note that the genetic map is different for men and women recombination frequency is higher in...
TRANSCRIPT
![Page 1: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/1.jpg)
Note that the genetic mapis different for men and women
Recombination frequency is higher in meiosisin women
![Page 2: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/2.jpg)
• The CEPH families were instrumental in constructing the map
• But our goal is to map human diseases
•You rarely get large multi-generational highly informative families
• How do we get to a lod score of 3 with small families?
How do we extend the map to identifying disease genes?
That’s the awesome power of logarithms
![Page 3: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/3.jpg)
Science (2006) 312:279-282
![Page 4: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/4.jpg)
Recall: The small family (5 kids) and Mom (informative) was either:
D
2
d
1
D
1
d
2OR
L = [(0.9)5 + (0.1)5 ]/ 2
(0.5)5
Z = log10 L = 0.97
What if there were no crossovers?
(For one crossover, Z = 0.021, the crossover penalty)
Dd 12 dd 22
dd 12 Dd 22 Dd 22 dd 12Dd 12
![Page 5: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/5.jpg)
Add the lod scores from different families
This is the same as multiplying probabilities
What is the probability of two coin flips and getting two heads?
0.5 x 0.5 = 0.25 (product rule in statistics)
If the same markers are in two different families, then they are independent
4 or 5 small families, and a small number of crossovers, should suffice
Works extremely well for DNA markers, more problematic for diseases
If the disease (phenotype) is caused mutations in either of two genes, then mixing lod scores will confound the analysis (called heterogeneity)
![Page 6: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/6.jpg)
Autosomal Recessive
Use IBD Mapping
Look for homozygous region in affected individuals, Not homozygous in unaffected individuals
IDB preserves the haplotype
Similar principle as Linkage Disequilibrium
Except it is with individuals, not populations
![Page 7: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/7.jpg)
Disequilibrium Mapping
A way to map genes using populations
Instead of using pedigress, use all of the patients
We are interested in haplotypes
GAAAGGAAAAGAAGATTTACTTCC[1396bp]GAAGCTCAGAAAGGCGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAGAATAC
Haplotype 3
GAAAGGAAAAGAAGATTTCCTTCC[1396bp]GAAGCTCAGAAAGGTGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAGAATAC
GAAAGGAAAAGAAGATTTACTTCC[1396bp]GAAGCTCAGAAAGGCGATAATATAAAAAATAT[2502bp]TTGGGAATTTACAAAATAC
2 alleles 2 alleles 2 alleles
Haplotype 2
Haplotype 1
![Page 8: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/8.jpg)
A B C D E
A1 B1 C1 D1 E1
A2 B2 C2 D2 E2
Consider five loci each with two alleles
How Many Haploytpes? A1 B2 C1 D2 E1
A2 B2 C1 D1 E2Individual =
Two haplotypes
In theory there are 25 (32) possibilities IF the combinations are independent
In practice, far fewer (5-10 in sub-Mb distances)
![Page 9: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/9.jpg)
A B C D E
A1 B1 C1 D1 E1
A2 B2 C2 D2 E2
Some SNPs are “old”
Example A1 and A2, D1 and D2 If they are in Hardy Weinberg equilibrium,then 4 haplotypes
A1 D1A1 D2A2 D1A2 D2
A new SNP arises (B2), but in just one haplotype
A1 B2 D1
A1 B1 D1A1 B1 D2A2 B1 D1A2 B1 D2
New Haplotype
WHY?
![Page 10: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/10.jpg)
A1 B2 C1 D1 E1A1 B1 C1 D1 E1A1 B1 C1 D2 E1A2 B1 C1 D1 E1A2 B1 C1 D2 E1
Even later, two new SNPs arise (C2 and E2)
A1 B1 C2 D1 E1
A2 B1 C1 D1 E2
So we end up with a total of 7 haplotypes for 5 SNPs
There is a possibility of recombination between SNPs
However, this is very slow and improbable, especially for short distances
![Page 11: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/11.jpg)
Now consider that a disease mutation arises between C and D
Just like the SNPs, it is likely to have arisen once
And it is in only one of the common 7 haplotypes
Therefore the SNP alleles in that haplotype are correlated with the mutation
This is the principle of DISEQUILIBRIUM MAPPING
It depends on:
1. Age of the mutation
2. Age of the SNPs in the haplotype
3. Age of the population
4. Frequency of recombination (distance between) SNPs
![Page 12: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/12.jpg)
Disequilibrium mapping is particularly useful when:
There is a relatively new disease mutation
Relatively isolated (and hopefully new) population (Finland)
A B C D E
*PopulationAlleleFrequencies
1 0.3 0.2 0.8 0.7 0.22 0.7 0.8 0.2 0.3 0.8
If equilibrium, patients should have same allele frequencies
If disequilibrium, patients should have increased frequencies near the disease gene
The degree of deviation should be maximal near the disease gene
![Page 13: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/13.jpg)
A1 B2 C 1 D2 E1
*
Simple Case:
Autosomal dominant disease arises between C and D of a particular genotype
A Few Generations Later:
Allele Frequencies
Population 0.3 0.8 0.3 0.3 0.2
Patients 1 1 1 1 1
Over time:
(Patients only) 0.6 0.9 1 1 0.9
Later
0.4 0.8 1 1 0.7
![Page 14: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/14.jpg)
Deviation fromPopulationFrequency
Distance along Chromosome
Disease Gene
![Page 15: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/15.jpg)
So this is it……………….
How do we find the gene and the mutation?
We need to make the correlation with the genetic map
(for example distance in cM) to the physical map (DNA)
Most important to have the physical map annotated
![Page 16: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/16.jpg)
Distance along Chromosome
Disease Gene
All methods give a map location(Maximum Likelihood)
![Page 17: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/17.jpg)
Point your browser to genome.ucsc.edu
Identify the genes in the interval
Look for best candidate
Expression data (is the gene expressed in affected tissue?)
Is expression of the gene affected in patients?
Ultimately we must search for mutations
DNA sequencing is best (SSCP is usually done first)
Does the mutation make sense
For example, recessive= loss of function
![Page 18: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/18.jpg)
SNP chips Lots of possibilities
![Page 19: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/19.jpg)
Great Dane x Mexican Chihuahua
F1 Big (Great Danes)
3 Big : 1 Small?
Not Likely………….The sum total of many gene….multigenic
![Page 20: Note that the genetic map is different for men and women Recombination frequency is higher in meiosis in women](https://reader035.vdocuments.us/reader035/viewer/2022062407/56649c7c5503460f94931555/html5/thumbnails/20.jpg)
Many human disorders, conditions and predispositions are multigenic
Twin studies where identical twins are raised together or raised apart
Look at complex behaviors and ask if they are genetic or environment
Answer: For almost every single behavior…..it’s a little of both
“Heritability” or the fraction of the condition that is genetic
But how many genes?
Association studies…..use SNP chips and the awesome power of
Computational Biology