a CAR activator. This was also strongly

supported by the in vivo study in CAR KO rats; where 3000 ppm momfluorothrin

increased CYP2B1/2 mRNA in WT rats but not in CAR KO rats (Fig. 8A, Table 5).

Hepatic CYP2B induction (Associative event)

In Wistar male rats, hepatic CYP2B activity was induced 2.8-fold after 7 days

treatment with 3000 ppm of momfluorothrin (Fig. 7C, Table 4). A marginal increase in

43 / 120

CYP2B activity to 1.2-fold of control was observed in male rats given 1500 ppm

momfluorothrin for 7 days (Table 4). In addition, hepatic CYP2B1/2 mRNA levels in

male rats given 3000 ppm momfluorothrin for 7 or 14 days were robustly increased by

16 or 18 fold, respectively (Fig. 4, Table 4), suggesting that CYP2B mRNA levels

would also have been significantly increased at lower doses of momfluorothrin. In

females, increases in hepatic CYP2B activity were observed at momfluorothrin dose

levels of 1500 and 3000 ppm after 7 days (Fig. 7C, Table 4) and at a dose level of 3000

ppm after 14 days (Table 4).

Liver hypertrophy (Associative event)

Treatment with momfluorothrin resulted in significant increases in liver weights

associated with hepatocellular hypertrophy throughout the liver lobule (Table 4). In

addition, increased smooth endoplasmic reticulum, characteristic of enzyme inducers

(Ghadially, 1997), was observed in liver sections from male and female rats given a

high 6000 ppm dose level of momfluorothrin for 13 weeks (ECHA, 2014).

By transmission electron microscopy, the treatment of male rats with 3000 ppm

momfluorothrin for 7 and 14 days did not result in any apparent increase in numbers

and size of peroxisomes. This confirms the results of the selected CYP mRNA analysis

and the global gene expression studies that momfluorothrin is not PPARα agonist in rat

liver (Fig. 4, Fig. 9, and Table 4).

Altered gene expression specific to CAR activation (Key event #2)

Activation of CAR in both the mouse and rat results in changes in the expression of

a large number of genes involved in phase I and II xenobiotic metabolism, cell

44 / 120

proliferation, apoptosis and energy metabolism (Elcombe et al., 2014). Although studies

in WT mice and CAR-KO mice have demonstrated that not all genes affected by PB are

CAR-dependent, some of genes were only induced in WT mice, suggesting CAR

specific genes. The altered genes by momfluorothrin treatment at 3000 ppm for 14 days

overlapped with genes altered after 14-day treatment with NaPB as shown in this study

(Okuda et al., 2017a). In addition, those by momfluorothrin also overlapped with genes

altered after 7-day treatment with a CAR activator metofluthrin (1800 ppm) or NaPB

(1000 ppm); i.e., CYP family 2, subfamily b; polypeptide 2 aldehyde dehydrogenase;

aldo-keto reductase; UDP-glucuronosyltransferase; glutathione-S-transferase and

epoxide hydrolase (Deguchi et al., 2009). Interestingly, CAR specific genes

demonstrated by Ueda et al. (2002), those are also included CYP family 2, subfamily b;

aldehyde dehydrogenase; and glutathione-S-transferase, also overlapped. These findings

suggest that momfluorothrin alters gene expression specific to CAR.

Increased cell proliferation (Key event #3)

The treatment of male and female Wistar rats with 1500 and 3000 ppm

momfluorothrin for 7 days resulted in significant increases in replicative DNA synthesis

(Fig. 7B, Table 4). Significant increases in replicative DNA synthesis were also

observed in male and female Wistar rats given 3000 ppm momfluorothrin for 14 days

(Table 4). However, the magnitude of the increase in replicative DNA synthesis after 14

days was less marked than that observed after 7 days in both sexes (Fig. 6B, Table 4).

This finding is consistent with previous studies with other mitogenic rodent liver CAR

activators where short-term treatment results in a peak stimulation of hepatocyte

labeling index values (Cohen and Arnold, 2011; Elcombe et al., 2014; Lake, 2009; Lake

45 / 120

et al., 2015; Yamada et al., 2009). Although the hepatocyte labeling index returns to

control levels with continued treatment with the compound, the overall number of cell

replications per animal is increased. This is because treatment with such chemicals

causes a sustained increase in liver weight which results in an overall increase in the

number and size of hepatocytes (Cohen and Arnold, 2011; Elcombe et al., 2014; Lake,

2009). For example, in a study employing a stereological technique, an increase in the

total number of hepatocytes per animal was observed in rats treated with PB for 12

weeks (Carthew et al., 1998). Thus, although hepatocyte labeling index values may

return to control levels after continued momfluorothrin treatment, the number of cell

replications in treated animals continues to be enhanced due to the increase in the total

number of hepatocytes per animal. The continued stimulation of cell proliferation may

lead to tumor formation as a result of critical errors being produced during cell

replication and/or enhanced proliferation of spontaneously initiated pre-neoplastic

hepatocytes (Cohen and Arnold, 2008; Schulte-Hermann et al., 1983).

Furthermore, momfluorothrin increased replicative DNA synthesis in WT rats

(Tables 4 and 5), but not in CAR KO rats (Table 5), demonstrating that CAR activation

is required for momfluorothrin-increased hepatocellular proliferation.

Clonal expansion leading to altered hepatic foci (Key event #4)

The treatment of male and female Wistar rats with momfluorothrin for 2 years

resulted in liver tumor formation. In addition to the formation of liver tumors, the

chronic treatment of male and female rats with 3000 ppm momfluorothrin also resulted

in significant increases in eosinophilic hepatocellular foci (Table 1).

46 / 120

Liver adenoma/carcinoma (Key event #5)

The incidences of the total number of animals with hepatocellular adenomas and/or

carcinomas of the 0, 200, 500, 1500 and 3000 ppm groups were 2, 0, 4, 12 and 33% for

males, and 0, 0, 2, 2 and 10% for females, respectively (Table 1). Treatment with 3000

ppm momfluorothrin significantly increased the incidence of hepatocellular adenoma in

both sexes and of hepatocellular carcinoma in male rats. The combined incidence of

hepatocellular adenoma and carcinoma was significantly increased in male and female

rats given 3000 ppm momfluorothrin, with a non statistically significant increase being

observed in male rats given 1500 ppm momfluorothrin. Therefore, the incidences of

hepatocellular adenoma, carcinoma, and combined in males given 1500 and 3000 ppm

momfluorothrin were equivalent to or higher than the maximum incidence of the

historical background; and the combined incidence of female rats given 3000 ppm

momfluorothrin was within the historical background incidence, while incidence of

carcinoma was equivalent to the maximum incidence of the historical background.

Overall, treatment with momfluorothrin in rats for 2 years produced hepatocellular

tumors in males at 1500 and 3000 ppm and in females at 3000 ppm. The no tumorigenic

dose levels (no observed effect levels for tumors) in male and female rats were

established at 500 ppm and 1500 ppm, respectively.

3. Concordance of dose-response relationships

The present MOA study was performed with momfluorothrin doses used in the

2-year bioassay. As shown in Fig. 7, the effects of momfluorothrin on CYP2B enzyme

induction, hypertrophy (liver weight), and cell proliferation (replicative DNA synthesis)

showed similar dose-dependency. In particular, in males and females at 3000 ppm, those

47 / 120

effects were significantly increased and corresponded with the tumor inducing dose

(Table 6). In addition to the 7-day study, increases in hepatocyte hypertrophy and

relative liver weights were also observed at 1500 ppm and above in both male and

female Wistar rats after treatment for 52 weeks or longer (ECHA, 2014).

In males at 1500 ppm, the increased incidence of liver tumor was equivocal; not

statistically significant, but equivalent to or higher than the maximum incidence of the

historical background in male Wistar rats. Thus 1500 ppm in males appeared to be

borderline for tumor production. The increased relative liver weights and hepatocellular

proliferation observed in rats given 1500 ppm momfluorothrin correlated with the

observed tumor formation (Table 6). The treatment of male Wistar rats with 1500 ppm

momfluorothrin did not result in a significant increase in CYP2B enzyme activity (Fig.

7C), hence the dose response between tumor formation and CYP2B induction was not

completely matched (Table 6). However, there were 16-18 fold increases in CYP2B1/2

mRNA levels in male Wistar rats given 3000 ppm momfluorothrin for 7 and 14 days

(Table 4), which suggest that some increase in CYP2B1/2 mRNA levels would have

been observed in male rats treated with 1500 ppm momfluorothrin. Moreover,

hepatocellular tumor incidence at this dose level was only marginally increased (not

statistically significant) and increased incidences of eosinophilic hepatocellular foci

were only observed at 3000 ppm in both sexes (Table 1). The tumor incidence data

suggests that the potency for CAR activation by momfluorothrin would be less at a dose

level of 1500 ppm than at 3000 ppm.

48 / 120

Table 6. Temporality and dose-response for MOA key events related to male and female Wistar rat liver tumors.

Temporal

Dose (ppm)

Key Event #1

CAR activation Key Event #2

A altered gene

expression

specific to

CAR

activation

Key Event #3

Increased cell

proliferation a

Key Event

after recovery

Key Event #4

Clonal expansion

leading to altered

hepatic foci

Key Event #5 Liver

adenomas/

carcinomas

Biomarker

CYP2B

mRNA and

activity

Associative

Event: Increased

liver weight and

hypertrophy

Time points 7, 14 days

7, 14 days

13, 52, 104

weeks

14 days 7, 14 days 7 days after 7

days treatment 104 weeks 104 weeks

Males

WT

200 - - ND - ND - -

500 - - ND - ND - -

1500 - c

+

(7D -104W) ND

+

(7D) d ND -

+

(104W) e

3000

+

(7 - 14D)

+

(7D- 104W)

+

(14D)

+

(7 - 14D) -

+

(104W)

+

(104W)

CAR KO 3000 b

- - ND - ND ND ND

Females

WT 200 - - ND - ND - -

500 -

+

(52W) ND - ND - -

1500

+

(7D)

+

(7D - 104W) ND

+

(7D) d ND - -

3000

+

(7 - 14D)

+

(7D - 104W) ND

+

(7 - 14D) ND

+

(104W)

+

(104W)

WT: wild type Wistar rats. CAR KO: CAR Knock out rats. + with shadow indicates effect present at indicated time points of the treatment. - indicates effect absent at indicated time points of the treatment.

ND indicates No data.

a: Although hepatocyte labeling index values, determined as BrdU labeling index, may return toward control levels with continued momfluorothrin treatment for more than 14 days, the number of cell

replications in treated animals appeared to be enhanced due to the increased total number of hepatocytes per animal. In this Table, “Increased cell proliferation” means “Increased total cell proliferation”.

b: The key/associative events in the CAR KO rat study were determined after 7 days treatment.

c: Increased PROD activity in males at 1500 ppm was a marginal change without statistical significance (1.2-fold of control).

d: Cell proliferation in both sexes at 1500 ppm were determined only after 7 days treatment.

e: The combined incidence of hepatocellular adenoma and carcinoma was increased in male rats given 1500 ppm momfluorothrin, with a non-statistically significant. As the incidences of hepatocellular

adenoma, carcinoma, and combined in males given 1500 ppm momfluorothrin were equivalent to or higher than the maximum incidence of the historical background, 1500 ppm was concluded as tumor

inducing dose level. Table is adapted from Okuda et al., (2017a).

Do

se l

evel

49 / 120

Indeed, the present data demonstrate that the effects on hepatocellular proliferation,

CYP2B enzyme induction and liver hypertrophy were less marked in male Wistar rats

given 1500 compared to 3000 ppm momfluorothrin (Table 4).

In females given 1500 ppm momfluorothrin, while the early events such as the

increased hepatic CYP2B activity, relative liver weight and hepatocellular proliferation

were observed after 7 days of treatment, liver tumor formation was not increased

(Table 6).

4. Temporal Association

If a key event (or events) is an essential element for carcinogenesis, it must precede

the appearance of the tumors. Data are available for the effect of treatment of male and

female Wistar rats with momfluorothrin at various time points ranging from 7 days to 2

years (Table 6). The treatment of male and female Wistar rats with momfluorothrin for 7

days resulted in an induction of CYP2B enzymes. Cell proliferation, assessed as the

hepatocyte labeling index, was increased in male and female Wistar rats given

tumorigenic dose levels of momfluorothrin for 7 and 14 days. Momfluorothrin produced

increases in liver hypertrophy (assessed both by morphology and as increases in liver

weight) at a number of early time points and also at later time points. Examination of

liver sections from the momfluorothrin two year bioassay revealed increases in altered

cell foci at the tumorigenic dose level of 3000 ppm in male and female Wistar rats.

Three of 51 male Wistar rats given 1500 ppm momfluorothrin also had altered cell foci

(Table 1). As altered foci are the precursor lesions for subsequent tumor formation in

rodent liver (Elcombe et al., 2014), it is considered that the liver foci developed before

the appearance of liver tumors. Overall, there is a logical temporal sequence for all key

50 / 120

and associative events in momfluorothrin-induced liver tumor formation, in which all

key and associative events precede tumor formation (Table 6).

In females at 1500 ppm, while the early events such as the increased hepatic

CYP2B activity, relative liver weights and hepatocellular proliferation were observed

after 7 days of treatment, liver tumor was not increased (Table 6). Incidence of the

eosinophilic hepatocellular foci was observed at 1500 ppm with a non-statistically

significant increase and higher than average but less than highest incidence of historical

control (Table 1). These finding suggest that 1500 ppm momfluorothrin induced the

early events but not later events promoting from foci to tumor in female Wistar rats.

5. Strength, consistency and specificity of association of key events and tumor

response

As mentioned above, the effects of momfluorothrin on key and associative events at

early phase of treatment correlated with the dose-relationship for liver tumor formation.

Furthermore there is a logical temporal sequence for all key and associative events in

momfluorothrin-induced liver tumor formation, in which all key and associative events

precede tumor formation.

The effects of momfluorothrin on liver weight, hepatocellular hypertrophy and

CYP2B enzyme induction after 7 days of treatment were shown to be reversible after 7

days of cessation of treatment. Therefore, effects of short term treatment with

momfluorothrin on the liver are reversible, which is consistent with the known hepatic

effects of other mitogenic rodent liver CAR activators (LeBaron et al., 2013, 2014;

Osimitz and Lake, 2009; Tinwell et al., 2014; Yamada et al., 2014).

51 / 120

6. Biological plausibility and coherence

The proposed MOA for liver tumor formation by momfluorothrin involves

activation of CAR which results in the key event of increased cell proliferation.

Associative events include induction of CYP2B enzymes and liver hypertrophy.

Prolonged treatment results in the formation of altered hepatic foci and liver tumors

(Table 6). This MOA is similar to that of several other non-genotoxic rodent liver

carcinogenic agents which are CAR activators (Currie et al., 2014; Lake et al., 2015;

LeBaron et al., 2013, 2014; Osimitz and Lake, 2009; Tinwell et al., 2014; Yamada et al.,

2009, 2014).

As described earlier, the key events for the MOA for momfluorothrin-induced rat

liver tumor formation comprise CAR activation, increased cell proliferation and the

development of altered hepatic foci as these constitute necessary steps in the MOA. The

induction of CYP2B enzymes and liver hypertrophy comprise associative events and

represent reliable markers of CAR activation. The role of CAR in CYP2B enzyme

induction and increased hepatocellular proliferation by momfluorothrin was also

demonstrated in cultured rat hepatocytes using the RNAi technique and in an in vivo

study in CAR KO rats. These findings are consistent with those of metofluthrin

(Deguchi et al., 2009; Yamada et al., 2009).

7. Other modes of action

Liver tumors can be produced in rodents by both genotoxic and non-genotoxic

agents (Cohen and Arnold, 2011; Williams, 1997). Momfluorothrin is clearly not

genotoxic, being negative in a variety of in vivo and in vitro genotoxicity assays (Ames

test, in vitro chromosomal aberration test, in vitro gene mutation assay, UDS assay and

52 / 120

mouse micronucleus test)(ECHA, 2014). Liver tumors can be produced in rodents by

various non-genotoxic MOAs including cytotoxicity, activation of CAR, activation of

PPAR, porphyria, statins and hormonal perturbation (Cohen, 2010; Cohen and Arnold,

2016; Holsapple et al., 2006; Klaunig et al., 2003; Meek et al., 2003). In the general

toxicity studies, utilizing both histopathology and electron microscopy techniques, there

was no evidence of hepatocellular toxicity (e.g. necrosis, fatty liver), peroxisome

proliferation, porphyria, statin-like alterations, increased iron deposition or any evidence

of hormonal perturbation. In addition, as shown in Fig. 4, unlike effects on CAR, gene

expression profiling analysis studies demonstrated no marked alterations in either

PPAR, AhR or PXR signaling. Overall, it is considered that the hepatic effects of

momfluorothrin in the rat and subsequent liver tumor formation are mediated by

activation of CAR.

Although some oxidative stress related genes were increased in the global gene

expression analysis (Okuda et al., 2017a), the direct endpoints related to oxidative stress

have not examined. Oxidative stress in the liver after administration of PB or

metofluthrin was assessed by MDA as an indicator of lipid peroxidation, as well as total

and reduced glutathione as a measure of antioxidant capacity. However, no evidence

was obtained for the involvement of oxidative stress in PB or metofluthrin-induced rat

liver tumor formation (Deguchi et al., 2009). In the liver of rats treated with

momfluorothrin, there was no histopathological evidence indicating increased oxidative

stress, such as degenerative findings like necrosis and fibrosis. Though oxidative stress

has been implicated as an important factor in the carcinogenesis process for both

genotoxic and nongenotoxic mechanisms (Klaunig and Kamendulis, 2004), it was not

identified as a key event for liver tumor formation by PB and other CAR activators

53 / 120

(Elcombe et al., 2014).

8. Uncertainties, inconsistencies, and data gaps

No data have been obtained for effects of momfluorothrin treatment on apoptosis

and inhibition of gap junctional intercellular communication, which were identified as

an associative event and an associative event/modulating factor, respectively, in the

MOA for PB-induced rodent liver tumor formation proposed by Elcombe et al. (2014). I

consider that, since decreased apoptosis or inhibition of gap junctional intercellular

communication are not key events (Elcombe et al., 2014), these data gaps do not alter

the overall conclusion regarding the postulated MOA for momfluorothrin-induced rat

liver tumors.

9. Conclusions

These data are considered adequate with a high degree of confidence to explain the

development of liver tumors in rats following chronic administration of momfluorothrin.

As described above, a plausible MOA for momfluorothrin-induced rat liver tumor

formation have been established as CAR activated MOA, with a strong

dose-dependency and temporal consistency, that is similar to certain other

non-genotoxic mitogenic rodent liver carcinogenic agents which are CAR activators

including PB and metofluthrin (Currie et al., 2014; Kushida et al., 2016; Lake et al.,

2015; LeBaron et al., 2013, 2014; Osimitz and Lake, 2009; Tinwell et al., 2014;

Yamada et al., 2014, 2015). Alternative MOAs for momfluorothrin-induced rat liver

tumor formation have been excluded. Therefore, the answer to question 1 “Is the WoE

sufficient to establish a MOA in animals?” in the IPCS framework is Yes.

54 / 120

Chapter 2

Evaluation of human relevancy for rat hepatocellular tumors induced by

momfluorothrin

2-1

Utility analysis of novel humanized chimeric mice with human hepatocytes for human

risk assessment treated with CAR activator, NaPB

55 / 120

Introduction

In the previous chapter, it was identified the MOA for momfluorothrin-induced rat

liver tumors mediated by CAR activation pathway. CAR is the molecular target of CAR

activators (i.e. PB, metofluthrin, and momfluorothrin) and activation of this receptor is

an essential for the rodent liver tumor development (Okuda et al., 2017a; Yamada et al.,

2015; Elcombe et al., 2014; Huang et al., 2005; Wei et al., 2000; Yamamoto et al.,

2004). A number of studies using PB have shown that the CAR is also present in the

human liver and that the receptor can be activated by various drugs and chemicals

(Elcombe et al., 2014; Molnar et al., 2013; Moore et al., 2003), but CAR-mediated liver

non-genotoxic carcinogenesis is not generally considered to be human-relevant (Cohen,

2010; Elcombe et al., 2014; Holsapple et al., 2006; Lake, 2009) because the key species

difference is that while PB stimulates replicative DNA synthesis in rodent hepatocytes,

such effects are not observed in cultured human hepatocytes (Elcombe et al., 2014;

Hirose et al., 2009; Lake, 2009; Parzefall et al., 1991). In addition, there is no clear

evidence for PB-associated liver cancer risk in humans based on epidemiological data

from a large number of clinical studies including long-term therapeutic treatment of

epileptics (Friedman et al., 2009; La Vecchia & Negri, 2014). Based on these data,

evaluation utilizing the ILSI/IPCS framework (Boobis et al., 2006) demonstrates that

the MOA for PB-induced liver carcinogenicity is not relevant for humans (Cohen, 2010;

Elcombe et al., 2014; Holsapple et al., 2006; Lake, 2009).

In addition to the use of hepatocyte culture systems, if the key species difference in

PB-stimulated hepatocyte replicative DNA synthesis could be evaluated in an in vivo

experiment, the results obtained would provide important data for the human risk

56 / 120

assessment of CAR activators like PB. One possible in vivo system for such a study is

the use of humanized mice (Foster et al., 2014; Kitamura and Sugihara, 2014). Recently,

mice with human hepatocyte chimeric livers have been produced by transplanting

human hepatocytes into albumin enhancer/promoter-driven urokinase-type plasminogen

activator-transgenic severe combined immunodeficient (uPA/SCID) mice with liver

disease (Tateno et al., 2004; 2013). The host mouse hepatocytes are replaced with

human hepatocytes in the livers of the chimeric mice to the degree indicated by the

replacement index, which is the occupancy ratio of the human hepatocyte area to the

total (human and mouse) area on histological sections. In some cases, the replacement

index in these mice can be as high as 96%. The transplanted human hepatocytes express

mRNA for a variety of human drug-metabolizing enzymes and transporters, in a manner

similar to that of the donor liver (Tateno et al., 2004; 2013). Chimeric mouse livers

constructed with human hepatocytes contain a small percentage of mouse hepatocytes

and mouse hepatic sinusoidal cells (mainly Kupffer cells, endothelial cells, and stellate

cells). Human hepatocytes have been shown to cooperate with mouse hepatic sinusoidal

cells in liver functions such as enzyme induction (Tateno et al., 2004) and viral

infection (Mercer et al., 2001). Interestingly, human hepatocytes in the livers of

chimeric mice are also susceptible to growth enhancing activities. The treatment of

chimeric mice with human growth hormone (hGH) increases the repopulation speed and

the replacement index of transplanted human hepatocytes, as determined by increased

replicative DNA synthesis and the up-regulation of GH-related signalling molecules

(Masumoto et al., 2007). Furthermore, partial hepatectomy also enhances hepatocellular

proliferation in chimeric mice (personal communication, Dr. Chise Tateno). These

57 / 120

findings thus suggest that transplanted human hepatocytes in chimeric mice are

responsive to hepatocyte mitogens.

The objective of the present study was to examine whether studies with chimeric

mice with humanized liver could provide further support for previous evaluations of the

MOA for PB-induced rodent liver tumor formation which have concluded that this

mitogenic MOA is not relevant for humans (Cohen, 2010; Elcombe et al., 2014;

Holsapple et al., 2006; Lake, 2009). The effects of NaPB-treatment on key and

associative events observed at the early phase of treatment were compared in CD-1

mice, Wistar Hannover rats, and in chimeric mice with humanized liver.

These obtained experimental and analytical data have already been published from

Toxicological Sciences (Yamada et al., 2014).

58 / 120

Materials and Methods

Test chemical.

Momfluorothrin and metofluthrin were provided by Sumitomo Chemical Co., Ltd.

(See chapter 1). NaPB (Lot No. TLQ4248; purity, 98.0%) and human epidermal growth

factor (hEGF; AF-100-15), Peprotech (EC, London, United Kingdom) were purchased

from Wako Pure Chemical Industries, Ltd. (Osaka, Japan).

Animals and husbandry.

All experiments were performed in accordance with The Guide for Animal Care

and Use of Sumitomo Chemical Co., Ltd.; The Guide for Biosafety of Sumitomo

Chemical Co., Ltd.; or with the ethical approval of the PhoenixBio Ethics Board.

CD-1 mouse and Wistar Hannover rat.

Male Crlj:CD1(ICR) mice aged 9 weeks and male HarlanRCCHanTM:WIST rats

(WH rats) aged 9 weeks were purchased from Charles River Japan, Inc., Hino Breeding

Center (Shiga, Japan) and Japan Laboratory Animals, Inc., Hanno Breeding Center

(Saitama, Japan), respectively. The animal acclimatization and environmental conditions

were same as chapter 1.

Chimeric mouse.

The in-life phase of the experiment using chimeric mice and SCID mice was

performed at PhoenixBio Co., Ltd. (Higashihiroshima, Japan). Chimeric mice with

human hepatocytes (PXB mouse®, PhoenixBio Co., Ltd) were produced as previously

described (Tateno et al., 2004; 2013). Briefly, cryopreserved human hepatocytes (donor

59 / 120

ID: BD195) were purchased from BD Biosciences, Woburn, MA, USA. Human

hepatocytes were transferred to homozygotic cDNA-uPA+/+

/SCID mice aged 20-30

days as donor cells for the chimeric mice because cells from young subjects are more

responsive to stimulation of hepatocellular proliferation (Masumoto et al., 2007). For

transplantation, vials of cryopreserved human hepatocytes (5-15 x 106 cells/vial) were

thawed and transplanted into 20-60 uPA/SCID mice (2.5 x 105 viable cells/mouse).

Since the human albumin (hAlb) concentration in mouse blood correlates well with the

replacement index (Tateno et al., 2004), the hAlb concentration in the blood samples

was measured to predict the replacement index of human hepatocytes in mouse livers.

Chimeric mice have previously been shown to have almost confluent human

hepatocytes at 64 days and 81 days after transplantation (Tateno et al., 2004). To reduce

possible variation of background levels of replicative DNA synthesis, treatment with

NaPB was commenced more than 70 days after transplantation (animal age 14-17

weeks). Human hepatocytes in chimeric mice are considered to be deficient in GH

because the human GH receptor is unresponsive to mouse GH (Souza et al., 1995). Due

to a lack of human GH in chimeric mice, the chimeric mouse liver spontaneously

becomes fatty in the human hepatocyte regions about 70 days after transplantation

(Tateno et al., 2011). Therefore, to mimic the normal in vivo condition and to decrease

steatosis, Alzet minipumps (Model 1002, Alzet Corporation, Palo Alto, CA, U.S.A.)

containing recombinant human GH (Wako Pure Chemical Industries Ltd.), with a

release rate of 2.05 µg/hr, were implanted in the subcutaneous tissue of mice under

isoflurane anesthesia on the day prior to 7 days before the commencement of chemical

treatment. The animals were housed in a clean room with HEPA filtered air. During the

course of the study, the environmental conditions in the animal room were set to

60 / 120

maintain a temperature range of 18 - 28 °C and a relative humidity range of 30 - 80,

with frequent ventilation and a 12 hour light (8:00 - 20:00)/ 12 hour dark (20:00 - 8:00)

illumination cycle. A commercially available pulverized diet (CRF-1; Oriental Yeast

Co., Ltd., Tokyo) containing vitamin C (300 mg/100g diet) and filtered tap water were

provided ad libitum throughout the study. The animals were not fasted overnight prior to

sacrifice. Mice were randomly assigned to each group based upon body weight and

replacement indices, so that there was no significant difference in mean body weight

and replacement indices among the groups.

Design for study.

In the hEGF study, the effects of hEGF treatment (150 μg/kg, 4 times per day, i.p.,

for 2 days) on human hepatocyte replicative DNA synthesis were determined in

chimeric mice (5 animals/dose).

The design of the NaPB study is summarised in Table 7. Male CD-1 mice and WH

rats (8 animals/dose) were fed diets containing 0 (control), 500, 1000, 1500, or 2500

ppm NaPB for 7 days. In previous bioassays, liver tumors were increased in a number

of mouse strains at a NaPB dietary level of 500 ppm (IARC, 2001; Whysmer et al.,

1996) and at a dietary level of 1000 ppm in male mice of the low spontaneous tumor

incidence C57BL/10J mouse strain (Jones et al., 2009). Therefore, dietary levels of 500

and 1000 ppm were selected for this study. In addition, in order to evaluate the effects of

higher doses of NaPB, dietary levels of 1500 and 2500 ppm were also investigated. In

the dose setting study where chimeric mice (3 mice/dose) with less than a 70%

replacement index were given NaPB at dose levels of 0, 1500, 2000, and 2500 ppm, one

of three animals died at each of 2000 and 2500 ppm doses. Diets containing 0 (control)

61 / 120

or 1500 ppm were fed to chimeric mice (5 mice/dose) with more than a 70%

replacement index for 7 days in the main study. However, 3 of 5 chimeric mice given

1500 ppm NaPB also died. Replicative DNA synthesis and other data was thus only

obtained from two animals at 1500 ppm. Therefore, additional chimeric mice fed diets

containing 0 (control), 500, and 1000 ppm were investigated and the combined data

from these two experiments were evaluated to obtain dose-response effects of NaPB in

chimeric mice. SCID mice were treated with 0 (control) and 1500 ppm for comparison

with the highest dose group in the chimeric mouse study. As significant increases in

hepatocyte replicative DNA synthesis, determined as the hepatocyte labeling index, are

observed transiently at the early phase of treatment with NaPB in rodents (Cohen and

Arnold, 2011; Elcombe et al., 2014; Lake, 2009), a 7-day treatment period was selected

for the present study.

Mortality, body weight, and food consumption were monitored throughout the study.

Alzet minipumps (Model 2001 in CD-1 and chimeric mice, Model 2ML1 in rats; Alzet

Corporation) containing BrdU (Sigma Company, St Louis, MO, U.S.A.), with a release

rate of 40 and 200 µg/hr, respectively, were implanted in the subcutaneous tissue of

mice and rats, under anesthesia with diethyl ether or isoflurane on the day prior to 7

days (2 days for the hEGF study) before the scheduled euthanasia. After the 7-day

treatment period, blood was collected at euthanasia from all surviving animals from the

abdominal aorta under diethyl ether anesthesia (CD-1 mice and WH rats) and from the

heart under isoflurane anesthesia (chimeric mice and SCID mice) without prior fasting.

62 / 120

Table 7. Summary of study design of NaPB study.

Animals CD-1 mice Wistar Hannover rats Chimeric mice a SCID mice

Sex Male

Age (weeks) 10 10 14 10-14

Number of animals per dose 8 8 5 b 5

NaPB dose levels (ppm) 0, 500, 1000, 1500, 2500 0, 500, 1000, 1500, 2500 0, 500, 1000, 1500 c 0, 1500

Human GH treatment d No No Yes No

Administration route In diet

Administration period (days) 7

Measurements e Body weight, food consumption, plasma concentration of PB, hepatic CYP2B activity (PROD activity),

hepatocyte replicative DNA synthesis (BrdU labeling index), liver histopathology (light and electron

microscopy), functional transcriptomic and metabolomic analyses, and selected gene expression determined by

quantitative real-time polymerase chain reaction

a: The range of replacement index with human hepatocytes in chimeric mice used in the present study was 73-90%.

b: Control (0 ppm) group of chimeric mice consisted of 9 animals because data from two experiments were combined.

c: Chimeric mice were not examined at 2500 ppm due to death in preliminary dose setting study. Data at 1500 ppm in chimeric mice is from two surviving

animals.

d: Due to a lack of human GH in chimeric mice, the chimeric mouse liver spontaneously becomes fatty in the human hepatocyte regions about 70 days after

transplantation (Tateno et al., 2011). Therefore, to mimic the normal in vivo condition and to decrease steatosis, Alzet minipumps containing recombinant

human GH were implanted in the subcutaneous tissue of mice on the day prior to 7 days before the commencement of NaPB treatment.

e: Electron microscopy was only examined in chimeric mice, and functional transcriptomic and metabolomic analyses were not examined in SCID mice.

Table is adapted from Yamada et al., (2014).

63 / 120

All organs and tissues from all animals were subjected to gross pathological

examination. The liver of all animals was weighed under wet condition. Relative organ

weight (organ weight to body weight ratio) was calculated on the basis of the body

weight on the day of euthanasia. After necropsy, a piece of liver from all surviving

animals was removed and stored in RNA stabilization solution (Life Technologies Co.,

Carlsbad, CA) at 4°C overnight. After that, the RNA stabilization solution was removed

and these samples were moved to a deep freezer at –80°C for analysis for gene

expression, whereas the rest of the liver tissue was processed for hepatic microsomal

CYP enzyme activity, histopathology, and replicative DNA synthesis measurements.

The blood samples were immediately centrifuged at 2150 g for 15 min at 4 °C and the

plasma samples obtained were immediately extracted with a 3-fold volume of

acetonitrile. The supernatants were stored at -80 °C until examined by liquid

chromatography/mass spectrometry (LC/MS) analysis.

Plasma concentration of PB.

Chromatographic separation was performed by a CapcellPak C18 MG II column

(35 x 3 mm, 3 µm, Shiseido). The mobile phase was A; 0.1% formic acid in water and

B; acetonitrile delivered at a flow rate of 0.5 mL/min, and the gradient condition

was %B = 5% (0 min) - 100% (5 min). MS data acquisition was accomplished in

selected reaction monitoring mode (SRM) for PB (negative, m/z=231/188) with an

atmospheric pressure chemical ionization interface using a TSQ Vantage (Thermo

Fisher Scientific Inc.). Standard curves were obtained using NaPB.

64 / 120

Quantitative real-time PCR.

CYP2B mRNA expression levels were determined in livers of all surviving animals

from each model. Quantitative real-time PCR assays were performed as described

chapter 1. The primer and probe sequences are listed in Table 3.

Hepatic CYP enzyme activity.

Liver postmitochondrial supernatant (S9) fractions were prepared and CYP2B

activity was determined as PROD by fluorometric analysis using the specific substrate

for CYP2B enzyme as shown chapter 1.

Liver histopathology.

Livers from all surviving animals were examined by light microscopy and

transmission electron microscopy in described chapter 1. In addition, for chimeric mice,

the right lateral lobe in the control and NaPB 1500 ppm groups was prefixed by

perfusing 2.5% glutaraldehyde in 0.2 M phosphate buffer (pH 7.4) using a syringe for 2

animals/group. Human hepatocyte-originated areas of these liver samples were cut into

piece of less than 5 mm in thickness with a razor blade in 2.5% glutaraldehyde in 0.2 M

phosphate buffer (pH 7.4).

Hepatocyte replicative DNA synthesis.

The cell proliferation rate was evaluated as replicative DNA synthesis determined

as the BrdU labeling index. BrdU labeling was analyzed microscopically in a blinded

manner with more than 2000 hepatocytes per animal being evaluated in CD-1 mice and

WH rats. An image analysis system was used to evaluate the BrdU labeling indices of

65 / 120

human hepatocytes in chimeric mice and mouse hepatocytes in SCID mice. Glass slides

were scanned at 20x magnification using Olympus VS120 virtual slide scanning system

(Olympus, Tokyo, Japan) and Definiens Tissue Studio software (Definiens, Munich,

Germany). Areas consisting of human hepatocytes (without inflammation or necrosis)

were selected manually with at least one area from each of 4 lobes (lateral left lobe,

lateral right lobe, medial right lobe and medial left lobe) and custom-made image

analysis algorithms were applied to the digital slides to automatically detect and

quantify the number of positively and negatively stained hepatocytes. The total number

of evaluated human hepatocytes was more than 8,000 per chimeric or SCID mouse.

Statistical analysis.

See chapter 1.

66 / 120

Results

Summary of the effect of NaPB treatment on some selected endpoints are shown in

Table 8. In this study data are expressed on a plasma PB µg/mL basis, rather than on a

ppm dietary dose level basis, in order to permit a clearer evaluation of species

differences in the effects of NaPB treatment.

Mortality and Body weight

One CD-1 mouse given 2500 ppm NaPB, three chimeric mice given 1500 ppm

NaPB and one control chimeric mouse died during treatment (data not shown),

suggesting that the maximum tolerated dose of NaPB in chimeric mice is lower than

that in both CD-1 mice and WH rats. A statistically significant suppression of final body

weight with concomitant lower food consumption was observed in WH rats treated with

NaPB 2500 ppm (data not shown). The body weights of the two surviving chimeric

mice given 1500 ppm NaPB were similar to those of control chimeric mice.

NaPB Intake and Plasma Levels

NaPB intakes, calculated from food consumption and NaPB concentration in diet

data, and plasma PB levels were increased in a dose-dependent manner in CD-1 mice,

WH rats, and chimeric mice (Table 8). While mean plasma PB levels were similar in

CD-1 mice and WH rats, chimeric mice had the highest plasma PB levels at each NaPB

dietary level. The ranges of PB plasma levels in chimeric mice given 500, 1000 and

1500 ppm NaPB were 17.3-35.9 µg/mL, 40.1-149.4 µg/mL, 86.3-146.1 µg/mL,

respectively.

67 / 120

Table 8. Summary for responses to NaPB treatment in CD-1 mice, Wistar Hannover rat, chimeric mice and SCID mice

CD-1 mice WH rats Chimeric mice SCID mice

(ppm) 500 1000 1500 2500 500 1000 1500 2500 500 1000 1500 c

1500

Overall NaPB intake

(mg/kg/day)

59 120 180 250 30 60 85 120 69 150 230 220

Plasma NaPB levels

(µg/mL)

12 30 43 70 8.0 20 35 61 27 75 120 43

Absolute liver weight a 1.2 1.5 1.5 1.6 1.1 1.2 1.2 1.2 1.2 1.2 1.2 1.4

Relative liver weight a 1.2 1.4 1.5 1.7 1.1 1.2 1.2 1.3 1.1 1.1 1.1 1.5

PROD activity a 4.4 5.4 6.4 6.4 22 27 24 20 6.8 14 14 13

CYP2B mRNA levels a 43 59 61 62 170 220 230 250 6.9 7.4 11 160

Hepatocyte hypertrophy b 8/8 8/8 7/7 7/7 8/8 6/8 8/8 8/8 1/5 1/5 2/2 5/5

BrdU labeling index a 5.7 13 18 17 3.9 4.6 4.7 4.4 1.9 1.3 1.4 4.6

a: Vales are presented as fold control at each dose level. Values statistically significantly different from control (p<0.05) are presented with bold red.

b: Results are presented as number of animals with findings per number of animals examined.

c: Data at 1500 ppm in chimeric mice which is from two surviving animals was not analyzed statistically.

Table is adapted from Yamada et al., (2014).

68 / 120

In this paper most data are expressed on a plasma PB µg/mL basis, rather than on a

ppm dietary dose level basis, in order to permit a clearer evaluation of species

differences in the effects of NaPB treatment.

Liver weight and morphology

Statistically significant, dose-dependent increases in absolute liver weight were

observed in CD-1 mice, WH rats and chimeric mice (Table 8). In the highest NaPB dose

group of chimeric mice, the increase was not statistically significant owing to the small

number of animals that survived. Statistically significant, dose-dependent increases in

relative liver weight were observed in CD-1 mice and WH rats, whereas NaPB only

produced small increases in relative liver weight in chimeric mice (Table 8). The

chimeric mouse livers were characterized morphologically (Fig. 10A) and histologically

(Fig. 10B) with respect to the extent of chimerism, in that they contained both white and

red areas (Fig. 10A). The white areas consisted of human hepatocytes and were easily

distinguishable from the areas of mouse hepatocytes. The red nodules that were

distributed sporadically in the livers of chimeric mice represent colonies of

transgene-deleted host hepatocytes, as reported previously (Sandgren et al., 1991). In

the human hepatocytes of chimeric mice treated with 1500 ppm NaPB, cytosolic

glycogen areas were decreased and the size of the cells was slightly increased in the

centrilobular area (Figs. 10C and 10D). These hepatic changes suggest that

human-originated hepatocytes exhibited slight hypertrophic changes after NaPB

treatment, the effect being less marked than that observed in WH rats and CD-1 mice

(data not shown).

69 / 120

Figure 10. Liver gross pathology and histology in chimeric mice. Photographs present gross (A)

and histological (B) appearance of livers of control chimeric mice, with h-heps and m-heps

representing human hepatocytes and mouse hepatocytes, respectively. Histopathology (C, D) and

ultrastructure (E, F) of human hepatocyte-originated areas of chimeric mice given 0 (C, E) and 1500

ppm (D, F) NaPB are also presented. Centrilobular hepatocellular hypertrophy (D) and proliferation

of SER (F) was observed in NaPB treated chimeric mice. Figure is adapted from Yamada et al.,

(2014).

70 / 120

Electron microscopic evaluation was only conducted in chimeric mice treated with

1500 ppm NaPB, which supported the light microscopic changes, since an increase of

SER was observed in the human-originated hepatocytes (Figs. 10E and 10F).

Hepatic CYP2B gene expressions and enzyme activity

CYP2B mRNA levels by NaPB were significantly increased in three animal models,

but the increase was much less in chimeric mice than in CD-1 mice and WH rats (6.9,

7.4, and 11.3-fold at 500, 1000, and 1500 ppm in chimeric mice, respectively) (Fig.

11A). While PROD activity was increased in a dose-dependent manner up to 1000 ppm

NaPB (mean plasma PB level 75.2 µg/mL) in chimeric mice. The maximum fold

change of the PROD activity in chimeric mice (approximately 14-fold control) was

between WH rats (approximately 20~27-fold control) and CD-1 mice (approximately

5~6-fold control) (Fig. 11B). In the highest NaPB dose group of chimeric mice the

increase was not statistically significant owing to the small number of animals that

survived.

71 / 120

Figure 11. Effect of NaPB treatment on CYP2B mRNA expression (A) and hepatic

7-pentoxyresorufin O-depentylase (CYP2B marker) activity (B) in CD-1 mice, WH rats and

chimeric mice. The mRNAs were determined by quantitative real-time PCR and presented as fold

control (0 ppm) levels. Mean values from 5-9 animals except for data at 1500 ppm in chimeric mice

which is from two surviving animals are presented as fold control at each dose level. Values

significantly different from control (0 ppm) are: *p<0.05 and **p<0.01. Figure is adapted from

Yamada et al., (2014).

72 / 120

Replicative DNA Synthesis

In CD-1 mice and WH rats, replicative DNA synthesis was significantly increased

by treatment with NaPB at all dose levels (Figs. 12A). While human hepatocytes in

chimeric mice did not show any significant increase in replicative DNA synthesis at

NaPB dose levels of 1000 and 1500 ppm, even though plasma PB levels (75±46.9 and

116 (86 and 146) µg/mL for 1000 and 1500 ppm) were higher than those of the highest

2500 ppm CD-1 mouse group (70.2±48.7 µg/mL) (Figs. 12A). Interestingly, treatment

with hEGF significantly increased replicative DNA synthesis in human hepatocytes of

chimeric mice (Fig. 12B). Thus, these data clearly demonstrate that transplanted human

hepatocytes in chimeric mice maintain the mitogen signaling. All individual labeling

index values in NaPB-treated chimeric mice were within the control range (2.4~10.7 %)

except for one outlier given 500 ppm NaPB (16.6 %), suggesting that the marginally

higher values in NaPB-treated chimeric mice are not biologically significant (Fig. 12C).

73 / 120

Figure 12. Effect of NaPB treatment on replicative DNA synthesis in CD-1 mice, WH rats, and

chimeric mice. (A) Mean values are presented as fold control at each dose level, (B) the effect of

hEGF treatment (150 µg/kg x 4 times /day, i.p., 2 days) on hepatocyte replicative DNA synthesis in

chimeric mice, (C) Individual values (triangles) with mean value of the dose groups (bars) in

chimeric mice. The shaded area represents the control range. While at 500 ppm mean value of all

animals examined is 7.2%, it is 5.3% when one outlier (16.6%) is excluded. Values significantly

different from control (0 ppm) are: **p<0.01. In chimeric mice, no values were significantly

different (p>0.05) from control (0 ppm) irrespective of inclusion of one outlier. Figure is adapted

from Yamada et al., (2014).

74 / 120

Discussions

The treatment of rats and mice with NaPB results in activation of CAR leading to a

pleiotropic response, which includes liver hypertrophy, induction of CYP2B and other

xenobiotic metabolising enzymes, increased hepatocyte proliferation and ultimately in

the development of altered hepatic foci and liver tumors. A number of evaluations have

identified the key and associative events in the MOA for NaPB-induced rodent liver

tumor formation (Cohen, 2010; Elcombe et al., 2014; Holsapple et al., 2006; Lake,

2009). The pivotal key event in this MOA is the stimulation of hepatocyte replicative

DNA synthesis. Although NaPB produces cell proliferation in rat and mouse

hepatocytes, other models are refractory to the mitogenic effects of this compound

(Elcombe et al., 2014; Lake, 2009). While NaPB induces replicative DNA synthesis in

rodent hepatocytes both in vivo and in vitro, the absence of an increase in cultured

human hepatocytes suggests that the MOA for NaPB-induced rodent liver tumor

formation is qualitatively not plausible for humans (Elcombe et al., 2014).

Apart from in vitro studies with cultured human hepatocytes, another possible model

for investigating the effects of NaPB and related compounds on human hepatocytes is to

utilise immunocompromised mice with humanized livers. The uPA/SCID model used in

this investigation (Tateno et al., 2004; 2013) has been used in a number of toxicity and

metabolism studies to predict human response to drugs and other compounds (Foster et

al., 2014; Kitamura and Sugihara, 2014). The data obtained in this study clearly

demonstrate that transplanted human hepatocytes in chimeric mice are responsive to

hEGF, a hepatocyte mitogen.

CAR is present in human liver and can be activated by drugs and other compounds,

75 / 120

including NaPB (Elcombe et al., 2014; Molnar et al., 2013; Moore et al., 2003). In the

present study the treatment of chimeric mice with human hepatocytes with NaPB

resulted in significant dose-dependent increases in mRNA levels of known CAR-target

genes including CYP2B6. There was also a good correlation between plasma PB levels

and CYP2B6 mRNA levels (Fig. 11A), confirming the functional viability of CAR

signalling in the human hepatocytes of the chimeric mice. The higher induction of

PROD activity in chimeric mice compared to CD-1 mice may be due in part to

contamination by mouse hepatocytes, because unlike the mRNA studies, the method for

examination of PROD activity used in this study does not distinguish between human

and mouse hepatocytes and PROD is not generally used as a marker of CYP2B6 (Fig.

11B). Although the lower responsiveness of chimeric mice to NaPB compared to CD-1

mice and WH rats may be partially attributable to lower expression of CAR mRNA,

species differences in the signalling of CAR target genes are likely contribute to

differences in potency for each response, especially for hepatocellular proliferation.

In keeping with previous studies, the treatment of CD-1 mice and WH rats with

NaPB resulted in significant increases in hepatocyte replicative DNA synthesis.

Treatment with NaPB also increased replicative DNA synthesis in hepatocytes of SCID

mice (Table 8). In contrast to CD-1 mice, WH rats and SCID mice, the treatment of

chimeric mice with NaPB did not result in any increase in hepatocyte replicative DNA

synthesis (Table 8).

The plasma levels of PB observed in chimeric mice with human hepatocytes after

treatment with NaPB were higher than those obtained in both CD-1 mice and WH rats.

In addition, the dose setting study established that that NaPB dietary levels of >1500

ppm could not be administered to chimeric mice with human hepatocytes. It is therefore

76 / 120

considered that the lack of effect of NaPB on replicative DNA synthesis in chimeric

mice with human hepatocytes is an accurate finding, as higher dose levels of NaPB

could not be examined in this study. Moreover, the plasma levels of PB observed in

chimeric mice with human hepatocytes in this study following treatment with 1000 and

1500 ppm NaPB were around 3-5 fold higher than those reported in human subjects

given therapeutic doses of 3-6 mg/kg where plasma levels ranged from 10-25µg/mL

(Monro, 1993).

In conclusion, some of the key and associative events in the MOA for

NaPB-induced rodent liver tumor formation are observable in human liver. However,

the key species difference is that although NaPB is a mitogenic agent in rat and mouse

liver, no such effect is observed in human liver. To date, the major evidence that NaPB

is not mitogenic in human liver comes from studies with cultured human hepatocytes

(Elcombe et al., 2014; Hirose et al., 2009; Lake, 2009). The data obtained in this study

provides additional in vivo evidence for a marked species difference in the mitogenic

effects of NaPB.

77 / 120

Chapter 2

Evaluation of human relevancy for rat hepatocellular tumors induced by

momfluorothrin

2-2

Analysis for the human relevancy for rat hepatocellular tumors induced by

momfluorothrin using cultured rat and human hepatocytes and humanized chimeric

mice

78 / 120

Introduction

In chapter 1, the MOA for rat hepatocellular tumor formation by momfluorothrin

was evaluated based on the ILSI/IPCS framework (Boobis et al., 2006, 2008;

Sonich-Mullin et al., 2001). This MOA study demonstrated that momfluorothrin

produces liver hypertrophy, induces hepatic CYP2B enzymes and increases

hepatocellular proliferation in WT rats but not in CAR KO rats (Okuda et al., 2017a).

Moreover, alternative MOAs for momfluorothrin-induced rat hepatocellular tumor

formation including cytotoxicity, activation of PPARα, accumulation of iron, statin-like

effects and hormonal perturbation have been excluded (Okuda et al., 2017a). These

findings demonstrate that the MOA for hepatocellular tumor formation by

momfluorothrin is the same as that of some other nongenotoxic mitogenic CAR

activators such as metofluthrin, a close structural analogue to momfluorothrin (Yamada

et al., 2009), and PB (Elcombe et al., 2014).

Since increased hepatocellular replicative DNA synthesis is considered to be the

critical key event for CAR-mediated hepatocellular tumorigenesis (Elcombe et al.,

2014), it is important to determine whether the test compound has a mitogenic effect on

human hepatocytes or not.

Based on the MOA for momfluorothrin-produced rat hepatocellular tumors being

the same as that for PB and metofluthrin (Okuda et al., 2017a), the MOA for

momfluorothrin-induced rat hepatocellular tumors is also postulated as not relevant in

humans. To confirm this hypothesis, species differences in mitogenic effects of

momfluorothrin and its major metabolite Z-CMCA

((Z)-(1R,3R)-3-(2-cyanoprop-1-enyl)-2,2-dimethylcyclopropanecarboxylic acid) were

examined using both cultured rat and human hepatocytes in the present study. In

79 / 120

addition to the cultured human hepatocytes, the effects of momfluorothrin and

metofluthrin on replicative DNA synthesis in human hepatocytes of chimeric mice were

examined in this chapter.

These obtained experimental and analytical data were published from the Journal of

Toxicological Sciences (Okuda et al., 2017b).

80 / 120

Materials and Methods

All animal experiments were performed in accordance with The Guide for Animal

Care and Use of Sumitomo Chemical Co., Ltd.; and all experiment using human

hepatocyte preparations were performed in accordance with The Guide for Biosafety of

Sumitomo Chemical Co., Ltd.

Test chemicals

The chemicals were obtained from the following manufacturers: momfluorothrin

(See chapter 1), metofluthrin (See chapter 1), and Z-CMCA (Lot No. SK0712171;

Purity 99.8 %), Sumitomo Chemical Co., Ltd. (Tokyo, Japan); NaPB (Lot No.

KLM4036, purity 98.0%), Wako Pure Chemical Industries, Ltd. (Osaka, Japan); human

recombinant hepatocyte growth factor (hHGF), Sigma-Aldrich (St. Louis, USA); hEGF

(See chapter 2-1), Peprotech (EC, London, United Kingdom).

Cultured hepatocytes study

Hepatocytes

Rat hepatocytes were isolated by a two-step perfusion procedure from

HarlanRccHanTM:WIST male rats aged 10 weeks (purchased from Japan Laboratory

Animals, Inc., Hanno Breeding Center, Saitama, Japan) (Hirose et al., 2009; Yamada et

al., 2015). Viability (range 80 - 92 %) was determined by trypan blue exclusion. Rat

hepatocytes were cultured in William’s medium E (GIBCO) (See chapter 2 in materials

and methods)

Cryopreserved human hepatocytes for the cell culture study were obtained from

Celsis IVT (MD, USA). A total of ten different human hepatocyte preparations were

81 / 120

used in this study. Information on the donors of the hepatocyte preparations used is

presented in Table 9. Human hepatocytes were thawed and plated according to the

supplier's instructions. Briefly, cryopreserved hepatocytes were thawed at 37 ºC for 1

min, transferred into 20 mL in William’s medium E containing 2 mM L-glutamine, 0.1

µM bovine insulin, 1 µM dexamethasone, 10 mM nicotinamide, 0.2 mM L-ascorbic

acid, 0.5 ng/ml hEGF, and 10 % (v/v) fetal bovine serum. The supernatant was

discarded and the hepatocytes were resuspended in Williams’ medium E containing the

additions described above (Yamada et al., 2015).

For assays of CYP2B mRNA induction, rat hepatocytes were plated at a density of

4.0 x 105 cells/well per 2 mL of medium containing the above additions in 6-well plates

(two rats) and 6.0 x 104 cells/well per 500 µL of medium containing the above additions

in 24-well plates (3 rats); human hepatocytes were plated at a density of 3.0 x 105

cells/well per 500 µL of medium containing the above additions in 24-well plates. For

assays of replicative DNA synthesis, rat and human hepatocytes were plated at a density

of 1.0 x 104 and 3.5 x 10

4 cells/well per 100 µL of medium containing the above

additions, respectively, in 96-well plates. All tissue culture plates were coated with

collagen I (AsahiTechnoGlass, Japan) and the hepatocytes were cultured at 37 ºC in a

humidified incubator under an atmosphere of 95 % air/5 % carbon dioxide (Hirose et al.,

2009; Yamada et al., 2015).

82 / 120

Table 9. Details of human hepatocyte preparations studied

Human hepatocytes were obtained from Celsis (Bioreclamation IVT) (# 1-10) or BD Biosciences (# 11-13).

Endpoints determined: A: cell viability; B: BrdU incorporation; C: CYP2B mRNA expression; and D: liver

weight.

CVA: Cerebrovascular attack; ICH: Intracerebral hemorrhage; MVA: Motor vehicle accident; RD: Respiratory

Disease.

Table is adapted from Okuda et al., (2017b).

# Lot

No. of

donor

Gender Ethnicity Age Smoking Alcohol Drug

use

Cause of

death

Experiments Endpoints

determined

1 BHL Male Caucasian 28 Yes Yes Yes ICH-Stroke Cultured cell

studies

A, B

2 ETA Female Caucasian 80 Yes No

reported

No

reported

CVA A, B

3 CDP Male Caucasian 58 No No No CVA B

4 DOO Male Caucasian 57 No No No Anoxia;

2nd to CVA

B, C

5 FCL Female Hispanic 10

months

No No No

reported

Anoxia/

drowning

B, C

6 IPH Female Caucasian 52 No No No Anoxia;

2nd to CVA

7 LLA Male Caucasian 26 Yes Yes No

reported

Head trauma

8 LMP Female Caucasian 38 Yes Yes No

reported

CVA

9 MMM Female Caucasian 3 No No No Drowning

10 QOQ Male Caucasian 66 Yes Yes No CVA

11 BD87 Male Caucasian 2 No No

reported

No MVA Chimeric

mouse studies

B, C, D

12 BD85 Male African

American

5 No No

reported

Yes

(RD)

Anoxia

13 BD195 Female Hispanic 2 No No

reported

No MVA

83 / 120

Chemical treatment

For assays of CYP2B induction, rat and human hepatocytes were incubated for 48

hours in medium containing the above additions and in William’s medium E containing

2 mM L-glutamine, 0.7 µM bovine insulin, and 50 µM hydrocortisone hemisuccinate

(Sigma-Aldrich), respectively. Rat and human hepatocytes were treated with

momfluorothrin (1, 5, 10, 50, 100, 500, and 1000 µM), Z-CMCA (5, 10, 50, 100, 500,

and 1000 µM) and NaPB (500 (rat hepatocytes only) and/or 1000 µM). As a vehicle

control, all media were supplemented with dimethyl sulfoxide (DMSO) at a final

concentration of 0.1% (v/v). The medium was changed after 4 hours (only rat) from

plating the hepatocytes and then at 24 hour intervals. For each concentration of the test

chemicals the assays were run in three wells of 6-well plates or in three wells of 24-well

plates. Studies were performed with hepatocyte preparations from five rats and seven

human donors, and each assay was performed on a different isolation and donor (not

pooled).

For assays of replicative DNA synthesis, rat and human hepatocytes were incubated

for 48 hours in medium same as CYP2B induction assay. Rat and human hepatocytes

were treated with momfluorothrin (1, 5, 10, 50, 100, 500, and 1000 µM), Z-CMCA (5,

10, 50, 100, 500, and 1000 µM for rat hepatocytes; 5, 100, 500, and 1000 µM for human

hepatocytes), NaPB (500 and 1000 µM) and recombinant hHGF (10 and 100 ng/mL),

which is a well-known growth factor stimulating replicative DNA synthesis in

hepatocytes (Hirose et al., 2009; Runge et al., 1999; Yamada et al., 2015). In the media

containing momfluorothrin, Z-CMCA, NaPB and hHGF for rat and human hepatocytes,

0.5 ng/mL EGF was added to activate DNA synthesis (Runge et al., 1999). As a vehicle

control, all media were supplemented with DMSO at a final concentration of 0.1% (v/v).

84 / 120

The medium was changed after 4 hours (only rat) from plating the hepatocytes and then

at 24 hour intervals. Assays were run in either eight or twelve wells of 96-well plates at

each concentration of the test chemicals and hHGF. Studies were performed with

hepatocyte preparations from eight rats and ten human donors.

Determination of DNA synthesis

The extent of DNA synthesis was determined by measuring BrdU (Sigma-Aldrich)

incorporation into DNA over a 24 hour period in humidified incubator at 37 ºC, using a

Cell Proliferation ELISA BrdU (chemiluminescent) kit (Roche, Germany) as previously

described (Hirose et al., 2009; Yamada et al., 2015). BrdU (100 µM) was added to the

medium at the point of the medium change after 24 hours of chemical treatment. After

24 hours treatment with the test chemicals and hHGF in medium containing BrdU,

hepatocytes were dried and fixed according to the kit supplier's instructions. The

luminescences of the samples were measured with a luminometer (EnVision,

PerkinElmer), with the measurements being conducted by Sumika Technoservice

Corporation (Hyogo, Japan). The proliferation rate was calculated from the luminescent

intensity compared to untreated controls.

CYP2B mRNA expression analysis by quantitative real-time PCR

At the end of the treatment period, the medium was removed and the hepatocytes

(approximately 2-4 x 105 cells) were washed with PBS (pH 7.4). Total RNA preparation

and quantitative real-time PCR assays for rat CYP2B1/2 and human CYP2B6 were

performed as described chapter 1. In addition, levels of rat and human GAPDH mRNA

were determined as internal controls. The primer and probe sets are listed in Table 3.

85 / 120

Cell viability analysis

Under the same conditions as for the experiments for replicative DNA synthesis,

cell viability was analyzed employing a Cell counting kit (Dojindo laboratories,

Kumamoto, Japan) as previously described (Yamada et al., 2015). Briefly, rat and

human hepatocytes were incubated in 96-well plates at a density of 1.0 x 104 and 3.5 x

104 cells/well, respectively, for 48 hours with medium containing momfluorothrin (10,

50, 100, and 1000 µM), Z-CMCA (50, 100 and 1000 µM), NaPB (1000 µM), or hHGF

(10 and 100 ng/mL). As a vehicle control, all media were supplemented with DMSO at

a final concentration of 0.1 % (v/v). The medium was changed after 4 hours (only rat)

from plating the hepatocytes and then at 24 hour intervals. After the test chemical

treatment, medium containing the Cell counting kit reagent was added to each well and

the cells incubated for 4 hours at 37 °C. The plates were read using a microplate reader

(SH-1000 Lab, Corona Electric, Ibaraki, Japan) at a wavelength of 450 nm. The

measurements were conducted by Sumika Technoservice Corporation. Cell viability

was determined with two preparations each of cultured rat and human hepatocytes.

Since an initial screening conducted in two preparations each of cultured rat and

human hepatocyte (Lot numbers of human hepatocytes were BHL and ETA) showed

that momfluorothrin and Z-CMCA had no marked cytotoxicity, cell viability was not

examined in other preparations.

Humanized chimeric mice study

The in-life phase of the experiments using chimeric mice was performed at

PhoenixBio Co., Ltd. (Hiroshima, Japan). Three experiments focused on the cell

proliferation effects on human hepatocytes were conducted with chimeric mice

86 / 120

produced by individual three donors (donor ID; BD87, BD85, and BD195, see Table 9).

Briefly, cryopreserved human hepatocytes from donors BD85, BD87 and BD195 were

purchased from BD Biosciences, Woburn, MA, USA. Human hepatocytes from donors

BD85 and BD87 were transferred to homozygotic cDNA-uPA+/+

/SCID mice and

hepatocytes from donor BD195 were transferred to hemizygotic cDNA-uPAwild/+

/SCID

mice (which is an improved type from homozygotic SCID mice) (Tateno et al., 2015)

aged 20-30 days as donor cells for the chimeric mice because cells from young subjects

are more responsive to stimulation of hepatocellular proliferation (Masumoto et al.,

2007). The range of replacement indices in chimeric mice used in Experiments I (BD87),

II (BD85) and III (BD195) was estimated as 75-89%, 90-100%, and 81-98%,

respectively. The highest dose level in the 2-year rat study in which hepatocellular

tumors were increased by treatment with momfluorothrin and metofluthrin was used in

this study; namely 3000 ppm for momfluorothrin, 1800 ppm for metofluthrin. The dose

level of momfluorothrin was originally set at 3000 ppm in Experiment I, but it was

decreased to 1100 ppm in Experiments II and III due to animal deaths (Days 2 and 3,

commencement of treatment is counted as Day 0) in Experiment I. Since 1500 ppm

momfluorothrin, which was the 2nd

higher dose level in the 2-year rat study, also

showed a palatability problem with similar degree as 3000 ppm in the preliminary dose

setting study (date not shown), 1100 ppm was used in the Experiments II and III.

Chemical intake (170 and 146 mg/kg/day in Experiment II and III, respectively; Table

10) was higher than or equivalent to those at tumorigenic dose levels in males in the rat

2-year bioassay; 73 mg/kg/day at 1500 ppm and 154 mg/kg/day at 3000 ppm. The oral

route was selected because it is one of the potential exposure routes for humans and to

be consistent with the exposure route utilized in the momfluorothrin and metofluthrin

87 / 120

rat carcinogenicity and MOA studies. Diet containing the test compounds was provided

to animals ad libitum for 7 days due to a clear enhancement of hepatocellular

proliferation having been observed in rats in previous studies after 7-days treatment

with momfluorothrin (see chapter 1) and metofluthrin (Yamada et al., 2009).

Mortality, body weight, and food consumption were monitored throughout the study.

Alzet minipumps (Model 2001; Alzet Corporation) containing BrdU (Sigma Company,

St Louis, MO, U.S.A.), with a release rate of 40 µg/hr were implanted in the

subcutaneous tissue of mice, under anesthesia with isoflurane on the day prior to 7 days

before the scheduled euthanasia. After the 7-day treatment period, blood collection,

gross pathological examination, liver weight, and storage of liver sample were

conducted with same methods as chapter 2-1.

Quantitative real-time PCR.

CYP2B mRNA expression levels were determined in livers of all surviving animals

from each model. Quantitative real-time PCR assays were performed as described

chapter 1. The primer and probe sequences are listed in Table 3.

Hepatic CYP enzyme activity.

Liver postmitochondrial supernatant (S9) fractions were prepared and CYP2B

activity was determined as PROD by fluorometric analysis using the specific substrate

for CYP2B enzyme as shown chapter 1.

88 / 120

Liver histopathology.

Livers from all surviving animals were examined by light microscopy and

transmission electron microscopy in described chapter 1. Human hepatocyte-originated

areas of these liver samples were cut into piece of less than 5 mm in thickness with were

fixed in 10 % neutral buffered formalin.

Hepatocyte replicative DNA synthesis.

The cell proliferation rate was evaluated as replicative DNA synthesis described in

chapter 2-1. The total number of evaluated human hepatocytes was more than 8,000 per

chimeric mouse.

Statistical analysis.

See chapter 1.

89 / 120

Results

Cultured hepatocytes study

To compare the responses between rat and human hepatocytes to treatment with

momfluorothrin, Z-CMCA, NaPB and hHGF, the data obtained for cell viability,

CYP2B mRNA expression, and replicative DNA synthesis for both species are

presented in Figs. 13-15.

Cell viability

With respect to cell viability (Fig. 13), none of the treatments produced a marked

reduction in formazan production by dehydrogenase enzymes. Some small decreases in

formazan production were observed in rat hepatocytes treated with 1000 M

momfluorothrin and human hepatocytes treated with 1000 M Z-CMCA. The increases

in formazan production at some concentrations of momfluorothrin, NaPB and hHGF

observed in rat hepatocytes may be due to increased metabolic activity as a result of

either CYP2B enzyme induction and/or increased replicative DNA synthesis.

CYP2B gene expression

Treatment with 1000 M NaPB produced a less marked effect on CYP2B mRNA

levels in human than in rat hepatocytes (Fig. 14). The effects of momfluorothrin and

Z-CMCA on CYP2B mRNA levels were also less marked in human than in rat

hepatocytes, with Z-CMCA only producing an induction of CYP2B mRNA levels in rat

hepatocytes.

90 / 120

Figure 13 Effect of hHGF, NaPB, momfluorothrin and Z-CMCA on cell viability in cultured

rat and human hepatocyte. Rat and human hepatocytes were treated with hHGF (10 and 100

ng/ml), NaPB (1000 μM), momfluorothrin (10-1000 μM) and Z-CMCA (50-1000 μM) for 48 hours

and cell viability was determined by a cell counting kit. Results are presented as individual values

expressed as percentage of control at each concentration of hHGF, NaPB, momfluorothrin and

Z-CMCA in each of two rat and human hepatocyte preparations. Figure is adapted from Okuda et al.,

(2017b).

91 / 120

Figure 14. Effect of NaPB, momfluorothrin and Z-CMCA on CYP2B mRNA expression in

cultured rat and human hepatocytes. Rat and human hepatocytes were treated with NaPB (500

and 1000 μM), momfluorothrin (1-1000 μM) or Z-CMCA (5-1000 μM) for 48 hours and rat

CYP2B1/2 and human CYP2B6 mRNA levels determined by quantitative real-time PCR. Results are

presented as mean SD (n=2-5 rat and n=1-7 human hepatocyte preparations) expressed as

percentage of control at each concentration of NaPB, momfluorothrin or Z-CMCA. Values

significantly different from control (DMSO only treated) are: * p<0.05 and ** p<0.01 in rat

hepatocytes; and ##

p<0.01 in human hepatocytes. Figure is adapted from Okuda et al., (2017b).

92 / 120

Replicative DNA synthesis

The treatment of rat hepatocytes with 100 ng/mL hHGF and human hepatocytes

with 10 and 100 ng/mL hHGF resulted in significant increases in replicative DNA

synthesis, thus confirming the functional viability of the rat and human hepatocyte

preparations used in these studies to treatment with a mitogenic agent (Fig. 15). In rat

hepatocytes, significant increases in replicative DNA synthesis were observed after

treatment with 500 and 1000 M NaPB and 5 and 10 M momfluorothrin, whereas

replicative DNA synthesis was reduced by treatment with 100-1000 M

momfluorothrin. In contrast to the effects observed in rat hepatocytes, the treatment of

human hepatocytes with 500 and 1000 M NaPB and 1-1000 M momfluorothrin had

no significant increase in replicative DNA synthesis. Treatment with 5-1000 M

Z-CMCA had no significant effects on replicative DNA synthesis in either rat or human

hepatocytes.

93 / 120

Figure 15. Effect of hHGF, NaPB, momfluorothrin and Z-CMCA on replicative DNA synthesis

in cultured rat and human hepatocytes. Rat and human hepatocytes were treated with hHGF (10

and 100 ng/ml), NaPB (500 and 1000 μM), momfluorothrin (1-1000 μM) or Z-CMCA (5-1000 μM)

for 48 hours and replicative DNA synthesis determined by BrdU incorporation over the last 24 hours

of culture. Results are presented as mean SD (n=3-8 rat and n=5-10 human hepatocyte

preparations) expressed as percentage of control at each concentration of hHGF, NaPB,

momfluorothrin or Z-CMCA. Values significantly different from control (DMSO only treated) are: *

p<0.05 and ** p<0.01 in rat hepatocytes; and # p<0.05 and

## p<0.01 in human hepatocytes. Figure is

adapted from Okuda et al., (2017b).

94 / 120

Chimeric mice study

A summary of the data obtained is presented in Table 10. In three separate

experiments, chimeric mice transplanted with human hepatocytes from different donors

were treated for 7 days with diets containing 1800 ppm metofluthrin (average chemical

intake, 239-285 mg/kg/day) and with 1100 or 3000 ppm momfluorothrin (average

chemical intake, 146-170 mg/kg/day for 1100 ppm; 410 mg/kg/day for 3000 ppm).

As described in the Method section, the dose level of momfluorothrin was changed

in Experiments II and III due to animal interim deaths (Days 2 and 3, commencement of

treatment is counted as Day 0) in Experiment I. Regarding metofluthrin, while no

mortality was observed in Experiments I and III, two of five animals treated with 1800

ppm metofluthrin were found dead during the early phase of treatment (Days 2 and 3) in

Experiment II. The average chemical intakes in these 7-day studies were higher than

those observed at tumourigenic dose levels administered to male rats in the 2-year

bioassays, which were 38 and 78 mg/kg/day for 900 and 1800 ppm mg/kg/day

metofluthrin, respectively, and 73 and 154 mg/kg/day for 1500 and 3000 ppm

momfluorothrin, respectively. With the exception of interim deaths due to suppressed

food consumption possibly resulting from neurotoxicity during the early phase of

treatment (data not shown), no severe toxic effects were observed during the study.

95 / 120

Table 10. Summary of findings in chimeric mouse study

Experiment I. Donor ID; BD87

Groups Control Metofluthrin

1800 ppm

Momfluorothrin

3000 ppm

hEGF

600 μg/kg

Number of animals examined 5 5 3a 5

Average Chemical intake (mg/kg/day) 0 272 410 0.6

Liver weight Absolute (g) 2.78±0.36 2.89±0.32 2.36±0.51 2.75±0.25

(fold control) (1.00) (1.04) (0.85) (0.99)

Liver weight Relative (g/body weight x 100) 13.47±1.80 14.43±2.13 11.83±1.43 13.78±1.13

(fold control) (1.00) (1.07) (0.88) (1.02)

Replicative DNA synthesis in human hepatocytes (%) 11.59±6.77 4.63±2.03 6.71±6.76 21.18±9.03

(fold control) (1.00) (0.40) (0.58) (1.83)

Human CYP2B6 mRNA (% of control average) 100±18.93 111±11.90 136±17.70* 124±18.24

(fold control) (1.00) (1.11) (1.36) (1.24)

Mouse Cyp2b10 mRNA (% of control average) 100±33.49 424±118.90** 1692±600.04* 154±26.17*

(fold control) (1.00) (4.24) (16.92) (1.54)

Experiment II. Donor ID; BD85

Groups Control Metofluthrin

1800 ppm

Momfluorothrin

1100 ppm

hEGF

600 μg/kg

Number of animals examined 5 3b 8 5

Average Chemical intake (mg/kg/day) 0 239 170 0.6

Liver weight Absolute (g) 2.30±0.20 2.14±0.08 2.17±0.21 2.53±0.23

(fold control) (1.00) (0.93) (0.94) (1.10)

Liver weight Relative (g/body weight x 100) 11.71±0.79 11.72±0.68 11.19±0.67 12.94±0.87*

(fold control) (1.00) (1.00) (0.96) (1.11)

Replicative DNA synthesis in human hepatocytes (%) 7.44±4.00 5.23±3.08 4.59±1.61 12.22±5.51

(fold control) (1.00) (0.70) (0.62) (1.64 )

Human CYP2B6 mRNA (% of control average) 100±12.90 137±14.75* 93±12.77 135±41.88

(fold control) (1.00) (1.37) (0.93) (1.35)

Mouse Cyp2b10 mRNA (% of control average) 100±55.9 281±136.5* 266±105.9** 112±27.2

(fold control) (1.00) (2.81) (2.66) (1.12)

Experiment III. Donor ID; BD195

Groups Control Metofluthrin

1800 ppm

Momfluorothrin

1100 ppm

hEGF

600 μg/kg

Number of animals examined 5 8 5 5

Average Chemical intake (mg/kg/day) 0 285 146 0.6

Liver weight Absolute (g) 2.63±0.40 2.61±0.34 2.61±0.40 3.21±0.39*

(fold control) (1.00) (0.99) (0.99) (1.22)

Liver weight Relative (g/body weight x 100) 11.98±1.59 12.44±1.68 11.94±1.21 14.94±2.00*

(fold control) (1.00) (1.04) (1.00) (1.25)

Replicative DNA synthesis in human hepatocytes (%) 8.37±4.53 5.01±1.76 4.55±1.32 15.46±5.61

(fold control) (1.00) (0.60) (0.54) (1.85)

Human CYP2B6 mRNA (% of control average) 100±14.79 121±19.78* 86±16.29 120±29.02

(fold control) (1.00) (1.21) (0.86) (1.20)

Mouse Cyp2b10 mRNA (% of control average) 100±26.9 305±96.6** 191±14.1** 122±55.5

(fold control) (1.00) (3.05) (1.91) (1.22)

Results are presented as mean±SD, and values in parenthesis are fold change of control. Values significantly different

from control are: * p<0.05 and ** p<0.01. a: For the momfluorothrin group of the experiment I, since five of eight

animals found dead during treatment, group mean was evaluated in survived three animals. b: For the metofluthrin

group of the experiment II, since two of five animals were found dead during treatment, group mean was evaluated in

survived three animals. Table is adapted from Okuda et al., (2017b).

96 / 120

CYP2B gene expression

Under these study conditions, increased levels of CYP2B6 mRNA were observed in

human hepatocytes, but the effects were relatively weak, being 1.1-1.4 fold of control in

animals given 1800 ppm metofluthrin and 1.4 fold of control in animals given 3000

ppm momfluorothrin. Although serum or liver concentrations of the test chemicals were

not examined in the present study, significant increases in Cyp2b10 mRNA expression

mouse hepatocytes (Table 10) demonstrated that treatment with metofluthrin or

momfluorothrin significantly stimulated CAR in the mouse hepatocytes of the chimeric

mice.

Replicative DNA synthesis

Under these conditions, treatment with metofluthrin or momfluorothrin did not

result in any increases in replicative DNA synthesis of human hepatocytes (Table 10,

Fig. 16A). However, as a positive control, hEGF treatment increased replicative DNA

synthesis in human hepatocytes (Fig. 16A and 16B) though statistical significance was

not observed due to the small number of animals examined (Table 10, Fig. 16A). When

the data from all three experiments were combined, statistically significant increased

replicative DNA synthesis was observed in the hEGF group (Fig. 16B). The BrdU

labelling index was only determined in human hepatocytes and not in mouse

hepatocytes in which the rate of replicative DNA synthesis was high even in controls

(Fig. 17C and 17D), and thus it was difficult to compare between control and treatment

animals. The cause of the high spontaneous DNA synthesis in the mouse hepatocytes is

unclear but may be related to induced synthesis of DNA and/or hepatocyte damage by

expression of uPA with consequent regeneration.

97 / 120

Figure 16. Effect of metofluthrin, momfluorothrin and hEGF on replicative DNA synthesis in

human hepatocytes of chimeric mice. Replicative DNA synthesis as determined by BrdU labeling

index is presented for individual (A) and average (B) of three experiments in chimeric mice from

three different donors. Results are presented as mean SD (A, n=3-8 mice per experiment per

group; B, n=3 experiments per group). Figure is adapted from Okuda et al., (2017b).

98 / 120

Figure 17. Liver histology and DNA synthesis in chimeric mice.

(A) Hematoxylin and eosin staining of appearance of livers of the control chimeric mice, with h-heps

and m-heps representing human hepatocytes and mouse hepatocytes, respectively. (B-D)

Immunohistochemistory for BrdU in the control animal (serial section of figure 17A (B), human

hepatocytes area in the control animal (C) and human hepatocytes area in the hEGF treatment group

(D). Scale bars are 100 m. Figure is adapted from Okuda et al., (2017b).

99 / 120

Discussions

The stimulation of replicative DNA synthesis via CAR activation is the critical key

event in the proposed MOA for momfluorothrin-induced rat liver tumor formation, as

demonstrated by CAR KO rat study, CAR knockdown hepatocyte study using RNAi

and hepatic global gene expression analysis (Okuda et al., 2017a). Therefore, effects of

momfluorothrin and its major metabolite Z-CMCA on CYP2B mRNA induction and

replicative DNA synthesis were examined in cultured rat and human hepatocyte

preparations and in human hepatocytes of chimeric mice in the present study.

Cyp2B is well-known as an associative event but not a key event for hepatocellular

tumorigenesis related to CAR activation (Elcombe et al., 2014). Induction of total

cytochrome P450 content and individual subfamily enzymes generally correlate poorly

with carcinogenicity (Elcombe et al., 2002). Thus, Cyp2B is a biomarker for CAR

activation, but the increases in Cyp2B levels do not correlate with the extent of cell

proliferation. The treatment of rat and human hepatocytes with 1000 µM NaPB

significantly increased CYP2B mRNA levels, demonstrating that under the

experimental conditions employed in this study the cultured hepatocytes maintain

enough CAR signaling functions to be able to respond to treatment with CYP2B

enzyme inducers.

hHGF is a well-known growth factor which is known to stimulate replicative DNA

synthesis in hepatocytes (Runge et al., 1999; Yamada et al., 2015; Hirose et al., 2009).

In the present study, hHGF increased replicative DNA synthesis in rat and human

hepatocytes in a concentration-dependent manner. These results confirmed the

functional viability of the rat and human hepatocyte preparations used in this study to

100 / 120

the effect of a known hepatocyte mitogen.

Though momfluorothrin concentrations in rat liver have not been determined,

plasma concentrations of momfluorothrin and Z-CMCA were determined in rats treated

with momfluorothrin at 3000 ppm in the diet for 3 and 7 days. The plasma concentration

of momfluorothrin was around 0.3 µM at both time points, and the concentration of

Z-CMCA was approximately 10-fold higher than that of momfluorothrin (unpublished

data).

Since test chemical concentrations in the liver are expected to be more than

2~10-fold higher than plasma concentrations based on findings of the momfluorothrin

metabolism study (ECHA, 2014), the concentration range used in the present study

(1~1000 µM for momfluorothrin, 5~1000 µM for Z-CMCA) would cover these

expected concentrations in the liver. The treatment of rat hepatocytes with 1000 M

momfluorothrin and human hepatocytes with 1000 M Z-CMCA resulted in slight

decreases in formazan production, suggesting that high concentrations of

momfluorothrin or Z-CMCA could be toxic to rat or human hepatocytes. However, the

toxic effects observed at high concentrations in vitro does not appear to occur in vivo, as

no hepatotoxic effects, such as necrosis, were observed in in vivo rat studies at doses up

to the maximum tolerated dose (MTD) (ECHA, 2014; Okuda et al., 2017a). Thus, these

findings suggest that the plasma concentrations of these chemicals in the

carcinogenicity study with momfluorothrin were less than 1000 M.

The treatment of rat hepatocytes with 500 and 1000 µM NaPB significantly

increased replicative DNA synthesis consistent with previous findings (Hirose et al.,

2009). Replicative DNA synthesis in rat hepatocytes was significantly increased by

treatment with 5 and 10 M momfluorothrin to 1.6- and 1.8- fold control, respectively.

101 / 120

However, the treatment of rat hepatocytes with 5-1000 M Z-CMCA had no statistically

significant effect on replicative DNA synthesis, suggesting that momfluorothrin is likely

the causative agent for rat liver tumor production rather than its major metabolite

Z-CMCA.

For human hepatocytes, in contrast to hHGF, replicative DNA synthesis was not

increased by treatment with 500 and 1000 M NaPB, 1-1000 M momfluorothrin or

5-1000 M Z-CMCA in the present study. The lack of effect of NaPB on replicative

DNA synthesis in cultured human hepatocytes is consistent with previous findings

(Hirose et al., 2009; Yamada et al., 2015; Parzefall et al., 1991). In keeping with the

properties of the prototypic CAR activator PB, two closely structurally related

pyrethroid insecticides metofluthrin (Yamada et al., 2015; Hirose et al., 2009) and

momfluorothrin (present study) were demonstrated not to stimulate replicative DNA

synthesis in cultured human hepatocytes. In addition, no stimulation of replicative DNA

synthesis by NaPB in human hepatocytes has already been demonstrated in vivo in the

study utilizing chimeric mice with human hepatocytes (Yamada et al., 2014). The

present study demonstrated that momfluorothrin and metofluthrin did not increase in

vivo human hepatocyte replicative DNA synthesis in chimeric mice employing

hepatocytes from three different donors. Thus, correlation can be made between the

findings in the human cells in the chimeric mice and the effects utilizing human cells in

vitro compared to rodent cells.

Human applicability of the proposed mode of action

In terms of the human relevance of an animal carcinogenic MOA there are three

questions to consider (Boobis et al., 2006) before reaching a conclusion (See Fig. 1). As

102 / 120

described in chapter 1, the postulated MOA is similar to that of certain other

non-genotoxic agents which are CAR activators including that of a close structural

analogue metofluthrin (Yamada et al., 2009). Alternative MOAs for

momfluorothrin-induced rat liver tumour formation have been excluded. Thus, a

plausible MOA for momfluorothrin-induced rat liver tumour formation has been

established, and therefore, the answer to question 1 is yes. In assessing the relevance of

animal MOA data to humans, a concordance table has been suggested as being of

considerable value (Boobis et al., 2006). Such a table is presented in Table 11. This

includes not only the data for the effects of momfluorothrin in the rat, but also the

available data for humans.

A number of studies have shown that CAR is present in human liver and that this

receptor can be activated by drugs and other compounds (Moore et al., 2003). Hence, it

is probable that at high doses momfluorothrin could activate CAR in human liver.

Treatment with momfluorothrin increased CYP2B6 mRNA levels in human hepatocytes

(Fig. 14). Thus, at high doses momfluorothrin has the potential to activate CAR and

induce CYP2B enzymes in human liver.

Studies in human subjects given anticonvulsant drugs (which induce hepatic CYP

enzymes) have shown that prolonged treatment with high doses can increase liver size

in humans, which is associated with liver hypertrophy and increased smooth

endoplasmic reticulum (Aiges et al., 1980, Pirttiaho et al., 1978). Thus, by comparison

with the effects of such anticonvulsant drugs, at high doses momfluorothrin has the

potential to produce hypertrophy in human liver.

103 / 120

Table 11. Comparison of key and associative events on MOA for liver tumorigenesis of

momfluorothrin in rats and humans (Table is adapted from Okuda et al., (2017b)).

As the stimulation of replicative DNA synthesis is the critical key event in the

proposed MOA for momfluorothrin-induced rat hepatocellular tumor formation (Okuda

et al., 2017a), the effect of momfluorothrin on replicative DNA synthesis has been

studied in cultured rat and human hepatocytes (Fig. 15). Using hepatocyte cultures,

increases in replicative DNA synthesis following treatment with hHGF were observed

in both rat and human hepatocytes. However, increased replicative DNA synthesis

following momfluorothrin treatment was only observed in rat hepatocytes, not in human

hepatocytes. These results demonstrate that momfluorothrin only induced replicative

Key (K) and Associative (A)

Event Evidence in Rats Evidence in Humans

Activation of CAR (K) Inferred from CAR-siRNA

studies and from induction of

CYP2B enzymes

Probable at high doses

(Inferred from induction of

CYP2B mRNA in vitro in

cultured hepatocytes and in vivo

in chimeric mice with human

hepatocytes)

Induction of CYP2B (A)

[as a marker for CAR

activation]

Direct experimental evidence

in vivo and in vitro in

cultured hepatocytes

Probable at high doses

(Experimental evidence in vitro

in cultured hepatocytes and in

vivo in chimeric mice with

human hepatocytes)

Hepatocellular hypertrophy

(A)

Direct experimental evidence

in vivo

Possible at very high doses #

(Experimental evidence in vivo

in chimeric mice with human

hepatocytes treated with NaPB)

Increased hepatocellular

proliferation (K)

Direct experimental evidence

in vivo and in vitro in

cultured hepatocytes

Not predicted to occur

(Not observed in cultured

hepatocytes and in vivo in

chimeric mice with human

hepatocytes)

Altered hepatic foci (K) Direct experimental evidence

in vivo

Not predicted to occur

Liver tumours Yes Not predicted to occur

104 / 120

DNA synthesis in rat and not in human hepatocytes. This conclusion is also strongly

supported by the chimeric mouse study, where no increase in replicative DNA synthesis

in human hepatocytes was also observed (Table 10, Fig. 17).

The data obtained in these studies with the CAR activator momfluorothrin is in

agreement with literature data on other CAR activators that have shown increased

replicative DNA synthesis in cultured rodent hepatocytes but not in cultured human

hepatocytes (Hirose et al., 2009, Lake et al., 2015, Elcombe et al., 2014, Parzefall et al.,

1991, Yamada et al., 2015). As examination of the available data demonstrates that the

MOA for momfluorothrin-induced rat liver tumor formation is qualitatively not

plausible for humans, there is no need to consider quantitative differences in either

kinetic or dynamic factors between rats and humans (Fig. 18). In addition to a

quantitative difference in response, a quantitative difference in exposure, which is not

generally the basis for quantitative differences under the WHO/IPCS framework, is also

discussed here. It should be noted that likely human chronic exposure to

momfluorothrin would be orders of magnitude lower than momfluorothrin dose levels

required to produce liver tumors in the rat. Thus, not only is there a qualitative

difference between the rat and human in the response of the liver cells to the pyrethroid

CAR activators regarding induction of liver tumors, but also a marked quantitative

difference in the level of exposure. Thus, based on quantitative considerations, the

confidence in a lack of effect in humans at expected exposures is even stronger than that

based only on qualitative considerations. Consequently, momfluorothrin is of no

carcinogenic hazard or risk for humans.

105 / 120

Figure 18. The conclusion of the human risk assessment in the rat liver tumors induced by

momfluorothrin based on the IPCS framework.

106 / 120

Conclusions

The obtained data demonstrated that the MOA for momfluorothrin-induced rat

hepatocellular tumors was mediated by CAR activation in chapter 1. While some of the

key (activation of CAR) and associative (CYP2B enzyme induction and hepatocellular

hypertrophy) events in the MOA for momfluorothrin-induced rat hepatocellular tumor

formation could occur in human liver, the available in vitro and in vivo experimental

data demonstrated that human hepatocytes appear to be refractory to the mitogenic

effects of momfluorothrin in chapter 2. In addition, no stimulation of replicative DNA

synthesis by NaPB and metofluthrin was demonstrated in vivo in the study utilizing

chimeric mice with human hepatocytes. Therefore, these data suggested that CAR

activators including momfluorothrin have no carcinogenic risk for humans.

Since pyrethroids, including natural pyrethrins, have been used for many years as

insecticides for household, agricultural, and other applications, the Agency for Toxic

Substances and Disease Registry (ATSDR) provided an excellent review entitled

“Toxicological Profile for Pyrethrins and Pyrethroids” (ATSDR, 2003). According to

this review, no reports were located regarding cancer in humans or animals following

inhalation or dermal exposure to pyrethrins or natural pyrethroids. However, in the case

of oral exposure to these chemicals, while pyrethrins and some pyrethroids have been

shown to cause tumors in rodent models (Tsuji et al., 2012), no reports were located

regarding cancer in humans. Although there are no epidemiological data for

momfluorothrin or metofluthrin so far, the conclusion in this study may also be

supported by epidemiological data for pyrethroids/natural pyrethrins (ATSDR, 2003).

107 / 120

Acknowledgements

The author deeply appreciates Tomoya Yamada Ph.D., senior scientist in Sumitomo

Chemical Company, and Professor Yoshimasa Nakamura, the primary mentor of the

doctorate degree program in Okayama University, for providing the expert technical

advises throughout this research project.

The author also appreciates Professors Yoshiyuki Murata and Yoshinobu Kimura,

the secondary mentor of the doctorate degree program in Okayama University, for

providing the technical advises.

Finally, I also thank the other contributors to this research project from Sumitomo

Chemical Company, Ltd., and Sumika Technoservice Corporation.

108 / 120

References

Abe, H., Ogawa, T., Wang, L., Kimura, M., Tanaka, T., Morita, R., Yoshida, T., and

Shibutani, M. (2014). Promoter-region hypermethylation and expression

downregulation of Yy1 (Yin yang 1) in preneoplastic liver lesions in a thioacetamide rat

hepatocarcinogenesis model. Toxicol. Appl. Pharmacol. 280, 467-474.

Aiges, H. W., Daum, F., Olson, M., Kahn, E., and Teichberg, S. (1980). The effects of

phenobarbital and diphenylhydantoin on liver function and morphology. J Pediatr. 97,

22-26.

ATSDR (2003). Toxicological profile for Pyrethrins and Pyrethroids. U.S. Department

of Health and Human Services, Public Health Service, Agency for Toxic Substances

and Disease Registry (ATSDR). In Atlanta, GA.

Boobis, A. R., Cohen, S. M., Dellarco, V., McGregor, D., Meek, M. E., Vickers, C.,

Willcocks, D., and Farland, W. (2006). IPCS framework for analyzing the relevance of

a cancer mode of action for humans. Crit. Rev. Toxicol. 36, 781-792.

Boobis, A. R., Doe, J. E., Heinrich-Hirsch, B., Meek, M. E., Munn, S., Ruchirawat, M.,

Schlatter, J., Seed, J., and Vickers, C. (2008). IPCS framework for analyzing the

relevance of a noncancer mode of action for humans. Crit. Rev. Toxicol. 38, 87-96.

Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,

109 / 120

248-254.

Carmichael, N., Bausen, M., Boobis, A. R., Cohen, S. M., Embry, M., Fruijtier-Polloth,

C., Greim, H., Lewis, R., Bette Meek, M. E., Mellor, H., Vickers, C., and Doe, J.

(2011). Using mode of action information to improve regulatory decision-making: an

ECETOC/ILSI RF/HESI workshop overview. Crit. Rev. Toxicol. 41, 175-185.

Carthew, P., Edwards, R. E., and Nolan, B. M. (1998). The quantitative distinction of

hyperplasia from hypertrophy in hepatomegaly induced in the rat liver by phenobarbital.

Toxicol. Sci. 44, 46-51.

Chamberlain, M., Haines, C., and Elcombe, C. R. (2014). Characterisation of the

hepatic effects of phenobarbital in constitutive androstane receptor (CAR, NR113)

knockout rats. Toxicol. Sci. 138(Suppl. 1), 301.

Cohen, S. M. (2010). Evaluation of possible carcinogenic risk to humans based on liver

tumors in rodent assays: the two-year bioassay is no longer necessary. Toxicol. Pathol.

38, 487-501.

Cohen, S. M., and Arnold, L. L. (2008). Cell Proliferation and Carcinogenesis. J.

Toxicol. Pathol. 21, 1-7.

Cohen, S. M., and Arnold, L. L. (2011). Chemical Carcinogenesis. Toxicol. Sci. 120,

S76-S92.

110 / 120

Cohen, S. M., and Arnold, L. L. (2016). Critical role of toxicologic pathology in a

short-term screen for carcinogenicity. J. Toxicol. Pathol. 29, 215-227.

Cohen, S. M., Klaunig, J., Meek, M. E., Hill, R. N., Pastoor, T., Lehman-McKeeman,

L., Bucher, J., Longfellow, D. G., Seed, J., Dellarco, V., Fenner-Crisp, P., and Patton,

D. (2004). Evaluating the human relevance of chemically induced animal tumors.

Toxicol. Sci. 78, 181-186.

Corton, J. C., Cunningham, M. L., Hummer, B. T., Lau, C., Meek, B., Peters, J. M.,

Popp, J. A., Rhomberg, L., Seed, J., and Klaunig, J. E. (2014). Mode of action

framework analysis for receptor-mediated toxicity: The peroxisome

proliferator-activated receptor alpha (PPARalpha) as a case study. Crit. Rev. Toxicol.

44, 1-49.

Currie, R. A., Peffer, R. C., Goetz, A. K., Omiecinski, C. J., and Goodman, J. I. (2014).

Phenobarbital and propiconazole toxicogenomic profiles in mice show major

similarities consistent with the key role that constitutive androstane receptor (CAR)

activation plays in their mode of action. Toxicology 321, 80-88.

Deguchi, Y., Yamada, T., Hirose, Y., Nagahori, H., Kushida, M., Sumida, K., Sukata,

T., Tomigahara, Y., Nishioka, K., Uwagawa, S., Kawamura, S., and Okuno, Y. (2009).

Mode of action analysis for the synthetic pyrethroid metofluthrin-induced rat liver

tumors: evidence for hepatic CYP2B induction and hepatocyte proliferation. Toxicol.

Sci. 108, 69-80.

111 / 120

ECHA (2014). CLH report, Proposal for Harmonised Classification and Labelling

Based on Regulation (EC) No 1272/2008 (CLP Regulation),Annex VI, Part 2.

Substance Name:: 1R-trans-Z-momfluorothrin.

https://echa.europa.eu/documents/10162/13626/clh_proposal_1r_trans_z_momfluorothr

in_en.pdf/34bf8211-758e-4cf5-a4d9-bfe616464965. Accessed date: May 2, 2017.

Elcombe, C. R., Odum, J., Foster, J. R., Stone, S., Hasmall, S., Soames, A. R., Kimber,

I., and Ashby, J. (2002). Prediction of rodent nongenotoxic carcinogenesis: evaluation

of biochemical and tissue changes in rodents following exposure to nine nongenotoxic

NTP carcinogens. Environ. Health Perspect. 110, 363-375. .

Elcombe, C. R., Peffer, R. C., Wolf, D. C., Bailey, J., Bars, R., Bell, D., Cattley, R. C.,

Ferguson, S. S., Geter, D., Goetz, A., Goodman, J. I., Hester, S., Jacobs, A.,

Omiecinski, C. J., Schoeny, R., Xie, W., and Lake, B. G. (2014). Mode of action and

human relevance analysis for nuclear-receptor mediated liver toxicity: a case study with

phenobarbital as a model constitutive androstane receptor (CAR) activator. Crit. Rev.

Toxicol. 44, 64-82. .

Foster, J. R., Lund, G., Sapelnikova, S., Tyrrell, D. L., and Kneteman, N. M. (2014).

Chimeric rodents with humanized liver: bridging the preclinical/clinical trial gap in

ADME/toxicity studies. Xenobiotica 44, 109-122.

Friedman, G. D., Jiang, S.-F., Udaltsova, N., Quesenberry, C. P., Chan, J., and Habel, L.

A. (2009). Epidemiologic evaluation of pharmaceuticals with limited evidence of

carcinogenicity. Int. J. Cancer 125, 2173-2178.

112 / 120

Ghadially, F. N. (1997). Endoplasmic reticulum. In Ultrastructural Pathology of the

Cell and Matrix, Forth edition, pp. 433-602, Btterworth-Heimemann, Boston, MA.

Gold, L. S., Manley, N. B., Slone, T. H., and Ward, J. M. (2001). Compendium of

chemical carcinogens by target organ: results of chronic bioassays in rats, mice,

hamsters, dogs, and monkeys. Toxicol. Pathol. 29, 639-652.

Hirose, Y., Nagahori, H., Yamada, T., Deguchi, Y., Tomigahara, Y., Nishioka, K.,

Uwagawa, S., Kawamura, S., Isobe, N., Lake, B. G., and Okuno, Y. (2009).

Comparison of the effects of the synthetic pyrethroid Metofluthrin and phenobarbital on

CYP2B form induction and replicative DNA synthesis in cultured rat and human

hepatocytes. Toxicology 258, 64-69.

Holsapple, M. P., Pitot, H. C., Cohen, S. M., Boobis, A. R., Klaunig, J. E., Pastoor, T.,

Dellarco, V. L., and Dragan, Y. P. (2006). Mode of action in relevance of rodent liver

tumors to human cancer risk. Toxicol. Sci. 89, 51-56.

Huang, W., Zhang, J., Washington, M., Liu, J., Parant, J.M., Lozano, G. and Moore,

D.D. (2005): Xenobiotic Stress Induces Hepatomegaly and Liver Tumors via the

Nuclear Receptor Constitutive Androstane Receptor. Mol. Endocrinol., 19, 1646-1653.

Huff, J., Cirvello, J., Haseman, J., and Bucher, J. (1991). Chemicals associated with

site-specific neoplasia in 1394 long-term carcinogenesis experiments in laboratory

rodents. Environ. Hlth. Persp. 93, 247-270.

113 / 120

IARC (2001). Some Thyrotropic Agents: PHENOBARBITAL AND ITS SODIUM

SALT. IARC Monogr. Eval. Carcinog. Risks Hum. 79, 161-288.

Jones, H. B., Orton, T. C., and Lake, B. G. (2009). Effect of chronic phenobarbitone

administration on liver tumour formation in the C57BL/10J mouse. Food Chem.

Toxicol. 47, 1333-1340.

Kitamura, S., and Sugihara, K. (2014). Current status of prediction of drug disposition

and toxicity in humans using chimeric mice with humanized liver. Xenobiotica 44,

123-134.

Klaunig, J. E., Babich, M. A., Baetcke, K. P., Cook, J. C., Corton, J. C., David, R. M.,

DeLuca, J. G., Lai, D. Y., McKee, R. H., Peters, J. M., Roberts, R. A., and

Fenner-Crisp, P. A. (2003). PPARalpha agonist-induced rodent tumors: modes of action

and human relevance. Crit. Rev. Toxicol. 33, 655-780.

Klaunig, J. E., and Kamendulis, L. M. (2004). The role of oxidative stress in

carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 44, 239-267.

Kushida, M., Yamada, T., and Okuno, Y. (2016). Mode of action and assessment of

human relevance for chemical-induced animal tumors. In Thresholds of Genotoxic

Carcinogens (T. Nomi, and S. Fukushima, Eds.), pp. 193-203. Academic Press,

London.

Lake, B. G. (2009). Species differences in the hepatic effects of inducers of CYP2B and

114 / 120

CYP4A subfamily forms: relationship to rodent liver tumour formation. Xenobiotica 39,

582-596.

Lake, B. G., Price, R. J., and Osimitz, T. G. (2015). Mode of action analysis for

pesticide-induced rodent liver tumours involving activation of the constitutive

androstane receptor: relevance to human cancer risk. Pest Management Science 71,

829-834.

La Vecchia, C., and Negri, E. (2014). A review of epidemiological data on epilepsy,

phenobarbital, and risk of liver cancer. Eur. J. Cancer Prev. 23, 1-7.

LeBaron, M. J., Geter, D. R., Rasoulpour, R. J., Gollapudi, B. B., Thomas, J., Murray,

J., Kan, H. L., Wood, A. J., Elcombe, C., Vardy, A., McEwan, J., Terry, C., and

Billington, R. (2013). An integrated approach for prospectively investigating a

mode-of-action for rodent liver effects. Toxicol. Appl. Pharmacol. 270, 164-173.

LeBaron, M. J., Gollapudi, B. B., Terry, C., Billington, R., and Rasoulpour, R. J.

(2014). Human relevance framework for rodent liver tumors induced by the insecticide

sulfoxaflor. Crit. Rev. Toxicol. 44 Suppl 2, 15-24.

Manibusan, M. K., Odin, M., and Eastmond, D. A. (2007). Postulated carbon

tetrachloride mode of action: a review. J Environ Sci Health C Environ Carcinog

Ecotoxicol Rev 25, 185-209.

Maronpot, R. R., Yoshizawa, K., Nyska, A., Harada, T., Flake, G., Mueller, G., Singh,

115 / 120

B., and Ward, J. M. (2010). Hepatic Enzyme Induction. Toxicol. Pathol. 38, 776-795.

Masumoto, N., Tateno, C., Tachibana, A., Utoh, R., Morikawa, Y., Shimada, T.,

Momisako, H., Itamoto, T., Asahara, T., and Yoshizato, K. (2007). GH enhances

proliferation of human hepatocytes grafted into immunodeficient mice with damaged

liver. J. Endocrinol. 194, 529-537.

Meek, M. E., Boobis, A., Cote, I., Dellarco, V., Fotakis, G., Munn, S., Seed, J., and

Vickers, C. (2014). New developments in the evolution and application of the

WHO/IPCS framework on mode of action/species concordance analysis. J. Appl.

Toxicol. 34, 1-18.

Meek, M. E., Bucher, J. R., Cohen, S. M., Dellarco, V., Hill, R. N.,

Lehman-McKeeman, L. D., Longfellow, D. G., Pastoor, T., Seed, J., and Patton, D. E.

(2003). A framework for human relevance analysis of information on carcinogenic

modes of action. Crit. Rev. Toxicol. 33, 591-653.

Mercer, D. F., Schiller, D. E., Elliott, J. F., Douglas, D. N., Hao, C., Rinfret, A.,

Addison, W. R., Fischer, K. P., Churchill, T. A., Lakey, J. R. T., Tyrrell, D. L. J., and

Kneteman, N. M. (2001). Hepatitis C virus replication in mice with chimeric human

livers. Nat. Med. 7, 927-933.

Molnar, F., Kublbeck, J., Jyrkkarinne, J., Prantner, V., and Honkakoski, P. (2013). An

update on the constitutive androstane receptor (CAR). Drug Metabol. Drug Interact. 28,

79-93.

116 / 120

Monro, A. (1993). The paradoxical lack of interspecies correlation between plasma

concentrations and chemical carcinogenicity. Regul. Toxicol. Pharmacol. 18, 115-135.

Moore, J. T., Moore, L. B., Maglich, J. M., and Kliewer, S. A. (2003). Functional and

structural comparison of PXR and CAR. Biochim. Biophys. Acta 1619, 235-238.

Okuda, Y., Kushida, M., Sumida, K., Nagahori, H., Nakamura, Y., Higuchi, H.,

Kawamura, S., Lake, B. G., Cohen, S. M., and Yamada, T. (2017a). Mode of action

analysis for rat hepatocellular tumors produced by the synthetic pyrethroid

momfluorothrin: evidence for activation of the constitutive androstane receptor and

mitogenicity in rat hepatocytes. Toxicol. Sci. 158, 412-430.

Okuda, Y., Kushida, M., Kikumoto, H., Nakamura, Y., Higuchi, H., Kawamura, S.,

Cohen, S. M., Lake, B. G., and Yamada, T. (2017b). Evaluation of the human relevance

of the constitutive androstane receptor-mediated mode of action for rat hepatocellular

tumor formation by the synthetic pyrethroid momfluorothrin. J. Toxicol. Sci. 42,

773-788.

Osimitz, T. G., and Lake, B. G. (2009). Mode-of-action analysis for induction of rat

liver tumors by pyrethrins: relevance to human cancer risk. Crit. Rev. Toxicol. 39,

501-511.

Parzefall, W., Erber, E., Sedivy, R., and Schulte-Hermann, R. (1991). Testing for

induction of DNA synthesis in human hepatocyte primary cultures by rat liver tumor

promoters. Cancer Res. 51, 1143-1147.

117 / 120

Pirttiaho, H. I., Sotaniemi, E. A., Ahokas, J. T., and Pitkänen, U. (1978). Liver size and

indices of drug metabolism in epileptics. Br. J. Clin. Pharmacol. 6, 273-278.

Rossi, L., Ravera, M., Repetti, G., and Santi, L. (1977). Long-term administration of

DDT or phenobarbital-Na in Wistar rats. Int. J. Cancer 19, 179-185.

Runge, D. M., Runge, D., Dorko, K., Pisarov, L. A., Leckel, K., Kostrubsky, V. E.,

Thomas, D., Strom, S. C., and Michalopoulos, G. K. (1999). Epidermal growth factor-

and hepatocyte growth factor-receptor activity in serum-free cultures of human

hepatocytes. J. Hepatol. 30, 265-274.

Sandgren, E. P., Palmiter, R. D., Heckel, J. L., Daugherty, C. C., Brinster, R. L., and

Degen, J. L. (1991). Complete hepatic regeneration after somatic deletion of an

albumin-plasminogen activator transgene. Cell 66, 245-256.

Schulte-Hermann, R., Timmermann-Trosiener, I., and Schuppler, J. (1983). Promotion

of spontaneous preneoplastic cells in rat liver as a possible explanation of tumor

production by nonmutagenic compounds. Cancer Res. 43, 839-844.

Sohn, O. S., and Fiala, E. S. (1995). Effects of dietary restriction and fasting on selected

rat liver enzymes of xenobiotic metabolism and on AOM-induced DNA guanine

methylation in rat liver and colon. Nutr. Cancer 23, 13-22.

Sonich-Mullin, C., Fielder, R., Wiltse, J., Baetcke, K., Dempsey, J., Fenner-Crisp, P.,

Grant, D., Hartley, M., Knaap, A., Kroese, D., Mangelsdorf, I., Meek, E., Rice, J. M.,

118 / 120

and Younes, M. (2001). IPCS conceptual framework for evaluating a mode of action for

chemical carcinogenesis. Regul. Toxicol. Pharmacol. 34, 146-152.

Souza, S. C., Frick, G. P., Wang, X., Kopchick, J. J., Lobo, R. B., and Goodman, H. M.

(1995). A single arginine residue determines species specificity of the human growth

hormone receptor. Proc. Natl. Acad. Sci. U. S. A. 92, 959-963.

Tateno, C., Kataoka, M., Utoh, R., Tachibana, A., Itamoto, T., Asahara, T., Miya, F.,

Tsunoda, T., and Yoshizato, K. (2011). Growth hormone-dependent pathogenesis of

human hepatic steatosis in a novel mouse model bearing a human

hepatocyte-repopulated liver. Endocrinology 152, 1479-1491.

Tateno, C., Kawase, Y., Tobita, Y., Hamamura, S., Ohshita, H., Yokomichi, H., Sanada,

H., Kakuni, M., Shiota, A., Kojima, Y., Ishida, Y., Shitara, H., Wada, N. A., Tateishi,

H., Sudoh, M., Nagatsuka, S., Jishage, K., and Kohara, M. (2015). Generation of Novel

Chimeric Mice with Humanized Livers by Using Hemizygous cDNA-uPA/SCID Mice.

PLoS One 10, e0142145.

Tateno, C., Miya, F., Wake, K., Kataoka, M., Ishida, Y., Yamasaki, C., Yanagi, A.,

Kakuni, M., Wisse, E., Verheyen, F., Inoue, K., Sato, K., Kudo, A., Arii, S., Itamoto, T.,

Asahara, T., Tsunoda, T., and Yoshizato, K. (2013). Morphological and microarray

analyses of human hepatocytes from xenogeneic host livers. Lab. Invest. 93, 54-71.

Tateno, C., Yoshizane, Y., Saito, N., Kataoka, M., Utoh, R., Yamasaki, C., Tachibana,

A., Soeno, Y., Asahina, K., Hino, H., Asahara, T., Yokoi, T., Furukawa, T., and

119 / 120

Yoshizato, K. (2004). Near completely humanized liver in mice shows human-type

metabolic responses to drugs. The American journal of pathology 165, 901-912.

Tinwell, H., Rouquie, D., Schorsch, F., Geter, D., Wason, S., and Bars, R. (2014). Liver

tumor formation in female rat induced by fluopyram is mediated by CAR/PXR nuclear

receptor activation. Regul. Toxicol. Pharmacol. 70, 648-658.

Tsuji, R., Yamada, T. and Kawamura, S. (2012): Mammal Toxicology of Synthetic

Pyrethroids. In: Pyrethroids: From Chrysanthemum to Modern Industrial Insecticide.

Topics in Current Chemistry Vol. 314 (Matsuo, N. and Mori, T., eds.), pp. 83-111,

Springer Berlin / Heidelberg.

Ueda, A., Hamadeh, H. K., Webb, H. K., Yamamoto, Y., Sueyoshi, T., Afshari, C. A.,

Lehmann, J. M., and Negishi, M. (2002). Diverse roles of the nuclear orphan receptor

CAR in regulating hepatic genes in response to phenobarbital. Mol. Pharmacol. 61, 1-6.

Wei, P., Zhang, J., Egan-Hafley, M., Liang, S., and Moore, D. D. (2000). The nuclear

receptor CAR mediates specific xenobiotic induction of drug metabolism. Nature 407,

920-923.

Whysner, J., Ross, P. M., and Williams, G. M. (1996). Phenobarbital mechanistic data

and risk assessment: Enzyme induction, enhanced cell proliferation, and tumor

promotion. Pharmacol Ther. 71, 153-191.

Williams, G. M. (1997). Chemicals with carcinogenic activity in the rodent liver;

120 / 120

mechanistic evaluation of human risk. Cancer Lett. 117, 175-188.

Wood, C. E., Hukkanen, R. R., Sura, R., Jacobson-Kram, D., Nolte, T., Odin, M., and

Cohen, S. M. (2015). Scientific and regulatory policy committee (SRPC) review:

Interpretation and use of cell proliferation data in cancer risk assessment. Toxicol.

Pathol. 43, 760-775.

Yamada, T., Kikumoto, H., Lake, B. G., and Kawamura, S. (2015). Lack of effect of

metofluthrin and sodium phenobarbital on replicative DNA synthesis and Ki-67 mRNA

expression in cultured human hepatocytes. Toxicol. Res. 4, 901-913.

Yamada, T., Okuda, Y., Kushida, M., Sumida, K., Takeuchi, H., Nagahori, H., Fukuda,

T., Lake, B. G., Cohen, S. M., and Kawamura, S. (2014). Human hepatocytes support

the hypertrophic but not the hyperplastic response to the murine nongenotoxic

hepatocarcinogen sodium phenobarbital in an in vivo study using a chimeric mouse with

humanized liver. Toxicol. Sci. 142, 137-157.

Yamada, T., Uwagawa, S., Okuno, Y., Cohen, S. M., and Kaneko, H. (2009). Case

study: an evaluation of the human relevance of the synthetic pyrethroid

metofluthrin-induced liver tumors in rats based on mode of action. Toxicol. Sci. 108,

59-68.

Yamamoto, Y., Moore, R., Goldsworthy, T. L., Negishi, M., and Maronpot, R. R.

(2004). The orphan nuclear receptor constitutive active/androstane receptor is essential

for liver tumor promotion by phenobarbital in mice. Cancer Res. 64, 7197-7200.