offutt newcomers guide 2013

88

Upload: suburban-newspapers

Post on 29-Mar-2016

239 views

Category:

Documents


6 download

DESCRIPTION

Offutt Newcomers Guide 2013

TRANSCRIPT

  • 2 Offutt Air Force Base Newcomers Guide

    entistry is changing at a rate that is dif cult to comprehend. New techniques and materials, combined with the publics desire to look and feel better about

    themselves, has truly created a Golden Age of Dentistry. When it comes to your familys dental health, you need choices. You want affordability and deserve quality. Wouldnt it be nice to have both and have them available to you close to home? This is what Your Family Dentist offers.

    Prosthodontics: Bridge, Partials, DenturesAesthetic Dentistry: Whitening, Veneers, Implants, Crowns (One Appointment)

    Minor Oral Surgery: Extractions, Soft Tissue Excision

    General Dentistry: Bonding, Tooth Colored Restorations ( llings), Mouth Guards

    Endodontics: Root CanalsPreventive Dentistry: Hygientists, Sealants, Fluoride Treatments (Remember every 6 months)

    Our Services Include But Are Not Limited To:

    Proud to extend our Exclusive Military

    Pricing.Financing Available through Wells Fargo.

    Micah Jeppesen D.D.S.1502 S. WASHINGTON STREET SUITE 200

    PAPILLION, NE 68046

    402-339-2501 www.drmicah.com

    eeeeennnnnnnnnnnntttttttttttiiiiiiiiiiiiiissssssssstttttttrrrrrrryyyyyyy iiiiiiiissssssssssss cccccccccccccchhhhhhhhhhhhhhhhhhhhhaaaaaaaaaaaaaaaannnnnnnnnnnnnnnggggggggggggggggggggggiiiiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnnnnnggggggggggggggggggggggg aaaaaaaaaaaaaaatttttttttttttt aaaaaaaaaaa rrrrrrrrrrrraaaaaaaaaaaaattttttttttttteeeeeeeeeeeeee ttttttttthhhhhhhhhhhhhhhhaaaaaaaaaaaaatttttttttttt iiiiiiiiiiiisssssssssss ddddddddddddddiiiiiiiiiiiiffffffffffffffccccccccccccccccuuuuuuuuuuuulllllllllltttttttttttttt tttttttttttttttoooooooooooooooccccccccoooooooooooooooommmmmmmmmmmmmmmmmmmpppppppppppppppppppprrrrrrrrrreeeeeeeeeehhhhhhhhhhheeeeeeennnnnnnnndddddddddddd.... NNNNNNNNNNNNNNNNNNNNNNNNNNNeeeeeeeeeeeeeeeeeewwwwwwwwwwwwwwwwwwwwww tttttttttttttttteeeeeeeeeeeeeecccccccccccccchhhhhhhhhhhhhhhnnnnnnnnnnnnnnnniiiiiiiiiiiiiiiiqqqqqqqqqqqqqqqquuuuuuuuuuuuuuueeeeeeeeessssssssssss aaaaaaaaaaaaaaaaaaannnnnnnnnnnnddddddddddddd mmmmmmmmmmmmaaaaaaaaaaaaaaaaaatttttttttttteeeeeeeeeeerrrrrrrrrrriiiiiiiiiiiiiiiiiiaaaaaaaaaaaaaaaaaalllllllllllllllllllllssssssssssssssssssssss,,,,,,,,, ccccccccccooooooommmmmmmmmmmmmbbbbbbbbbbbbbbbiiiiiiiiiiiiiinnnnnnnnnnnnnnneeeeeeeeeeeeeeeeddddddddddddddwwwwwwwwwwwwwwwiiiiiiiiiiiiiiiiiittttttttttttttthhhhhhhhhhhhhhhhhhhhh ttttttttttttttttthhhhhhhhhhheeeeeeeeeeee ppppppppppppppppppuuuuuuuuuuuuuubbbbbbbbbbbbbbllllllllllllllllliiiiiiiiiiiiiicccccccccccsssssssssssssssssssss ddddddddddddddddddddeeeeeeeeeeeeeeeeeeesssssssssssssssiiiiiiiiiiiiirrrrrrrrrrrrrrrrreeeeeeeeeeeeeee ttttttttttttttooooooooooooooooooooo lllllllllllllooooooooooooooooooooooooooooooooooooookkkkkkkkkkkkkkkkkkkkkkkkkk aaaaaaaaaaaannnnnnnnnnnnnddddddddddd ffffffffffffffffeeeeeeeeeeeeeeeeeeeeeellllllllllllll bbbbbbbbbbbbbbbbbbbbbbbbbbeeeeeeeeeeeeeeeeettttttttttttttttttttttteeeeeeeeeeeeeeeerrrrrrrrrr aaaaaaaaaaaaaaaaabbbbbbbbbbbbbbbbooooooooooooooooouuuuuuuuuuuuuuuuuuttttttttttttttttteeeeeeeeeeeeeemmmmmmmmmmmmmmmmmmmmmmmssssssssssssssssssseeeeeeeeeeeeeeeeeeeeelllllllllllllvvvvvvvvvvvvvvvvvvvvvvvveeeeeeeeeessssssssssss,,,,,, hhhhhhhhhhhhhhhhhhhhhhhaaaaaaaaaaassssssssssss ttttttttttttrrrrrrrrrrrrrrruuuuuuuuuuullllllllllyyyyyyyyyyyyyyyyyyyyyyyyyyyy ccccccccccccccccrrrrrrrrrrrrreeeeeeeeeeeeeeeeeeeaaaaaaaaaaaaaaattttttttttttteeeeeeeeedddddddddddddddddddddd aaaaaaaaaaaaaaaaaaa GGGGGGGGGGGGGGGGGGGooooooooolllllllldddddddddddddeeeeeeeeennnnnnnnnnnnnnnnnn AAAAAAAAAAAAgggggggggggeeeeeeeeeeeeee ooooooooooooooooooooffffffffffffffffff DDDDDDDDDDDDDDDDDDDDeeeeeeeeeeeeeennnnnnnnnnnnnnnnnttttttttttttiiiiiiiiiiiissssssssssstttttttttttrrrrrrrrrryyyyyyyyyyyyyyyy........

    WWWWWWWWWWWWWWWWWhhhhhhhhhhhhheeeeeeeeeeeeennnnnnnnnnnnnnnnnnnn iiiiiiiiiiiiiiiiiiiiiiiiiiitttttttttt ccccccccccccccoooooooooooooommmmmmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeeeeessssssssssssssssss ttttttttttttttttooooooooooooooooo yyyyyyyyyyyyyyyyyyyyyyyoooooooooooooooooouuuuuuuuuuuuuuuurrrrrrrrrrrrrrr fffffffffffffffffffffaaaaaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmmmiiiiiiiillllllllyyyyyyyyyyyyyssssssssssssss ddddddddddddddddddddeeeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnntttttttttttaaaaaaaaaaaaaaaaallllllllllll hhhhhhhhhhhhhhhhhhhhhhhhheeeeeeeeeeeeeeeeeeeeeeeeeeaaaaaaaaaaaaallllllllllllltttttttttttttttttttthhhhhhhhhhhhhhhhh,,,,, yyyyyyyyyyyyyyyyyyoooooooooooooouuuuuuuuu nnnnnneeeeeeeeeeeeeeeeeeeeeeeeeddddddddddddddd ccccccccccchhhhhhhhhhhhhhooooooooooiiiiiiiiiiiiiiiiicccccccccccceeeeeeeeeeeeeeeeessssssssssss...... YYYYYYYYYYYYYYoooooooooooooooooouuuuuuuuuuuuuwwwwwwwwwwwwwwwwaaaaaaaaaaaaannnnnnnnnnnnttttttttttttt aaaaaaaaaaaaaaaaaaffffffffffffffffffffffffffffffffffffffffffffooooooooooooooorrrrrrrrrrrrrrrrrrrddddddddddddddddddddaaaaaaaaaaaaaaabbbbbbbbbbbbbbbbbiiiiiiiiiiiiiilllllllllllllllliiiiiiiiiiiiiiiiiiiiiiiiiitttttttttttyyyyyyyyyyyyyyyy aaaaaaaaaaaannnnnnnnnnnnnnddddddddddd ddddddddddeeeeeeeeeessssssssssseeeeeeeerrrrrrrrrrvvvvvvvvvvveeeeeeeeeeeeeeeeee qqqqqqqqqqqqqqqqqqquuuuuuuuuuuuuuuaaaaaaaaaaaaaaaallllllllllllliiiiiiiiiiiiiiiiitttttttttttttttttyyyyyyyyyyyyyyyyyyyyyyy....... WWWWWWWWWWWWWWWWWWoooooooooooouuuuuuuuuuuuulllllllllllldddddddddddddddnnnnnnnntttttttt iiiiiiiiiiitttttttttttttt bbbbbbbbbbbbbbbbbbbbbbeeeeeeeeeeeeeee nnnnnnnnnnnnnnnnniiiiiiiiiiiicccccccccccccceeeeeeeeeeeeeeeeeeee ttttttttttttttttttooooooooooooo hhhhhhhhhhhhhhhhaaaaaaaaaaavvvvvvvvvveeeeeeeeeeeeeeeeeeebbbbbbbbbbbbbbbooooooooooooooooooooooottttttttttthhhhhhhhhhhhhhhhhhh aaaaaaaaaaaaaannnnnnnnnnnnnndddddddddddddddddddddddd hhhhhhhhhhhhhhhhhhhhhhhhhaaaaaaaaaaaaaaaaaaaaavvvvvvvvvvvvvvvvvveeeeeeeeeeeeeeee tttttttttttttttttthhhhhhhhhhhhhhhheeeeeeeeeeemmmmmmmmmmmmm aaaaaaaaaaaaavvvvvvvvvvvvvvvvaaaaaaaaaaaaaaaaaaaaiiiiiiiiilllllllllaaaaaaaaaaabbbbbbbbbbbbbbblllllllllleeeeeeeeeeeeeee ttttttttttttttoooooooooooooooo yyyyyyyyyyyyyooooooooooooooouuuuuuuuuuuuuuuuuuuuuuuu ccccccccccccclllllllllllllooooooooooooooooooooosssssssssssssssssssssssssssssseeeeeeeeeee ttttttttttttoooooooooooo hhhhhhhhhhhhhooooooooooommmmmmmmmmmmeeeeeeeeeeeeee??????????????? TTTTTTTTThhhhhhhhhhhhhhhhhhhhhhiiiiiiiiiiissssssssssssss iiiiiiiiiiiiiiiiiiissssssssssssssss wwwwwwwwwwwwwwwwwwwwwhhhhhhhhhhhhhhaaaaaaaaaaaaattttttttttttttYYYYYYYYYYYYYYYooooooooooouuuuuuuuuuuuuuurrrrrrrrrrrr FFFFFFFFFFFFFFFFFFFFFFFFaaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmmmmmmmmmmmmmiiiiiiiiiiiiiiiillllllllllllllllllyyyyyyyyyyyyyyyyyyy DDDDDDDDDDDDDDDDDDDDDeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnnnttttttttttttttttttttiiiiiiiiiiiiiiiiiiiiiiiiisssssssssssttttttttttttt oooooooooofffffffffffffffffffffffffffeeeeeeeeeeeerrrrrrrssssss.....ttttt

    eeeeeeeeeecccccccccccccccccccccwwwwwwwwwwwwwww

    ttttttttttttthhhhhhhhhhhhhhhhheeeeeeeeeeeeeeee

    PrPrPrPrPrPrPrPrrrrPrososososossosoosssthththtththhthththttthhhtt odododododododododododododoododo oonononoononononononnonoonntititititititittitititiititt cscscscscssscscsscss: :::: :: BrBrBrBrBrBrBBrBrBrBrBrBBrB idididididididididdiddidddddi gegegegegegegegeggeggegegegeggeegeggge,, , ,, , ,, PaPaPaPaPaPPaPaPaPaPaPaPaPaPaPaPartrtrtrtrtrtrtrtrtrtrttrttrtiaiaiaiaiaiaiaiaiaiaiaiaiaiiaiaiaiaaiaaalslslslslslslslsllslsllsslslslsslllss,,,,, , , , ,,, DeDeDDDDDeDeDeDeDeeeDDeDeDeDDDeeeeD ntntnntntnntnnttnnnntntturururuurururuuu esesesessesssssssesssAeAeAeAeAeAeAeAeAAeststststststststsss heheheheheheeh tititititititttittiitiitttt ccc cc cccccccc DeDeDeDeDeDeDeDeDentntntntnntntnttnttntntntisisisisisisiisisssissssisssstrtrtrtrtrtrttrttrtttttrtrtrttrry:y:y:y:y:yy:y:y:y:y:yy:y::y:y:yy:yy W W W WWWW W W WWWWWWWWWWhihihihihihihihihihihihiihiiteteteteteteteteetetetetetettetetenininininininnininniininiiinin ngngngngngngngngngngngggngngngngngg,,, , ,,,, ,,, VeVeVeVeVeVeVeVeVeVeeVeVeVeVVVeVVVeVVVeVV nenenennenennenenenennnennnneneeeeeerererereereeers,s,s,s,s,s,sImImImImmmmplplplplpplppplp anananananananaantsttstststststsstsststs, , ,,, CrCrCrCrCrCCrCrCC owowowowowwowowwownsnsnsnssnsnsnsnsssss ( ( ( ( (((( ((OnOnOnOnOOOnOnOnnnOnOnnOnOnnne e e e eee eeee ee eee ee ApApApApApApApApApApApApApApApAAppppppppopopopopopopopopopooopopopooooppp ininininininininnninininntmtmtmtmtmmtmtmtmmtmtmtmtmtmtmtmmmtmmmtmtmmmmenenenenenenenenenenenenenenenennent)t)t)t)t)t)t)t)t)t)t)t)t))tt)

    MiMiMMMMMiinonononn r r rrr r OrOrOrOrOrOrOrOrralalalalalalaala S S SS S SSSururururururururgegegeeeegeegeegg ryryryryryryryryryryyryryrryryrryrryryry: : : : :: :::: ExExExExEExExExExExExExExtrtrtrtrtrtrtrtrtrtrrtrtrttrracacacacacacacacacacacacacctitititititititititititititiiiitiiiiiiiononononononononononnnononnonoonononononns,s,s,s,s,s,s,s,ss,s,s,s,s,s,sss,s,sSoSoSoSoSoSoSoS ftftftfftt T TT TTTTTTisisisisisisisssususususussuue e ee ExExExEExExxxciciciciciciciciiic sisisisisisisiiisisissiisisiiiiononononononononononononononnnnnnno

    GeGeGeGeeGGG nenenneeeerrrarararaar l l lll DeDeDDDDeDeDeDeeentntnttntntntnn isississsisstrtrtrtrttttt y:y:y:y:y:y:y:y:y:y::: B BB B BBBBBBBonononononononononnonnnonnnnnnndidididididididididiidiididididdidididididddid ngngngngngngngngngnggngnggngngngnnnngg,, ,,,,,,, , ToToToToToToToToToToToToToToToToooooToootototototototototttotttotototototoototh h h hhhhh hh hhhhhhh CoCoCoCoCoCoCoCoCoCoCoCoCCoCoCoCCoCoCCCC lolololllolololololololollololoorerererereererrereeer d d ddddd dd ddddddReReReReReReReReRReRestststststststorororrrrroratatatatatattattioioioiooooonsnsnsnsnsnsnsnnsss ( ( ( ( (( ( lllllllllllllllininininininiinnninnnngsgsgsgsgsgsgsgsgsgsgsgsgsssgsgsg ),),)),),),),)),),),)),)))))))))))) MM M M M M MM MMMMMMMMMMMMouououououououuouououooououuuouuthththhththhhthhhththhththththh GGG G G GG GGGGGGGGGGGuauauuauauaauauaaauuauuauuauuuuauuu rdrdrdrdrdrdrdrdrdrdrdrdrdrdrrddrddsssssssssssss

    EnEnEnEnEnEnnEnEnnE dodododooodooodododdodododoontntntntttnntnticiciciciciiiici s:s:s:s:s:s:s::ss RoRoRoRoRoRRRoRoRoRoRoRoooototottotttotottto C C C C CCCCananananananananananaanaaaanalalalalaaalalalalallaaalsssssssssssssssPrPrPrrrrPPreveveveveveveveee enenenenenennenene tititiiiitiiiiveveveveveveveveevv D D D Denenenennennenentititiiiiiitittt ststststststtstsstryryryryryyryryryyy: ::: :: HyHyHyHyHyHyHyHyHyyy iggigigigigigig enenenenenenenennnnnnnnnntitititititititititiitiistststststststssststststssss s,s,sss,s,ss,s,s,s,ssss S S S SS SSSS SSSSSSSeaeaeaeaeaeaeeaaeaeaaaaealalalalalalalalalaalaalalantntntntntntntntntntntntnttntnntntntts,s,s,s,s,s,s,s,s,s,ss,sss,FlFlFFlFlFFFlFllluouououuooooririririririririiidedededededededed T T TT T TTTTrerereerererererr atatatatatatatataa mmememememeeemmentntntntnnntntnn s sssss s (R(R(R(R(R(R(RR(RR(Rememememememememmmmemememememeeemememmbebebebeebebeebebeber r r rrrrr r eveveveveveveverererereeeee yy y yyy 66 6 666666 momomomomomoomommom ntntntntntntnttntnttnthshshhhshshshshhshshhs))))))))))))

    OOOOOOOOOOOOOOOOOOOOuuuuuuuuuuuuuuuurrrrrrrrrrrrrrrrr SSSSSSSSSSSSSSSSSSSSeeeeeeeeeeeeeeeeeeeerrrrrrrrrrrrrrrrrrrrvvvvvvvvvvvvvvvvvviiiiiiiiiiiiiiiiiiiiicccccccccccccccccceeeeeeeeeeeeesssssssssssssssssssssssssssss IIIIIIIIIIIIIIIIIIInnnnnnnnnnnnnnnnnnnnnnncccccccccccccccccccccclllllllllllllllluuuuuuuuuuuuuuuuuuuudddddddddeeeeeeeeeeeeeeeBBBBBBBBBBBBBBBBBBuuuuuuuuuuuuuuuuuuuuuuuuutttttttttttttttttttttttttttttttttt AAAAAAAAAAAAAAAAAAAArrrrrrrrrrrrrreeeeeeeeeeeeeeeeeeee NNNNNNNNNNNNNNNNNNNNNNooooooooooooooooottttttttttttttttttttttttt LLLLLLLLLLLLLLLLLLLLLLLLiiiiiiiiiiiiiiiiimmmmmmmmmmmmmmmmmmmmmmmmiiiiiiiiiiiiiiiiiittttttttttttttttttteeeeeeeeeeeeeeeeeeeeeeeeeeedddddddddddddddddddddddddddd TTTTTTTTTTTTTTTTTTTToooooooooooooo::::::::::

    PPPPPPPPPPPPPPPPPPPPPPPPrrrrrrrrrrrrrrrrroooooooooooooooooooooouuuuuuuuuuuuuuuuuuuddddddddddddddddd tttttttttttttttttooooooooooooooooooo eeeeeeeeeeeeeeeexxxxxxxxxxxxxxxxttttttttteeeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnnnnnnddddddddddddd ooooooooooooooouuuuuuuuuuuuurrrrrrrrrrrrPPPPPPPPPPPPPPPPPPPrrrrrrooooooooouuuuddddddddddddddddd tttttttttttooooooo eeeeeeeexxxxxxxtttttttttteeeeeennnnnndddddddddddddddd oooouuuuuuurrrrEEEEEEEEEEEEEEEEExxxxxxxxxxxxxxxxxxxccccccccccccccccccllllllllllllllllluuuuuuuuuuuuuuusssssssssssssssssiiiiiiiiiiiiiiiiiivvvvvvvvvvvvvvvvveeeeeeee MMMMMMMMMMMMMMiiiiiiiiiiiiiilllllllllllliiiiiiiiiiiiittttttttttttttaaaaaaaaaaaaaarrrrrrryyyyyyyyyy

    PPPPPPPPPPPPPPPPrrrrrrrrrrriiiiiiiiiiiccccccccccciiiiiiiiiiiinnnnnnnnnnggggggggggggggg........FiFiFiFiFiFFiFiFiFFiFFFiF nnnnnanananananaaaancncncncncncccccininininininnnng g gg ggggg AvAvAvAvAvAvAvAvAvvvaiaiaiaiiia lalalalaalaaablblblblbllbblb e e e e eeeee ththhththhththhhrorororororororororr ugugugugugugugh h h hhhhh WeWeWeWeWeWeWeWWeW llllllllllls s s sss s FaFaFaFaFaFaFargrgrgrgrgrrgrgrgrgrgrgrgo.o.o.o.ooo

    111111155555555555555000000000022222222222222 SSSSSSSSSSSSSS...... WWWWWWWWWWWWWWWAAAAAAAAAAAAAAASSSSSSSSSSSSHHHHHHHHHHHHHHHIIIIIIIIIIIIIIIINNNNNNNNNNNNNNNNGGGGGGGGGGGGGGGTTTTTTTTTTTTTTTOOOOOOOOOOOOOOONNNNNNNNNNNNNNN SSSSSSSSSSSSSSSSSSSSTTTTTTTTTTTTTTTTTTTTTTRRRRRRRRRRRRRRRRRRRRRRRRRRRREEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEETTTTTTTTTTTTTTTTTTTTTT SSSSSSSSSSSSSSSSUUUUUUUUUUUUUUUIIIIIIIIITTTTTTTTTTTTTEEEEEEEEEEEEEEE 2222222222222222220000000000000000000000000000000000000000000000000

    PPPPPPPPPPPPPPPAAAAAAAAAAPPPPPPPPPPPPPPIIIIIIIIIIILLLLLLLLLLLLLLLLLLLLLLLLLLLLLIIIIIIIIIIIOOOOOOOOOOOONNNNNNNNNNNNNNNNNNNNN,,,,,,,,, NNNNNNNNNNNNNNNEEEEEEEEEEEEEEEEEEEEEE 6666666666666666666688888888888888888888888880000000000000000000044444444444444444444446666666666666666666

    444444444440000000000000022222222222222222222-------33333333333333333333339999999999999999----------2222222222222225555555555555555555000000000000000011111111111111112222 222222222 wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww.........ddddddddddddddddddddddddddddddrrrrrrrrrrrrrrrrrrrrrrrrrmmmmmmmmmmmmmmmmiiiiiiiiiiiiiicccccccccccccccaaaaaaaaaaaaaaaaahhhhhhhhhhhhhhh......cccccccccccccccooooooooooooooooommmmmmmmmmmmmmmm

  • Offutt Air Force Base Newcomers Guide 3

  • For more information,please contact

    Dr. Richard E. Hasty at [email protected]

    402.296.3361www.pcsd.org

    facebook.com/pcsd68048@PCSD68048_Supt

    Working in partnership to ensure Academic

    achievement, responsible Behavior and Civic

    engagement.

    Plattsmouth Community Schools

    Plattsmouth, NEDistrict accredited through NCA AdvancED. Healthy Schools Programs in all buildings.

    A rural community and schools along Highway 75 that are within 10 min. of

    Bellevue and 20 min. of Omaha.

    Early Childhood State-designated model program for Positive Behavior Supports. Strong home-school connections.

    Elementary Class sizes in K-3 of 14-20 students. Active PTO, WATCH DOGS, and a highly rated 21st Century before and after school program.

    Middle School Strong emphasis on academics, ne arts, and athletics. New 21st Cen-tury after school program.

    High School Over 130 courses available to students. Dual-credit available through the University of Nebraska at Omaha and Southeast Community College. The only High School of Business and High School Diesel Mechanic programs in NE. Strong empha-sis on academics, culinary arts, ne arts, and athletics. One of two Silver Level Healthy Schools Programs in the nation.

    4 Offutt Airforce Base Newcomers Guide

  • Offutt Air Force Base Newcomers Guide 5

  • 6 Offutt Air Force Base Newcomers Guide

  • Offutt Air Force Base Newcomers Guide 7

  • 8 Offutt Air Force Base Newcomers Guide

    PCS ExpertsThe Husker Home FindersMilitary Spouse, Retired Military & Relocation Backgrounds

    Experienced Agents Ranked in the Top1% in the Metro Area for Home Sales

    Unrivaled Web Exposure & Innovative Technology FREE Hired Home Stager Sellers Exclusive Buyer Representation

    PcsOffutt.com(402) 709-4908 (402) 915-3443We Match All Rebate Programs!

  • Offutt Air Force Base Newcomers Guide 9

    Whats Inside

    getting started ...............................................12

    security forces ..............................................19

    finding a home ..................................................20

    moving with tricare ......................................25

    services and facilities ..................................29

    omaha map .........................................................43

    bellevue map ....................................................44

    offutt map .........................................................46

    base housing map ...........................................48

    clubs and associations ...............................50

    fightin 55th units ...........................................54

    major tenant units ........................................58

    offutt history .................................................74

    area schools ...................................................77

    advertisers index .........................................85

    www.offutt.af.mil

    Produced by Suburban Newspapers, Inc., a private firm in no way connected with the U.S. Air Force. Contents of the Offutt Newcomers Guide or Telephone Directory are not necessarily the official views of, or endorsed by, the U.S. Government, DOD, or the Department of the Air Force. The appearance of advertising in this product does not constitute endorsement by DOD, the Department of the Air Force, or Suburban Newspapers, Inc. of the products or services advertised. Everything advertised in the publication shall be made available for purchase, use, or patronage without regard to race, color, religion, sex, national origin, age marital status, physical handicap, political affiliation, or any other non-merit factor of the purchaser, user or patron. Editorial content is reviewed by the Public Affairs Office of the 55th Wing. All photographs are Air Force photographs unless otherwise indicated.

    Century 21 Agents

    Century Real Estate

    402-291-4800USAA Preferred Realtor

    Video Century21Century.com

    Download FREE Century 21 Mobile App For One Click Access to Sales & Rental Properties.

  • 10 Offutt Air Force Base Newcomers Guide

    Welcome to Richland Homes

    Models located in Kingsbury Hills Just north of HWY 370 on 114th St.

    New Homes from the $170s

    Represented by: Jill Marie Brown [email protected] 402-215-6715

    www.buildwithrichland.com

    * Military support on campus* Caring and dedicated advisors* Student tuition assistance* Special policies for deployments* Online classes

    Choose Iowa Western

    The world is waiting.

    [email protected] / 800.432.5852 / 2700 College Road, Council Bluffs, Iowa

    iwcc.edu

    Choosing a college is a big decision.At IowaWestern, we go out of ourway to help military students makethe right choice for their future.We offer:

  • Offutt Air Force Base Newcomers Guide 11 NMLS#13970

    FREEDOM LENDING LLC

    Serving Those Who Serve Our Country.

    Apply by phone or online at VAhomebenefi t.com

    DENNIS W. CLARKFREEDOM LENDING, LLC402-333-5432

    1230 S. 120th StreetOmaha, NE 68144

    www.mortgageloansofamerica.com

    VA, FHA & USDA Loan Available No Money Down Purchases 1st Time Homebuyer Program Re nance Specialists (No appraisals on VA IRRL) Rural Housing Lender 100% Financing Available Guaranteed Loan Costs FREE Pre-Qualifying by Phone or Online

    Visit www.omahahomesavings.com or text Save $$53,272 to 71441to learn how you can save $53,272.00 by fi nancing your home with us.

    NMLS#13970

    Apply by phone or online atVAhomebenefit.com

    DENNIS W. CLARKFREEDOM LENDING, LLC402-333-5432

    1230 S. 120th StreetOmaha, NE 68144

    www.mortgageloansofamerica.com

    VA, FHA & USDA Loan Available No Money Down Purchases 1st Time Homebuyer Program Renance Specialists (No appraisals on VA IRRL)) Rural Housing Lender 100% Financing Available Guaranteed Loan Costs FREE Pre-Qualifying by Phone or Online

    Visit www.omahahomesavings.com or textSave $$53,2772 to 71441to learn how you can save $53,272.00 by financing your homee wwith us.

  • 12 Offutt Air Force Base Newcomers Guide

    Getting Started

    Welcome to Offutt!Offutt Air Force Base has many ways to keep you informed of what is happening in and around the com-

    munity. The base has a website located at www.offutt.af.mil where you can read stories on what is happening within Team Offutt. In addition, anyone in your family can find information if assistance is ever needed on the websites Comprehensive Airman Fitness page.

    The base also has a very active social media program with a Facebook page, Twitter page, FLICKr page, YouTube channel and even an Offutt Weather Twitter page that can send you a text when the base is closed or there is delayed reporting because of inclement weather.

    For those of you with a smart phone, we have teamed up with other bases to provide an App. Simply look for MyMC2 or My Military Communities. Once you have it, choose Offutt and you will have what is happening on base in the palm of your hand.

    There is also a base newsletter. The Offutt E-News is distributed to base employees on Mondays, Wednesdays and Fridays. It is also available to spouses who request it. Simply e-mail [email protected] and request to be added to the distribution list.

    Last but not least, is the base newspaper, which is called The Base: 68113. This commercial paper is distributed by Suburban Newspapers using content mainly from the Offutt website.

    LocationOffutt AFB is 10 miles south of downtown Omaha in

    Bellevue, Neb., just six miles south of Interstate 80 at the Intersection of Capehart Road and U.S. Highway 75. The base operators phone number is (402) 294-1110, or DSN 271-1110.

    Driving from the East, West or NorthTake Interstate 80 to U.S. Highway 75 South, the

    Kennedy Freeway to Bellevue. To enter the Kenney Gate, go south approximately six miles and exit at Nebraska Highway 370. Turn left and go under the overpass to the second exit (Offutt AFB/Fort Crook Road). Turn right off the exit, get into the left lane and turn into the Kenney Gate (with all the flags). To enter the SAC Gate, go south approximately seven miles and exit at Offutt AFB/Capehart Rd. Turn left. The SAC Gate is straight ahead approximately one mile.

    Driving from the SouthFrom the South, exit Interstate 29 at exit number 42 in

    Iowa, and turn west on Iowa Highway 370. Go four miles.

    Cross the Bellevue Toll Bridge (toll is $1 one way). Continue straight on Nebraska Highway 370 (Mission Ave). At the fourth stoplight (Lincoln Rd), turn left and enter the base straight ahead. This is the Bellevue Gate, which is open from 6 a.m. to 2 p.m. Monday through Friday.

    Offutt Welcome CenterThe Bellevue Public Schools/Offutt Welcome Center is

    located in a brick, steel-roofed building on the northwest corner of the junction of NE Highway 370 and Ft Crook Road. The welcome center provides visitors with information on Offutt and the surrounding community. In addition, it also offers newcomers with a warm and inviting environment to meet their sponsors and access computers, the internet, employment information and maps. The superintendents office for the Bellevue Public Schools is located in the same building. To contact the Offutt Welcome Center, call (402) 827-8554, Monday-Wednesday, 7:30 a.m. - 12 p.m.

    Sponsorship/MailMeet your sponsor at the Offutt Welcome Center if

    you arrive during business hours. If you want to have mail forwarded to you at Offutt, you can use the following address: (Your Rank and Name), 110 Airman Circle Ste 99999, Offutt AFB, NE 68113-2070.

    Lodging ReservationsReservations at Offutt Inns can be made up to 120 days

    in advance and prior to receiving permanent change of station orders. Reservations must be reconfirmed three days prior to your arrival and will be canceled at 6 p.m. on the check-in date unless guaranteed with a credit card. To make reservations or for further information, call (402) 294-3671 or DSN 271-3671. Reservations may also be faxed to (402) 294-3199 or sent via e-mail to [email protected].

    Advance Pay for PCSingAdvance military pay is available within 30 days

    prior to PCSing and up to 60 days after arrival at your new permanent duty station. E-5s and above may request one month advance pay (minus deductions) without commanders approval and up to three months with commanders signature. E-4s and below will require commanders signature regardless of the number of months. Repayment on advance military pay is 12 months with an available extension of up to 24 months, again with commanders approval.

  • Offutt Air Force Base Newcomers Guide 13

    Getting Started

    Signing In When you arrive at Offutt, youll need to sign in at

    your unit commanders support staff office. Your leave enroute ends the day you sign in. Talk to your sponsor, your supervisor or an expert in your unit about when to sign in. Remember, you must sign in before or on your Report No Later Than Date.

    Important Items to Hand Carry: Copies of your PCS orders All moving paperwork, inventory, etc. Employment records of family members Medical, dental and immunization records

    for entire family School records for children and adults Pet records and immunizations Phone numbers for your gaining unit, sponsor and

    command post (for emergencies during transit)

    Mandatory AppointmentsIn-processing briefing

    Your CSS will schedule you for a briefing to complete all finance and military personnel flight in-processing. Be sure to bring several copies of your PCS orders, all travel documents, your personnel records and your medical records. The briefing also includes a section on family readiness and TRICARE at Offutt. Plan on spending one to two hours at this briefing.

    First Term Airmen CenterAfter completing the base in-processing briefing, all

    first-term/first-duty-station Airmen report to the First Term Airmen Center for in-processing and orientation. Airmen return to their units of assignment for unit specific in-processing, then report to FTAC the following week for 14 days of mission orientation, details, training and completion of base-level in-processing.

    EO Newcomers Orientation and First Duty Station Training

    In accordance with Air Force Instruction 36-2706, all Department of Defense personnel will receive equal opportunity human relations education within 30 days of arrival. These briefings are designed for individuals to comprehend and recall Air Force, Air Combat Command and local installation commanders Zero Tolerance policy regarding unlawful discrimination and sexual harassment. For appropriate scheduling, contact the EO office at (402) 294-3709 or DSN 271-3709.

    Right Start OrientationThis four-and-a-half hour briefing is mandatory for all

    personnel in-processing to Offutt. Its a one-stop orientation that covers all required newcomer briefings except the finance and travel briefings. Spouses are highly encouraged to attend.

    Also on ArrivalRelocation Assistance

    Come to the Airman & Family Readiness Center for information on the community and other relocation services. The Airman & Family Readiness Centers phone number is (402) 294-4329.

    Household Goods ShipmentThe Joint Personal Property Shipping Office in Colorado

    Springs, Colo., handles all in-bound household goods. Call (800) 771-1819 or DSN 692-9291 as soon as possible after arrival to arrange the delivery of your household goods. If you have housing and your household goods have arrived, you can schedule a delivery date. Personally Procured Moves (formally known as DITY moves) are filed with Household Goods, Bldg. 323C, Room 301.

    TRICARE RegistrationIf youre coming from a base in a region other than

    WEST, youre required to transfer enrollment for you and your family members in TRICARE Prime to this region (WEST) and select a Primary Care Manager upon arrival to Offutt. If you are coming from a base located in this region (WEST), youre required to request a Primary Care Manager change. TRICARE Prime coverage wont automatically transfer from one location to another for you or your family members. You must be proactive regarding your familys healthcare benefits. To enroll your family members, visit www.tricareonline. com. If your family members arent already enrolled in TRICARE Prime, appointments for your family members will be on a space-available basis at Ehrling Bergquist Clinic.

    Pay InquiriesThe 55th Comptrollers Squadrons Financial Services

    Office is located in Building C, Room 138. They can also be reached by calling either (402) 294-3300 for military/travel pay or (402) 294-3005 for civilian pay. In case of a financial emergency, the Air Force Aid Society can be reached through the Airman & Family Readiness Center at (402) 294-4329.

  • 14 Offutt Air Force Base Newcomers Guide

    Getting Started

    On-Base PhonesThe base has four telephone prefixes: Commercial 294

    and 232, and DSN 271 and 272. To place calls from one on-base phone to another, dial the seven-digit number 294-XXXX or 232-XXXX, whichever is appropriate. To place calls from an on-base phone to an off-base phone, dial 99 then the seven-digit number (you will hear a dial tone after dialing 99). To place DSN calls, dial 94 then the seven-digit number. Long distance calls from on-base phones can only be made by using a personal identification number thats issued by the 55th Communications Group through unit telephone control officers.

    AirportsTheres one major airport in the metro Omaha area.

    Eppley Airfield is four miles northeast of downtown Omaha at 4501 Abbott Drive, off Highway 480 North and Sorenson Expressway. There are also two small noncommercial airports in the Omaha area. North Omaha Airport is located on North 72nd Street in Omaha and Millard Airport is located at 12916 Millard Airport Plaza in West Omaha.

    Weather OverviewOmaha area weather varies significantly throughout

    the year. Summers are very warmand at times rather humid with high temperatures ranging between 80 and 90 degrees Fahrenheit. Summertime thunderstorms are observed (on average) nine times per monthJune through September. These storms usually occur in the late evening and overnight hours and account for nearly half of the regions annual rainfall.

    On the other hand, winter weather is rather dry and cold. Typical daytime high temperatures range between 30 and 40 degrees Fahrenheit from December through March. Nevertheless, below zero temperatures are possible during colder spells and strong winds can create wind chill factors of 20 to 40 degrees below zero. Annual snowfall for eastern Nebraska averages between 25 and 30 inches. Spring and fall the transition seasons are mild, with high temperatures reaching 50 and 60 degrees Fahrenheit. Occasionally this transition time produces severe weather isolated severe thunderstorms with hail (and even the possibility of tornadoes) as warm and cold air masses clash in the Central Plains States.

    On-base government transportation Offutts shuttle bus stops at various base locations Monday

    through Friday, 6 a.m. to 5:30 p.m. The shuttle bus doesnt run on weekends or holidays. For more information or a copy of the shuttle schedule, call transportation dispatch at (402) 294-4375.

    KNOW HOW

    www.napaonline.com

    Reserve Online,Pickup in Store

    6160 Grover Street Omaha 402-554-45002301 Cornhusker Road Bellevue 402-291-62002318 North 90th Street Omaha 402-571-9900

    2629 West Broadway Council Bluffs 712-323-75275212 South 133rd Court Omaha 402-895-9433

    8505 Giles Road Papillion 402-597-0555

    www.napaonline.com

    Reserve Online,Pickup in Store

    6160 Grover Street Omaha 402-554-45002301 Cornhusker Road Bellevue 402-291-62002318 North 90th Street Omaha 402-571-9900

    2629 West Broadway Council Bluffs 712-323-75275212 South 133rd Court Omaha 402-895-9433

    8505 Giles Road Papillion 402-597-0555

    SHADY LANE RANCH, INC.17744 Shady Lane, Council Bluffs (Old Lincoln Hwy) 51503 712-323-1932(2 1/2 miles north of Council Bluffs on Old Lincoln Hwy / North Broadway)

    Horseback rides all summer & fall.Call ahead & reserve!

    HAYRACK & HORSEBACK RIDES

    Shady LaneRanch Inc.HAYRACK RIDES, DAILY & EVENINGS THROUGH FALL

    Book ahead! Group min. 20 person per rack followed by Campfire Parties. Discounts on Sundays for church groups, family groups,

    scouts & other special organizations.

    OPEN DAILY!

    SHADY LANE RANCH, INC.17744 Shady Lane, Council Bluffs (Old Lincoln Hwy) 51503 712 323 193217744 Shady Lane, Council Bluffs (Old Lincoln Hwy) 51503 712-323-1932(2 1/2 miles north of Council Bluffs on Old Lincoln Hwy / North Broadway)

    HoHHHHHHHHHH rseback rides all summer & falCall ahead & reserve!

    HAYRACK & HORSEBACK RIDES

    RRRRaaaanncccchhhh IIIIncccc..Ranch Inc.ll.

    HAYRACK RIDES, DAILY & EVENINGS THROUGH FALLHROUGH FALLBook ahead! Group min. 20 person per rack followed by Campfire Parties.

    Discounts on Sundays for church groups, family groups,scouts & other special organizations.

    OPENPENDAAILY!Y!LY!LYY!!LY

  • Offutt Air Force Base Newcomers Guide 15

    Regent Financial Group is an award winning veteran ownedMidwest mortgage company with an A+ BBB rating

    Make a strategic financial decision with a new VA Home Loan!

    Purchase a home with 100% nancing and no down payment Consolidate existing mortgage debt and other bills into a new low rate VA Loan.

    No monthly mortgage insurance No application fees Free credit analysis

    1910 S. 72nd St., Suite 103 Omaha 402.884.5634

    Brad DexterMortgage Loan Of cer

    License # 78146www.regent nancial.com

    braddexter@regent nancial.com

    RRReeegggeeennnttt FFFiiinnnaaannnccciiiaaalll GGGrrrooouuuppp iiisss aaannn aaawwwaaarrrddd wwwiiinnnnnniiinnnggg vvveeettteeerrraaannn ooowwwnnneeedddMMMiiidddweessttt mmoortttgggagggee ccoommpppannyy wiiittthhh ann AAA+ BBBBBBBBB ratttiiinnggg

    RRegentt FFiinanciiall GGroup iis an awardd wiinniing vetteran ownedd

    PPPPuuuurrrccchhaaasseeee aa hhhhooommmeeee wwwwwiitthhhhh 11110000000%%% nnaannccinngggggg aaanndddd nnnnoooo ddddooowwwnnn pppppaaayyyyyyyyymmmeennnttttPPPPPPPPuuuuuuuurrrrrrcccccchhhhhhhhhhhhaaaaaaassssssseeeeeeeeeeee aaaaaaa hhhhhhhhhhhhooooommmmmmmeeeeeeeeeee wwwwwwwwwwwiiiiiiittttttthhhhhhhhhhhhhhh 111111111100000000000000000%%%%%%%%%%%%%%% nnnnnnnaaaaaannnnnnccccciiiiiiiiiiinnnnnnngggggggggg aaaaaaaaaaannnnnndddddddddddd nnnnnnnnnooooooooooo dddddddddddddddooooowwwwwwwnnnnnnnnnn pppppppppppaaaaaayyyyyymmmmmmeeeeeennnnnnttttttttttttt CCCCCCCCoooooonnnnnnsssssssooooooollllllllliiiiiiiidddddddddaaaaatttttttteeeeeeeeee eeeeeeeeexxxxxxxiiiiiiiissssssstttttttttiiiiiiiiinnnnnnngggggggggg mmmmmmmmoooooorrrrrrtttttttttggggggggaaaaaaaggggggggeeeeeeeeee ddddddddddddddeeeeebbbbbbbbbttttttttt aaaaaaaaannnnnndddddddddd oooooooootttttttthhhhhhhhhheeeeeeeerrrrrrr bbbbbbbbbiiiiiiiiillllllllllllllllssssssssss iiiiiiiinnnnnnntttttttttooooooooo aaaaaaa nnnnnnnnneeeeeeeewwwwwwwwww llllllllooooooowwwwwwwww rrrrrrrraaaaaaaatttttttteeeeeeeeee VVVVVVVVVVAAAAAAAAAAA LLLLLLLLLLLoooooooooaaaaaaannnnnnnnnn..

    NNNNNNNNoooooooo mmmmmmmmoooonnnntttttthhhhhhhhhlllllllyyyyyyyy mmmmmmmoooorrrtttttttggggaaaaggggeeeeeee iiiiiiiinnnnssssuuuurrrraaaannnncccceeeeeeee NNNNNNNNooooooo aaaaaaaappppppppppppppplllllllliiiiiiiicccccccaaaaaattttttttiiiiiiiiooooonnnnn ffffeeeeeeeeeeeessssssss FFFFrrreeeeeeeeeeeeeee ccccrrreeeeeeeddddddddiiiiiiittttt aaaaaaaannnnnnaaaaaallllllllyyyyyysssssssiiiiiiissssssss

    1910 S. 72nd St., Suite 103 Omaha 402.884.5634

    Brad DexterBrad DexterMortgage Loan Ofcer

    License # 78146www.regentnancial.com

    [email protected]

    Deluxe Continental Breakfast featuring waf es, oatmeal, eggs and meat, pastries and cereal InternetHot Tub Exercise Room Guest Laundry Cookies at Check-in

    High Speed Internet LCD TVs Refrigerators Microwaves

    WHITE HOUSE INN, BELLEVUE, NE

    ALL ROOMS FEATURE:

    HOTEL FEATURES INCLUDE:

    NEWLY REMODELED!!

  • 16 Offutt Air Force Base Newcomers Guide

  • Offutt Air Force Base Newcomers Guide 17

    Thanksgiving!LUTHERAN CHURCH

    Corner of 36th and Hwy 370, Bellevue NE 68123402-292-2695

    www.thanks-giving.orgServices: Saturday evening 5:30pm

    Sunday morning 8:15Traditional Service

    Sunday morning 9:30 & 11:00Contemporary Services

    LLUUTTHHHEERRAAANNN CCHHUURRCCCHHCoornner oof 366thh aand Hwwyy 337700, BBeelleevvuee NNEE 668812233

    402-229922--22669955wwwwww.tthannkks--ggivvinngg.oorrg

    SSerrviicees:: Satturdaayy eeveenning 5:30ppmmSuunddaay mmorrniingg 8:155

    TTraaditioonnal SSeervviceSSunddayy mmoornninng 99:330 && 111:000

    CCoonteemmporraryy SSerrvicees

    ST. MATTHEW CATHOLIC PARISH12210 S. 36th Street, Bellevue | Office: 402-292-7418

    www.stmatthewsomaha.orgST. MATTHEW CATHOLIC SCHOOL

    School: 402-291-2030 | Preschool thru 8th gradewww.stmatthewsschool.net

    Worship Times: Saturday, 5:00 pmSunday, 8:00, 9:30 and 11:30 amDaily Mass: 7:00 and 8:20 am

    Worship:Sunday Morning: 10:30 a.m.Thursday Evening: 6:00 p.m.

    36th & Greene Avenue402-734-2400

    www.aldersgatebellevue.org

    AldersgateUnited Methodist

    Church

    Walnut CreekVeterinary Clinic

    Surgery & dentistry Medicine & vaccinations

    Skin, ear & eye care Care for puppies & kittens

    Senior Pet Care In house radiology

    We treat yours like one of ours!

    B.J. Ravnsborg, DVM

    Kendra May, DVM

    Megan Losee, DVM

    Mon. - Fri. 8am-6pm; Sat. 8am-noon96th & Hwy 370 402-505-5445

    www.walnutcreekvetclinic.com

    Walnut CreekVeterinary Clinic

    Surgery & dentistry Medicine & vaccinations

    Skin, ear & eye care Care for puppies & kittens

    Senior Pet Care In house radiology

    We treat yours like one of ours!W

    B.J. Ravnsborg, DVM

    Kendra May, DVM

    Megan Losee, DVM

    Mon. - Fri. 8am-6pm; Sat. 8am-noon96th & Hwy 370 402-505-5445

    www.walnutcreekvetclinic.com

    NEBRASKAS #1 PRO SHOPNEBRASKAS #1 PRO SHOP

    TOM KELLEYSBOWLING PRO SHOP

    WESTGATE PLAZA3401 S. 84th St.

    Omaha, NE 68124Email: [email protected]

    Mon-Fri 9am-5:30pmThur 9am-8pmSat 9am-4pm

    402-397-5555

    2ND LOCATION601 Chateau Drive, inside

    Leopard Lanes in BellevueWed/Thurs 4-9pm

    Fri 6-9pm

    Check out Kelleysproshop.com for

    extra dates & timesLARGEST SELECTION OF QUALITY EQUIPMENT, ACCESSORIES

    ESTABLISHED 1980, SAME DAY SERVICE

    Whether you need a question answered, a problem solved,or a claim reported, my jobis to make it happen.Like a good neighbor, State Farm is there.CALL ME TODAY.

    Beingthereis whyIm here.

    P097193.1 State Farm, Home Oce, Bloomington, IL

    Jon Bergmeier, Agent1240 N Washington St Ste B

    Papillion, NE 68046Bus: 402-339-3555

    www.jonbergmeier.com

  • 18 Offutt Air Force Base Newcomers Guide

    Full Time Realtor Since 1988 I will assist you in relocating across town or across the nation

    Knowledgable in the complete greaterOmaha area housing market

    Email: [email protected] Web: MARYLOUBELL.COM

    Cell 402-681-6478 Direct 402-597-4164 Toll Free 1-800-927-3314

    Specializing In Sarpy County

    Sarpy Countys Source For Real Estate

    Stop in today for a complimentary Buyer Information Packet

    48th & Hwy 370Papillion, NE 68133

    402-597-5008 402-293-5008800-927-3314 www.npdodge.com

    Clients Are #1 With Me!Professionalism with the personal touch!Marylou

    Bell Full Time Realtor Since 1988sist you in relocating across town or across the nation

    Knowledgable in the complete greaterOmaha area housing market

    Email: [email protected]: MARYLOUBELL.COM

    Cell 402-681-6478 Direct 402-597-4164Toll Free 1-800-927-3314

    Specializing In Sarpy County

    Stop in today for a complimentary Buyer Information Packet

    48th & Hwy 370Papillion, NE 68133

    402-597-5008 402-293-5008800-927-3314 www.npdodge.com

    Clients Are #1 With Me!Clients Are #1 With Me!ofessionalismofessionalism with the personal touch!with the personal touch!

    I will as

    ProPro

  • Offutt Air Force Base Newcomers Guide 19

    Security Forces

    Getting Onto BaseOffutt has three gates for your use. The Kenney Gate and

    the STRATCOM Gate are open 24 hours. The Bellevue Gate is open Monday-Friday from 6 a.m. to 2 p.m. including ACC Family Days. The Bellevue Gate is closed weekends and federal holidays. Visitor passes are granted through the Pass and Registration Center, which is located adjacent to the STRATCOM Gate. They are open Monday-Friday from 7 a.m. to 5 p.m.

    Vehicle RegistrationThe Air Force no longer requires military, family members

    and Department of Defense employees to register vehicles on base. All drivers must have a valid Department of Defense identification card, valid drivers license, current registration and proof of insurance. International drivers licenses are valid up to 30 days upon arrival to Offutt, after which only valid state licenses are permitted. For more information, contact the Pass and Registration office at (402) 294-8979.

    Weapon RegistrationAll personnel residing in dormitories, bachelor living

    quarters, temporary living facilities (TLFs), government housing (to include privatized housing) or billeting/lodging facilities must register any firearms they possess. The registration focal point for personnel assigned to the 55th Wing will be the individuals group commanders support staff or unit orderly room. For all other organizations, the unit orderly room is the focal point for registration.

    Emergency Phone NumbersThe 911 emergency system is used on Offutt and in

    the local communities for fire, rescue and police services. Dialing 911 from an on-base phone, including most phones in Capehart housing, will connect you to base emergency services, the 55th Security Forces Squadron, base fire department and Ehrling Bergquist clinic. Dialing 911 from an off-base residence will connect you with Sarpy County 911 emergency services.

    Insuring your Personal VehicleAll automobiles must have insurance, and proof of this

    must be provided to obtain state registration. For more information regarding Nebraska insurance laws, call the Sarpy County Motor Vehicle Department at (402) 593-2148 located at 84th St. and Hwy 370.

    Driving On-BaseGeneral

    Operators and passengers of all vehicles operated on Air Force installations must wear seat belts. Children newborn through six years of age will be seated and restrained in a Department of Transportation-approved child restraint seat. The speed limit on Offutt is 25 miles per hour unless otherwise posted. The speed limit in base-housing areas varies from 15 mph to 25 mph (as posted).

    Only hands-free cell phone use is authorized by the Department of Defense on installations while operating a vehicle.

    SpeedingDriving more than 10 to 15 mph over posted speed

    limit within base housing will result in a seven-day driving suspension and the drivers base traffic history being assessed points. Any second speeding offense in base housing within 12 months will result in a 30-day suspension and points assessed. Any third speeding offense in base housing within 12 months will result in a six-month suspension and points assessed. Citations issued to people for exceeding the base housing posted speed limit by 16 mph or ore will be reviewed on a case-by-case basis.

    CautionPlease use caution along curb side parking in the base

    housing areas. Congestion makes it very difficult to see children playing and walking through the area. Please drive with extreme care.

    AlcoholThe legal drinking age in Nebraska is 21. Purchase or

    possession of an alcoholic beverage by someone underage is a misdemeanor. Nebraska law and Offutt AFB regulations prohibits having an open container of alcohol in a vehicle, even if the vehicle is parked. All persons driving on Nebraska roads are deemed to have given consent to a chemical test to determine the level of drugs or alcohol in their blood, breath or urine. Refusal of a breath test is a misdemeanor. Refusal may also result in revocation of driving privileges for up to 15 years, depending on the offenders prior record. For more information on any legal issues, call the base legal office at (402) 294-3732/3733.

  • 20 Offutt Air Force Base Newcomers Guide

    Finding a Home

    On- and Off-Base HousingPrivatized Housing Information

    As part of the Military Housing Privatization Initiative, the Air Force conveyed all Offutt AFB housing units to America First Communities on Sept. 15, 2005. AFC operates the community under the name Rising View and is revitalizing the housing community. They own, operate, maintain and manage the community for the next 50 years. Privatization brings much needed improvements to the Offutt community and improves the quality of life for military families stationed at Offutt.

    Although Rising View is privatized, the Offutt AFB Housing Management Office (HMO) continues to support your housing needs. It is always recommended that you visit the HMO before making housing arrangements. The information provided below includes an overview of privatized housing and a brief description of the application process. If you have any questions, contact the HMO at DSN 271-6242 or Commercial (402) 294-6242. You may also contact the Rising View Property Management Office at (402) 991-9840. More information is also available at www.risingview.com.

    Privatized Housing OverviewOnce complete, Rising View will have demolished nearly

    1,900 homes, renovated 484 homes and built 914 new homes (a combination of three and four bedroom homes for Junior and Senior NCO as well as Company Grade, Field Grade, and Senior Officer). Rising View has also provided several community enhancements, including increased recreational facilities (e.g., soccer field and playgrounds), trail systems, and a new Community Center facility. Active duty military members will receive Basic Allowance for Housing (BAH) according to your rank and dependent status.

    If you choose to live at Rising View, your rent will be equal to your BAH and this will include utilities, maintenance, renters insurance, and trash/yard waste/recycling. You will be required to sign a one-year lease. For military married to military, the rent will be based on the with dependent rate of the senior ranking member (junior ranking member will still collect BAH and pocket the difference). Example:

    - Without dependent rate E-5 BAH is $842 and without dependent rate E-4 BAH is $738 for a combined total BAH of $1,576.00 if the E-5 and E-4 military members are married

    - With dependent rate E5 BAH is $1,070 so this would be the rent amount

    - The difference in BAH between what the household is collecting and the rent amount ($1,576 minus $1,070) equals $506.00 (this is what the junior ranking member pockets)

    Visit Rising View online at www.risingview.com for more information about the houses, the community, and Offutt AFB.

    Applying for Privatized Housing The Offutt HMO processes all applications for privatized

    housing. All eligible active duty military members are authorized to submit an advance application. You should visit your current installations HMO, with copies of your PCS orders, to fill out an application and they will mail/fax it to our HMO. If you receive short notice PCS orders, you may want to request that the housing office fax your application and orders to this office at DSN 271-9763. The effective date of your advance application is the date you depart your losing duty station. If you submit an advance application, you will be advised via DD Form 1747 (Status of Housing Availability) of the effective date of placement on the waiting list, number of bedrooms authorized, and the estimated waiting period for a home. The estimated waiting period will be based on your projected arrival date and not on the date of application. If you do not submit an advance application, you may apply at the HMO as a walk-in upon arrival; however, your date of application will be the day you apply.

    Assignments of Privatized Housing In all cases, assignments to privatized housing are made

    only to personnel who have arrived at the installation and have processed into their unit. After this occurs, you must visit the HMO to be processed in, or call ahead for an appointment. In order to be processed in and referred to privatized housing, you must complete an application (if no advance application was submitted) and present your in-processing checklist to the HMO, who will then validate your eligibility, and refer you to Rising View. Rising View will then escort you to visit available homes and answer any questions you may have. If you choose to live in privatized housing, Rising View will process the required paperwork (including a resident lease) and complete the assignment process. Assignment is made by number of bedrooms authorized (up to four bedrooms), date of application and pay grade category.

    Wait Time For most housing grade categories, there is a short

    waiting period in place.

    Existing Offutt HousingOfficer and Enlisted Housing Area

    Rising View is located two miles west of Offutt AFB and offers a variety of housing styles for Junior NCOs, Senior NCOs, Company Grade Officers, Field Grade Officers and Senior Officers. The majority of the community consists of two-story duplex homes with a two-car garage. Other home

  • Offutt Air Force Base Newcomers Guide 21

    Finding a Home

    styles vary and may include single-level homes, homes with unfinished basements, and accessible homes. Each home is equipped with a stove, refrigerator, garbage disposal, dishwasher, washer/dryer hookups and central heating and air conditioning (newly constructed and renovated homes also include microwaves).

    Coffman HeightsThese homes are located on the base proper and were

    built between 2000-2008. Each home is equipped with a stove, refrigerator, garbage disposal, dishwasher, central heat and air conditioning (newly constructed homes also include a microwave). These are all duplex single-story or two-story homes with one- or two-car garages.

    Fort Crook Historic Housing The Fort Crook Historical District, located in the

    center of the base, was originally a U.S. Army cavalry post, completed in late 1896. Today, the district includes two housing areas: Chiefs Row consists of seven, three- and four-bedroom, two-story brick homes and one single two story home. Generals Row consists of 18 three story brick homes (nine duplexes) and one single, three-story home for general/flag officers and mission essential commanders.

    Off-Base Housing InformationAll military personnel, including unaccompanied and

    single personnel, are encouraged to process through the housing office prior to entering into a lease agreement or purchase agreement. If you arrive during non-duty hours, contact the Lodging Office, Building 44, on Grants Pass, or call (402) 294-3671, 291-9000, or DSN 271-3671. The staff can provide you with information concerning temporary lodging and any restrictions.

    The housing office staff provides information on off-base housing from its computerized rental and sales listings. The listings include information on the number of bedrooms, price range and location, and can be tailored to meet your needs. Temporary housing listings are also available. The housing office staff can provide you with a pamphlet which contains a list of furnished and unfurnished temporary rental apartments and also local area motels and hotels. Motel/hotel weekly rates range from $245 to $500. Temporary apartment rentals are available, but management will usually require a monthly agreement. These will range from $500 to $1200, and vary by location and amenities. Our off-base housing situation ranges from fair to very good, depending upon your

    Highway 370 & 72nd StPapillion 402.537.0046Mon-Sat 10 - 9, Sun 12 - 6

    ShadowLakeShopping.com

    More than 70 stores, services and restaurants

    YOUR PLACE

    FULL SERVICEBAR & LOUNGE

    Luncheon Specials Fast Lunch Service

    4006 Twin Creek Dr.Located in the Twin Creek Plz.

    402-291-8855

    DINING IN / CARRY OUTDAILY SPECIALS

    ALL MILITARY RECEIVE 10% OFF YOUR TOTAL PURCHASE.

    WEDNESDAY ONLY!

    NEW LIFE THRIFT

  • 22 Offutt Air Force Base Newcomers Guide

    Finding a Home in your neighborhood

    DUNDEE402.934.9439

    RALSTON402.339.1944

    MILLARD402.505.6660

    BELLEVUE402.932.1944

    Sunday through Thursday

    11am to 1am

    Friday & Saturday11am to 2am

    TAKE OUT& DELIVERY

    varsityromancoinpizza.com

    in your neighborhood

    DUNDEEDUNDEE402.934.9439

    RALSTONRALSTON402.339.1944

    MILLARDMILLARD402.505.6660

    BELLEVUEBELLEVUE402.932.1944

    Sunday throughThursday

    11am to 1am

    Friday & SaturdayF11am to 2am

    TAKE OUT& DELIVERY&

    in your neighborhood

    varsityromancoinpizza.comarsit romancoinpi a com

    Proudly representing...

    USAA Preferred AgentCheri Andersen402-630-3969

    [email protected]

    Licensed in IA and NE

    BUYING,SELLING ORBUILDING?Looking for the perfect budget & lifestyle in the Heartland area?Let my knowledge & expertise walk you through the process with con dence and ease. Call Me today!

    personal situation, family composition and intentions. The majority of apartment rentals include only one and two bedrooms. Some three-bedroom and four-bedroom units are available but tend to be fairly expensive. The rental vacancy rate for apartments and single family homes in the area is near six percent and 10 percent, respectively. Housing rentals in Bellevue (adjacent to the base), and Papillion (approximately eight miles from the base) can usually be found, but are generally more expensive. Rental prices may vary according to location and amenities, and are subject to change. Owning a pet will limit your options, since few landlords allow them. If allowed, you may be required to pay a pet deposit and an additional monthly pet fee. The approximate average rental price of a unit within commuting distance of Offutt AFB, excluding utilities, is as follows.

    Council Bluffs (Iowa), Plattsmouth, and South Omaha (Nebraska) are located within a 15-20 minute drive from the base. Rentals in these areas range from $550 to $1500 per month, plus utilities.

    There is an abundance of new home construction throughout the Metropolitan Omaha Area. The approximate average sale price of a home within a 15-mile radius of Offutt AFB (mostly Sarpy County) varies according to location, amenities, and individual desires. The below information, not all inclusive, represents three- and four-bedroom home sales, as reported by the Sarpy County Assessors Office, sold for a specific period.

    Automated Housing Referral Network The Automated Housing Referral Network (https://

    www.ahrn.com) is sponsored by the Department of Defense and is designed to improve the process of securing available housing for relocating military members and their families. AHRN.com encompasses off-base rentals, on-base military rentals, short-term rentals, roommates wanted and military For Sale by Owner listings.

    Apartments Average Rental Price (Unfurnished) 1-bedroom: $550-750 2-bedroom: $600-850 3-bedroom: $800-1100

    Single Family Dwellings 2-bedroom: $575-782 3-bedroom: $975-1400 4-bedroom: $1200-1500

    Location Average Prices Bellevue East: $136,000 - $154,000 Bellevue West: $166,000 - $220,000 Gretna: $189,000 - $245,000LaVista: $161,000 - $257,000 Millard: $156,000 - $254,000 Papillion: $181,000 - $245,000 Springfield: $157,000

  • Offutt Air Force Base Newcomers Guide 23

    Online and face to face classes available

    goOU.ou.eduThe University of Oklahoma is an equal opportunity institution.

    ITS YOUR DEGREE.GO GET IT.

    The UNIVERSITY of OKLAHOMAat OFFUTT AFB

    Masters degree options available at Offutt A.F.B.

    Contact (402) 291-8879 or email [email protected] for more information.

    LindaHayton, BROKER ASSOC. 402-639-6363CRS, GRI, ABR, CSP, CMRS

    DonHayton, REALTOR 402-639-6566JohnLytle, BROKER ASSOC. 402-639-9993Christine Lytle, REALTOR 402-597-5008

    Email: [email protected]:800-927-3314

    4912 Shannon Drive Papillion, NE 68133

    Family of Realtors serving Offutt, Bellevue, Papillion, Omaha, Plattsmouth and surrounding areas

    Retired military family and Military Relocation Specialists Top 1% of the Omaha area metro agents in residential home sales

    Helping Offutt Families buy and sell homes for over 20 years.

    HAYTON/LYTLE TEAMOmahaHouseCalls.com

    We Make House Calls... That Sell HOMES!

    Bill [email protected] [email protected]

    TWENTY FOUR YEARS SELLING REAL ESTATE

    MULTIMILLION DOLLAR PRODUCER

    CERTIFIED RESIDENTIAL SPECIALIST (CRS)

    GRADUATE REALTOR INSTITUTE (GRI)

    ASSOCIATE BROKER SINCE 1988

    WINNER OF DISTINGUISHED SALESPERSON AWARD

    TOP LISTING AWARD WINNER

  • 24 Offutt Air Force Base Newcomers Guide

    Your Career

    Federally insured by the NCUA. No security clearance is required for PenFed employment. An offer of employment, and continued employment, is contingent on satisfactory results from a credit check, criminal background check, and verication of previous education and job experience. Equal Opportunity Employer: M/F/V/D.

    over 1.1 million members worldwide with more than $15 Billion in assets.

    mortgages and car loans, low cost credit cards, and much more.

    PenFed has two Omaha Metro Area locations:13220 Fort Street, Omaha 502 Fortune Drive, Papillion

    PenFed is for the extremely motivated individual that enjoys a challenging

    Accounting Audit Card Services Collections Compliance IT Employee Services Member Services

    PenFed is for the extremely motivated individual that enjoys a challenging

    Medical, Dental, and Vision Disability Coverage Life Insurance 401(k) with company match Generous Personal and Sick Leave

    Education Assistance Flexible Spending Accounts On-site Fitness Center

    PenFed.org/MyCareer: View available positions and download an employment application.

    [email protected]: Submit your resume (or fax it to 402-951-2661).

    Please, no drops ins or phone calls.

  • Offutt Air Force Base Newcomers Guide 25

    Moving with Tricare

    Moving with TRICAREYour TRICARE coverage is completely portable

    meaning it moves with you. Youre covered worldwide both in transit to your new duty location and once you arrive but depending on where you go you may use a different TRICARE health plan option. Additionally, you may have different steps depending on which health plan option you are using now. For more information, visit www.tricare.mil.

    When Enrolled in a TRICARE Prime Option

    The TRICARE Prime options include TRICARE Prime and TRICARE Prime Remote in the United States, and TRICARE Prime Overseas and TRICARE Global Remote Overseas in regions outside of the United States. Follow these simple steps to ensure you have no break in coverage when you move. Do not unenroll from your TRICARE Prime option before you move. Once you arrive at your new location, update your personal information in the Defense Enrollment Eligibility Reporting System (DEERS) immediately. Select a new primary care manager (PCM) when moving within the same region or submit a new Prime enrollment form within 30 days if youre moving to a new region. Where you are moving will determine which Prime option you will enroll in. If you move to a new Prime service area, transfer your enrollment by submitting a TRICARE Prime Enrollment and PCM Change Form to your regional contractor. Be sure to include all family members on the form who wish to use Prime.

    When Using TRICARE Standard and Extra

    TRICARE Standard and Extra are available to family members only. Active duty service members are required to enroll in one of the Prime options described above. TRICARE Standard and Extra are available throughout the United States and enrollment is not required. Any active duty family member who is registered in DEERS may use these programs by seeing any network or non-network providers that are authorized by TRICARE. In areas outside of the United States, active duty family members who dont want to use a Prime option may use TRICARE Standard Overseas by seeing a qualified host nation provider. If youre already using TRICARE Standard and Extra, moving is easy. Once you arrive at your new location, update your personal information in the Defense Enrollment Eligibility Reporting System (DEERS) immediately. Then, find TRICARE-authorized providers in your new area. Here are a few things to remember about using TRICARE Standard and Extra in a new region: In the U.S.: Visit your new regional contractors

    website for a list of providers. Remember, if you see network providers, youll be using the Extra option and pay lower cost shares. Outside of the U.S.: Contact your TRICARE Service Center for help locating a qualified host nation provider. The TRICARE Extra option is not available in overseas areas. If you move to a new region, youll have a new claims address for submitting your TRICARE claims. Learn your new regions prior authorization requirements because these requirements can differ by region.

    Getting Care Along the WayBefore you move, make sure youve received any routine

    medical or dental care you think you might need during the time youll be traveling. Or, delay the care until you get to your new duty location.

    Emergency Care in the United StatesCall 911 or go to the nearest emergency room. TRICARE

    defines emergency care as medical services provided for a sudden or unexpected medical or psychiatric condition, or the sudden worsening of a chronic (ongoing) condition that is threatening to life, limb, or sight and needs immediate

    PAPILLION955 North Adams Street

    GRETNA830 Village Square

    JOSEPH HURD DDS MSDColonel, USAF (Ret.), Board Certi ed

    SHAWN POWELL DDS MSwww.exclusivelyortho.com 402-339-0506

    Military Insurance Accepted

  • 26 Offutt Air Force Base Newcomers Guide

    Moving with Tricare

    medical treatment, or which has painful symptoms that need immediate relief to stop suffering.

    If you are hospitalized in a civilian facility for more than 24 hours, contact your regional contractor. Urgent care in the United States Coordinate with your PCM and/or regional contractor. TRICARE defines urgent care as medical care for a condition that will not result in disability or death if not treated immediately but should be treated within 24 hours to avoid further complications. If you are in a Prime program, you must coordinate urgent care with your primary care manager and/or regional contractor before receiving care. If you are in TRICARE Standard and Extra or TRICARE For Life, you can receive care as you normally would. You should, however, contact your contractor as soon as possible to coordinate any prior authorizations that are needed.

    Emergency or Urgent Care OverseasContact closest TRICARE Area Office or TRICARE

    Global Remote Call Center. You dont need prior authorization for emergency or urgent care but the TRICARE Area Office or TRICARE Global Remote Call Center will help you find the best care available in the overseas area in which you are traveling.

    Filling Prescriptions on the RoadYou should have all your prescriptions filled before you

    leave, but if you need a prescription filled while youre traveling in the United States, you have several options:

    If near an MTF, fill the prescription at the MTF pharmacy.

    Find the closest TRICARE network pharmacy. If a network pharmacy is not available, you can visit

    a non-network pharmacy. In this case, you may have to pay up front for your medications and file a claim with Express Scripts, Inc., for reimbursement. For more details, visit the TRICARE website.

    The mail-order option is not recommended for a prescription you need right away, but if youll be traveling for a long time, you can arrange for any regular prescriptions to be filled via the mail-order pharmacy.

    Limited Overseas Pharmacy CoverageTRICARE network pharmacies are only located in the

    United States, Puerto Rico, Guam and the U.S. Virgin Islands. You can have prescriptions filled at host-nation pharmacies, if necessary. Host-nation pharmacies are treated the same as non-network pharmacies. If you have prescriptions filled at a host-nation pharmacy, you should expect to pay for the total amount up front and file a claim with Wisconsin Physicians Service for partial reimbursement.

    To use the mail-order pharmacy overseas, the prescription must be from a U.S. licensed provider and you must have an APO or FPO address.

    To learn more about pharmacy claims, visit the TRICARE website at www.tricareonline.com.

    THE HONDA

    The Fastest Growing Honda Dealer in Omaha & Council Bluffs!

    51 800-247-5341www.hondacarsofbellevue.com

    HONDA CARS OF BELLEVUE

    Cornhusker Rd.

    75

    Chandler Rd. E.

    Fort CrookRd.N

    .

    The Fastest Growing Honda Dealer in Omaha & Council Bluffs!

    THE ALL-NEW 2013 HONDA ACCORD

  • Offutt Air Force Base Newcomers Guide 27

    1, 2 & 3 Bedroom Floor plans

    Full-Size washer & dryer included

    Cozy gas fireplaces (with gas logs)

    Keyed access entry

    Garages (with openers)

    24-hour emergency maintenance

    24-hour fitness center with free weights & sauna

    Intrusion alarms*

    Vaulted Ceilings*

    Two outdoor swimming pools

    To view more photos and floor plans visit our websitewww.pointemanagementco.com

    402-339-12578211 So. 87th Plaza

    Office HoursM-F 9:00-6:00 Sat 9:00-5:00

    Sun 12:00-5:[email protected]

    402-445-44334345 N 126th Court

    Office HoursM-F 9:00-6:00 Sat 10:00-5:00

    Sun 12:00-5:[email protected]

    POINTING YOU IN THE RIGHT DIRECTION

    We pride ourselves on maintaining our communities to a level of quality you are proud to call home.

    *Select units only

    1, 2 & 3 Bedroom Floor plans

    Full-Size washer & dryer included

    Cozy gas fireplaces (with gas logs)

    Keyed access entry

    Garages (with openers)

    24-hour emergency maintenance

    24-hour fitness center with free weights & sauna

    Intrusion alarms*

    Vaulted Ceilings*

    Two outdoor swimming pools

    To view more photos and floor plans visit our websitewww.pointemanagementco.com

    402-339-12578211 So. 87th Plaza

    Office HoursM-F 9:00-6:00 Sat 9:00-5:00

    Sun 12:00-5:[email protected]

    402-445-44334345 N 126th Court

    Office HoursM-F 9:00-6:00 Sat 10:00-5:00

    Sun 12:00-5:[email protected]

    We pride ourselves on maintaining our communities to a level of quality you are proud to call home.

    *Select units only

  • 28 Offutt Air Force Base Newcomers Guide

    22 Greater Omaha Locations 402-592-6000GreatWesternBank.com

    1-800-ALEGENTAlegentCreighton.com

    MEET A DOCTOR. WHEREVER.GET TO KNOW YOUR DOCTOR BEFORE YOUR APPOINTMENT. They know all about you. Your ailments. What troubles you. Where it hur ts. Isnt it only fair you know a lit tle more about your physician? With video introductions, you can f ind a physician who f its your lifestyle and interests best. Just visit AlegentCreighton.com on your smart device and youre there.

    Memorial/Schuyler Mercy/Corning Plainview Alegent Creighton Clinic

    Bergan Mercy Creighton University Medical Center Immanuel Lakeside Mercy/Council Bluffs Midlands/Papillion Community Memorial/Missouri Valley

  • Services and Facilities

    Offutt Air Force Base Newcomers Guide 29

    Army and Air Force Exchange ServiceThe Exchange offers a wide range of goods and services

    for military people and their families. Offutt Exchange contains a flower shop, gift shop, health supplements store, optical shop, barber shop and food court. The Exchange also operates a Military Clothing store, beauty shop, laundry/dry cleaner and an alterations tailor shop. For specific facility hours, visit www.shopmyexchange.com.

    Burger KingBurger King is located in the Offutt Mini Mall on

    Garland Boulevard. It offers Burger Kings standard fare of breakfast sandwiches and biscuits, hamburgers, specialty sandwiches, salads, ice cream and other side items.

    CommissaryThe commissary stocks more than 13,000 grocery items

    and offers 18 checkout lanes. Complete in-store bakery and deli are also available. The hours are: Monday, closed; Tuesday-Friday, 7 a.m. to 8 p.m.; Saturday and Sunday, 9 a.m. to 6 p.m. For more information, call (402) 294-6784 or visit www.commissaries.com.

    ExpressesOffutt has three Expresses. Mini-Mall Express is located

    off Garland Avenue. Wherry Express is located on Nelson Drive. Capehart Express is located in Capehart Housing off 25th Street and Hruska Boulevard. Both Mini Mall and Wherry Express dispense two grades of gasoline.

    Exchange Food CourtThe Food Court, located in the Exchange Mall, offers a

    variety of fast-food choices, including Taco Bell, Popeyes, Anthonys Pizza, Charleys Steakery and Starbucks.

    FirestoneFirestone is located in the Offutt Mini Mall. Firestone

    offers automotive care, products and tires. It is staffed with ASE certified mechanics.

    Military Clothing Sales StoreThe Offutt Military Clothing Store located in the

    Exchange Mall, stocks issue and commercial military items as well as other military related merchandise. For current hours, visit www.shopmyexchange.com.

    Public AffairsThe 55th Wing Public Affairs office provides current

    news and events. Visit www.offutt.af.mil for more information. The Offutt E-News, an electronic newsletter featuring command directed information, is distributed to all Team Offutt users via e-mail three times a week. To submit information for publication in the E-News, email [email protected]. The public affairs office also acts as an interface between the base and the community. Public affairs is responsible for all news media interaction, base tours, the base speakers bureau and other community relations programs. The staff can be reached at (402) 294-3663.

    Red CrossThe American Red Cross provides worldwide emergency

    communications in the event of a critical accident, illness, death or birth in a service members immediate family. The Red Cross will verify the situation and relay an emergency leave request, if necessary, to the proper military authorities. This service is available by calling (888) 737-4306. At Offutt, the Red Cross provides health and safety classes and volunteer opportunities for CPR and first aid instructors, hospital services, disaster services, blood services and youth programs. The Red Cross periodically sets up a mobile blood bank at Offutt for those interested in donating. Call (402) 232-5663 for more information. The American Red Cross office is located in Building C, Room 108; phone (402) 294-5032.

    RV StorageOffutt RV storage lot is located near the AAFES Wherry

    Shoppette on the north side of the base. The lot has 380 8-, 20- and 25-foot spots and 88 26- to 40-foot spots. The lot has a keyless entry pad for 24-hour access. Vacancies are limited. For more information, call (402) 294-2167.

    RENT-TO-OWNFLAT PANEL TVS, STEREOS, HUGE SELECTION OF FURNITURE, APPLIANCES, BEDS, VACUUMS,

    CAMCORDERS, COMPUTERS & MORE.SHORT TERM RENTALS AVAILABLE

    Largest Selection Guaranteed Low Prices No Credit Hassle No Repair Bills

    (402) 292-9000516 Galvin Rd. S

    Bellevue(Across from Shopko)

    (402) 898-58004650 L Street

    Omaha, NE

    (402) 873-51111728 S. 11th St.

    Nebraska City, NE

  • 30 Offutt Air Force Base Newcomers Guide

    Drop In and Discover the Potential at the Kroc Center:

    Group Fitness Classes Indoor Pools: lap swimming

    and slides for the kids Climate-controlled Fitness Center Affordable Fun: less expensive

    than taking the family out to a movie!

    KidZone childcare for ages 1 to 7 while you workout or take an art class

    Birthday Party options for kids

    www.OmahaKroc.orgEasy to nd at 2825 Y Street

    When you need to...

    Get Out of the House!

    Become a MemberPresent your ofcial military verication and receive 15% Off your Kroc Center membership plus no registration fee! A savings of up to $155!

    402-291-5000

    Current furneral information Sign our guest book

    402-291-5000

    Current furneral information Sign our guest book

    We offer spacious one & two bedroom apartments and two bedroom townhomes. Easy access to Offutt AFB and downtown Omaha.A superb location to Shadow Lake Towne Center

    402

    339-8773

    1221 Gold Coast Road Papillion, NE

    Quiet residential neighborhood Large balconies and patios Garages Fitness Center

    Tennis court & swimming pool Energy efficient Cable ready On-site laundry No pets, please

  • Services and Facilities

    Offutt Air Force Base Newcomers Guide 31

    55th Force Support SquadronFor the latest information and facility hours for the

    programs below, visit the 55th Force Support Squadron online at www.offutt55fss.com.

    Aero ClubThe Offutt Aero Club, named the Curtis E. LeMay Flight

    Training Center, was the first flying club in the armed forces. The club provides aircraft rental and a Federal Aviation Administration-approved school for private pilots through Airline Transport Pilot certification. The club has several aircraft, ranging from basic single engine types to multi-engine. Nearly all aircraft are certified for instrument flying. Several FAA-certified flight instructors are available and flight instruction is tailored to meet the needs of the members. Temporary duty and shift-work schedules can be accommodated. The Aero Club stocks pilot supplies at a discount for members. For more information, call (402) 294-3385.

    Airman & Family Readiness CenterThe Airman & Family Readiness Center is committed

    to assisting commanders, active-duty military, guard and reserve personnel, eligible for family members and DOD civilian employees with managing the competing demands of the military mission and family. The center provides a wide array of comprehensive serves including family life issues, personal financial assistance, deployment support, transition assistance, employment, relocation, information and referral and crisis management. The Airman & Family Readiness Center works closely with the Air Force Aid Society, Navy Relief Society and Army Relief Services to provide emergency assistance to our personnel and their families. For more information, call (402) 294-4329.

    AquaticsOffutts aquatic program is managed by Outdoor

    Recreation. Two outdoor swimming pools are open from May to September, on Memorial Day Weekend and closing on Labor Day. The Capehart Pool offers a childrens pool, complete changing facilities, locker rooms and a sun deck. The Base Pool, located south of Generals Row, provides changing facilities, locker rooms, and a sun deck. Swimming is available year round for indoor fitness swimming located in the Offutt Field House. For more information on aquatics, call (402) 294-4049.

    Arts & Crafts Arts & Crafts Center is located at 101 Union Lane,

    Building 363.You will find a world of creative gift ideas, including shadowboxes, trophies and plaques. The center

    also offers a consignment gallery, frame shop and laser engraving. Hours of operation are Tuesday-Friday from 9 a.m. to 5 p.m. and Saturdays from 9 a.m. to 2 p.m. The center is closed on Sundays, Mondays and holidays. For more information, call (402) 294-3837.

    Auto HobbyFourteen self-service stalls are available for do it yourself

    maintenance with flat stalls, drive on lifts, frame lifts, lube racks, a tire machine and more. There is also specialized equipment for turning brake drums and discs, computerized engine analysis, battery charging system and more. Many common use items are on inventory for your convenience with other items offered by special ordered to include tires, parts, batteries, windshield wipers, etc. The minor maintenance service provides quality repair work at affordable rates for personal vehicles, golf carts, ATVs, and GSA fleet. The center also maintains an automatic car wash, self serve wash bays, secure storage lot for automobiles, and a resale lot. Our hours of operation are on Tuesdays, Thursdays, Fridays and Saturdays. We are closed on Sundays, Mondays, Wednesdays and holidays. For more information, call (402) 294-5564.

    Now Is The Time To Buy!Brent Rasmussen, CRMS, President

    Offi ce: 402-991-5153 Fax: 402-884-73868420 West Dodge Rd. Ste 113

    Omaha, NE 68114E-mail: [email protected]

    www.mtg-specialists.com

    DRIVEN TRUSTED RELIABLE

    Nebraskas only Certifi ed Residential Mortgage Specialist

    Brent Rasmussen,CRMS, President

    Office: 402-991-5153 Fax: 402-884-73868420 West Dodge Rd. Ste 113

    Omaha, NE 68114E-mail: [email protected]

    www.mtg-specialists.com

    DRIVEN TRUSTED RELIABLE

    Nebraskas only Certifi edResidential Mortgage Specialist

  • Services and Facilities

    32 Offutt Air Force Base Newcomers Guide

    Child Development ProgramsWelcome to our child development programs. Our

    mission is to assist military and civilian families in balancing the competing demands of family life and the accomplishment of the military mission. We provide a quality, safe, healthy and caring learning environment for children in our care. We respect each childs unique interests, experiences, abilities and needs, thus allowing us to be responsive to each child. Likewise, our program respects and supports the ideals, cultures, and values of families in their task of nurturing children. The programs offer regular full-time care for children six weeks to five years of age, from 6:30 a.m. to 6 p.m. on Mondays through Fridays. Hourly care is available by reservation for children 12 months to 5 years of age. For additional information about our programs, call the Child Development Center directors at (402) 294-2203 for CDC I and (402) 232-2526 for CDC II.

    Equipment RentalOutdoor Recreation - Equipment Rental provides a wide

    variety of rental equipment to all base personnel. Rental equipment includes household items, lawn and garden

    equipment, party supplies including a large inventory of inflatables, various utility trailers, sporting gear, and outdoor recreation equipment including, but not limited to, boats, canoes, campers and outdoor adventure gear. Our diverse calendar of outdoor adventure events is packed with exciting adventures year round. The Recreation Vehicle Storage Lot boasts 490 secure storage spaces ranging in size from 20-45 available for recreation vehicles and trailers. We are co-located with Auto Hobby on Union Lane and are open from 9 a.m. to 5 p.m. Monday, Tuesday, Thursday, Friday and Saturday. We are closed Sundays, Wednesday and holidays. For more information, contact us at (402) 294-4049.

    Family Child CareFamily Child Care (FCC) is a Program that oversees

    the care of children in affiliated on-base or off-base homes, and certifies applicants who wish to operate a home based child care facility under base jurisdiction. It provides ongoing support and resources to providers, and advertises the program within the Offutt community. Offutts FCC Providers are well-trained professionals who provide quality child care for children ages 2 weeks to 12 years. While care

    KORT A. IGEL D.D.S., M.S., P.C.

    10801 PACIFIC STREET | SUITE 200OMAHA, NE 68154

    107 HIGHLAND STREETPAPILLION, NE 68046

    402.330.1152WWW.KORTIGEL.COM

  • Services and Facilities

    Offutt Air Force Base Newcomers Guide 33

    is available during normal duty hours, it can also be available 24 hrs a day. It is aimed at accommodating parents who work shifts, rotating shifts, alerts, weekends, extended duty, or who have a child requiring specialized care. Parents seeking a provider or anyone interested in becoming a FCC provider may call the Family Child Care Office at (402) 294 -9016, Monday thru Friday from 7:30 a.m. to 4:30 p.m.

    Fitness and Sports CenterThe Offutt Field House provides base members with

    an outstanding fitness facility. This facility offers a lap-swimming pool and coed sauna, four racquetball courts, three tennis courts, two multipurpose courts (basketball, volleyball) as well as one additional basketball court and an indoor soccer field, a running track that is .4 miles in length, and a wide variety of cardiovascular training equipment. It just recently created a large co-located free weight and resistance area, an aerobics room, a spin room as well as new basketball shoot out area and indoor driving ranges. Day lockers are plentiful and a play area for children is featured. The field house also has a juice bar for patrons to utilize and purchase their favorite energy drinks and smoothies. The

    field house also has a co-located HAWC to insure all your fitness needs are addressed. The fitness center offers incentive programs for all patrons to participate in. You can inquire at the customer service desk.

    Offutt also offers a four-diamond softball complex, which is also utilized for the intramural flag football season. For hours of operation or further information, call (402) 294-5413/5414.

    Intramural SportsThe Offutt sports program offers basketball, softball,

    volleyball indoor soccer and flag football. If you are interested in participating in one of these sports, contact your unit sports representative or the intramural sports office at 294-5451 or 294-5413 at the Offutt Field House.

    Flight KitchenThe Flight Kitchen provides numerous choices of

    nutritious, appetizing meals to passengers and crew of Air Force aircraft. To find out what is offered or to order flight or ground meals contact the Flight Kitchen team at 294-1104 or 294-1105.

    www.bellevuepediatricdentistry.com

    11511 S 42nd Street | Suite 101Bellevue, NE 68123 | 402-291-5400

    Our goal is to help make your childs dental care as easy, comfortable and

    enjoyable as possible!

    www.bellevuepediatricdentistry.com

    11511 S 42nd Street | Suite 101Bellevue, NE 68123 | 402-291-5400

    Our goal is to help make your childsdental care as easy, comfortable and

    enjoyable as possible!

    Rugby FootballTeam

    goatsrugby.com

    Rugby Football

    Club

    Kyle CCihhaall44444444444000000022222-7077-4820

    goatsrugby.com

    Rugby Football

    Club

  • Services and Facilities

    34 Offutt Air Force Base Newcomers Guide

    Information, Ticket & TravelThe ITT office is located in with Outdoor Recreation

    Equipment Rental on Union Lane. Tickets to local and regional attractions and select events can be purchased at discounted prices, as well as advance tickets for national theme parks like Walt Disney World. We are open from 9 a.m. to 5 p.m. Monday, Tuesday, Thursday, Friday and Saturday. We are closed Sundays, Wednesday and holidays. For more information, contact us at (402) 294-4049.

    LodgingWelcome to Offutts Air Force Inns! We hope you will

    enjoy the attractions of Offutt AFB and the Omaha area. Rest assured youll be well taken care of during your stay the staff wants it to be memorable and they are eagerly awaiting your requests. Visit www.offutt55fss.com/facilities/lodging.html for more information.

    Visitors QuartersVisitors of all ranks can enjoy comfortable

    accommodations in any one of the 133 rooms located in the three modern lodging facilities: OMalley Inn, Malmstrom Inn, and the Fort Crook House. All facilities, except the

    Fort Crook House, are located near the Patriot Club. Fort Crook House, otherwise known as Quarters 13, is used for distinguished visitors and is located on Generals Row in the Fort Crook Historical District.

    Temporary Lodging FacilitiesOffutts Air Force Inns manages 30 temporary lodging

    units from Rising View, in the Capehart military housing area. Each unit has sleeping accommodations for 8 adults, 2 bath and shower, a fully furnished kitchen, washer and dryer in each house, telephone, free Wi-Fi, and cable television. Since the number of personnel making permanent change of station moves in or out can exceed the number of TLFs available, be sure to make reservations well ahead of your arrival especially during the peak transition months of May through October. Off-base temporary lodging is available; however, it can also be in limited supply during peak times.

    ReservationsReservations at Offutts Air Force Inns can be made up

    to 120 days in advance and prior to receiving PCS orders. Reservations must be reconfirmed three days prior to your arrival and will be canceled at 6 p.m. on the check-in date

    Live On Site Manager Completely Fenced We Sell Boxes & Moving Supplies We Rent U-Haul Equipment Concrete Drives Well Lit Area Auto Pay or Pay Online Options

    Military DiscountsStorage for Business

    & Personal Use

    1502 Bristol Street (84th & Hwy 370)Papillion, Nebraska 68046 402-596-1557

    Toll Free 877-596-1557www.strongboxstorage.com

    email: [email protected]

    Live On Site ManagerLi O Sit M Completely Fenced We Sell Boxes & Moving Supplies We Rent U-Haul Equipment Concrete Drives Well Lit Area Auto Pay or Pay Online Optionsliine OOpttiiions

    Military DiscountsStorage for Business

    & Personal Use

    151515155020202022022 BBB B Bririririririr stststststst lololollll S SStrtrtreeeeeeeeeeeeeeeeeeeeeeeeeeeeeeet t t t tttttttt (8(8(8(8(8(8(8(8(88(84t4t4t4t4t4t4t4t4t4thh h h h hhhh & & & & & && &&& &&&& HHHHwHwHwHwwwwHHHwwH yyyy yyyyy 3337373737373737337373737700000000)0))))0000PPPPaPaPaP pipipiillllllioioioi n,n,n, N N Nebebebbbbebbrrararararaaskskskska a aaaaa 6868686868686868686888888804040404040404040404040 66 6 6 6 6 66 666 404040404040404040402-2-2-22-2-2-2-2-2-5595959595959595959995 6-6-6666-6-6-6-151515151511155555757557575577

    ToToToTTollllllll FFF FFFFFFFrereree e eeeee 878787877-7-7-7-7-7-7-7-7-59595959595595959595 6-6-6-6-6--6-151515151551557575757575757557wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww w.w.w.w stststrororoooongngngngngnggbobobobobob xxxsxsxsxsxsxstotototoototototooooorararararrrararrragegegegegegegg .c.c.c.c.ccomomomomommomom

    emeemememmmmmaiaaiiaiaiaiaiaiillll:l:l: p p papapapppppililiililllilililililiiiiiononononononoononnn@s@@@s@@s@s@s@s@ssss@ trtrtrtrtrtrtrrrrtronnnononononooono gbgbgbgbbbbbbbbbbgbgbgbggbbg oxoxoxoxoxoxoxoxoxstststststststss ororororororoorragagagagagagagagage.e.eee.e.e.e.e.cococcocococococococoooommmmm

    Join our Family!Worshipping, learning, and serving together in Christ

    1220 bellevue blvd. south, bellevue, newww.1stpresbvue.org402-291-1104

    First Presbyterian Church

    Worshipping, learning, andserving together in Christ

    1220 bellevue blvd. south, bellevue, newww.1stpresbvue.org402-291-1104

  • Services and Facilities

    Offutt Air Force Base Newcomers Guide 35

    unless guaranteed with a credit card. To make reservations or for further information, call (402) 294-3671 or DSN 271-3671. Reservations may also be faxed to (402) 294-3199.

    NAF Human Resources OfficeThe Non-Appropriated Funds Human Resources Of