nuclear translocation sequence and regions in acmnpv me53

Nuclear Translocation Sequence and Regions in AcMNPV ME53 Are Important for Optimal 1

Baculovirus Production 2

3

Yang Liua, Jondavid de Jongb, Éva Nagyb, David A. Theilmannc and Peter J. Krella# 4

5

Department of Molecular and Cellular Biology, University of Guelph, Ontario, Canadaa; 6

Department of Pathobiology, University of Guelph, Ontario, Canadab; Pacific Agri-Food 7

Research Centre, Agriculture and Agri-Food Canada, Summerland, British Columbia, Canadac 8

9

10

Running Head: AcMNPV ME53 Nuclear Translocation and Virus Production 11

12

Address correspondence to Peter J. Krell, [email protected]. 13

14

Word count abstract: 224 15

Word count main text: 6,28716

JVI Accepted Manuscript Posted Online 3 February 2016J. Virol. doi:10.1128/JVI.03115-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on February 12, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2

Abstract 17

Autographa californica multiple nucleopolyhedrovirus (AcMNPV) is in the family Baculoviridae, 18

genus Alphabaculovirus. AcMNPV me53 is a highly conserved immediate early gene in all 19

lepidopteran baculoviruses that have been sequenced, and is transcribed up to late times 20

post-infection. Although me53 is not essential for viral DNA synthesis, infectious budded virus 21

(BV) production is greatly attenuated when deleted. ME53 associates with the nucleocapsid on 22

both budded virus and occlusion-derived virus, but not with the virus envelope. ME53 23

co-localizes in plasma membrane foci with the envelope glycoprotein GP64 in a 24

GP64-dependent manner. ME53 localizes in the cytoplasm early post-infection, and despite lack 25

of a reported nuclear localization signal (NLS), ME53 translocates to the nucleus at late times 26

post-infection. To map determinants of ME53 that facilitate its nuclear translocation, 27

recombinant AcMNPV bacmids containing a series of ME53 truncations, internal deletions and 28

peptides fused with HA or GFP tags were constructed. Intracellular localization studies identified 29

residues within amino acids 109 to 137 at the N-terminus of ME53 that acted as the nuclear 30

translocation sequence (NTS) facilitating its nuclear transport at late times post-infection. The 31

first 100 N-terminal amino acids and the last 50 C-terminal amino acids of ME53 are dispensable 32

for high levels of budded virus production. The region within amino acids 101 to 398, which also 33

contains the NTS, is critical for optimal levels of budded virus production. 34

35

Importance 36


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3

Baculovirus me53 is a conserved immediate early gene found in all sequenced lepidopteran 37

alpha- and betabaculoviruses. We first identified residues within amino acids 109 to 137 at the 38

N-terminus that act as the ME53 nuclear translocation sequence (NTS) to facilitate its nuclear 39

translocation, and defined an internal region within amino acids 101 to 398, which includes the 40

NTS, as being necessary for optimal budded virus production. Altogether these results indicate a 41

previously unidentified nuclear role that ME53 plays in virus replication. 42

43

Introduction 44

The Baculoviridae comprises a family of insect DNA viruses, mostly from the order Lepidoptera 45

but also from the orders Diptera and Hymenoptera. Baculoviruses are characterized by a circular 46

double-stranded DNA genome, ranging from 80 to 180 kb in size, packaged within a rod-shaped 47

capsid and enclosed by a lipid envelope (1). 48

49

The viral DNA genome is uncoated into the nucleus followed by virus gene transcription, DNA 50

replication, and eventually nucleocapsid assembly in the nucleus prior to budding from the cells 51

or occlusion into polyhedra (2, 3). Baculovirus gene expression and regulation follows a 52

temporal cascade. Immediate early genes are transcribed first within 30 minutes post-infection 53

followed by transactivation of viral early genes (4). The early gene products, then allow for viral 54

DNA replication and late/very late gene transcription (5, 6). Late and very late gene transcription 55

is dependent on viral early gene products and viral DNA replication (6). 56


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

4

57

Autographa californica nucleopolyhedrovirus (AcMNPV) is in the species Autographa 58

californica multiple nucleopolyhedrovirus, the type species of the Alphabaculovirus genus. 59

AcMNPV me53 (ACNVgp140) is a conserved immediate early gene found in all sequenced 60

lepidopteran alpha- and betabaculoviruses. me53 is transcribed both early and late during 61

infection from a dual early/late promoter (7, 8, 9). The putative 449 aa ME53 protein contains a 62

proline rich region at the N-terminus and a C terminal C4 zinc finger domain, whose function is 63

not yet clear. Although ME53 is not essential for viral DNA synthesis, infectious budded virus 64

(BV) production is greatly attenuated if me53 is knocked out (10). Western blot analysis of 65

purified virions revealed that ME53 is associated with both BV and occlusion-derived virus 66

(ODV), suggesting that ME53 may act as a packaging protein or as a structural component 67

associated with intranuclear baculovirus virion assembly (10). Fractionation of budded virions 68

further demonstrated that ME53 associates exclusively with the nucleocapsid, but not with the 69

envelope (10). Moreover, besides co-localizing at foci in the cell membrane along with the viral 70

major envelope protein GP64 in an infection and GP64 dependent manner, ME53 also 71

translocates into the nucleus in the late phase (11). Since ME53 translocates to the nucleus, we 72

were interested in identifying the amino acid sequence responsible for this. 73

74

Protein nuclear import typically requires a nuclear localization signal (NLS), which normally 75

consists of a short cluster of positively charged arginine and/or lysine residues or a short 76


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

5

sequence of basic amino acids flanked by prolines. The NLSs are recognized by nuclear transport 77

receptors such as importins in the cytoplasm which assist transport through the nuclear pore 78

complex into the nucleus. Typical NLSs can be further classified as bipartite or monopartite (12). 79

A monopartite NLS is composed of only one element, whereas a bipartite NLS is composed of 80

two separated elements. For example, AcMNPV nuclear protein LEF-3 residues 26 to 32 81

PKKIREN were identified to be the LEF-3 core NLS, with adjacent residues 18K and 19R 82

augmenting the nuclear transport as part of the bipartite element (13). Similarly, AcMNPV 83

DNApol, that is essential for viral DNA replication, also utilizes a bipartite NLS within residues 84

804 to 827 and a monopartite NLS within residues 939 to 948, both essential for its nuclear 85

localization (14). Unlike the typical NLS, the non-typical NLSs do not have much in common. 86

Some of the motifs are within one short region, while some of them are far apart. Most of them 87

depend on specific protein structure formation and/or protein-protein interaction to facilitate their 88

nuclear localization function (15, 16, 17). For instance, residues 534 to 538 KVNRR in 89

AcMNPV IE-1 form a positively charged domain that contributes to a novel nuclear localizer to 90

initiate IE-1 nuclear transport upon homodimerization (18). AcMNPV P143 (helicase) itself, like 91

ME53, does not have an NLS, but it is recruited and co-transported to the nucleus when bound to 92

LEF-3 which has a bipartite NLS (19). Similarly, while ME53 localizes primarily to the 93

cytoplasm early post-infection, it adopts a nuclear localization at late times. Moreover, ME53 94

nuclear translocation is infection dependent as plasmid expressed ME53 remains only 95

cytoplasmic (11). This suggests that ME53, which lacks an identifiable NLS, is more likely to 96


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6

rely on a late nuclear protein to escort ME53 to the nucleus. However, the region in ME53 97

responsible for its nuclear translocation and the mechanism ME53 uses to translocate to the 98

nucleus are still unknown. We hypothesized that ME53 has a nuclear translocation sequence 99

responsible for its nuclear translocation. In this study, we constructed a series of ME53 mutations 100

by truncations, internal deletions, internal peptides and site-directed mutagenesis focusing on the 101

N-terminus. These analyses have identified residues critical for ME53 nuclear translocation and 102

would constitute an NTS. We also identified a minimal region of ME53 required for optimal BV 103

production in vitro. 104

105

Materials and Methods 106

Viruses and cell lines 107

Bacmid bMON14272, containing an AcMNPV genome and propagated in Escherichia coli 108

DH10B strain, was purchased from Invitrogen Life Technology. AcMNPV me53 was deleted by 109

replacing it with the chloramphenicol acetyltransferase gene (10). This me53 knockout bacmid 110

was used as the backbone for all the recombinant bacmid constructs developed herein. The Sf21 111

insect cell line, derived from the fall armyworm (Spodoptera frugiperda), was cultured at 27°C in 112

Grace’s medium (Invitrogen Life Technologies) supplemented with 10% fetal bovine serum, 113

penicillin (100 μg/ml), and streptomycin (30 μg/ml). In all experiments, the virus inoculum was 114

allowed to adsorb for 1h upon infection. 115

116


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

7

Bioinformatic analysis 117

To obtain an overview of ME53 evolutionary relationship, conservation among baculoviruses, 118

identification of conserved regions, and secondary structure prediction, lepidoptera 119

nucleopolyhedroviruses (NPV) from Group I alphabaculoviruses (with GP64 as major envelope 120

protein) and Group II alphabaculoviruses (with F protein as major envelope protein), and from 121

betabaculoviruses (granuloviruses, GVs) were selected for ME53 bioinformatic analysis by 122

pairwise comparison and phylogeny. The viruses selected are Group I alphabaculoviruses 123

Autographa californica MNPV (AcMNPV), Anticarsia gemmatalis MNPV (AgMNPV), 124

Antheraea pernyi NPV (AnpeNPV), Bombyx mori NPV (BmNPV), Choristoneura fumiferana 125

DEF MNPV (CfDEFNPV), Choristoneura fumiferana MNPV (CfMNPV), Epiphyas postvittana 126

NPV (EppoNPV), Hyphantria cunea NPV (HycuNPV), Maruca vitrata NPV (MaviNPV), Orgyia 127

pseudotsugata MNPV (OpMNPV), Plutella xylostella multiple NPV (PlxyNPV), Rachiplusia ou 128

MNPV (RoMNPV) and Thysanoplusia orichalcea NPV (ThorNPV); Group II alphabaculoviruses 129

Adoxophyes honmai NPV (AdhoNPV), Agrotis segetum NPV (AgseNPV), Ecotropis obliqua 130

NPV (EcobNPV), Helicoverpa armigera NPV (HearNPV), Lymantria dispar MNPV (LdMNPV), 131

Leucania separata MNPV (LsMNPV), Mamestra configurata NPV (MacoNPV), Orgyia 132

leucostigma NPV (OrleNPV), Spodoptera exigua MNPV (SeMNPV), Spodoptera frugiperda 133

MNPV (SfMNPV), Spodoptera litura NPV (SpltNPV) and Trichoplusia ni SNPV (TnSNPV); 134

and betabaculoviruses Adoxophyes honmai GV (AdhoGV), Agrotis segetum GV (AgseGV), 135

Choristoneura occidentalis GV (ChocGV), Cydia pomonella GV (CpGV), Cryptophlebia 136


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

8

leucotreta GV (CrleGV), Epinotia aporema GV (EpapGV), Helicoverpa armigera GV (HearGV), 137

Phthorimaea operculella GV (PhopGV), Plutella xylostella GV (PlxyGV), Spodoptera frugiperda 138

GV (SfGV) and Spodoptera litura GV (SpliGV). To infer the evolutionary relationship of ME53, 139

amino acid sequences of ME53 protein homologues were aligned with ClustalX and MEGA 140

5.0.2 was used to generate a phylogenetic tree based on the differences and similarities of ME53s 141

(20). SIAS (http://imed.med.ucm.es/Tools/sias.html) was applied to calculate the pairwise 142

similarity and identity of ME53s from each group based on its amino acid sequence. Furthermore, 143

T-COFFEE (21) (http://tcoffee.crg.cat/apps/tcoffee/index.html) was applied to evaluate the 144

amino acid conservation of ME53 from Group I alphabaculoviruses. In order to investigate the 145

related secondary structure within the conserved region based on its amino acid sequence, Ali2D 146

(http://toolkit.tuebingen.mpg.de/sections/secstruct) (22) was performed to predict all the possible 147

alpha helix and beta strand secondary structures formed in ME53 from Group I 148

alphabaculoviruses. 149

150

Generation of AcMNPV bacmids with HA tagged ME53 peptides and internal deletions 151

The me53 promoter was amplified from the AcMNPV bacmid using the primers me53pro-F: 152

gagctcagcgtgtgcgccggagcaca (SacI site in italics) and me53pro-R: tctagatgtaactgttagttagcact 153

(XbaI site in italics) and cloned into pBluescript using SacI and XbaI, generating pBlue-pro. The 154

Simian virus 40 (SV40) poly(A) signal was amplified from plasmid pFACT with primers sv40-F: 155

gatatcgatcataatcagccatacca (EcoRV site in italics) and sv40-R: ctcgaggatccagacatgataagata (XhoI 156


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

9

site in italics) and cloned into pBlue-pro using EcoRV and XhoI, generating pBlue-pro-sv40. 157

Each me53 fragment for making bacmids expressing ME53 peptides ME5333-82, ME5383-152, 158

ME53153-225 and internal deletions ME53Δ33-82, ME53Δ83-152, and ME53Δ153-225 was amplified 159

from AcMNPV bacmid DNA and fused with a double HA epitope tag at the C-terminus by using 160

primers listed in Table 1. The fragments were then cloned into pBlue-pro-sv40 using XbaI and 161

EcoRV. The fragment containing the me53 promoter, C-terminal HA-tagged me53 truncation, 162

and SV40 poly(A) signal was then subcloned into pFACT-GFP using SacI and XhoI, generating 163

the donor plasmid for transposition. The Tn7 cassette from the donor plasmid was transposed to 164

the atti-Tn7 transposition site in the me53-knockout bacmid as described in the Bac-to-Bac 165

expression manual (Invitrogen) to generate recombinant bacmids. All constructs containing 166

ME53 mutations were confirmed by sequencing. 167

168

Generation of GFP fused ME53-truncated AcMNPV bacmids 169

The green fluorescence protein (gfp) gene was amplified from plasmid pFACT-GFP by using 170

primers gfp-F: ctgcaggtgagcaagggcgaggagctg (PstI site in italics) and gfp-R: 171

gatatcttacttgtacagctcgtccatgc (EcoRV site in italics) and cloned into pBlue-pro-sv40 using PstI 172

and EcoRV, generating pblue-pro-gfp-sv40. Each me53 fragment for making ME53 truncations 173

ME53NTS, ME53Δ2-106, ME53Δ2-108, ME53Δ2-112, ME53Δ2-113, ME53Δ2-121, ME53Δ2-150 and 174

ME53Δ250-449 was amplified from AcMNPV bacmid by using primers listed in Table 2. The 175

fragments were then cloned into pBlue-pro-gfp-sv40 using XbaI and PstI. The insert containing 176


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

10

the me53 promoter, C-terminal GFP fused me53 truncation, and SV40 poly(A) signal was then 177

subcloned into pFACT using SacI and XhoI, generating the donor plasmid for transposition, and 178

used to generate recombinant bacmids in the me53 knockout bacmid as described above. All 179

constructs containing ME53 truncations were confirmed by sequencing. 180

181

GFP tagged ME53 site-directed mutagenesis and internal deletions 182

Site-directed mutagenesis in me53 was carried out using primers listed in Table 3 designed for 183

specific point mutations and internal deletions at the ME53 N-terminus. Codons for residues 121 184

(E), 122 (R) or 126 (K) in ME53 were each changed by point mutation to alanine (A) through 185

PCR reactions using pFACT-ME53:GFP as the template. All internal deletions ME53Δ107-121, 186

ME53Δ121-130, ME53Δ126-140, ME53Δ138-145 and ME53Δ159-168 were carried out through PCR 187

reactions using pFACT-ME53:GFP as the template as well. PCR reactions (25 μl) were set up as 188

follows: template DNA (200 ng/μl) 1 μl, forward primer (200 nM) 2 μl, reverse primer (200 nM) 189

2 μl, dNTP (200 μM) 0.5 μl, pfu buffer (1x) 2.5 μl, pfu polymerase (1.25U) 0.5 μl, water 17 μl 190

(total volume adjusted to 25 μl). The PCR program was: 1. 95°C 5 mins; 2. 95°C 30 sec, 3. 56°C 191

1 min, 4. 68°C 12 mins; 5. repeat steps 2 to 4 17 times. Final incubation was at 4°C for 12 h. The 192

PCR products with point mutations or internal deletions in me53 were then transformed into 193

DH5α competent cells. Colonies with positive donor plasmid were selected, and the donor 194

plasmid was transposed into the atti-Tn7 transposition site in me53-knockout bacmid for ME53 195

mutant bacmid construction as described above. All constructs containing me53 point mutations 196


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

11

or internal deletions were confirmed by sequencing. 197

198

Transfection 199

Recombinant bacmid DNA was purified using a midi-plasmid extraction kit from Qiagen, and 200

the NanoDrop ND-1000 was then used to determine the bacmid DNA concentration. For 201

transfection, Sf21 cells were seeded at 1×106 cells/35 mm plate overnight. Cells were then 202

transfected with 5 μg of the bacmid DNA by using 8 μl Cellfectin II from Invitrogen according 203

to the manufacturer’s protocol. After incubation for 5 h, the DNA and Cellfectin mixture was 204

removed and replaced with fresh Grace’s medium. 205

206

Fluorescence and immunofluorescence confocal microscopy 207

Sf21 cells were seeded on coverslips at 1×106 cells/plate (35 mm plate) overnight and then 208

transfected with each of the recombinant bacmid DNAs, respectively. An early time point of 18 209

hours post-transfection (hpt) and a late time point of 48 hpt were selected to observe ME53 210

localization. At 18 and 48 hpt, cells were first fixed with 4% paraformaldehyde in PBS for 15 211

min, washed 3 times for 5 min each with 1 ml PBS, and then blocked for 30 min with 3% bovine 212

serum albumin (BSA) in PBS. After blocking, cells were incubated with mouse anti-HA 213

monoclonal antibodies (Sigma) which were diluted 1:20 in 3% BSA in PBS for 2 h, and rinsed 3 214

times in 1 ml PBS for 5 min each time. Cells were then incubated in Alexafluor 594 goat 215

anti-mouse secondary antibodies (Invitrogen) diluted 1:100 in 3% BSA in PBS for 1 h, and 216


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

12

rinsed 3 times for 5 min each in 1 ml PBS. For truncated or mutated ME53:GFP, 217

virus-transfected cells were fixed with 4% paraformaldehyde in PBS for 15 min and washed 218

twice with 1 ml PBS (5 min each). In both cases cells were then stained with Hoechst for 30 min 219

in the dark and examined with the Leica SP5 CLSM confocal microscope using a 63× dipping 220

lens. For ME53:GFP, excitation was at 488 nm, and acquisition was between 500 and 523 nm for 221

GFP. For ME53:HA, excitation was at 594 nm, and acquisition was between 607 and 671 nm for 222

Alexafluor 594. To determine the percentage of successfully transfected cells showing nuclear 223

localization of ME53, 40 cells with evidence of HA or GFP mediated fluorescence were chosen 224

at random and scored. A lower magnification of cell monolayers are shown to demonstrate that 225

fluorescence in either or both cytoplasm or nucleus was observed in more than one cell. 226

227

Virus titration 228

Sf21 cells were seeded at 1×106 cells/plate (35 mm plate) overnight. Cells were then transfected 229

with 5 µg of recombinant bacmid DNA by using 8 µl Cellfectin II from Invitrogen according to 230

the manufacturer’s protocol. To determine the level of BV production, a 200 µl sample of the 231

medium was collected at 7 days post-transfection and centrifuged at 1,000 x g for 5 min to pellet 232

cells. The supernatant was then used for end-point dilution (100 to 10-9) to determine the virus 233

titer (23). Plates were scored according to the presence of occlusion bodies. For each of the 234

ME53-mutated bacmids, two replicates of virus titrations were performed. 235

236


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

13

Results 237

Bioinformatic analysis predicted three highly conserved regions in ME53 238

While ME53 homologues are found in alpha- and betabaculoviruses, none could be found in 239

delta- or gammabaculoviruses. To obtain an overview of ME53 evolutionary relationships, ME53 240

from both alpha- and betabaculoviruses were selected for phylogeny studies and analysis of its 241

amino acid sequence conservation. The phylogenetic tree showed evidence for three ME53 242

clades. All Group I alphabaculovirus ME53s studied formed clade 1 but it also contained ME53 243

from only one Group II alphabaculovirus, SfMNPV. Clade 2 contained ME53 from mostly 244

betabaculoviruses though ME53 from four Group II alphabaculoviruses were also part of this 245

clade. Clade 3 contained ME53 from mostly Group II alphabaculoviruses, but also included three 246

betabaculoviruses. Among the Group I ME53s, PlxyNPV ME53 is the most highly conserved 247

with AcMNPV ME53. Overall, ME53s from the Group II alphabaculoviruses and 248

betabaculoviruses are more distant from Group I ME53s (Fig. 1A). While in general the ME53s 249

segregate according to genera and group I and II, this is not absolute. Interestingly ME53s from 250

the Group II alphabaculoviruses segregate into the same two clades as the betabaculovirus 251

ME53s while ME53s from Group I alphabaculoviruses are restricted to only the first clade. In 252

addition, by pairwise comparison, the amino acid similarity and identity of AcMNPV and viruses 253

from each group are shown in Tables 4-6. The conservation of ME53 is in general consistent 254

with the baculovirus classification in the two genera. That there is at least some conservation in 255

ME53s among different genera suggests ME53 may also be conserved in its evolutionary 256


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

14

function. 257

258

ME53s from Group I alphabaculoviruses (AcMNPV, AgMNPV, AnpeNPV, BmNPV, CfDEFNPV, 259

CfMNPV, EppoNPV, HycuNPV, MaviNPV, OpMNPV, PlxyNPV, RoMNPV and ThorNPV) are 260

similar in the size of the polypeptide (433 aa to 483 aa) and share a high amino acid similarity 261

and identity. However, ME53s from Group II alphabaculoviruses (AdhoNPV, AgseNPV, 262

EcobNPV, HearNPV, LdMNPV, LsMNPV, MacoNPV, OrleNPV, SeMNPV, SfMNPV, SpltNPV 263

and TnSNPV) and betabaculoviruses (AdhoGV, AgseGV, ChocGV, CpGV, CrleGV, EpapGV, 264

HearGV, PhopGV, PlxyGV, SfGV and SpliGV) lack the first 80 to 110 amino acids at the 265

N-terminus present in Group I and consequently are much smaller (289 aa to 450 aa). 266

Nevertheless, there are three highly conserved regions that exist in ME53s from both alpha- and 267

betabaculoviruses. The first conserved region, relative to AcMNPV ME53, is at the amino 268

terminus within aa 107 to 190 of Group I, especially from aa 111 to 138 (both alphabaculoviruses 269

and betabaculoviruses), including three 100% conserved residues D111, R113 and G138. 270

However, the function of this region prior to our work was not known. The second highly 271

conserved region lies within aa 225 to 300 and the third to aa 379 to 400 (both 272

alphabaculoviruses and betabaculoviruses) which includes the previously identified putative zinc 273

finger domain (Fig. 1B). 274

275

Among the highly conserved alphabaculoviruses, Group I ME53s share a high amino acid 276


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

15

similarity with aa 111 to 145 relative to AcMNPV ME53 at its N-terminus being highly 277

conserved (Fig. 2A). In particular, residues D111, L112, R113, H115, F116, S118, E121, R122, 278

M125, L129, F131, T133, N134, Y135, G138 and Y139 are 100% conserved (asterisks, Fig 2A). 279

Moreover, three residues D111, R113 and G138 are conserved not just in Group I 280

alphabaculoviruses, but are also conserved in Group II alphabaculoviruses and betabaculoviruses. 281

Among all the conserved sites, two are acidic residues D111 and E121 and three are basic 282

residues R113, H115 and R122. Such charged amino acids may contribute to its conformation 283

and form domains that are capable of binding to chaperone proteins to facilitate ME53 nuclear 284

localization. The secondary structure predicted in the conserved N-terminus aa 111-145 region is 285

of an alpha helix from aa 113 to 136 (Fig. 2A), which is also the longest alpha helix predicted in 286

ME53. Another highly conserved region in ME53 is a zinc finger domain from aa 379 to 400 that 287

is conserved in all alpha- and betabaculoviruses (Fig. 1B and 2B). In particular, AcMNPV ME53 288

residues C379, C382, K383, K386, N391, P392, C396, C399, G400, F401, T402, F407 and Y411 289

are 100% conserved among all Group I alphabaculoviruses analyzed (Fig. 2B). The conserved 290

cysteines C379, C382, C396 and C399 have the appropriate spacing for a C4 zinc finger (Fig. 291

2B). 292

293

Preliminary mapping of ME53 fragments required for nuclear translocation 294

By sequence analysis, ME53 does not contain any recognized mono- or bipartite NLSs. 295

Moreover, ME53 translocates to the nucleus only in the late phase during virus infection, which 296


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

16

further suggests that ME53 does not have an intrinsic NLS. Thus it may utilize viral and/or host 297

chaperone proteins to facilitate its nuclear translocation. To identify which region is needed for 298

the nuclear translocation of AcMNPV ME53 in virus-transfected cells, a series of ME53 peptides 299

and corresponding internal deletions (Δ) were constructed (Fig. 3A). Since the 200 amino acids 300

in the C-terminus of ME53 are not essential for its nuclear translocation (24), the focus of this 301

study was on the 250 amino acids in the N-terminus. Based on the amino acid composition of 302

different regions, the ME53 N-terminus was further divided into 3 contiguous smaller regions, 303

ME5333-82, ME5383-152 and ME53153-225. Each region contains a cluster of positively charged 304

arginine or lysine residues which are often part of a typical NLS. A double HA epitope tag was 305

fused to the C-terminus of the ME53 mutants to follow their intracellular localization by 306

immunofluorescence microscopy. Since most of the ME53 peptides and internal deletions 307

reduced the normal levels of BV production, there was insufficient virus available for infection 308

studies. Consequently, we used transfection with bacmid DNAs throughout the study. ME53 309

localization was analyzed at 18 and 48 hpt. Transfected cells identified as showing ME53 nuclear 310

translocation were those in which fluorescence could be seen largely in the nucleus. By 18 hpt, 311

which is equivalent to approximately 6 hours post-infection (hpi), the full length ME53, the 312

ME53 peptides and internal deletions from each construct all localized mainly in the cytoplasm, 313

with only negligible levels showing in the nucleus (ME53:2HA, Fig. 4). By 48 hpt, which is 314

equivalent to approximately 36 hpi, the full length ME53 was localized equally in the cytoplasm 315

and nucleus. Subsequently, only 48 hpt was used for analysis of nuclear translocation. As shown 316


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

17

in Fig. 4, by 48 hpt, the full length ME53 localized primarily in the nucleus, and 85% of the 317

successfully transfected cells showed obvious nuclear translocation. However, peptide 318

ME5333-82 showed only cytoplasmic localization, while the corresponding internal deletion 319

ME53Δ33-82 did not inhibit its nuclear transport. Similarly, the peptide ME53153-225 localized 320

exclusively to the cytoplasm, while the corresponding internal deletion ME53Δ153-225 still 321

translocated primarily to the nucleus. These data suggested that neither the peptide ME5333-82 322

nor the peptide ME53153-225 was important for ME53 nuclear localization. In contrast, by 48 hpt, 323

the peptide ME5383-152 translocated to the nucleus in 65% of the successfully transfected cells, 324

mimicking the full length ME53 localization, while the corresponding internal deletion 325

ME53Δ83-152 failed to localize to the nucleus (Fig. 4). Thus the peptide ME5383-152, which 326

includes the N-terminus conserved region of aa 111-145 shown in the bioinformatic analysis, 327

was found to be sufficient for its ME53 nuclear translocation. 328

329

Fine mapping the ME53 NTS sequence 330

To confirm the preliminary mapping results of the NTS to aa 83-152 from immunofluorescence 331

microscopy, and to more finely map the minimal residues in this peptide essential for ME53 332

nuclear transport, N- and C- terminal truncations (Δ) of ME53 were constructed. In addition, 333

each of the constructs was fused with a GFP-tag at its carboxyl end (Fig. 3B). Each of the 334

AcMNPV bacmids with ME53:GFP truncations was transfected into Sf21 cells and monitored 335

for nuclear localization. As an infection negative control, only the expression plasmid 336


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

18

pME53:GFP was transfected. ME53:GFP in the absence of bacmid co-transfection was localized 337

to the cytoplasm only, while that expressed from a bacmid did localize to the nucleus (Fig. 5). 338

Previous data have shown that the C-terminus of ME53 is not required for its nuclear 339

translocation (24). To confirm this result, the entire 200 amino acids in the C-terminus were 340

deleted (Δ250-449) from ME53. As expected, ME53Δ250-449:GFP accumulated in the nucleus at 341

late times post-transfection, confirming that the C-terminus of ME53 is not required for its 342

nuclear transport (Fig. 5). 343

344

To more finely map the NTS, AcMNPV bacmids with different N-terminus truncations of 345

ME53:GFP were transfected into Sf21 cells (Fig. 6). ME53Δ2-106:GFP and ME53Δ2-108:GFP 346

showed no or minimal impact on nuclear translocation. A major reduction in cell numbers 347

showing nuclear transport was observed starting with ME53Δ2-112:GFP where only 55% of the 348

cells showed nuclear translocation. Even lower levels of nuclear localization was observed for 349

deletions beyond 112 including ME53Δ2-113:GFP with 40%, ME53Δ2-121:GFP with 12.5% and 350

finally ME53Δ2-150:GFP with 0% nuclear localization (Fig. 6). This showed that the ME53 351

N-terminus aa 2-108 is not required for the nuclear translocation. Therefore, the ME53 NTS 352

required for optimal nuclear translocation mapped to residues within aa 109-249. Combined with 353

the immunofluorescence data of the HA-tagged constructs (Fig. 4), the N-terminal truncation 354

studies tentatively mapped the NTS to residues within aa 109-152. 355

356


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

19

To more accurately define the C-terminus of the NTS within aa 109-152, an additional series of 357

internal deletions (Δ) at the C-terminus of this region in ME53:GFP was generated (Fig. 1B). 358

The internal deletions were Δ107-121, Δ121-130, Δ126-140, Δ138-145 and Δ159-168. Of these 359

five internal deletions, only ME53Δ138-145:GFP and ME53Δ159-168:GFP had minimal or no 360

impact on nuclear translocation (Fig. 7). ME53Δ107-121:GFP, ME53Δ121-130:GFP and 361

ME53Δ126-140:GFP all greatly compromised the nuclear translocation at 48 hpt (Fig. 7). Based on 362

these data the C terminus of ME53 NTS does not go beyond amino acid 137. These results 363

therefore mapped the ME53 NTS to residues within aa 109-137, a highly conserved region that 364

includes a predicted alpha helix of aa 113-136. 365

366

To confirm the function of the NTS as a nuclear translocation sequence ME53 bacmids 367

containing an NTS (aa 109 - 137) fused to GFP (NTS:GFP) and a fusion between GFP and 368

ME53 lacking NTS (ΔNTS:GFP) were constructed. Compared to GFP alone, which localized 369

equally between the cytoplasm and nucleus, the NTS bearing GFP concentrated mostly to the 370

nucleus in the successfully transfected cells by 48 hpt. In contrast, the internal deletion of NTS 371

(aa 113 - 139) in ME53 of a ME53:GFP fusion (ΔNTS:GFP), which is also predicted to disrupt 372

the alphahelical structure in this area, totally abolished the nuclear translocation (Fig. 8). 373

Therefore, the ME53 NTS was found to be essential and sufficient for its nuclear translocation. 374

375

Alanine mutagenesis within ME53 NTS 376


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

20

Site-directed mutagenesis was introduced to disrupt the predicted alpha helix component within 377

the ME53 NTS to determine if the highly conserved residues E121, R122 or K126 were critical 378

for ME53:GFP nuclear translocation. Residues E121, R122 or K126 were mutated to alanine, 379

respectively, to determine the effect on the nuclear localization. These mutations were predicted 380

by COILS (http://www.ch.embnet.org/software/COILS_form.html) to disrupt the alpha helix 381

secondary structure in this region. However, ME53 translocated to the nucleus for all of the 382

single mutations E121A, R122A or K126A (Fig. 9). Even a mutation of both E121 and R122 383

(E121A/R122A) failed to reduce its nuclear translocation (data not shown). The fact that the 384

ME53s expressed by these mutants localize to the nucleus suggested that these specific amino 385

acids are not critical for nuclear translocation. 386

387

ME53 NTS and other residues within amino acids 101 to 398 are necessary for optimal 388

budded virus production 389

In addition to nuclear translocation, ME53 also forms foci at the cell membrane, and is required 390

for high level BV production. A series of bacmids containing ME53 mutations were used to 391

determine the minimal region necessary for efficient BV production. Virus titrations for each of 392

the ME53 mutants were performed at 7 days post-transfection, and the percent virus yields 393

shown in Fig. 10 were based on the average titers of two replicates. 394

395

The virus with wildtype (WT) ME53 showed a high titer at 2.05×108 TCID50/ml, while virus 396


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

21

without ME53 (ME53 KO) had a decreased yield to 1.48×104 TCID50/ml, only less than 0.01% 397

of the WT. Viral titers from cell monolayers transfected with the N-terminus truncations 398

demonstrated that the BV production from a bacmid lacking the first 50 amino acids (Δ3-50) in 399

the N-terminus of ME53 was equivalent to that of WT, while BV production from a bacmid 400

lacking the first 100 amino acids (Δ3-100) in the N-terminus was reduced to 11% compared to 401

the WT. However, further deletion from the N-terminus (Δ3-121) severely impaired virus yield 402

to less than 0.01% of the WT, similar to that of the ME53 KO bacmid (Fig. 10). This suggests 403

that a region at the N-terminus beginning between aa 50 and 100 is required for optimal BV 404

production, though not for nuclear translocation, while the N terminal region beginning between 405

aa 100 and 121 is essential for BV production at a level above that for the ME53 KO bacmid. As 406

this latter truncation would disrupt the putative NTS, this suggested that the ME53 nuclear 407

localization is also required for optimal BV production. In addition, viral titers from cell 408

monolayers transfected with different lengths of C-terminus truncations demonstrated that the 409

C-terminal 50 amino acids were not essential for normal levels of BV production. With the 410

C-terminal 50 amino acids deleted (Δ399-449), virus yield was at 48% of the WT. However, 411

further deletion up to the C-terminal 100 amino acids (Δ349-449) resulted in a much lower viral 412

titer to 0.078% of the WT, demonstrating that ME53 ending between aa 349 and 399 is essential 413

for optimal virus yield. Therefore, a region within aa 101-398 in AcMNPV ME53 is necessary 414

for optimal BV production (Fig. 10). 415

416


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

22

BV production was greatly impaired for the internal deletion bacmid Δ113–139 which deletes the 417

ME53 NTS (ΔNTS), and the internal deletion bacmid Δ169-191. The BV yield of Δ113–139 and 418

Δ169-191 were only 0.015% and 0.013% of the WT, respectively. The C-terminus internal 419

deletion Δ278-302 also reduced the virus titer to 0.058% compared to the WT (Fig. 10). This 420

suggested that the NTS region aa 109-137 itself in ME53 is not just important for nuclear 421

translocation, but is also required for optimal BV production. Interestingly, the virus yield of the 422

zinc finger deletion (ΔZnF) in ME53 was 53% of the WT, essentially indistinguishable from that 423

of WT ME53 at 7 days post-transfection (Fig. 10). The virus titers from the ΔZnF bacmid was 424

also measured and compared to wildtype bacmid at 24, 48, 60 and 72 hpt, and the virus yield at 425

those time points was similar to those of the WT ME53 (data not shown). This suggests that there 426

is no delay in virus production when the zinc finger is deleted, and the C4 zinc finger domain 427

itself in ME53 is not necessary for optimal BV production. 428

429

Discussion 430

AcMNPV me53 is a continually expressed gene from immediate early to late phase during 431

infection (9). me53 is essential for wild type levels of BV production and deletion of me53 432

results in a 10,000 fold reduction in virus yield (10). Our bioinformatic analysis showed that 433

ME53 is conserved in both alpha- and betabaculoviruses, but is not found in gamma- or 434

deltabaculoviruses. Compared to Group I alphabaculoviruses, ME53s from Group II 435

alphabaculoviruses and betabaculoviruses lack about 100 aa of the N-terminus. This amino 436


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

23

terminal region of the AcMNPV ME53 is the same one we found was dispensable for NTS 437

activity and optimal virus production. However, there are three highly conserved regions in 438

ME53 in both the alpha- and betabaculoviruses. The first one is at the N-terminus within aa 107 439

to 190, which includes the ME53 NTS at aa 109-137 identified in this study. The second one lies 440

at the C-terminus within the range aa 225 to 300. The third conserved sequence includes the 441

previously identified putative zinc finger domain at aa 379-400. 442

443

Intracellular localization of ME53 revealed a switch from an early cytoplasmic localization to a 444

nuclear localization later during infection (11). That ME53 localized only to the cytoplasm early 445

in infection suggested a lack of an NLS in ME53. Moreover, as previously reported (11) and 446

confirmed in this study, when ME53:GFP alone was transiently expressed in a plasmid, ME53 447

remained in the cytoplasm. Since ME53 remained cytoplasmic in the absence of virus infection, 448

this suggested the involvement of viral chaperone proteins available late post-infection enabling 449

ME53 nuclear translocation. For nuclear proteins with a typical NLS to initiate nuclear transport, 450

the NLS interacts with two major cellular proteins importin α and importin β to complete the 451

protein translocation through the nuclear pore complex (12, 25, 26). However, for nuclear 452

proteins that do not have a typical NLS, such as ME53, little is known about the nuclear 453

translocation mechanism. A series of ME53 truncations and internal deletions were constructed 454

to more accurately map the NTS to residues within aa 109-137, and shown to be essential for the 455

nuclear translocation. Within the alphabaculovirus ME53s NTS region, aa 113-136, consists of a 456


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

24

cluster of highly conserved amino acids that form a predicted alpha helix which may contribute 457

to forming a domain capable of binding to chaperone proteins to facilitate ME53 nuclear 458

localization. That deletion of the NTS prevents nuclear localization of an ME53:GFP fusion 459

while addition of NTS to a GFP enhances GFP localization to the nucleus further confirms the 460

nuclear translocation function of the AcMNPV ME53 NTS. If the region including the alpha 461

helix is deleted, the ME53 nuclear translocation efficiency is much lower than the wildtype 462

ME53. This suggests that the alpha helix region in the NTS is required for the interaction 463

between ME53 and a putative chaperone protein. Since changing some of the conserved charged 464

amino acids in the predicted alpha helix did not alter the NTS activity, it suggests that the NTS is 465

not dependent on the alpha helical nature or these specific charged amino acids, and other amino 466

acids within the NTS might complement their function. ME53 transiently expressed in 467

uninfected cells is distributed predominantly in the cytoplasm, suggesting that virus infection is 468

required to escort ME53 to the nucleus. Since the deletion of ME53 does not compromise viral 469

DNA replication, this suggests that the nuclear-localized ME53 is required for a purpose other 470

than DNA replication. For example that virus assembly occurs in the nucleus, and ME53 is 471

detected on both BV and ODV nucleocapsids suggests that ME53 might act as a structural or 472

scaffolding protein involved in virus assembly. A similar example of baculovirus proteins 473

chaperoning other viral proteins to the nucleus are between baculovirus P78/83 and 474

BV/ODV-C42 that are both required for virus assembly. The highly conserved baculovirus 475

protein BV/ODV-C42 contains a putative NLS at its C-terminus, and is capable of binding to the 476


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

25

viral nucleocapsid protein P78/83. Although P78/83 itself does not have an NLS, it is capable of 477

translocating to the nucleus but only when BV/ODV-C42 binds to P78/83 resulting in its 478

recruitment to the nucleus for actin polymerization and nucleocapsid assembly (27, 28). 479

480

Results of this study showed that the NTS and other residues within aa 101-398 in ME53 are 481

critical for optimal levels of BV production. That the ME53s in Group II alphabaculoviruses and 482

betabaculoviruses lack the N-terminal 100 amino acids of the Group I alphabaculoviruses further 483

demonstrates that they are not essential for ME53 function and BV production. Surprisingly, 484

viral titer from the zinc finger knockout bacmid was similar to that of WT ME53 throughout the 485

replication cycle, indicating that the putative zinc finger domain is dispensable for normal levels 486

of BV production. It is significant that the deletion of only the ME53 NTS greatly compromised 487

BV production, with a 10,000 fold decrease in virus titer, similar to the me53 knockout virus. 488

Thus, BV production levels correlate with the nuclear localization of ME53. Although ME53 489

nuclear translocation is important for normal BV production, it seems that virus production also 490

requires the regions surrounding the NTS from aa 101-398. When aa 169-191 or aa 278-302 491

downstream of the nuclear translocation region were deleted, ME53 was able to enter the nucleus, 492

but the virus production level was still compromised. Though we lack direct evidence, one 493

possible nuclear function of ME53 is as a matrix or even structural protein directly affecting 494

intranuclear viral nucleocapsid assembly. ME53 NTS within aa 109-137 may thus facilitate 495

ME53 nuclear transport, and the nuclear localized ME53 may be required for efficient viral 496


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

26

nucleocapsid assembly and eventual egress. Nevertheless, since deletion of the full length ME53 497

still yields infectious BV production albeit at extremely low levels, other viral or host nuclear 498

proteins may be able to substitute the function of ME53 in virus production, although at much 499

reduced efficiency. 500

501

Moreover, since ME53 localizes to both the nucleus and cell membrane foci, it is likely that 502

ME53 influences virus production during both the assembly and budding steps. Preliminary data 503

from immunoprecipitation assays revealed that ME53 potentially interacts with both viral 504

envelope GP64 and capsid protein VP39 (unpublished data). Since VP39 is a nuclear viral 505

protein and participates in virus assembly, VP39 might act as a chaperone protein to facilitate 506

ME53 nuclear translocation. When VP39 was deleted ME53 still translocated to the nucleus, 507

albeit at a much lower level (11). While this suggests that VP39 might be one ME53 chaperone 508

protein other viral or host proteins could chaperone ME53 nuclear translocation as well. In 509

addition, the association of ME53 with viral envelope protein GP64 is also consistent with their 510

co-localization and foci formation at the plasma membrane. Previous studies (24) do not support 511

a direct interaction between GP64 and ME53, because GP64 and ME53 do not form foci when 512

only these two proteins are expressed in uninfected cells. Nevertheless, a third viral protein 513

might bind both ME53 and GP64 for foci formation and potential virus budding. 514

515

ME53 might have multiple roles after being transported to the nucleus. Since ME53 has a C4 516


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

27

zinc finger domain which is usually involved in DNA binding and protein interactions, and the 517

zinc finger domain is highly conserved across both the alpha- and betabaculoviruses, ME53 518

might also be involved in viral gene transcription regulation in virus production. ME53 might 519

transactivate the expression of other viral genes encoding structural proteins to increase the pool 520

of the structural proteins for nucleocapsid assembly. Transcription factors are normally related to 521

DNA binding and transcriptional activation, and can function only when they enter the nucleus. 522

For instance, herpes simplex virus 1 tegument protein VP16 initiates viral transcriptional 523

activation in the nucleus by recruiting host protein Oct-1 and host cell factor (29, 30, 31, 32) to 524

form a complex on the regulatory sites of TAATGARAT motifs in each of the immediate early 525

gene promoters to activate its expression (33, 34). ME53 might play a similar role at later times 526

post-infection by transactivating the expression of viral late structural protein genes for BV 527

assembly or ODV formation. This would be consistent with the fact that ME53 is distributed 528

predominantly in the cytoplasm at early times post-infection, while the nuclear translocation is 529

observed mostly late in infection. 530

531

In summary, this study is the first to report that AcMNPV ME53 utilizes an NTS within aa 532

109-137 to translocate to the nucleus, and a region within aa 101-398 is necessary for optimal 533

BV production. These studies have for the first time demonstrated the functional significance of 534

ME53 in baculovirus replication and indicates that it has multiple roles including in the nucleus 535

and later at the plasma membrane for virus egress. Furthermore, identification of an NTS now 536


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

28

allows us to better assess the possible nuclear roles, such as in transcriptional regulation and 537

nucleocapsid assembly, for example by using an ME53 ΔNTS bacmid. 538

539

Acknowledgement 540

This work was funded by the Natural Sciences and Engineering Research Council of Canada 541

(NSERC) discovery (RGPIN-2009-8395 and RGPIN-2014-05472) and strategic (STPGP 542

365213-2008) grants to PJK. We acknowledge Dr. Michaela Strüder-Kypke and David Leishman 543

for technical assistance. 544

545

References 546

1. Funk J., S. C. Braunagel, G. F. Rohrmann. 1997. Baculovirus Structure. In The 547

Baculoviruses. Edited by L. K. Miller. New York: Plenum Press. 548

2. Federici B. A. 1997. Baculovirus Pathogenesis. In The Baculoviruses. Edited by L. K. 549

Miller. New York: Plenum Press. 550

3. Lauzon, H. A., C. J. Lucarotti, P. J. Krell, Q. Feng, A. Retnakaran, and B. M. Arif. 551

2004. Sequence and organization of the Neodiprion lecontei nucleopolyhedrovirus genome. 552

J. Virol. 78:7023-7035. 553

4. Chisholm, G. E. and D. J. Henner. 1988. Multiple early transcripts and splicing of the 554

Autographa californica nuclear polyhedrosis virus IE-1 gene. J. Virol. 62:3193-3200. 555


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

29

5. Lu, A. and L. K. Miller. 1995. The roles of eighteen baculovirus late expression factor 556

genes in transcription and DNA replication. J. Virol. 69:975-982. 557

6. Rodems, S. M., S. S. Pullen, and P. D. Friesen. 1997. DNA-dependent transregulation by 558

IE1 of Autographa californica nuclear polyhedrosis virus: IE1 domains required for 559

transactivation and DNA binding. J. Virol. 71:9270-9277. 560

7. Chen, Y. R., S. Zhong, Z. Fei, Y. Hashimoto, J. Z. Xiang, S. Zhang, and G. W. Blissard. 561

2013. The transcriptome of the baculovirus Autographa californica multiple 562

nucleopolyhedrovirus in Trichoplusia ni cells. J. Virol. 87:6391-6405. 563

8. Knebel-Morsdorf, D., J. T. Flipsen, R. Roncarati, F. Jahnel, A. W. Kleefsman, and J. M. 564

Vlak. 1996. Baculovirus infection of Spodoptera exigua larvae: lacZ expression driven by 565

promoters of early genes pe38 and me53 in larval tissue. J. Gen. Virol. 77 ( Pt 5):815-824. 566

9. Knebel-Morsdorf, D., A. Kremer, and F. Jahnel. 1993. Baculovirus gene me53, which 567

contains a putative zinc finger motif, is one of the major early-transcribed genes. J. Virol. 568

67:753-758. 569

10. de, Jong. J., B. M. Arif, D. A. Theilmann, and P. J. Krell. 2009. Autographa californica 570

multiple nucleopolyhedrovirus me53 (ac140) is a nonessential gene required for efficient 571

budded-virus production. J. Virol. 83:7440-7448. 572


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

30

11. de, Jong. J., D. A. Theilmann, B. M. Arif, and P. J. Krell. 2011. Immediate-early protein 573

ME53 forms foci and colocalizes with GP64 and the major capsid protein VP39 at the cell 574

membranes of Autographa californica multiple nucleopolyhedrovirus-infected cells. J. 575

Virol. 85:9696-9707. 576

12. Cook, A., F. Bono, M. Jinek, and E. Conti. 2007. Structural biology of nucleocytoplasmic 577

transport. Annu. Rev. Biochem. 76:647-671. 578

13. Au, V., M. Yu, and E. B. Carstens. 2009. Characterization of a baculovirus nuclear 579

localization signal domain in the late expression factor 3 protein. Virology 385:209-217. 580

14. Feng, G. and P. J. Krell. 2014. Autographa californica multiple nucleopolyhedrovirus 581

DNA polymerase C terminus is required for nuclear localization and viral DNA replication. 582

J. Virol. 88:10918-10933. 583

15. Bange, G., G. Murat, I. Sinning, E. Hurt, and D. Kressler. 2013. New twist to nuclear 584

import: When two travel together. Commun. Integr. Biol. 6:e24792. 585

16. Chang, C. W., R. M. Counago, S. J. Williams, M. Boden, and B. Kobe. 2013. 586

Distinctive conformation of minor site-specific nuclear localization signals bound to 587

importin-alpha. Traffic. 14:1144-1154. 588

17. Kahms, M., J. Huve, R. Wesselmann, J. C. Farr, V. Baumgartel, and R. Peters. 2011. 589


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

31

Lighting up the nuclear pore complex. Eur. J. Cell Biol. 90:751-758. 590

18. Olson, V. A., J. A. Wetter, and P. D. Friesen. 2002. Baculovirus transregulator IE1 591

requires a dimeric nuclear localization element for nuclear import and promoter activation. 592

J. Virol. 76:9505-9515. 593

19. Wu, Y. and E. B. Carstens. 1998. A baculovirus single-stranded DNA binding protein, 594

LEF-3, mediates the nuclear localization of the putative helicase P143. Virology 595

247:32-40. 596

20. Clem, S. A., W. Wu, and A. L. Passarelli. 2014. The Trichoplusia ni single 597

nucleopolyhedrovirus tn79 gene encodes a functional sulfhydryl oxidase enzyme that is 598

able to support the replication of Autographa californica multiple nucleopolyhedrovirus 599

lacking the sulfhydryl oxidase ac92 gene. Virology 460-461:207-216. 600

21. Di, T. P., S. Moretti, I. Xenarios, M. Orobitg, A. Montanyola, J. M. Chang, J. F. Taly, 601

and C. Notredame. 2011. T-Coffee: a web server for the multiple sequence alignment of 602

protein and RNA sequences using structural information and homology extension. Nucleic 603

Acids Res. 39:W13-W17. 604

22. Ferreira, P. E., G. Holmgren, M. I. Veiga, P. Uhlen, A. Kaneko, and J. P. Gil. 2011. 605

PfMDR1: mechanisms of transport modulation by functional polymorphisms. PLoS. One. 606

6:e23875. 607


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

32

23. O’Reilly, D. R., L. K. Miller, and V. A. Luckow. 1994. Baculovirus expression vectors: a 608

laboratory manual. W. H. Freeman and Company, New York, NY. 609

24. de, Jong. J. 2010. Analysis of the immediate early/late protein me53 from the baculovirus 610

Autographa californica Nucleopolyhedrovirus. PhD thesis. University of Guelph, Guelph, 611

ON. 612

25. Goldfarb, D. S., A. H. Corbett, D. A. Mason, M. T. Harreman, and S. A. Adam. 2004. 613

Importin alpha: a multipurpose nuclear-transport receptor. Trends Cell Biol. 14:505-514. 614

26. Lange, A., R. E. Mills, C. J. Lange, M. Stewart, S. E. Devine, and A. H. Corbett. 2007. 615

Classical nuclear localization signals: definition, function, and interaction with importin 616

alpha. J. Biol. Chem. 282:5101-5105. 617

27. Braunagel, S. C., P. A. Guidry, G. Rosas-Acosta, L. Engelking, and M. D. Summers. 618

2001. Identification of BV/ODV-C42, an Autographa californica nucleopolyhedrovirus 619

orf101-encoded structural protein detected in infected-cell complexes with ODV-EC27 620

and p78/83. J. Virol. 75:12331-12338. 621

28. Wang, Y., Q. Wang, C. Liang, J. Song, N. Li, H. Shi, and X. Chen. 2008. Autographa 622

californica multiple nucleopolyhedrovirus nucleocapsid protein BV/ODV-C42 mediates 623

the nuclear entry of P78/83. J. Virol. 82:4554-4561. 624

29. O'Hare, P. and C. R. Goding. 1988. Herpes simplex virus regulatory elements and the 625


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

33

immunoglobulin octamer domain bind a common factor and are both targets for virion 626

transactivation. Cell 52:435-445. 627

30. Preston, C. M., M. C. Frame, and M. E. Campbell. 1988. A complex formed between 628

cell components and an HSV structural polypeptide binds to a viral immediate early gene 629

regulatory DNA sequence. Cell 52:425-434. 630

31. Stern, S., M. Tanaka, and W. Herr. 1989. The Oct-1 homoeodomain directs formation of 631

a multiprotein-DNA complex with the HSV transactivator VP16. Nature 341:624-630. 632

32. Xiao, P. and J. P. Capone. 1990. A cellular factor binds to the herpes simplex virus type 1 633

transactivator Vmw65 and is required for Vmw65-dependent protein-DNA complex 634

assembly with Oct-1. Mol. Cell Biol. 10:4974-4977. 635

33. Babb, R., C. C. Huang, D. J. Aufiero, and W. Herr. 2001. DNA recognition by the 636

herpes simplex virus transactivator VP16: a novel DNA-binding structure. Mol. Cell Biol. 637

21:4700-4712. 638

34. Wilson, A. C., M. A. Cleary, J. S. Lai, K. LaMarco, M. G. Peterson, and W. Herr. 1993. 639

Combinatorial control of transcription: the herpes simplex virus VP16-induced complex. 640

Cold Spring Harb. Symp. Quant. Biol. 58:167-178. 641

Figure Legends 642

Figure 1. Bioinformatic analysis of ME53s from Group I and II alphabaculoviruses and 643


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

34

betabaculoviruses. (A) Neighbor-Joining phylogenetic analysis of ME53 protein sequences. 644

Bootstrap scores of the nodes are shown. Clades 1, 2 and 3 are shown by brackets. (B) 645

Schematics of ME53 conservation relative to AcMNPV ME53 within each group of viruses 646

showing three highly conserved amino acid regions, 111 to 138, 225 to 300 and 379 to 399. 647

Figure 2. Analysis of amino acid sequence conservation of ME53s from Group I 648

alphabaculoviruses. Amino acid sequence alignment of ME53 N-terminus (A) and C-terminus 649

(B). The * represents 100% identical residues, : represents conserved substitutions, and . 650

represents semi-conserved substitutions. The sequences within the black squares represent the 651

predicted alpha helix of aa 113-136 (A) and putative zinc finger domain of aa 379-399 (B). The 652

numbered amino acids are the 100% conserved residues mentioned in the main text. 653

Figure 3. Schematics of ME53 bacmid constructions. (A) Cloning strategy for HA-tagged ME53 654

peptides and internal deletions using AcMNPV me53 knockout bacmid as backbone. HA epitope 655

tag (open square) was fused to the C-terminus of ME53 (black filled rectangle) to allow for 656

intracellular localization of ME53 by immunofluorescence microscopy; (B) Strategy for 657

GFP-fused ME53 truncations and internal deletions using the AcMNPV me53 knockout bacmid 658

as backbone. GFP tag (grey filled rectangle) was fused to the C-terminus of ME53 (black filled 659

rectangle) to follow ME53 localization by fluorescence microscopy. White rectangles represent 660

internal deletions. 661

Figure 4. Intracellular localization of HA-tagged ME53 peptides and internal deletions following 662

transfection with bacmid DNA at 18 and 48 hpt. Cells were fixed and stained with mouse 663


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

35

anti-HA primary antibody (1:20) and Alexafluor 594 goat anti-mouse secondary antibody (1:100). 664

Forty transfected cells showing red fluorescence were counted, and the % value represents the 665

percentage of cells showing nuclear localization. Peptide aa 83 to 152 localized largely to the 666

nucleus while ME53 lacking aa 83 to 152 remained cytoplasmic. Monolayer column is at a lower 667

magnification showing several cells in the same view. 668

Figure 5. Intracellular localization of plasmid-only expressed GFP-fused to ME53 (ME53:GFP 669

alone), bacmid DNA expressed full length ME53 fused to GFP (ME53:GFP) or ME53 lacking aa 670

250 to 449 at the C terminus fused to GFP (ME53Δ250-449:GFP), respectively at 48 hpt. Cells were 671

fixed and examined under a Leica SP5 CLSM confocal microscope using a 63× dipping lens. 672

Forty transfected cells with green fluorescence were counted, and the % value represents the 673

percentage of cells showing nuclear localization. Transient expression of ME53:GFP in the 674

absence of virus infection showed only cytoplasmic localization, while truncation of the 675

C-terminus of ME53 did not abolish its nuclear translocation.Figure 6. Intracellular localization 676

of GFP-fused ME53 N-terminus truncations with bacmid DNA at 48 hpt. Cells were fixed and 677

examined under the Leica SP5 CLSM confocal microscope using a 63× dipping lens. Forty 678

transfected cells with green fluorescence were counted, and the % value represents the 679

percentage of cells showing any nuclear localization. Nuclear localization started to be reduced 680

for truncations of ME53 downstream of amino acid 108. 681

\Figure 7. Intracellular localization of GFP-fused ME53 with internal deletions at the C terminus 682

of the putative NTS at 48 hpt. Cells were fixed and examined under a Leica SP5 CLSM confocal 683


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

36

microscope using a 63× dipping lens. Forty transfected cells with green fluorescence were 684

counted, and the % value represents the percentage of cells showing any nuclear localization. 685

ME53 nuclear translocation was observed for deletions of residues downstream of amino acid 686

137. 687

Figure 8. Intracellular localization of transiently expressed GFP (GFP alone) and bacmid 688

expressed ME53 fused to GFP (ME53:GFP), and GFP only tagged with the NTS (aa 109 - 137) 689

(NTS:GFP) and GFP fused to ME53 with the NTS (aa 109 - 139) deleted (ME53ΔNTS:GFP) at 690

48 hpt. Cells were fixed and examined under the Leica SP5 CLSM confocal microscope using a 691

63× dipping lens. Forty transfected cells with green fluorescence were counted, and the % value 692

represents the percentage of cells showing any nuclear localization. NTS:GFP localized mostly 693

to the nucleus, while deletion of NTS from ME53 abolished its nuclear localization 694

Figure 9. Intracellular localization of GFP-fused ME53 site-directed mutations with bacmid 695

DNA at 48 hpt. Cells were fixed and examined under a Leica SP5 CLSM confocal microscope 696

using a 63× dipping lens. Forty transfected cells with green fluorescence were counted, and the % 697

value represents the percentage of cells showing nuclear localization. Highly conserved residues 698

E121, R122 or K126 were mutated to alanine (A) respectively. None of the single site mutations 699

altered its nuclear translocation. 700

Figure 10. Virus titration of ME53 truncations and internal deletions at 7 days post-transfection. 701

Horizontal dashed lines refer to internally deleted regions, Δ means truncation or internal 702

deletion of the amino acids indicated, ME53 KO refers to ME53 knockout, and WT ME53 means 703


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

37

wildtype full-length ME53. Supernatant with BVs was collected and used in end-point dilution 704

(100 to 10-9) to determine the virus titer. Values are relative to 100% virus yield for the wild type 705

ME53 and are the average of two determinations. 706


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Table 1. Primers for HA tagged ME53 peptides or internal deletions. Restriction sites are in 1

italics and underlined. 2

Gene Name Sequence

me53 promoter ME53PRO-F GAGCTCAGCGTGTGCGCCGGAGCACA ME53PRO-R TCTAGATGTAACTGTTAGTTAGCACT

sv40 poly (A) SV40-F GATATCGATCATAATCAGCCATACCA SV40-R CTCGAGGATCCAGACATGATAAGATA

ME5333-822HA

ME53(33-82)-F TCTAGAATGCCGCCGTCGCCTGTTCGT

ME53(33-82)2HA-R GATATCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAATCTTTTCTGTTGACGACT

ME5383-1522HA

ME53(83-152)-F TCTAGAATGGGATATTTTGTGCCGCCCGAGTT

ME53(83-152)2HA-R GATATCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTATGCAAATTTGCCCGTCATGCGCAT

ME53153-2252HA

ME53(153-225)-F TCTAGAATGAGCAGGCCTGTGAAATACAA

ME53(153-225)2HA-R GATATCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAAGAAGGATATATTTCGTAC

ME531-32 ME53(1-449)-F TCTAGAATGAACCGTTTTTTTCGAGA ME53(1-32)-R GGATCCCGAGTTGGCGGCAGGCGCTGGCAA

ME5383-4492HA

ME53(83-449)-F GGATCCGGATATTTTGTGCCGCCCGAGTT

ME53(1-449)2HA-R GATATCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAGACATTGTTATTTACAAT

ME531-82 ME53(1-82)-R GGATCCATCTTTTCTGTTGACGACT ME53153-4492HA ME53(153-449)-F GGATCCAGCAGGCCTGTGAAATACAA ME531-152 ME53(1-152)-R GGATCCTGCAAATTTGCCCGTCATGCGCAT ME53226-4492HA ME53(226-449)-F GGATCCATCAATTTGGTCGACCTCAGCTA

3


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2

Table 2. Primers for GFP fused ME53 truncations. Restriction sites are in italics and underlined. 4

Gene Name Sequence

GFP tag GFP-F CTGCAGGTGAGCAAGGGCGAGGAGCTG GFP-R GATATCTTACTTGTACAGCTCGTCCATGC

ME53△2-106 ME53(107-449)GFP-F TCTAGAATGAAACAAGAGCGCGATCTACG ME53(1-449)GFP-R CTGCAGGACATTGTTATTTACAATA

ME53△2-108 ME53(109-449)GFP-F TCTAGAGAGCGCGATCTACGTATGCAT

ME53△2-112 ME53(113-449)GFP-F TCTAGAATGCGTATGCATTTCATGAGCGATT

ME53△2-113 ME53(114-449)GFP-F TCTAGAATGCATTTCATGAGCGATTTAGAAC

ME53△2-121 ME53(122-449)GFP-F TCTAGAATGCGCGACATCATGAAAGCCACG

ME53△2-150 ME53(151-449)GFP-F TCTAGAAAATTTGCAAGCAGGCCTGTGA

ME53△250-449 ME53(1-249)GFP-F CTGCAGTGACAGCAGATGTCTATGCGGTC

ME53NTS ME53NTS:GFP-F TCTAGAATGGAGCGCGATCTACGTATGCA ME53NTS:GFP-R CTGCAGCATAATGTAATTGGTGGA

5


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3

Table 3. Primers for GFP fused ME53 site-directed mutagenesis (point mutations or internal 6

deletions). 7

Gene Name Sequence

ME53(121 E TO A) 121 E TO A-F CATTTCATGAGCGATTTAGCCCGCGACATCA

TGAAAGCC

121 E TO A-R GGCTTTCATGATGTCGCGGGCTAAATCGCTCATGAAATG

ME53(122 R TO A) 122 R TO A-F CATTTCATGAGCGATTTAGAAGCCGACATC

ATGAAAGCCACGC

122 R TO A-R GCGTGGCTTTCATGATGTCGGCTTCTAAATCGCTCATGAAATG

ME53(126 K TO A) 126 K TO A-F GATTTAGAACGCGACATCATGGCCGCCACG

CTAAAATTTTCCAC

126 K TO A-R GTGGAAAATTTTAGCGTGGCGGCCATGATGTCGCGTTCTAAATC

ME53△107-121 ME53(△107-121)GFP-F GCGACAAACTGGATTTCGAACGCGACATCA

TGAAAGCCACG

ME53(△107-121)GFP-R ATGATGTCGCGTTCGAAATCCAGTTTGTCGCTGTACGCGGG

ME53△121-130 ME53(△121-130)GFP-F GCATTTCATGAGCGATTTAAATTACATTATG

GGCTACATAAACAGCAAAG

ME53(△121-130)GFP-R GTAGCCCATAATGTAATTTAAATCGCTCATGAAATGCATACGTAGATCG

ME53△126-140 ME53(△126-140)GFP-F

GAACGCGACATCATGAACAGCAAAGATATGCGCATGACGG

ME53(△126-140)GFP-R GCGCATATCTTTGCTGTTCATGATGTCGCGTTCTAAATCGCTCATG

ME53△138-145 ME53(△138-145)GFP-F CCACCAATTACATTATGCGCATGACGGGCA

AATTTGCAAGC

ME53(△138-145)GFP-R CAAATTTGCCCGTCATGCGCATAATGTAATTGGTGGAAAATTTTAGCG

ME53△159-168 ME53(△159-168)GFP-F

CAGGCCTGTGAAATACCGATGCACCACTTGCAATTATAGATTC

ME53(△159-168)GFP-R GCAAGTGGTGCATCGGTATTTCACAGGCCTGCTTGCAAATTTGC

8


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

4

Table 4. Pairwise comparisons of amino acid similarity (%) and identity(%) (similarity\identity) for 9

ME53 from Group I alphabaculoviruses. 10

AcMNPV PlxyNPV RoMNPV BmNPV ThorNPV MaviNPV CfDEFNPV AgMNPV CfMNPV OpMNPV EppoNPV AnpeNPV HycuNPV

AcMNPV — 98.71 96.03 91.87 78.44 72.21 45.55 44.61 42.53 43.66 43.10 42.91 39.31

PlxyNPV 99.43 — 96.21 91.68 78.82 72.02 45.17 44.23 42.15 43.28 42.72 42.53 39.31

RoMNPV 97.16 97.35 — 89.79 78.07 72.77 45.17 44.42 42.72 43.47 42.91 42.53 39.50

BmNPV 92.81 92.62 90.73 — 76.18 69.18 44.61 44.42 41.39 43.28 43.10 42.15 38.18

ThorNPV 83.93 83.93 83.55 81.09 — 67.10 44.61 44.80 44.04 44.04 43.10 43.28 39.69

MaviNPV 76.74 76.37 76.93 74.66 74.41 — 40.26 40.83 38.56 39.13 39.88 39.5 36.29

CfDEFNPV 56.52 56.52 56.14 55.19 55.76 51.79 — 94.32 62.38 62.38 67.29 60.11 56.14

AgMNPV 55.00 55.00 54.63 54.44 55.00 51.22 95.08 — 62.75 63.32 66.91 60.49 55.95

CfMNPV 53.11 53.11 53.11 52.17 53.68 49.52 72.40 73.34 — 80.34 61.05 62.57 61.81

OpMNPV 53.11 53.11 52.74 52.17 52.93 49.52 72.96 74.48 86.76 — 59.73 64.83 63.70

EppoNPV 52.55 52.55 52.36 52.36 52.55 50.28 75.04 74.66 71.07 69.75 — 58.03 53.49

AnpeNPV 52.36 52.55 51.98 50.28 52.74 49.14 69.56 70.13 74.1 73.15 67.48 — 51.98

HycuNPV 49.33 49.33 49.33 48.39 49.71 46.12 65.02 64.65 68.99 70.13 63.32 61.43 —

11


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

5

Table 5. Pairwise comparisons of amino acid similarity (%) and identity (%) (similarity\identity) for 12

ME53 from Group II alphabaculoviruses and AcMNPV. 13

AcMNPV AgseNPV TnSNPV SfMNPV MacoNPV SeMNPV LsMNPV LdMNPV OrleNPV SpltNPV AdhoNPV HearNPV EcobNPV

AcMNPV — 29.20 25.33 26.69 25.14 24.37 24.17 24.56 22.82 22.82 23.98 21.85 19.72

AgseNPV 36.94 — 58.60 68.47 64.21 64.60 46.42 48.93 44.68 45.45 50.09 47.38 29.78

TnSNPV 34.42 68.27 — 55.31 52.80 50.29 40.61 43.90 41.58 39.45 45.84 43.13 30.36

SfMNPV 33.65 76.2 62.66 — 59.38 68.85 43.32 44.87 42.94 42.16 48.16 43.71 29.98

MacoNPV 33.26 71.56 60.34 66.73 — 54.15 44.87 46.61 43.13 44.68 47.38 47.19 29.78

SeMNPV 32.68 70.01 56.86 74.46 61.50 — 38.87 41.58 38.68 38.49 41.77 41.00 27.85

LsMNPV 32.10 54.15 48.74 50.29 52.41 47.00 — 45.84 38.49 73.11 46.42 50.67 27.27

LdMNPV 31.72 55.89 52.41 52.41 52.99 48.35 52.41 — 51.06 44.29 47.00 43.13 35.78

OrleNPV 31.14 52.80 49.32 50.09 50.09 46.22 45.26 60.54 — 37.13 40.81 39.07 44.10

SpltNPV 30.94 52.41 47.19 49.70 51.25 45.26 79.49 50.29 45.06 — 43.90 48.93 24.95

AdhoNPV 30.75 57.44 52.41 54.73 55.12 48.54 53.19 52.80 47.77 51.64 — 45.06 25.91

HearNPV 29.98 55.51 51.25 51.64 56.47 48.35 58.41 52.22 47.77 56.47 51.45 — 24.56

EcobNPV 28.62 38.29 39.45 36.75 36.55 37.13 34.04 46.42 54.35 32.88 34.04 34.81 —

14


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6

Table 6. Pairwise comparisons of amino acid similarity (%) and identity (%) (similarity\identity) for 15

ME53 from betabaculoviruses and AcMNPV. 16

AcMNPV PlxyGV AgseGV SpliGV CrleGV HearGV CpGV SfGV PhopGV ChocGV AdhoGV EpapGV

AcMNPV — 18.53 16.70 18.94 17.31 15.88 18.12 16.08 17.10 16.49 16.90 11.40

PlxyGV 28.10 — 67.41 61.30 58.85 56.61 58.24 59.47 58.04 57.84 58.04 40.93

AgseGV 26.88 76.17 — 60.28 59.06 54.98 59.87 59.47 59.26 59.87 59.06 42.36

SpliGV 26.88 69.65 68.43 — 58.65 56.41 57.23 62.32 57.23 58.04 57.23 39.71

CrleGV 26.27 67.41 69.04 65.78 — 50.50 80.24 54.98 69.04 69.45 67.00 41.14

HearGV 25.66 63.95 63.74 64.56 58.45 — 50.71 73.52 49.69 49.08 50.10 38.69

CpGV 25.45 66.59 68.63 64.56 85.94 58.85 — 55.80 71.07 71.07 66.59 42.36

SfGV 25.45 67.00 68.83 69.85 62.11 80.24 62.11 — 56.00 53.56 54.37 37.88

PhopGV 24.43 66.80 68.63 65.78 76.37 57.43 78.00 61.91 — 66.59 66.59 41.54

ChocGV 23.42 65.78 69.24 64.35 77.39 58.04 77.80 61.30 75.35 — 66.59 42.76

AdhoGV 23.21 67.00 68.22 64.56 74.33 58.45 74.33 62.72 72.50 74.54 — 41.54

EpapGV 19.34 47.86 50.91 47.65 50.71 48.06 50.50 47.25 48.47 50.91 49.28 —

17


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

nuclear translocation sequence and regions in acmnpv me53

Documents