notch sigalling pathway regulates the terminal … · 2018. 7. 25. · shao jin, zhou yinghong,...
TRANSCRIPT
![Page 1: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/1.jpg)
NOTCH SIGALLING PATHWAY
REGULATES THE TERMINAL
DIFFERENTIATION OF
OSTEOBLASTS
Jin Shao
BDS, MDS
Submitted in fulfilment of the requirements for the degree of
Doctor of Philosophy
Institute of Health and Biomedical Innovation
Science & Engineering Faculty
Queensland University of Technology
2018
![Page 2: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/2.jpg)
![Page 3: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/3.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS i
Keywords
Notch, Wnt, bone modelling and remodelling, osteogenesis, osteogenic
differentiation, IDG-SW3 cell line, Hes1, E11, DMP1, Akt, PTEN
![Page 4: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/4.jpg)
![Page 5: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/5.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS iii
Abstract
The osteogenic process contains a series of successive differentiated steps from
BMSCs to osteocytes as the terminal stage of differentiation. Some factors and
signalling pathways play a role in the initiation and early stage differentiation of
osteogenesis, for example, Runx2 has been confirmed as a key transcriptional factor
to initiate osteoblastic differentiation. As the following step, the terminal
differentiation from osteoblasts to osteocytes is also an important physical process in
mediating mineralisation and maintaining the bone strength. However, the
mechanisms that regulate the terminal differentiation are largely unknown. This
thesis aims to fill this knowledge gap by exploring the molecular mechanisms
underlying the terminal differentiation for future application to improve the quality
of bone mineralisation.
First, a candidate signalling pathway, Notch, has been determined as a potential
target because Notch is a highly conserved mechanism in cell fate determination
throughout the animal kingdom and plays a role in terminal differentiation in various
tissues such as skin. In the first part of this thesis, several markers of the Notch
signalling pathway have been chosen to represent signalling intensity.
Immunostaining of Hes1 was conducted in normal rat femur samples as well as in
BMSC osteogenic culture, and the results revealed that osteocytes expressed Hes1
while osteoblasts did not. Also, Hes1, Notch1, and Rbp-jκ were all increased at
transcriptional level. Moreover, a Rbp-jκ luciferase reporter vector was transfected
into the IDG-SW3 cell line, and the luciferase intensity also increased during the late
stage of differentiation. Together, these results suggest that Notch signalling
increases during the transition from osteoblasts to osteocytes, which forces
researchers to reconsider the functions of Notch in osteocytes.
Next, the Notch signalling was inhibited by DAPT to testits role in regulating
osteocytes regarding proliferation, morphology, and mineralisation. FACS based on
the EdU labelled proliferation cells was conducted, and results indicate that Notch
inhibits cell proliferation at a very late stage of differentiation. The data from
![Page 6: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/6.jpg)
ivNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
morphological studies by SEM and immunostaining also suggest Notch plays a role
in the transition from a cubic osteoblast to a dendritic osteocyte. In the mineralisation
aspect, we found that DMP1 expression was decreased after Notch blockage.
Moreover, the mineral structures and mechanical properties were also impacted with
a deficient Notch signalling pathway. Even the intracellular mineral transport
presented abnormal particles that were too small for efficient extracellular mineral
deposit. The results presented in this part reveal the roles of Notch in osteocytes’
phenotype.
Finally, the mechanisms underlying how the Notch signalling pathway regulates the
osteocytes’ functions are discussed. The E11 and DMP1 promotor regions were
cloned into a luciferase reporter vector and two approaches to activate Notch were
utilised in this research: Notch extracellular antibody coating and Hes1 over-
expression vector transfection. The results indicated that Notch directly regulates
E11 expression through Hes1 activity, while it regulates DMP1 through some other
unknown mechanisms. It is of interest that the regulatory function of E11 by Hes1
was not found in the 293T cell line, indicating a cell context-dependent modeof
Notch signalling pathway. Finally, we also found that Notch signalling inhibits Wnt
through directly repressing phosphorylated level of Akt.
In conclusion, this thesis reveals complex functions of Notch in the terminal
differentiation of osteogenesis. The results suggest a potential application of Notch in
the treatment of abnormal bone mineralisation. However, further investigation on
Notch, especially quantitative research on signalling intensity, is favoured before
manipulating Notch in the research and development of the therapeutic applications.
![Page 7: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/7.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS v
Table of Contents
Keywords .................................................................................................................................. i
Abstract ................................................................................................................................... iii
Table of Contents ...................................................................................................................... v
List of Publications ............................................................................................................... viii
List of Conference Presentations ............................................................................................ ix
List of Figures ........................................................................................................................... x
List of Tables .......................................................................................................................... xv
List of Abbreviations ............................................................................................................ xvi
Statement of Original Authorship ........................................................................................... xx
Acknowledgements .............................................................................................................. xxii
Chapter 1: Introduction ...................................................................................... 1
1.1 Background ..................................................................................................................... 1
1.2 Hypothesis and aims ....................................................................................................... 2
1.3 Significance .................................................................................................................... 2
1.4 Thesis outline .................................................................................................................. 3
Chapter 2: Literature Review ............................................................................. 5
2.1 Introduction .................................................................................................................... 5
2.2 Transition from osteoblasts to osteocytes ....................................................................... 5
2.3 The environment of osteocyte residence and network behaviour ................................... 9
2.4 Mineralisation process inducted by osteocyte .............................................................. 10
2.5 The core Notch pathway: components and regulatory mechanisms ............................. 13
2.6 Notch regulates cell proliferation ................................................................................. 20
2.7 Notch in osteogenesis ................................................................................................... 23
2.8 Signalling crosstalk with Notch .................................................................................... 26 2.8.1 Notch and Wnt ..................................................................................................... 26 2.8.2 Notch and BMP ................................................................................................... 27 2.8.3 Notch and TGF-β ................................................................................................. 28 2.8.4 Notch and Hypoxia-Inducible Factor (HIF)-1 ..................................................... 29
2.9 In vitro and in vivo models for studying osteocytes ..................................................... 30
2.10 Summary and Implications ........................................................................................... 32
Chapter 3: Research Part One .......................................................................... 33
3.1 Abstract ......................................................................................................................... 37
3.2 Introduction .................................................................................................................. 37
3.3 Materials and methods .................................................................................................. 39 3.3.1 Immunohistochemistry ....................................................................................... 39 3.3.2 Immunofluorescence .......................................................................................... 39
![Page 8: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/8.jpg)
viNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
3.3.3 Cell culture ......................................................................................................... 40 3.3.4 Western blot ....................................................................................................... 41 3.3.5 Quantitative reverse transcription polymerase chain reaction (RT-qPCR) ....... 41 3.3.6 Rbpj luciferase reporter assay ............................................................................ 42 3.3.7 Statistical analysis .............................................................................................. 42
3.4 Results .......................................................................................................................... 42 3.4.1 Osteocytes express high levels of Notch signalling related markers ................. 42 3.4.2 Wnt signalling is downregulated during osteocyte formation ........................... 46
3.5 Discussion .................................................................................................................... 47
3.6 Conclusions .................................................................................................................. 49
Chapter 4: Research Part Two ......................................................................... 51
Principal Supervisor Confirmation ........................................................................ 53
4.1 Abstract ........................................................................................................................ 55
4.2 Introduction .................................................................................................................. 55
4.3 Materials and methods ................................................................................................. 57 4.3.1 Immunohistochemistry ...................................................................................... 57 4.3.2 Immunofluorescence .......................................................................................... 57 4.3.3 Cell culture ......................................................................................................... 58 4.3.4 siRNA knockdown ............................................................................................. 59 4.3.5 EdU labelling and FACS ................................................................................... 59 4.3.6 Western blot ....................................................................................................... 59 4.3.7 Quantitative reverse transcription polymerase chain reaction (RT-qPCR) ....... 60 4.3.8 SEM ................................................................................................................... 60 4.3.9 TEM ................................................................................................................... 61 4.3.10 AFM ................................................................................................................... 61 4.3.11 Calcium concentration ....................................................................................... 61 4.3.12 Statistical analysis .............................................................................................. 61
4.4 Results .......................................................................................................................... 62 4.4.1 Notch inhibits proliferation of late osteoblasts .................................................. 62 4.4.2 Notch is required for cell mediated mineralisation ............................................ 66 4.4.3 Notch plays a role in the morphological change from osteoblasts to
osteocytes ........................................................................................................... 73
4.5 Discussion .................................................................................................................... 77
4.6 Conclusions .................................................................................................................. 80
Chapter 5: Research Part Three ....................................................................... 81
5.1 Abstract ........................................................................................................................ 85
5.2 Introduction .................................................................................................................. 85
5.3 Materials and methods ................................................................................................. 88 5.3.1 Cell culture ......................................................................................................... 88 5.3.2 Vector construction and plasmid transfection .................................................... 88 5.3.3 Notch activation ................................................................................................. 89 5.3.4 Luciferase assay ................................................................................................. 89 5.3.5 Western blot ....................................................................................................... 90 5.3.6 Immunofluorescence .......................................................................................... 90
5.4 Results .......................................................................................................................... 91 5.4.1 Notch signalling pathway directly regulates E11 expression through Hes1
activity. .............................................................................................................. 91
![Page 9: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/9.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS vii
5.4.2 Notch signalling pathway regulates DMP1 expression in a Hes1 independent manner ........................................................................................... 93
5.4.3 The switch of Wnt to Notch in osteocytes formation is mediated by Akt and PTEN ........................................................................................................... 95
5.5 Discussion ................................................................................................................... 100
5.6 Conclusions ................................................................................................................ 103
5.7 Supplements ................................................................................................................ 104
Chapter 6: Conclusions and Discussion ......................................................... 107
6.1 Research summary ...................................................................................................... 109
6.2 Discussion ................................................................................................................... 110
6.3 Limitations .................................................................................................................. 114
6.4 Future implications ..................................................................................................... 115
References ............................................................................................................... 123
![Page 10: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/10.jpg)
viiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
List of Publications
The following is a list of submitted manuscripts that are derived from the work
performed in this thesis:
1. Shao Jin, Zhou Yinghong, Lin Jinying, Friis Thor, Crawford Ross, Xiao
Yin. (2017) Notch expressed by osteocytes plays a critical role in
mineralisation. Journal of International Molecular Medicine. Submitted.
2. Shao Jin, Zhou Yinghong, Xiao Yin. (2017) The molecular mechanisms
underlying the regulatory functions of Notch signalling during the terminal
differentiation of osteoblasts. Bone. Summitted.
3. Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision.
(2017) Molecular Aspects of Medicine (Review)
The following is a list of publications that are not related to the work
performed in this PhD thesis but published during the PhD candidature:
1. Shi Mengchao, Zhou Yinghong, Shao Jin, Chen Zetao, Song Botao, Chang
Jiang, Wu Chengtie, Xiao Yin. (2015) Stimulation of osteogenesis and
angiogenesis of hBMSCs by delivering Si ions and functional drug from
mesoporous silica nanospheres. Acta Biomaterialia, 21, pp. 178–189.
2. Li Shuigen, Shao Jin (Co-first author), Zhou Yinghong, Friis Thor, Yao
Jiangwu, Shi Bin, Xiao Yin. (2016) The impact of Wnt signalling and
hypoxia on osteogenic and cementogenic differentiation in human
periodontal ligament cells. Molecular Medicine Reports, 14, pp. 4975–4982.
![Page 11: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/11.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS ix
List of Conference Presentations
1. Shao Jin, Zhou Yinghong, Xiao Yin. The impact of Wnt signaling and
hypoxia on cementgenesis. 93rd International Association for Dental
Research (IADR) General Session. Oral presentation. (Boston, USA;
03/2015)
2. Shao Jin, Zhou Yinghong, Crawford Ross, Xiao Yin. Temporal expression
of Notch signalling regulates the transition from osteoblasts to osteocytes.
Institute of Health and Biomedical Innovation Inspire Conference. Oral
presentation. (Brisbane, Australia; 11/2015)
3. Shao Jin, Zhou Yinghong, Crawford Ross, Xiao Yin. Notch expressed by
osteocytes plays a critical role in mineralisation. 16th Australasian
BioCeramic Symposium. Oral presentation. (Brisbane, Australia; 12/2016)
![Page 12: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/12.jpg)
xNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
List of Figures
Figure 1: Transition from osteoblasts to osteocytes. Certain osteoblasts that are decided to become osteocytes stop proliferation and matrix secretion, then are buried in the matrix. Meanwhile, the cells present morphological alteration in term of generation of dendritic processes. As the dendrites elongate, the cells establish contact with deeper embedded osteocytes. ..................................................................................... 8
Figure 2: DMP1 mediates cell based mineralisation. ................................................. 12
Figure 3: The interaction between Notch receptors and ligands. ............................... 15
Figure 4: Models of supposed contact dimensions alter Notch signalling. ................ 17
Figure 5: Nuclear events in the regulation of Notch signalling. ............................... 19
Figure 6: Scheme of skin renewal. ............................................................................. 22
Figure 7: Summary of previous gene modification research on Notch signalling in osteogenesis. ............................................................................................ 25
Figure 8: Immunohistochemistry staining of Hes1 in rat femur. ............................... 43
Figure 9: Immunofluorescence staining of Hes1 in rBMSCs in the osteogenic culture of 7 days and 14 days. The rBMSCs cultured in osteogenic conditions for 14 days representing late differentiation stage expressed a high level of Hes1. The bar graph displays the ratio of Hes1 positive cells. The number of Hes1 positive cells significantly increased in osteogenic differentiation at 14 days compared with 7 days. n=3. * p < 0.05, unpaired Student’s t test, comparisons between day 7 and day 14. Scale bar: 50 μm. ............................................................................. 43
Figure 10: Western blots of Hes1 and β-catenin in rBMSCs and IDG-SW3 cell line. ............................................................................................................... 45
Figure 11: RT-qPCR results showed the transcription of Hes1, Notch1, and Rbpj all increased during differentiation. n=3 wells per group. * p < 0.05, compared with day 1 (one-way ANOVA with Bonferroni post hoc test). ............................................................................................... 46
Figure 12: Luciferase reporter assay showed Rbpj activity also increased during the differentiation of IDG-SW3 cell line. n=3 wells per group. ** p < 0.01, compared with day 1 (one-way ANOVA with Bonferroni post hoc test). ............................................................................................... 46
Figure 13: Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture. .......................................................................................................... 47
Figure 14: Ki-67 and PCNA immunohistochemistry staining of rat femur samples. ........................................................................................................ 62
Figure 15: EdU labelled rat BMSC in osteogenic culture. ......................................... 63
Figure 16: FACS based on EdU labelled BMSCs in osteogenic culture. .................. 64
![Page 13: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/13.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xi
Figure 17: FACS based on EdU labelled BMSCs and MC3T3 cell line in normal culture after 3 days. Inhibition of Notch by adding DAPT in normal culture medium caused decreases of proliferation from 33.7% to 29% in rat BMSCs and 26.9% to 16.6% in MC3T3 cell line. These results indicated an opposite function of Notch on proliferation at the early differentiation stage. ........................................................................... 66
Figure 18: Western blots showed IDG-SW3 cell line expressed DMP1. .................. 67
Figure 19: Live cell fluorescent images showed GFP activity representing DMP1 expression gradually increased during IDG-SW3 cell osteogenic differentiation. The increasing concentration of DAPT added into the culture system led to a gradual decrease of GFP intensities. And when the concentration of DAPT reached 50μM, the GFP was nearly eliminated. Scale bar: 50 μm. ............................................ 68
Figure 20: RT-qPCR results showed the transcription of Hes1, Notch1, DMP1, and E11 after Hes1 expression was intefered by siRNA targeting Hes1 after 3 days of treatment. Control represents normal IDG-SW3 cells, siRNA represents IDG-SW3 cells transfected with universal negative control siRNA, siRNA represents IDG-SW3 cells transfected with siRNA targeting Hes1. n=3 wells per group. * p < 0.05, comparison made between each two groups. (unpaired Student’s t test). There was no significant change between control and negative siRNA groups. .......... 69
Figure 21: IDG-SW3 cells formed mineralised nodules shown by von Kossa staining and TEM images. IDG-SW3 cells (–DAPT) formed more mineralised nodules compared with a group of (+DAPT) as shown by von Kossa staining. TEM images showed (–DAPT) minerals (upper: A, B, and C) were penetrated into and closely related to collagen fibrils (red arrow), while (+DAPT) minerals (lower: D, E, and F) were deposited on the surface of collagen, and it was difficult for the mineral to infiltrate into the gap zone of the collagenous fibrils (red arrow). .......................................................................................................... 70
Figure 22: TEM images of IDG-SW3 showing intracellular mineral particles. ........ 71
Figure 23: SAED analysis revealed the crystal structure of mineral nodules. ........... 72
Figure 24: Binding force assay. ................................................................................. 73
Figure 25: E11 is an osteocyte marker. ...................................................................... 74
Figure 26: E11 expression at both protein and RNA levels. ...................................... 75
Figure 27: Morphological characteristics of IDG-SW3 cells. ................................... 76
Figure 28: Western blot of Hes1 to confirm the effects of both Notch-activating approaches. Both Notch1 antibody coated and Hes1 overexpression vector transfection methods were effective to activate Hes1 expression. And the Hes1 overexpression approach presented a stronger effect. .......... 92
Figure 29: The mechanisms of Notch in regulating the expression of E11 and DMP1. A: The plasmid maps of the Hes1 overexpression vector, TetO-FUW-Hes1, and the luciferase reporter vectors, E11-pGluc basic 2 and DMP1-pGluc basic 2. B: The luciferase assay using the E11-pGluc-Basic 2 vector transfected into the IDG-SW3, MC3T3, and
![Page 14: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/14.jpg)
xiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
293T cell lines. C: The luciferase intensity after a co-transfection with the Hes1 overexpression vector significantly increased in both the IDG-SW3, MC3T3-E1, and 293T cell lines. n=3. P value as indicated, unpaired Student’s t test, comparisons between the Notch activation groups and the control groups, respectively. ................................................ 92
Figure 30: The expressions of DMP1 and E11 at both the RNA and protein levels. Antibody-induced Notch activation (A–C) caused the upregulation of both DMP1 and E11 at both the RNA and protein levels. However, the overexpression of Hes1 (D–F) only triggered E11 expression. n=3. * p < 0.05, unpaired Student’s t test, comparisons between Notch activation groups and control groups, respectively. ................................................................................................. 94
Figure 31: A, B: The expression of DMP1 was directly observed by a fluorescence microscope in live IDG-SW3 cells. GFP could only be observed when Notch was activated by the extracellular antibody (F), but not when Hes1 was overexpressed (D). Scale bar: 50 μm. C, D: The luciferase intensity of DMP1-pGluc-Basic 2 in the IDG-SW3 cell line increased only when Notch was activated by the extracellular antibody (G), while the overexpression of Hes1 did not sufficiently induce DMP1 expression (E). n=3. P value as indicated, unpaired Student’s t test, comparisons between the Notch activation groups and control groups, respectively. ........................................................................ 95
Figure 32: Western blots of β-catenin and Hes1 in the IDG-SW3 cell line osteogenic culture, with the supplementation of either LiCl or DAPT. The expression of β-catenin increased when Notch was inhibited, indicating a functional antagonism between these two signalling pathways. ...................................................................................................... 96
Figure 33: A: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the IDG-SW3 cell line under normal osteogenic condition and Notch inhibition with DAPT for 21 days. B: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the IDG-SW3 cell line plated on the Notch extracellular antibody (left) and IgG (right). The phosphorylation of Akt at the serine 473 site was inhibited by the Notch extracellular antibody. On the other hand, activating Notch by an extracellular antibody inhibited the phosphorylation of Akt at the serine 473 site, leading to the activation of GSK-3β and β-catenin degradation. ..................................................................................... 97
Figure 34: The crosstalk between the Notch and Wnt signalling pathways in rBMSCs. A: Immunofluorescence staining of β-catenin and Hes1 in osteogenically differentiated rBMSCs on day 14. The results showed that more cells expressed β-catenin after Notch blockade. Scale bar: 50 μm. B, C: The Wnt and Notch signalling exhibited an antagonist relationship at the late differentiation stage of the rBMSCs since blocking Notch enhanced β-catenin (B), and the activation of Wnt inhibited Hes1 expression (C). ..................................................................... 98
Figure 35: Immunofluorescent staining of β-catenin in the IDG-SW3 cell line. In the control groups (D–F), β-catenin was mainly expressed in the
![Page 15: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/15.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xiii
nucleus. When Notch was activated by the extracellular antibody (A–C), β-catenin was translocated into the cytoplasm (as indicated by white arrows) where it has no function. Scale bar: 10 μm. .......................... 99
Figure 36: The relationship between Notch and Wnt in non-osteogenic rBMSCs. A–F: Immunofluorescent staining of β-catenin in rBMSCs in normal culture. In the control groups (A–C), β-catenin was mainly expressed in the nucleus as indicated by the white arrows. When Notch was inhibited by adding DAPT (D–F), β-catenin was translocated into the cytoplasm where it has no function (as indicated by the white arrows). Scale bar: 30 μm. G: Western blots of the phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt in the rBMSCs in normal culture. ..................................... 100
Figure 37: Statistical analysis of Western blot. ........................................................ 105
Figure 38: Schematic of the U-shaped Notch expression pattern during osteogenesis. In BMSC, Notch maintains the pool of stem cells, and it is required to be downregulated to initiate osteogenic differentiation. During terminal differentiation, Notch is increased again to alter the cubic, amplifying. and matrix secretion osteoblasts to the dendritic, static, and mediating mineralisation osteocytes. ........................................ 109
Figure 39: The schematic shows a potential mechanism in osteoblast fate determination. 1, 2: The connection between osteoblasts is stable and broad, while the contact area between osteoblast and osteocyte is limited due to the dendritic morphology of osteocyte. 3: Osteocytes send burst Notch signalling to the osteoblasts committed to osteocytes according to the reports in a quantitative study of Notch signalling intensity that the limited connection presents burst Notch signalling. 4: Then, the increased Notch enhances the E11 expression through Hes1 activity and promotes DMP1 expression through some unknown mechanisms. E11 plays a role in dendrite formation and DMP1 mediates ordered extracellular mineralisation. NICD also prevents the nuclear translocation of β-catenin; therefore, it inhibits the β-catenin transcriptional activity. The intracellular β-catenin may also combine to E-cadherin to support the generation of cell processes. ......................... 110
Figure 40: Lateral induction and inhibition mechanisms in the transition from osteoblasts to osteocytes. When lateral induction (upper) mechanism is activated, osteoblasts induce surrounding cells to express the same pattern of ligands, thereby keeping the coordinated tempo in cells activities, here, all osteoblasts have the same phenotype and functions-secreting bone matrix. If the committed osteoblasts (red cubic cells in bottom) receive stimulation from osteocytes, they will express unique pattern of ligands and inhibit neighbours to express the same one, leading them maintain osteoblastic phenotype. It is of great interest that the committed cell will differentiate to osteocyte and after it generates new dendrites, it will recruit the next committed osteoblasts, in other words, attract neighbours to adopt the same fate. This transform indicates the topology of cell-to-cell contact has a profound impact on the Notch signalling regulation. ................................................ 117
![Page 16: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/16.jpg)
xivNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
Figure 41: Models of supposed contact dimensions alter Notch signalling. The ligands of Notch signalling present a dynamic behaviour in nature. They diffuse on the cell membrane before engagement with receptors and endocytosis. In the context that a dendritic signals sending cell contact to cubic signals receiving cell (upper), ligands will diffuse a long distance before endocytosis. Hence, the signals intensity is depended on the amount and convergence of ligands diffusion. When two cubic cells contact (bottom), the ligands diffuse a short distance before combination with receptors, in this scenario, the signals intensity is proportional to the contact area. .............................................. 119
![Page 17: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/17.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xv
List of Tables
Table 1: The primers for RT-qPCR ........................................................................... 42
Table 2: The primers for RT-qPCR ........................................................................... 60
![Page 18: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/18.jpg)
xviNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
List of Abbreviations
4', 6-diamidino-2-phenylindole DAPI
5-ethynyl-2´-deoxyuridine EdU
activator protein-1 AP1
adenomatosis polyposis coli APC
atomic-force microscopy AFM
basic helix-loop-helix bHLH
bone marrow stromal cell BMSC
bone morphogenetic protein BMP
bone sialoprotein BSP
bovine serum albumin BSA
C promoter-binding factor CBF
CBF1/Suppressor of Hairless/LAG-1 CSL
cyclin-dependent kinases CDK
Delta-like DLL
Delta-Serrate-LAG2 DSL
dentin matrix acidic phosphoprotein 1 DMP1
dentin sialophosphoprotein DSPP
diaminobenzidine DAB
dickkopf Dkk
![Page 19: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/19.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xvii
dimethyl sulfoxide DMSO
double-distilled water ddH2O
Dulbecco’s modified eagle medium DMEM
endoplasmic reticulum ER
epidermal growth factor EGF
ethylenediaminetetraacetic acid EDTA
fetal bovine serum FBS
fibroblast growth factor FGF
fluorescence assisted cell sorting FACS
glycogen synthase kinase-3β GSK-3β
green fluorescent protein GFP
hairy and enhancer of split-1 Hes1
hairy and enhancer of split related with YRPW motif 1 Hey1
human papillomavirus HPV
immunohistochemistry IHC
immunofluorescent IF
interferon-γ IFN-γ
Jagged JAG
longevity-assurance gene-1 LAG-1
mammalian achaete-scute homologue Mash1
mastermind-like MAML
![Page 20: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/20.jpg)
xviiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
matrix extracellular phosphoglycoprotein MEPE
membrane-type matrix metalloproteinase MT1-MMP
minimum essential medium MEM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine DAPT t-butyl ester
Notch intracellular domain NICD
nuclear factor kappa-light-chain-enhancer of activated NF-κB B cells
osteopontin OPN
paraformaldehyde PFA
phosphatase and tensin homologue PTEN
phosphatidylinositol 3- kinase PI3K
phosphatidylinositol 3,4,5-trisphosphate PIP3
phosphatidylinositol 4,5-bisphosphate PIP2
phosphate-buffered saline PBS
phosphate-regulating neutral endopeptidase, X-linked PHEX
poly adenosine diphosphate–ribose polymerase-1 PARP1
proliferating cell nuclear antigen PCNA
protein kinase B Akt
quantitative reverse transcription polymerase qRT-PCR chain reaction
receptor tyrosine kinase RTK
recombination signal binding protein for Rbp-jκ immunoglobulin kappa J region
runt-related transcription factor 2 Runx2
![Page 21: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/21.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xix
scanning electron microscope SEM
sclerostin SOST
selected area electron diffraction SAED
small integrin-binding ligand N-linked glycoprotein SIBLING
sodium dodecyl sulfate polyacrylamide gel electrophoresis SDS-PAGE
Sonic Hedgehog SHH
T-cell acute lymphoblastic leukaemia T-ALL
T-cell factor TCF
transforming growth factor - β TGF- β
transmission electron microscopy TEM
Wingless-related integration site Wnt
![Page 22: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/22.jpg)
xxNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
Statement of Original Authorship
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To the
best of my knowledge and belief, the thesis contains no material previously
published or written by another person except where due reference is made.
Signature: QUT Verified Signature
Date: June 2018
![Page 23: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/23.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xxi
![Page 24: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/24.jpg)
xxiiNOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS
Acknowledgements
I would like to express a deep felt appreciation and thanks to my supervisor,
Professor Yin Xiao; you have been a tremendous mentor for me. I would like to
thank you for enlightening my research inspirations and supervising my whole PhD
projects. Your support and encouragements have been priceless. I would also like to
thank my team supervisor, Professor Ross Crawford, for your insightful comments
and encouragements, but also for the hard questions at Bone Group meetings, which
gave me the incentive to widen my research. I am indebted to associate supervisor Dr
Yinghong Zhou and want to thank you for letting my research be an enjoyable
journey, and for your brilliant ideas and suggestions.
My sincere thanks also go to all the former and current members of the Bone Group,
especially Dr Thor Friis; thank you for your positively involvement with my cloning
project and detailed instructions on how to make experimental plans and records. I
would also like to thank you for your contribution in editing manuscripts of both
research papers and this thesis. And Dr Zhibin Du, Mr Qiliang Zuo, Ms Jinying Lin,
and Ms Shifeier Lu, thank you for your excellent work in the SEM and TEM areas;
your fundamental exploration rendered my morphological study proceeding
smoothly. Thanks to Ms Wei Shi; thank you for your careful guidance and
instruction on histology and immunostaining. Thanks to Dr Xufang Zhang and Dr
Pingping Han for tutoring me in lab skills. Warm thanks to Mr Patrick Lau and Ms
Inga Mertens-Walker, for their contribution to the experimental design and assistance
in my difficult cloning project. Thanks to kind and considerate Dr Indira Prasadam,
who was the first person who showed me around the lab when I first arrived. I must
also mention Dr Zetao Chen, Dr Xin Wang, Dr Nishant Chakravorth, Dr Anjali
Jaiprakash, Dr Saba Farnaghi, Mr Sunderajhan Sekar, Ms Rong Huang, Dt. Lan Xiao,
Dr Wei Fei, Ms Lingling Chen, Ms Antonia Sun, Mr Shengfang Wang, and Mr Akoy
Akuien; thank you for your companionship and for sharing experiences together
during an important and precious period of my life.
My sincere thanks go to Dr Leonore de Boer, Dr Jeremy Baldwin, Dr Christina
Theodoropoulos, Dr Jiongyu Ren, and other IHBI staff including Mr David Smith,
![Page 25: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/25.jpg)
NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL DIFFERENTIATION OF OSTEOBLASTS xxiii
Mr Dod Roshanbin, Mr Robert Smeaton, and Mr Scott Tucker for your help in
experimental procedures.
I would also like to express gratitude to Professor Jerry Feng from the Texas A&M
University Baylor College of Dentistry. Thank you for your kind gift of IDG-SW3
cell line and antibodies.
I would like to take this opportunity to thank my GP, Dr Kennedy from QUT
medical centre, and endocrine specialist, Dr Duncan from Royal Brisbane Women’s
Hospital. Thanks for your patience and professional advice to my medical condition
arising from a tumour of the pituitary gland. Thank you for taking care of me, letting
me get through the stressful time.
I would also like to acknowledge the tuition fee waiver from QUT.
Professional editor, Robyn Kent, provided copyediting and proofreading services,
according to the guidelines laid out in the university-endorsed national ‘Guidelines
for editing research theses’. I acknowledged his contribution to this thesis.
At last, I dedicate this thesis to my wife, Ms Lili Huang, for your love, patience, and
understanding that allowed me to spend most of my time on this thesis. Also, thanks
to my parents for their utmost tolerance and support.
![Page 26: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/26.jpg)
![Page 27: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/27.jpg)
Chapter 1: Introduction 1
Chapter 1: Introduction
1.1 BACKGROUND
The skeleton supports stature and locomotion, provides protection to various organs,
and regulates mineral homeostasis, especially calcium and phosphate. The skeleton
itself is vulnerable to trauma, particularly if it of poor quality. Figures from
Osteoporosis Australia show there was one bone fracture every 3.6 minutes in
Australia in 2013. By 2022, there will be one fracture every 2.9 minutes [1].
Moreover, a variety of congenital and progressive diseases can affect the health of
bone, including rickets, osteoporosis, and osteopetrosis [2, 3].
The skeleton conducts modelling during development and remodelling throughout its
whole life. Remodelling removes old or bad bone and replaces it with new bone [4].
Normal remodelling is required for the bone to adapt to mechanical loading and
resist traumatic insult [5]. Innumerable studies have been conducted to explore the
process of bone development and promote bone regeneration. It has been well
established that osteoblasts derived from bone marrow stromal cells secrete organic
collagen, which buries osteoblasts to form a new cell type, osteocytes. More and
more recent research has proved that it is osteocytes that mediate the mineralisation
of collagen, rather than osteoblasts [2, 6]. However, answers to some fundamental
questions are still largely unknown, such as the regulatory mechanisms of
mineralisation and the transition from osteoblasts to osteocytes.
The Notch signalling pathway is a highly conserved signalling system in most
multicellular organisms [7]. There are only four receptors (Notch 1–4) and five
ligands (Delta-like 1, 3 ,4 and Jagged 1, 2) working for this signalling pathway in
mammals, and all receptors and ligands are bound to the cell membrane. Engaged
receptors with ligands lead to the release of the intracellular domain, which further
translocates into the nucleus to regulate target gene expression [8]. Despite quite a
simple constitution, Notch presents complexity in functional output [9, 10]. The
intensive and fundamental functions in cell fate determination render Notch an ideal
candidate to be tested in the osteoblasts’ fate decision.
![Page 28: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/28.jpg)
2 Chapter 1: Introduction
In past decades, Notch was deemed an oncogene related to abnormal proliferation of
stem cells [11]. Hence, little attention was paid to Notch functions in differentiated
cells or even terminally differentiated cells such as osteocytes. Until recently, limited
studies revealed the possibility that Notch is highly expressed by osteocytes as well
[12, 13]. However, the specific functions and regulatory mechanisms still need to be
addressed.
1.2 HYPOTHESIS AND AIMS
Based on the epigenetic evidence issued in 2014, a downstream target effector of
Notch, Hey1, was upregulated more than ten-fold during the transition from
osteoblasts to osteocytes [12]. First, we boldly assumed that Notch plays a critical
role in this transition as well as in the normal functions of osteocytes. To test the
hypothesis, more solid evidence is preferred to confirm the high level of expression
of Notch in osteocytes. Second, Notch will be artificially blocked or activated to test
the impact on osteocyte function, regarding proliferation, morphology, and
mineralisation. Last but not least, we will explore the mechanism mediating this
signalling intensity change.
The specific aims of this thesis are summarised as follows:
Aim 1: To confirm the Notch signalling pathway is upregulated during the terminal
differentiation of osteoblasts towards osteocytes;
Aim 2: To evaluate the impacts on cell proliferation, morphological characteristics
and mineralisation after manipulating Notch signalling;
Aim 3: To explore the mechanisms that regulate activity of Notch signalling.
1.3 SIGNIFICANCE
This thesis clarifies the physical changes of the Notch signalling pathway during the
terminal differentiation of osteoblasts, which provides an explanation of the
controversial views of Notch’s functions in osteogenesis. Exploring the mechanisms
by which Notch regulates osteocytes gene expression will help to establish a new
therapeutical approach to treating osteocytes or mineralisation-related diseases by
precisely manipulating Notch both spatially and temporally.
![Page 29: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/29.jpg)
Chapter 1: Introduction 3
1.4 THESIS OUTLINE
The thesis was designed as three consecutive sections, based on the results reported
by two research papers. The detailed methodology, results, and discussion are
contained in the corresponding chapters.
Section 1: To address aim 1, confirmed the Notch signalling pathway is upregulated
during the terminal differentiation of osteoblasts. (Chapter 3)
In this section, Hes1 was chosen to represent the Notch signalling intensity, and the
expression of Hes1 was tested by immunohistochemistry staining,
immunofluorescent staining, Western blot, and qRT-PCR. The samples included rat
femur, rat BMSC, and IDG-SW3 cell line. Then, we transfected the IDG-SW3 cell
line with Rbp-jκ luciferase reporter to monitor the activity of Notch signal
transduction pathways. Rbp-jκ is necessary for the Notch transcriptional complex
and is a direct modulator of Notch signalling.
Related results were contained as a part of both research papers.
Section 2: To address aim 2, evaluated the impacts on cell proliferation,
morphological characteristics, and mineralisation after artificially blocking or
activating Notch signalling. (Chapter 4)
DAPT was added into the culture medium with both the rat BMSC and IDG-SW3
cell line. Significant abnormal mineralisation was observed through mineral staining,
DMP1 expression test, SEM, TEM, and AFM. The proliferation rate and cell
morphological parameters were changed as well. Then, Notch extracellular antibody
and Hes1 overexpression vector were applied to activate Notch signalling in the
IDG-SW3 cell line. It was found that Hes1 directly regulated the expression of the
earliest osteocytes marker, E11, highly suggesting that Notch signalling contributes
to the osteocyte’s phenotype. Notch was also found to regulate the level of DMP1
expression, although through some unknown downstream factors.
Related results were contained as a part of both research papers.
Section 3: To address aim 3, explored the mechanisms underlying the regulatory
functions of Notch signalling. (Chapter 5)
![Page 30: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/30.jpg)
4 Chapter 1: Introduction
In this section, two luciferase reporter vectors were constructed using E11 and DMP1
promotor regions respectively for further transfection experiments. The results
suggest Notch directly regulates E11 expression through Hes1 activity. As the Notch
signalling was upregulated during the terminal differentiation of osteoblasts, the
intensity of Wnt signalling was decreased. Hence, the crosstalk between Notch and
Wnt signalling pathways may control the signalling switch. To figure out how the
connection between Notch and Wnt signalling pathways was established, we tested a
series of relevant protein kinases activities in normal differentiation conditions or in
signal-modified conditions. The phosphorylation of Akt emerged as the bridge
linking these two signalling pathways.
Related results were contained as a part of both research papers.
A summary of all the studies is contained in Chapter 6, which includes further
discussion and the limitations of the current study. The proposal of future
implications is also raised in this chapter. A review that focuses on Notch signalling
in osteocytes has been generated based on a comprehensive literature review and our
experiment data.
![Page 31: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/31.jpg)
Chapter 2: Literature Review 5
Chapter 2: Literature Review
2.1 INTRODUCTION
Regulating diversity among differentiated cell types in development involves a
relatively small number of highly evolutionarily conserved signalling pathways,
including Wnt [14], Hedgehog [15], bone morphogenetic proteins (BMPs) [16, 17],
phosphatidylinositol 3-kinase (PI3K) [18], and Notch [19], all of which are the
subject of this review. Each of these pathways receives extracellular information and
relays it into the interior through specific control of transcriptional activities. Among
those signalling pathways, Notch is regarded as a simple one because it has a limited
number of components in signal cascade [8]. Although it has simple components,
Notch has pleiotropic actions in cell proliferation, apoptosis, and activation of
differentiation programmes in a large range of cell types and organs from the brain to
the skin in a cell context-dependent manner [9, 20]. However, there is a lack of clear
evidence that can be shown to draw a conclusion of Notch actions in bone modelling
and remodelling.
In the development of bone, osteoblastic lineage represents a continuous
differentiation process from bone marrow stromal cells (BMSC) towards osteoblasts,
the bone formation cells. Furthermore, osteoblastic lineage has three terminal
consequences: osteocytes, bone lining cells, and apoptosis [21]. The cell fate
determination is regulated by a complex network of signalling pathways, among
which Notch may become a potential mechanism that plays dominant roles [12, 13].
In this review, we try to summarise recent findings on Notch expression and function
in bone tissue and discuss the direction for future research.
2.2 TRANSITION FROM OSTEOBLASTS TO OSTEOCYTES
It is well accepted that osteocytes are derived from osteoblasts and that mature
osteocytes represent a terminal development stage of the osteogenic cells. There are
three potential fates of a mature osteoblast: apoptosis; becoming a bone lining cell,
which is a quiescent cell on the bone surface; and embedded in osteoid to begin a
new life as an osteocyte. The transition process of osteoblasts to osteocytes can be
![Page 32: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/32.jpg)
6 Chapter 2: Literature Review
defined as several different stages from early osteocytes to mature osteocytes that are
deeply embedded in a bone matrix, more specifically, in the spaces named lacunae
and canaliculi [6, 21]. During this transition, the committed osteoblast experiences a
series of substantial changes [22]. First, as it is determined to be an osteocyte, the
cell loses its proliferation capacity due to the limited space enclosed by bone matrix.
Second, the cell generates multiple slender processes (50–60 per cell) with the
appearance of a stellate cell, rather than a cubic cell [23]. These cell processes radiate
through the canaliculi system to deliver and receive signals and materials to and from
surrounding cells. In addition, the generation of dendrites is polarised, which is
characterised as the dendrites are first generated at the contact area between
osteoblasts and osteocytes, followed by arborisation of dendrites towards the bone
surface. [24] Third, the osteoblast produces organic collagen, while osteocytes
secrete minerals on the collagenous frame. In a gene array study, it was reported that
of the 20,754 genes expressed by the osteoblasts and osteocytes tested in the screen,
4,496 genes had been altered during the transition. These data showed that
osteoblasts and osteocytes share significant common features as well as presenting
unique phenotypes. It is of interest that Hey1 gene, a Notch-related transcriptional
factor, was upregulated more than ten-fold–the first direct evidence that osteocytes
had high Notch expression. Furthermore, all the genes related to cell cycle were
down-regulated during the transition, which suggested that Notch impeded cell
proliferation in osteocytes, unlike its role in the mesenchymal stem cells and early
differentiated osteoblasts [12].
Osteocytogenesis has long been regarded as a passive process. It is believed that
osteoblasts are passively buried by osteoid, which the cells themselves secrete.
However, some morphological research found that osteocytes present highly
organised formation in bone matrix, which indicates that osteocytogenesis is a finely
regulated and active process rather than a passive one [6]. Specifically, the embedded
osteocytes appear to be highly ordered in terms of the distance between any two
adjacent cells [25]. Also, in histology, each osteocyte occupies one lacuna and each
lacuna contains only one osteocyte, unless the lacuna is left empty after osteocyte
death. It had never been reported that one lacuna encompasses two or more
osteocytes, which means the osteoblast that is committed to osteocyte prevents its
neighbour cells from adopting the same cell fate. This fine-grained structural
![Page 33: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/33.jpg)
Chapter 2: Literature Review 7
characteristic indicates the transition from osteoblasts to osteocytes is a carefully
tuning developmental event.
During the terminal differentiation, osteocytes express unique markers that are not or
lowly expressed by osteoblasts. After being embedded in bone, the cell undertakes a
dramatic transformation from a cuboidal cell to a multidendritic style; meanwhile,
the distribution of cell skeleton–related proteins, such as fimbrin, cillin, filamin, and
spectrin, experiences significant changes [26]. The cell skeleton–related protein
E11/gp38, which has been considered as the earliest marker of osteocytes [27, 28], is
required to regulate the cell skeleton and morphology [29]. In particular, E11 is
responsible for both arborisation and elongation of dendritic processes [30, 31], and
the surrounding mineralisation promotes E11 expression in turn [32, 33].
A specific secreted protein of osteocytes, dentin matrix protein 1 (DMP1) is critical
for proper mineralisation of bone and dentin [34]. DMP1 is a highly acidic
phosphorylated extracellular non-collagenous protein that was first cloned from rat
teeth [35]. It belongs to a family of proteins called small integrin-binding ligand N-
linked glycoprotein (SIBLINGs), which contain five tandem genes (DSPP, BSP,
MEPE, SPP1, and DMP1) located within a 375,000 bp region on chromosome 4,
indicating that those proteins share unifying genetic characteristics [36]. In bone
tissue, the expression of DMP1 is much higher in osteocytes than in osteoblasts.
Hence, it also can be regarded as an osteocytes marker [37, 38]. It is of note that
osteocytes also highly express MEPE, another member of the SIBLINGs family,
which is important in regulating the phosphate metabolism [39], suggesting that the
SIBLINGs proteins are not only genetically relevant but also functionally related [40,
41]. Moreover, the phosphorylation of matrix proteins by casein kinaseⅡ(CKⅡ) is a
premise for their mineral-related function [34]. And this enzyme is produced in high
amounts by osteocytes but not by osteoblasts [42], which, in contrast, express high
levels of CKⅠ, another serine/threonine specific protein kinase family [43].
Other genes produced by osteocytes include phosphate-regulating gene with
homologies to endopeptidases on the X chromosome (PHEX) [44], a hormone that
regulates phosphate homeostasis in bone tissue [45]. Meanwhile, osteocytes also
produce matrix metalloproteinase 2 and 13, as well as membrane-type matrix
metalloproteinase (MT1-MMP) to remove extracellular matrix accompanying the
![Page 34: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/34.jpg)
8 Chapter 2: Literature Review
arborisation and elongation of dendrites [46-48]. When the differentiation process
comes to an end, osteocytes establish a well-connected network with each other and
the cells on the bone surface. The deep-buried osteocytes express dickkopf (DKK) 1
and sclerostin (encoded by SOST gene) which are both Wnt signalling antagonists
and inhibit excessive mineralisation [49, 50].
The expression of fibroblastic growth factor 23 (FGF23), a phosphaturic hormone, is
quite complex. After FGF23 was identified, it was deemed as predominately
expressed in osteocytes [51, 52]. More recently, Feng et al. showed FGF23 was
highly expressed in osteoblasts rather than osteocytes by in situ hybridisation and
immunohistochemistry. The FGF23 level in osteocytes was dramatically increased in
DMP1 null mice with no significant changes in osteoblasts [53, 54], which supports a
negative effect of FGF23 on bone mineralisation [55]. It is of note that FGF23 is
unable to pass through the gap junctions due to its molecular weight; hence, it is
released into the vascular system by osteoblasts or osteocytes and works as a
circulating factor [6].
In summary, the transition from osteoblasts to osteocytes involves fundamental
changes in the patterns of gene expression leading to the distinct functions of these
two cell types.
Figure 1: Transition from osteoblasts to osteocytes. Certain osteoblasts that are
decided to become osteocytes stop proliferation and matrix secretion, then are buried
in the matrix. Meanwhile, the cells present morphological alteration in term of
generation of dendritic processes. As the dendrites elongate, the cells establish
contact with deeper embedded osteocytes.
![Page 35: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/35.jpg)
Chapter 2: Literature Review 9
2.3 THE ENVIRONMENT OF OSTEOCYTE RESIDENCE AND NETWORK BEHAVIOUR
The lacunae and canaliculi, which accommodate osteocytes, form a complex system
serving as the pathway for the transport of nutrients and signals [56]. It has been
shown that the average number of osteocytes in an adult human is around 42 billion
and those cells form 23 trillion connections via dendrites. The total length of all these
dendrites can be 175,000 km [57]. Such complexity is only comparable to the
neuronal system in the human body [58].
The organisation of this lacunae–canaliculi system is closely related to bone mineral
quality, as the majority of minerals reside within a distance less than 1 µm from the
wall of the lacunae and canaliculi [59]. This observation further confirms that
osteocytes deliver minerals to a relatively long distance along canaliculi through
dendrites, while the minerals have limited ability to penetrate into bone matrix.
Hence, either underdeveloped architecture or high density of the lacunae–canaliculi
system correlates with bone mineral disorders [60]. Besides this anabolic function,
osteocytes can also mediate osteolytic activity in pathological conditions [61], which
has been defined as osteocytic osteolysis [62]. The ability of osteocytes to remove
and replace the mineralised matrix makes them an important access to regulate the
huge mineral reservoir in bone and directly contribute to calcium and phosphate
metabolism in response to hormone and mechanical loading [53, 63, 64]. Multiple
studies have shown that parathyroid hormone (PTH) and PTH-related protein
(PTHrP) are important triggers for osteocytic osteolysis [65-67].
Current understanding about the osteocyte network is that osteocytes communicate
with each other by gap junction [68], cadherins [69], and indirect secreting signalling
[70]. The gap junctions allow small molecules (<1 kDa) to transfer among
osteocytes’ plasma [71] and there have been reports that mechanical loadings on
osteocytes can promote the opening of gap junctions [72]. In addition to this direct
cell-to-cell contact, osteocytes also deliver some soluble signalling molecules in a
short distance, including prostaglandin E2 and ATP, to communicate with adjacent
cells [68, 73]. Aside from those well-documented signals propagation mechanisms
which are lack of specificity, another important type of signalling pathway bounded
on the cell membrane represented by the Notch signalling pathway springs to mind to
execute fine regulatory functions. Other researchers using live cell labelling methods
![Page 36: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/36.jpg)
10 Chapter 2: Literature Review
found the dendrites repeatedly extend and retract to establish a transient connection
with an adjacent cell, indicating that some cell-to-cell signalling can be transduced
through the “handshake” manner [74]. The motions of dendrites provide a
topological basis to Notch signalling regulation [75-77]. Recent studies revealed that
Notch is highly expressed by osteocytes [12, 13], which also supports our hypothesis.
Some dendrites that protrude from an osteocyte’s cell body extend beyond the
canaliculi system and directly contact with osteoblasts located on the bone surface
[78]. It remains unclear what signals are transduced between osteocytes and
osteoblasts. It is thought that pleiotrophin (also known as HB-GAM and OSF-1)
could be the signal mediator between osteocytes and osteoblasts and plays a role in
adult bone and mechanical sensing [79]. However, pleiotrophin-deficient mice
present a normal bone phenotype, which suggests pleiotrophin has a minimal role in
bone tissues [80]. Given that osteocytes express high Notch signalling, it is not
surprising that Notch mediates communication between osteocytes and osteoblasts
and plays a role in the cell fate determination of osteoblasts as well. We have to
admit that there is still no solid evidence to confirm this point. However, some
regulatory mechanisms of Notch signalling can be discussed, and we will give details
in the coming sections to provide a reasonable explanation of the events of cell fate
decision.
2.4 MINERALISATION PROCESS INDUCED BY OSTEOCYTE
It has been well documented that osteoblasts produce an unmineralised collagen
matrix called osteoid, which combines with calcium and phosphates to form
hydroxyapatite, the main component of the calcified bone matrix [81]. As osteoblasts
are far away from the mineral sites, it is believed that the osteocytes embedded in
osteoid play an important role in the mineralisation process [42]. Feng and
colleagues conducted several experiments to prove it is the osteocytes, not the
osteoblasts, that are mediating the biomineralisation. They applied calcein and
Alizarin Red double labelling methods to trace the mineral process. Interestingly, the
mineralisation started at the proximal sites of osteocytes, then extended to the distal
sites, and there was a clear boundary between two fluorochromes. However, in the
DMP1 knocked out mice, the labelling was dispersed and diffuse, indicating the
mineralisation was out of control and mineral deposited randomly. Above findings
![Page 37: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/37.jpg)
Chapter 2: Literature Review 11
suggested that DMP1 produced by osteocytes plays a critical role in regulating
mineralisation. Moreover, they use immuno-gold staining to label DMP1 and
observed samples under SEM. The results revealed that DMP1 was highly abundant
on the canaliculi walls next to the dendrites of osteocytes and then spread to
surrounding areas [82]. In an analogous situation of dentin histology, research has
shown that peritubular dentin is highly mineralised compared with intertubular
dentin [83]. Peritubular dentin surrounds the processes of odontoblast and directly
adsorbs amorphous matrix secreted by the odontoblasts [84]. Also, in elephant and
opossum, the development of peritubular dentin occurs in advance of intertubular
dentin [85]. Although there is no evidence to show that the bone just surrounding
osteocytes’ dendrites is more highly mineralised than the tissue that is some distance
from the osteocyte lacuna and canalicular system, the similarity between the
structure and components of dentin and bone suggests it is likely that the wall of the
lacuno–canalicular pore system is early and mostly developed in bone tissue. Further
histomorphometric research is required to reveal the fact of this important property
of bone tissue in the future. Even after apoptosis, due to the nonexistence of
connection to other types of cell and phagocytosis, the lacuno–canalicular space is
infilled with minerals and the remnant osteocyte’s structure, and components become
mineralised by themselves in vivo [86]. Together, all the evidence reviewed above
indicates osteocytes mediated mineralisation.
DMP1, the protein that plays a vital role in mineralisation, is a non-collagenous
extracellular protein secreted by osteocytes [87]. The function of DMP1 was
confirmed by the gene knockout research that DMP1 null mice present with rickets
and osteomalacia phenotype with hypophosphatemia [82, 88]. DMP1 is highly
anionic and rich in serine residues, which can be phosphorylated by casein kinase I
and II [34]. The unphosphorylated DMP1 is located in the nucleus; during the
transition from osteoblasts to osteocytes and osteocytes maturation, DMP1 is
phosphorylated, then released into the cytoplasm and extracellular matrix [89]. In the
extracellular matrix, DMP1 prevents autonomous precipitation of calcium phosphate
and promotes controlled nucleation of mineral particles by stabilising calcium
phosphate and transferring it to the gap region of collagen where it would then be
deposited and crystallised [34]. This high negatively charged property makes it
possible for DMP1 with a high binding affinity for calcium to initiate the nucleation
![Page 38: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/38.jpg)
12 Chapter 2: Literature Review
of mineralisation [90, 91] (Fig. 2). Currently, the methodology of mainstream
biological experimental is insufficient to discover the low level of nuclear DMP1. As
the phosphorylation initiates, DMP1 is continuously produced and phosphorylated,
leading to the aggregation of the protein, which allows it to be tested using general
methods, for example, Western blot analysis. Hence, DMP1 can still be regarded as a
specific marker for osteocytes.
Figure 2: DMP1 mediates cell based mineralisation.
A: With the presence of DMP1, the highly phosphorylated DMP1 integrates calcium
and phosphate and prevents spontaneous aggregation. Due to the negative charge of
phosphorylated DMP1, it infiltrates into the gap zone of collagen, which is positively
charged. B: In the absence of DMP1, the calcium and phosphate deposit
spontaneously at the surface of the collagen, leading to poor quality mineralisation
[34].
![Page 39: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/39.jpg)
Chapter 2: Literature Review 13
2.5 THE CORE NOTCH PATHWAY: COMPONENTS AND
REGULATORY MECHANISMS
The Notch signalling pathway in mammals contains single-pass transmembrane
ligands (Jagged 1, 2 and Delta-like 1, 3, and 4) and four epidermal growth factor
(EGF)-like Notch receptors (Notch 1–4) that display both redundant and distinct
functions [9]. The activation of receptors initiates a sequence of proteolytic events
with the assistance of ADAM metalloprotease and γ-secretase and eventually
releases Notch intracellular domain (NICD). NICD then translocates into the nucleus
and combines to the DNA-binding protein compound of Rbp-jκ and MAML 1–3 [92,
93] to control specific gene transcription, through transcriptional repressors hairy and
enhancer of split (Hes1–7) and hairy and enhancer of split related with YRPW motif
1 (Hey1, 2, and L) [8, 10].
Despite the simplicity in term of components, Notch adopts a series of complicated
mechanisms at different levels to couple with its versatility in controlling multiple
aspects of development. Some of these mechanisms had been well established:
Lateral induction and lateral inhibition. It is a mechanism of positive transcriptional
feedback to render Notch able to determinate the fates of two identical cells [10].
Initially, those two identical cells express the same levels of Notch ligands and
receptors, i) for lateral induction, the ligand (especially Jag1) expression cells induce
their neighbours to express the same type of ligand to coordinate the cell behaviour,
resulting in a homogenous commitment of cells [94, 95] and ii) for lateral inhibition,
whereby the ligand (especially Dll1) expressing cells inhibit the expression of the
ligand in the adjacent cells. Then a positive feedback loop amplifies the tiny
difference, and eventually, the Dll1 expressing cells prevent their neighbour cells
from adopting the same cell fate and generate a mosaic-like cellular developmental
pattern [96, 97]. Notch signalling both initiates phenotype changes and maintains
proper function; however, those roles may be attributed to different ligands involved
[98-100].
In cis (inhibition) and in trans (activation). Notch function is mediated by the cell-to-
cell contact as all the ligands and receptors are located on the cell membrane [101].
A single cell expresses both ligands and receptors, and it has been confirmed that the
![Page 40: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/40.jpg)
14 Chapter 2: Literature Review
combination of ligands and receptors on the same cell is inhibitory [5, 102] and
prevents the activation of receptors by neighbour cells as the binding sites have been
occupied [75, 103]. The regulation of the ratio of in cis and in trans patterns can
manipulate the Notch signalling at a multicellular level. Moreover, as a result of the
glycosylated modification of Notch receptors by Fringe proteins, the receptors can
only bind to Dll ligands and “free” Jag ligands can send signals to neighbouring cells
[102] (Fig. 3).
![Page 41: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/41.jpg)
Chapter 2: Literature Review 15
Figure 3: The interaction between Notch receptors and ligands.
(A) Notch ligands Jagged (JAG1, 2) and Delta-like (DLL1, 3, 4) possess
extracellular Delta-Serrate-LAG2 (DSL) domain through which the ligands bind to
the EGF-like repeats 11–12 in the extracellular domain of Notch receptors [5]. And
the N-terminals of the ligands present phospholipid-binding property, indicating the
ligands may also anchor to the adjacent cell membrane [104]. (B) Notch receptors
are activated through integration with the ligands located on the neighbour cells,
which is called in trans activation. In the other hand, when the receptors bind to the
![Page 42: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/42.jpg)
16 Chapter 2: Literature Review
ligands expressed on its own membrane, Notch signalling is inhibited, which is
called in cis inhibition. (C) Different ligands compete for the limited binding sites on
the receptors in a random manner (upper). However, the receptors can be
glycosylation modified, which prevents them from combining with JAG ligands and
only allows binding to DLL ligands (lower).
Tissue architecture and morphology. As Notch signalling requires cell-to-cell contact
to transmit a message, the organisation of tissue and cells can also regulate the signal
intensity. This property is unique in the Notch signalling pathway compared with
other signalling pathways that rely on secretive components, for example, the Wnt
signalling pathway. It has been reported that the signalling is proportional to the
contact area between two adjacent cells when the contact area is greater than the
diffusion area of ligands and receptors [105]. In other circumstances, like the cell-to-
cell connecting through cellular protrusions, the contact area is quite limited, leading
to more complex scenarios [106, 107]. It is of interest that the Notch signal through a
small contact area can be higher than through a large area using a mathematical
model of Notch signalling [105]. Moreover, the dynamic of Dll1 diffusion is faster in
protrusion than in the bulk cell body, which may centralise signals on the protrusion
area [108]. Even just transient contact between cells can transmit strong signals,
which has been found in neural crest cells and myotome cells that contact each other
in a “kiss and run” manner [109]. During the transition from osteoblasts to osteocytes,
the cell morphological changes render a different contact manner between adjacent
cells, which can contribute to altering signalling during the transition. Based on the
observation suggesting that osteocytes’ dendrites also present dynamic
characteristics, it is likely the signalling is strong and regulated in a sophisticated
way during the transition from osteoblasts to osteocytes. A possible explanation may
be that the broad interaction is also impacted by repressive factors at a higher level;
however, the protrusions connection is more specific and focuses on the positive
signalling factors (Fig. 4).
![Page 43: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/43.jpg)
Chapter 2: Literature Review 17
Figure 4: Models of supposed contact dimensions alter Notch signalling.
The contact between osteoblasts involves broad gap junctions and a large range of
ligands and receptors working in cis or in trans [110, 111]. The overall signals
transduced between osteoblasts are low but sustained. In the case of contact between
osteoblast and osteocyte, the connection area is small. A limited number of ligands
and receptors work in signalling transduction, while the signals can be burst as
repressive factors may be excluded.
Asymmetric division. It is common sense that a mother cell produces two identical
daughter cells in mitosis. However, there is another scenario when Notch plays a role
in the division. A model has been suggested that Numb protein, an inhibitor of Notch
signalling, is asymmetrically distributed into two daughter cells during cell
replication, which generates a bias of Notch signalling intensity of the daughter cells
[112].
Dosage dependence. A few studies have confirmed that Notch is dosage sensitive as
both ligands and receptors exhibit haploinsufficiency. The regulation of Notch is not
a “zero-sum game.” In contrast, the cells calculate the signal intensity, even just a
small stoichiometric difference, to restrict signal delivery. As an increasing number
of molecules have been added to the set that can interact with Notch components at
![Page 44: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/44.jpg)
18 Chapter 2: Literature Review
various aspects of the pathway, including biosynthesis, trafficking, and degradation,
the regulation of the Notch dosage can be a topic of incredible complexity.
Gutuharsha et al. also suggested that Notch signalling is a system rather than a
“pathway” [113].
Nuclear events. NICD entering the nucleus contributes the common approach of
Notch activation regardless of the types of receptors and ligands. This common way
produces various, or even opposite, outcomes in a cell-specific or stage-specific
manner, which can be attributed to the nuclear context that controls gene expression.
Notch signalling determines cell death or survival in the optic lobes of D.
melanogaster, relying on cooperation with the existing transcription factors [114]. A
proposed model suggested that the selected target gene of NICD-CSL (also known as
Rbpj in humans) complex needed to be prepared by histone acetylation to render the
complex more accessibility [115]. Moreover, the CSL-DNA-binding is dynamic,
leading to the possibility that Notch does not determine which gene would be
expressed intrinsically. In contrast, there may be another program that initiates
expression, and Notch activation will augment that expression [116, 117]. Hence,
epigenetic mechanisms, including histone methylation, which modify the
accessibility of gene promoters may have a profound influence on responses to
Notch signalling, which contributes to the different gene expression pattern mediated
by Notch [118, 119] (Fig. 5).
![Page 45: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/45.jpg)
Chapter 2: Literature Review 19
Figure 5: Nuclear events in the regulation of Notch signalling.
(A): Inhibitory mechanisms. The DNA is coiled around histone and inhibitory factors
present resulting in inhibition of the Notch transcriptional complex recognising and
initiating the gene’s regulatory sites. (B): Active mechanisms. In the presence of
chromatin modifying factors, the histone is highly acetylated and uncoiled to expose
the DNA regulatory sites to Notch transcriptional complex, thus initiating gene
transcription.
Signal crosstalk and integration. Given its pleiotropic nature, Notch signalling can
drive opposed actions in a context-dependent manner [120]. The integration of Notch
and other signalling pathways can provide a possibility for its context-specific
manner. The traditional views of the crosstalk describe signalling pathways as quite
distinct, linear approaches and integration only occurs on a limited number of nodes
shared by several pathways. Recently, as big data has been generated by high-
![Page 46: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/46.jpg)
20 Chapter 2: Literature Review
volume gene screen and microarray, a more representative and realistic model is the
network of signalling, and the interconnection can occur at various points of
pathways through a relatively large number of common members [113].
Oscillated regulation of Notch. A segmentation clock is an intrinsic mechanism that
realises temporal regulation of Notch signalling. During somitogenesis, Hes1
oscillates every two hours, which corresponds to the formation of somite buds from
the presomitic mesoderm [121]. Hes1 therefore restricts the pulse of the biological
clock by negative feedback. Based on this restricted developmental rhythm, another
Notch signalling effector, has a 22 minute half-life. Hirata et al. found mice
expressing mutant Hes7 with a 30 minute half-life presented severely disordered
somite segmentation [122]. Consistent with this, mutations in Jag1 and Dll3 caused
Alagille syndrome and spondylocostal dysostosis, respectively, in humans [123,
124]. Together, the temporal regulation of the Notch signalling pathway contributes
to the development of normal somites. Furthermore, oscillations of Hes1 are essential
for neural development because sustained overexpression of Hes1 negatively
regulates proneural and Notch-related gene expression [125]. The oscillated nature of
Notch signalling suggests that Notch has a self-control system for temporal
regulation. This is an important property because Notch has different expression
patterns throughout the different developmental stages [126, 127].
2.6 NOTCH REGULATES CELL PROLIFERATION
Notch is a signalling pathway that is fundamental to cell fate determination in all
animals. Its most prominent role is the regulation of cell proliferation and
differentiation in both embryonic and postnatal organs [128, 129]. A number of
studies have explored the regulatory function of Notch in stem cells, or progenitor
self-renewal, as well as differentiation of various tissues, such as intestinal [130],
muscle [131, 132], blood vessel [133, 134], haematopoietic [135, 136], neural [137,
138] and mesenchymal progenitor cells [139]. From these studies, it has emerged
that the nature of Notch signalling is multifunctional and multidirectional in a cell
context-dependent manner.
The process of cell proliferation is composed of a series of events defined as the cell
cycle. The cell cycle integrates a continuous growth cycle with a discontinuous
division cycle, which is strictly regulated by a complex molecular mechanism. The
![Page 47: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/47.jpg)
Chapter 2: Literature Review 21
cell cycle can be divided into a series of phases, including the G0 phase (quiescent
phase), G1 phase (cell growth), S phase (DNA synthesis and replication), G2 phase
(damaged DNA detection), and M phase (cell division). The transition between
different phases of the cell cycle is triggered by a network of protein and
phosphatases including cyclins and their cyclin-dependent kinases (CDK).
Specifically, Cyclins A and B trigger the G2–M transition. Cyclin A is synthesised in
the S phase and degraded at prometaphase. Cyclin B (composed of B1 and B2) is
synthesised in the S and G2 phases and degraded following the completion of
chromosome attachment to the mitosis spindle. Cyclins A and E are triggers for G1–
S phase transition. Cyclin C regulates RNA polymerase transcription, whereas
Cyclin D triggers the passing of the restriction point in the G1 phase and Cyclin E
synthesis [140]. During the whole cell cycle, G1–S phase transition is a critical
process that determines the cells to start DNA synthesis and dividing [141].
Dysregulated Notch1 plays a critical role in human T-cell neoplasia, and even the
human Notch1 gene itself was identified from a T-cell acute lymphoblastic
leukaemia (T-ALL) [142, 143]. Following this finding, a series of studies have
revealed that Notch1 interacts with c-Myc [144], Cyclin D1 [145], E2A-PBX1 [146],
and Ikaros [147] to override the G1–S checkpoint and induce proliferation of T-ALL
cells. There are no reports of tumours of myeloid origin following the overexpression
of Notch1, findings that are indicative of the cell- and tissue-specific context of the
Notch signalling pathway.
On the other hand, Notch can be a tumour suppressor in certain circumstances, such
as in the skin. In normal skin tissue, proliferating keratinocytes are located mainly in
the basal layer. The proliferation will cease after they migrate to the spinous layer.
Then, the cells are committed to terminal differentiation upwards to the granular
layer and further, the cornified layer experiencing cell morphology changes [148].
This model is analogous to the terminal differentiation of osteocytes in which the cell
cycle is arrested; cell morphology is changed, and specific proteins are expressed as
well (Fig. 6). Notch1 signalling in keratinocytes directly determines entry into
terminal differentiation by promoting expression of keratin1 and involucrin, both of
which are early differentiation markers. Moreover, Notch1 signalling also
upregulates expression of p21Waf1, a cyclin-dependent kinase inhibitor, leading to
the arrest of the cell cycle and the onset of terminal differentiation [149]. Also,
![Page 48: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/48.jpg)
22 Chapter 2: Literature Review
Notch1 activates NF-κB,which is required in the maturation of epithelial tissue
[150-152]. Notch1 mediates cell cycle arrest through several approaches, including
activator protein-1 (AP1). AP1 is inhibited by Notch1 through repression of c-FOS
expression, resulting in the exit of the cell cycle [153]. In vivo studies also provide
solid evidence to support the tumour-suppressive function of Notch1. Specifically,
knockout of Notch1 in the epidermis presented hyperplasia and basal cell carcinoma.
Meanwhile, the Sonic Hedgehog and Wnt signalling pathways were derepressed,
resulting in the development of tumours in Notch1 deficient mice [154]. Together,
Notch1 functions as a comprehensive tumour suppressor in the skin.
Figure 6: Scheme of skin renewal.
The skin stem cells are in the basal layer and undergo proliferation to maintain the
updating of skin. After the stem cells migrate upwards to the spinous layer, the cell
cycle is arrested, and the cells start to differentiate towards keratinocytes located at
the cornified layer as the terminal stage.
In the case of cervical cancer caused by human papillomavirus (HPV), although
Notch still activates p21Waf1 to inhibit cell proliferation, p21Waf is inactivated by
the E7 protein produced by the HPV [155-157]. Also, p100α and p63 proteins are
amplified in cervical cancer; they inhibit GSK-3β, which is a common inhibitor of
both Wnt and SHH signalling pathways [158, 159], and upregulate the PI3K
signalling pathway, resulting in a high level of proliferation [160, 161]. The
![Page 49: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/49.jpg)
Chapter 2: Literature Review 23
suppressive effect of Notch1 on Wnt and SHH signalling is overcome in HPV
infected cells. In this context, Notch1 has a limited ability to inhibit proliferation.
The diversity of Notch functions in proliferation can be attributed to the complexity
of the regulatory mechanisms discussed in the above sections. Evaluating the
functions of Notch requires a cell context-specific perspective.
2.7 NOTCH IN OSTEOGENESIS
Previous studies using various mouse transgenic models have revealed the function
of Notch in the osteoblastic lineage (Fig. 7). Briefly, Notch maintains the pool of
mesenchymal progenitors by suppressing osteogenic differentiation from early stage
precursors. Downregulation of Notch is required to drive differentiation towards
functional osteoblasts, the matrix secreting cells. Correspondently, mature
osteoblasts express a low level of Notch signalling [162-168]. In physiological
conditions, Notch signalling is decreased as osteoblasts mature, which can explain
the controversial phenotypes observed when Notch is disrupted at different time
points during the formation of mature osteoblasts.
Bone formation contains two sequential steps: first is organic matrix deposited by
osteoblasts, followed by mineralisation mediated by osteocytes that are derived from
osteoblasts [169]. It is of great importance to elucidate the function of Notch in the
final stage of bone formation. However, there is limited research until recently, based
on our best knowledge of that topic, and some key questions, including the specific
mechanism involving physiological regulation during the terminal differentiation, are
yet to be addressed.
It is well established that Runx2 is a core transcriptional factor in triggering the
differentiation of mesenchymal stem cells to osteoblasts [170]. However, no such
key factors have been identified in the transition from osteoblasts to osteocytes,
which is a valuable topic because mineralisation mediated by osteocytes is no less
important than matrix secretion implemented by osteoblasts in its contribution to
bone tissue with normal structure and function.
An epigenetic research [12] revealed striking changes in the transcriptome that
accompanied the transition from osteoblasts to osteocytes. Of the 20,754 genes
![Page 50: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/50.jpg)
24 Chapter 2: Literature Review
expressed by the osteoblasts and osteocytes tested in the screen, 4,496 genes had
altered regulation during the transition. These data showed osteoblasts and osteocytes
share significant common features and unique phenotypes. It is of interest that Hey1
gene, a Notch-related transcriptional factor, was upregulated more than ten-fold –
firm evidence that osteocytes had high Notch expression. Furthermore, all of the
genes related to cell cycle were downregulated during the transition, which suggested
that Notch impeded cell proliferation in osteocytes, contrary to its role in the
mesenchymal stem cells and early differentiated osteoblasts.
Regarding receptors and ligands expressed by osteocytes, the Notch1 receptor and
Jag1 ligand were the main upregulated markers distinct from others. Of the
downstream target genes, expression of Hes1 was increased, while Hes5 was stable
[13]. These findings together indicate a key role for Notch in osteocytes. Moreover,
this putative function should be tested in a more specific perspective that considers
the relevant markers in osteocytes, because opposite functions of Notch in different
organs have been reported due to different receptor–ligand combinations as well as
the downstream targets involved [171, 172].
The main data generated from an osteocyte-specific gene modified mouse model
come from Zanotti’s group [168, 173, 174]. However, it is difficult to make a clear
conclusion of the function of Notch in osteocytes. As reported, both activation and
inactivation of Notch in osteocytes by mating DMP1-Cre+/- mice with Notch 1/2 loxp/loxp and RosaNotch mice, respectively, generated a similar phenotype of increased
trabecular bone mass. There is no reasonable explanation for these results; the only
suggestion we can make is that the data based on the bone morphological analysis
lacks a further mineralisation test. In other words, the quality of the increasing bone
mass has not been determined. It has also been reported that activation of Notch in
mature osteoblasts contributed more osteocytes in cancellous bone of males, while
activation in osteocytes did not exhibit an increase in the number of osteocytes.
However, inactivation of Notch in osteocytes increased osteocyte density in
cancellous bone. A plausable explanation is that the pattern of physiological
expression of Notch in osteoblasts and osteocytes may differ. Given the dosage-
dependent property of Notch signalling, it is difficult for the activation of Notch in
osteocytes to generate a significant phenotype bcause the Notch signalling is already
strong in this context. In the scenario of inactive Notch, the increase in osteocyte
![Page 51: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/51.jpg)
Chapter 2: Literature Review 25
density could be a compensatory mechanism to rescue the defect of Notch signalling.
Although further research into the mechanism is needed, the existing data suggest
Notch might play a role in the transition from osteoblasts to osteocytes. Interestingly,
another finding points to the number of osteocytes in cortical bone not being
affected, whether or not Notch is activated in either sex. This is a further indication
of the sophisticated nature of context-dependent Notch signalling, since it is capable
of distinguishing osteocytes from trabecular bone from osteocytes from cortical bone
and exert a unique function. A more recent study using various Notch reporters and
modulated mice models provided convincing evidence that osteocytes express a high
level of Notch signalling and Notch has an anabolic response on the mature bone
[13]. The physiological fluctuation of signal intensity makes it necessary to uncover
the profound mechanism of Notch regulation, and the perspective of treating bone
diseases by purely activating or inactivating Notch, regardless of spatial and
temporal specificity, would not generate pronounced and consistent effects.
Figure 7: Summary of previous gene modification research on Notch signalling in
osteogenesis.
![Page 52: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/52.jpg)
26 Chapter 2: Literature Review
2.8 SIGNALLING CROSSTALK WITH NOTCH
2.8.1 Notch and Wnt
The Wnt signalling pathway is another important fundamental mechanism in
promoting bone formation [175-177]. It is noted that Wnt signalling should be down-
regulated in osteoblast terminal differentiation. Otherwise, the osteopenic phenotype
can be observed in which osteoblasts produce a large amount of osteoid that cannot
be mineralised properly by osteocytes [50]. This finding is consistent with the fact
that osteocyte expresses Sost, Dkk1, both of which are Wnt antagonists in bone [49,
178-180]. Striking osteopetrosis phenotype throughout the whole skeleton has been
reported after targeted deletion of the Sost gene in osteocytes [181, 182].
Nevertheless, a low level of Wnt signalling in osteocytes is still functional in
mechanosensing [179, 183]. Considering that Notch is upregulated during the
terminal differentiation, Wnt and Notch signalling may have an opposite expression
pattern in osteocytes. Further research is required in regards to which pathway is
dominant, or whether there is a higher mechanism that governs Wnt and Notch. The
results would be valuable to extend our perspective on bone mineralisation.
It is possible that the PI3K/Akt signalling pathway mediates the crosstalk between
Notch and Wnt pathways. The PI3K/Akt pathway is a key control point in
maintaining cell survival. Activation of Akt enhances cell growth by regulating
GSK-3β, which further regulates β-catenin, a downstream effector of canonical Wnt
signalling pathway [184-186]. GSK-3β, on the other hand, can regulate Notch
activity through NICD and Hes1 expression [187-189]. The encoding product of the
phosphatase and tensin homologue (PTEN) gene negatively regulates Akt activity by
dephosphorylating PIP3, an upstream activator of Akt [190]. Decreases of PTEN
result in activation of Akt, which accelerates cell growth and survival in multiple
advanced cancers [191]. Moreover, PTEN itself is inhibited by the Notch signalling
pathway through Hes1, indicating a reciprocal relationship between Notch and Akt
activity [192]. However, in the case of PTEN null cells, Hes1 exerts a direct
suppressive function on Akt, as reported in recent studies that Hes1 expression and
Akt phosphorylation are mutually exclusive during retina development [193-195]. It
has been reported that osteoblasts present a high level of phosphorylated Akt activity,
while recent findings indicate that p-Akt activity decreases during the differentiation
![Page 53: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/53.jpg)
Chapter 2: Literature Review 27
from late stage osteoblast to osteocyte [190]. Based on all aforementioned evidence,
we speculate that a cell context-dependent manner embedded in the crosstalk
between Notch and Wnt signalling can be both antagonistic and synergetic.
2.8.2 Notch and BMP
The BMPs pathway contains several types of ligands: BMP-1 is a metalloprotease
and BMPs 2–7 belong to the transforming growth factor -β (TGF-β) superfamily
[196]. They bind to type I or type II receptors to transduce intercellular cascade
through the Smad1, 5, 8, or p38 mitogen activated protein kinase (p38 MAPK)
pathway [197]. It is of note that those ligands have redundant functions and so do the
receptors [198]. The studies on BMP signalling pathway also lack a clear distinction
between its respective functions in osteoblasts and osteocytes, leading to
dichotomous results [17, 199]. The anabolic function of BMPs in bone (especially
BMP-2, 4, 7) is well established in osteoblast differentiation and chondrogenesis in
endochondral ossification [200, 201]. However, no solid evidence is available to
support the indispensable role of BMP signalling in osteocytes and mineralisation,
which suggests that the main contribution of BMP signalling in bone formation may
be at the matrix formation stage, rather than at the mineralisation stage [202, 203].
Early deletion of BMP-2 in osteogenesis using Prx-Cre or 3.6Col-Cre can cause
severe bone defects including low bone mass, brittle bones, and spontaneous
fractures [204, 205]. However, knocking out BMP-2 in mature osteoblasts by 2.3Col-
Cre does not affect the healing of bone fractures [206], suggesting the limited
function of BMP-2 in late stage of osteogenesis.
The mainstream opinion is that Notch enhances BMP activity in bone formation
[207, 208], although the fact can be much more complex. It has been reported that
osteocyte produce BMP-7, rather than BMP-2, in response to mechanical loading
[209]. Furthermore, sclerostin produced by osteocytes competitively binds with BMP
receptors to reduce BMP signalling, thereby preventing sclerosteosis [210]. In
normal physical conditions, the BMP signalling pathway is under strict regulation to
prevent ectopic ossification. Gremlin 1 and 2, antagonists of BMP-2, 4, and 7, have
been identified as special markers of skeletal stem cells with potential to turn into
bone and cartilage [211-215]. It is of interest that Gremlin1 shares great similarity
with Jag1 and Hes1 in promoter structure [216]. And Jagged-Notch signalling also
![Page 54: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/54.jpg)
28 Chapter 2: Literature Review
triggers Gremlin2 expression in the intermediate and dorsal domains in facial skeletal
development [217]. Notch also controls expression of another BMP signalling
antagonist, namely Noggin, which inhibits osteoblastic differentiation of BMSCs
[218, 219]. Administration of Noggin can rescue the altered phenotype in Rbpj
knock-out mice and improve bone formation [172]. All these data together suggest a
close relationship between BMP and Notch signalling pathways.
As mentioned above, one of the obstacles for the clinical application of BMP
signalling is the possibility of ectopic bone formation [220-224]. This suggests that
BMP signalling is an aggressive mechanism and may lead to excessive expression of
osteogenic genes in tissues that should not be ossified, for example, skeletal muscle.
Owen and Friedenstein proposed the classical concept of inducible skeletal
progenitors as early as 1988 [225]. Those progenitors are found in extraskeletal
tissues and committed to osteogenesis after BMP reprogramming, resulting in
ectopic bone formation. Meanwhile, Notch signalling has also been reported to
induce ectopic mineralisation in vascular smooth muscle cells via activating the
Msx2 gene [226]. Msx2 is also a target gene of the BMP2 pathway and responsible
for vascular calcification; however, Notch is able to directly activate Msx2
independent of BMP-2 [227], although Notch still enhances the responsiveness of
BMP-2 on Msx2 [228].
In summary, Notch and BMP may present an antagonistic relationship in physical
conditions, and BMP signalling is likely not involved in the terminal differentiation
and fate determination of osteoblasts cells. However, dysregulation of those
signalling pathways may lead to bone abnormality.
2.8.3 Notch and TGF-β
TGF-β signalling comprises three soluble ligands: TGF-β1, TGF-β2, and TGF-β3
[229]. Among them, TGF-β1 is the most abundant in bone matrix (200 μg/kg) [230].
TGF-βs elicit signals transduction through TGF-β receptors and activate Smad2/3 to
regulate target genes [229]. Similar to the BMP signalling, TGF-β also has an
alternative Smad-dependant pathway through p38 MAPK or extracellular signal
regulated kinase (Erk1/2) [231]. TGF-βs are deposited in extracellular matrix as
latent precursor molecules, which are cleaved by proteases like MMPs when
remodelling happens, resulting in the release of activated TGF-βs [232]. TGF-β
![Page 55: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/55.jpg)
Chapter 2: Literature Review 29
signalling induces migration of BMSCs to the bone formation sites and enhances
their proliferation [233]. However, it inhibits the maturation of osteoblasts,
mineralisation, and terminal differentiation [234]. A unique effect of TGF-β in
osteogenesis is that it prevents the apoptosis of osteoblasts to maintain a large cell
pool of osteoblasts; hence, it indirectly contributes to osteocyte formation [235].
Since osteocytes express high levels of Notch signalling and produce MMPs, Notch
signalling may be able to regulate TGF-β signalling through MMPs and couple the
osteolysis with bone formation. As a matter of fact, Notch regulates MMP2 and
MMP9 through the NF-κB pathway [236]. Notch also activates MMP13 expression
via an unknown mechanism [237]. It is unlikely that TGF-β acts as a decision maker
to determinate cell fate due to its own nature; however, it may amplify other signals
through its function in regulating cell numbers. It is reasonable to propose that after
being buried in matrix, osteocytes secrete MMPs to make room for the arborisation
and elongation of dendrites. During this process, the latent TGF-βs are also released
from matrix, diffuse along canaliculi structures to the bone surface, and eventually
contact with cells in bone marrow to regulate their viability. TGF-β signalling also
has a synergistic function with Notch, which is mediated by the interaction between
NICD and Smad3 [238, 239]. Taking into consideration the high density of the
canaliculi system, a substantial amount of active TGF-βs may be released in the
process. It seems that Notch and TGF-β signalling are mutually reinforced in signal
intensity and exert complementary functions.
2.8.4 Notch and Hypoxia-Inducible Factor (HIF)-1
HIF-1 is a dimeric transcription factor that controls the cell response to low oxygen
tension [240]. The functions of HIF-1 in bone formation are controversial based on
current findings [241-244]. It is believed that osteocytes are exposed to low oxygen
tension due to their limited access to vascular supply and this hypoxic environment
also contributes to the transition from osteoblasts to osteocytes [245]. Since the fate
of the committed osteoblasts – to become osteocytes – has been predetermined
before they are trapped in matrix, HIF-1 may not be the critical factor in this
transition; however, it still can have a role in facilitating the process.
Although the direct measurement of oxygen tension in osteocytes is unavailable,
existing data can help us analyse the microenvironment in which osteocytes reside.
Using two-photon phosphorescence lifetime microscopy, Spencer and colleagues
![Page 56: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/56.jpg)
30 Chapter 2: Literature Review
have directly measured the oxygen tension in blood vessels entering bone marrow
from bone matrix [246]. The results have shown that the oxygen tension dropped
from 31.8 mm Hg in bone matrix to 22.2 mm Hg in bone marrow, suggesting that
bone marrow consumes a large proportion of oxygen due to its dense cellularity and
high perfusion. This view is supported by another study showing haematopoietic
cells in relatively hypoxic status throughout bone marrow [247].
It has been reported that hypoxia stimulates the expression of Hes1 and Hey2 [248].
Furthermore, HIF-1 can stabilise NICD and enhance its transcriptional activity [249].
During the transition from osteoblasts to osteocytes, HIF-1 signalling can assist
Notch signalling to ensure the cells adapt to environmental changes and maintain
their viability.
In a brief summary, as yet there is no clear clue to describe the signal crosstalk
within those fundamental signalling pathways. The bewilderment and controversy
can be attributed to the complexity of the interconnected network. As the connection
among the components shared by various signalling pathways can occur at any level
and at any point of the pathway cascade, the overall output must be assessed in
detail, which is a quite new and demanding topic requiring advanced experimental
and analytical tools. However, big data generated by microarray analysis can provide
abundant information and shed light on research into signalling pathways [113].
Another limitation of the current bone research is that many studies on signalling
crosstalk focus on the early stage of osteoblast differentiation, while little attention
has been given to the terminal differentiation, which is a core process that switches
matrix secretion to mineralisation. And the most commonly used parameters to
evaluate bone formation are bone morphological data, which cannot reflect the
quality of the bone mass. Therefore, more detailed investigation on mineralisation,
mineral ultrastructure, and crystal structure is warranted in the future.
2.9 IN VITRO AND IN VIVO MODELS FOR STUDYING OSTEOCYTES
Because it is embedded in the mineralised bone matrix, the osteocyte is a challenging
cell type for functional study. One of the most difficult processes is the isolation of
osteocytes from bone tissues. Traditional methods for isolating osteocytes use
sequential EDTA and collagenase digestions, but the yields are limited, and the
osteocyte phenotype cannot be maintained in vitro [250, 251]. Recently, Stern et al.
![Page 57: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/57.jpg)
Chapter 2: Literature Review 31
used a tissue homogeniser to reduce the bone fragment to a suspension of bone
particles (50 µm in size) for culture, which makes it possible to obtain substantial
yields of osteocytes [252]. There are also some osteocyte-like cell lines available for
functional research. Among these cell lines, MLO-Y4 is the one most frequently
used. MLO-Y4 is representative of osteocytes at an early stage, expressing high
levels of the early osteocyte marker E11 and low levels of the mature osteocyte
marker Sost [253-255]. However, MLO-Y4 cannot fully simulate the gene
expressions and morphology changes in vitro, which represent the transition from
osteoblasts to osteocytes in physiological conditions. This is partly attributed to the
difficulty of constructing an ideal three-dimensional cell culture system in vitro to
mimic the physiological environment in vivo [256]. Until recently, Woo et al. have
developed a new ideal late osteoblasts cell line called IDG-SW3, which is derived
from the so-called immortomouse crossed with the Dmp1-GFP mouse, the latter
possessing an IFN-γ and temperature-sensitive SV40 large T antigen. This cell line
can maintain proliferation at 33°C with IFN-γ but undergo cell differentiation at
culture conditions of 37°C, which replicates the differentiation of osteoblasts to
mature osteocytes. The IDG-SW3 cell line expresses early and late osteocytes
markers, such as E11, Dmp1, Phex, MEPE Sclerostin, as well as Fgf23 [256].
With the development of advanced transgene and gene target technology, the
generation of the DMP1-Cre mouse, which expresses Cre recombinase under the
control of 10 kb Dmp1 promoter, has become an ideal strategy for in vivo research of
osteocyte function [257]. As Dmp1 is a specific marker of osteocytes and
odontoblasts, the Cre activity is predominantly restricted in these two cell types.
Therefore, researchers can establish a loss-of-function or overexpress model for the
genes of interest in osteocytes. Kramer et al. intercrossed DMP1-Cre mice with the
β-catenin gene-targeted mice, in which exons 2 to 6 of the β-catenin gene are located
within loxP sites. The homozygous progenies of these mice present with a low bone
mass phenotype that is characterised by absent cancellous bone mass and thinner
cortical bone in comparison with the wild type [258]. A recently released study using
animal models with heterozygous deletion of the β-catenin gene in osteocytes
demonstrated that the β-catenin signalling pathway is required for bone formation in
response to mechanical loading [259].
![Page 58: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/58.jpg)
32 Chapter 2: Literature Review
2.10 SUMMARY AND IMPLICATIONS
Stem cell therapy is a promising approach for bone regeneration [260, 261].
However, it is challenging to steer the differentiation and proliferation of stem cell. It
is certain that the Notch signalling pathway plays a fundamental role in this cell fate
decision, which renders it possible to control the fate of the stem cell by
manipulating the Notch pathway, where another difficulty is faced in that Notch
needs sophisticated regulation in osteogenesis. More specifically, a low level of
Notch signal is preferred for initiating osteoblastic differentiation and organic matrix
secretion while the high-intensity signal is required for terminal differentiation and
mineral deposition. If new light could be shed on the regulation mechanism used by
Notch signalling, the application of stem cell treatment in bone regeneration will be
possible. Precise methods that enable the Notch signalling pathway to be
manipulated spatially and temporally are also prerequisites. In a more detailed
perspective, the manipulation of the Notch pathway should be based on a niche level
or even on the individual cell as well.
The collagen matrix secreted by osteoblasts and the following mineral combined
with it under strict direction by osteocytes are essential for normal mineral tissue
with physical function – reaching an equilibrium between rigidity and resilience.
Notch signalling promotes the highly organised combination of collagen and mineral
through activating DMP1 expression, which has been confirmed in our study, and
possibly other noncollagenous proteins. With a better understanding of the
relationship between Notch and mineralisation, it may be possible to develop new
therapies and biomaterials for bone diseases. Based on these findings, we propose the
feasibility of specially designed biomaterials that can manipulate the Notch
signalling pathway in vivo in a spatial and temporal-specific manner.
![Page 59: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/59.jpg)
Chapter 3: Research Part One 33
Chapter 3: Research Part One
A temporal switch from Wnt to Notch is
a physiological process during the
transition from osteoblasts to osteocytes
—To demonstrate the activity of Notch
signalling is increased while Wnt signalling
is decreased during that transition
![Page 60: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/60.jpg)
34 Chapter 3: Research Part One
![Page 61: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/61.jpg)
Chapter 3: Research Part One 35
Suggested Statement of Contribution of Co-Authors for Chapter by
Published Paper
In the case of this chapter
Title: A temporal switch from Wnt to Notch is a physiological process during the
transition from osteoblasts to osteocytes.
Date, status, journal: Nov 2017, Submitted, received comments and under revision,
Journal of International Molecular Medicine
Contributor Signature Statement of contribution
Jin Shao Designed of the research, performed laboratory
experiments, data analysis and interpretation. Wrote
the manuscript.
Yinghong Zhou Design of the project, data analysis and reviewed
the manuscript, contribute equally to the manuscript
with Jin Shao
Jinying Lin Assisted with laboratory experiments and data
analysis
Rong Huang Assisted with laboratory experiments
Trung Dung
Nguyen
Assisted with laboratory experiments and data
analysis
Yuantong Gu Assisted with data analysis
Thor Friis Reviewed the manuscript
Ross Crawford Reviewed the manuscript
Yin Xiao Involved in the conception and design of the
project, supervised this work.
Principal Supervisor Confirmation
![Page 62: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/62.jpg)
36 Chapter 3: Research Part One
I have sighted email or other correspondence from all Co-authors confirming their
certifying authorship.
Name: Prof Yin Xiao Signature: Date:
04/Dec/2017
![Page 63: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/63.jpg)
Chapter 3: Research Part One 37
3.1 ABSTRACT
The osteogenic process contains several sequential steps including differentiation
from BMSC to osteogenic progenitors, which further differentiate towards pre-
osteoblasts, mature osteoblasts, and osteocytes as the terminal differentiation cell
type. As a highly conserved mechanism in cell fate determination, the Notch
signalling pathway has been intensively studied in osteogenesis. However, most
attention has been given to the early stage of osteogenic differentiation. In this
chapter, we investigated Notch expression during terminal differentiation. A
prominent target of the Notch signalling pathway, Hes1 transcriptional factor was
chosen as the indicator of Notch signalling. Immunostaining of Hes1 was performed
both in vivo and in vitro. Also, the transcriptions of Hes1, Notch1, and Rbp-jκ were
tested. To further confirm the Notch signalling intensity, a Rbp-jκ luciferase reporter
was transfected into an IDG-SW3 cell line to reflect Notch signalling. β-catenin was
tested to assess the signalling crosstalk and reveal the relationship between Wnt and
Notch signalling. The results are consistent with indications that Notch signalling
was increased during the terminal differentiation, whereas conversely, Wnt signalling
was decreased.
3.2 INTRODUCTION
It is now universally accepted that osteocytes are derived from osteoblasts [262],
which indicates that osteocytes may share some common points with osteoblasts, but
have their own unique characteristics. For example, osteocytes stop proliferation,
generate dendrites, and mediate mineralisation [22]. However, the precise
mechanism controlling this terminal differentiation process is largely unknown. A
few studies have revealed that the Wnt signalling pathway could play a role in this
transition. It has been reported that dickkoft 2 (Dkk2), a Wnt signalling antagonist, is
required for the terminal differentiation of osteoblasts and normal mineralisation.
The Dkk2 defective mice produced a large amount of organic collagen without the
mineralisation, which indicates Wnt signalling is naturally downregulated in this
transition process [50]. By contrast, osteocytes express another Wnt signalling
antagonist, sclerostin (Sost), exclusively among all cell types of osteoblastic lineage
[49]. The Wnt signalling is maintained at a low level but is still indispensable in
osteocytes to monitor and respond to mechanical loading [183]. The existing
![Page 64: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/64.jpg)
38 Chapter 3: Research Part One
evidence is still insufficient to conclude that the downward trend of Wnt signalling
determines and initiates the terminal differentiation.
The Notch signalling pathway in mammals contains single-pass transmembrane
ligands and four EGF-like Notch receptors that display both redundant and distinct
functions [9]. The activation of receptors initiates a sequence of proteolytic events
with the assistance of ADAM metalloprotease and γ-secretase and eventually
releases Notch intracellular domain (NICD). NICD then translocates into the nucleus
and combines to the DNA-binding protein compound of RBP-jκ and MAML 1-3 [92,
93] to control specific gene transcription, through transcriptional repressors hairy and
enhancer of split (Hes1-7) and hairy and enhancer of split related with YRPW motif
1 (Hey1, 2, and L) [8, 10]. The highly conserved Notch signalling pathway has
fundamental functions in determining the fates of various cells, including
maintenance of the osteoblastic progenitor cell pool. Notch signalling is expressed by
BMSCs to maintain their self-renewal. Using a transgenic mice model, knock-out of
Notch in BMSCs resulted in high bone mass at early ages, but starkly, low bone mass
at old ages, indicating that the progenitor pool is exhausted too early without Notch
signalling [162, 163]. On the other hand, Notch has to be down-regulated in order to
initiate the osteoblastic differentiation. In vitro studies suggest that Notch enhances
osteoblastic differentiation through direct activation of Runx2 by Hes1 activity [263].
However, controversial results have been generated with knock-out of Notch in the
osteoblasts in vivo [167, 168, 173, 264-270]. A problem embedded in those studies is
that none of them takes into account the natural expressional pattern of Notch
signalling in the differentiation process. In other words, there is still a lack of direct
evidence of the Notch functions in the terminal differentiation of osteoblastic lineage.
Limited studies focus on the functions of Notch in the terminal differentiation
towards osteocytes. Activation of Notch in osteocytes presents a high bone mass
phenotype [168]. But this effect should also be attributed to the inhibition of
osteoclastogenesis by Notch. Recently, two studies provided indirect evidence that
Notch is highly expressed in osteocytes [12, 13]. Specifically, Hey1, a target gene of
Notch signalling, was upregulated by more than 10-fold based on a gene array using
an IDG-SW3 cell line. Also, in the Notch reporter mouse model, osteocytes
expressed GFP that represented Notch signalling.
![Page 65: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/65.jpg)
Chapter 3: Research Part One 39
The temporal interaction of Notch and Wnt signalling plays a role in the key steps of
differentiation in a wide range of tissues and organs, including muscle, liver, cochlea,
and breast cancer [271-273]. Whether it also applies to osteogenesis is still unknown.
In this part, we performed both in vivo and in vitro studies to discuss the expressional
fluctuation between Notch and Wnt signalling pathways corresponding to various
phases during the transition from osteoblasts to osteocytes.
3.3 MATERIALS AND METHODS
3.3.1 Immunohistochemistry
The femoral samples from a 6 months female Wistar rat were decalcified in 10%
EDTA and embedded in paraffin. Serial sections of 5 µm thick were cut from the
paraffin blocks with a microtome. Briefly, after dewaxing and hydration, slides were
heated at 75 °C in a pressure cooker for antigen retrieval. The endogenous
peroxidase activity was eliminated by incubating in 3% H2O2 for 15 min. Non-
specific proteins were blocked with 10% swine serum for 1 h. Samples were
incubated with primary antibodies against Hes1 (ab71559, Abcam; 1:100) overnight
at 4 ºC, followed by incubation with a biotinylated swine-anti-mouse, rabbit, goat
secondary antibody (DAKO) for 15 min at room temperature, and then with
streptavidin peroxidase (DAKO) for 15 min. Diaminobenzidine (DAB) solution
(DAKO) was then added for 3 min to visualise the antibody complexes. The samples
were counterstained with Mayer’s haematoxylin for 15 s. Images of the stained slides
were then captured using Axion software under a light microscope (Carl Zeiss
Microimaging) at various magnifications.
3.3.2 Immunofluorescence
IDG-SW3 cells (kind gift from Professor Jerry Feng) and rat bone marrow–derived
mesenchymal stromal cells (BMSCs) were plated on 8-well chamber slides (177445,
Lab-Tek) at a density of 4,000 cells per well. The cells were washed 3 times with
ice-cold PBS followed by fixing with 2% paraformaldehyde (PFA) for 10 min at
room temperature. The cells were then incubated with 0.2% triton for cell
permeabilisation. Nonspecific proteins were blocked with the incubation of 1% BSA
in PBST for 30 min at room temperature. The primary antibodies, rabbit anti-Hes1
(ab71559, Abcam; 1:100) and anti-β-catenin (#9581, Cell Signaling Technology,
1:100), in PBST with 1% BSA were applied and incubated at room temperature for
![Page 66: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/66.jpg)
40 Chapter 3: Research Part One
1 h. The samples were then incubated with goat anti-mouse Alex Fluor 488 (A31560,
Life Technologies) and goat anti-rabbit Alex Fluor 647 (A21246, Life Technologies)
at room temperature for 30 min to detect the primary antibodies. The slides were
counterstained with DAPI (D1306, Life Technologies) and mounted with ProLong®
Gold Antifade Reagent (P10144, Life Technologies). The images were captured
using a Nikon EclipseTi-S microscope and a Leica SP5 confocal microscope. Cell
counting was performed using Image J software.
3.3.3 Cell culture
Rat BMSCs were isolated and cultured based on protocols from previous studies
[274]. Briefly, 12-week-old female Wistar rats were sacrificed by CO2 asphyxiation.
Femurs and tibias were dissected from surrounding tissues. The epiphyseal growth
plates were removed, and the marrow was collected by flushing with Dulbecco’s
Modified Eagle Medium (DMEM) (11885, Gibco), containing 100 U/mL of
penicillin, 100 μg/mL of streptomycin, and 10% fetal bovine serum (FBS), with a
21G needle. Single cell suspension was prepared by passing the cell clumps through
an 18G needle. The obtained cells were seeded into the tissue culture flasks
containing DMEM with 100 U/mL of penicillin, 100 μg/mL of streptomycin, and
10% FBS. On day 2, half of the medium containing nonadherent cells was replaced
with fresh medium. The medium was changed on day 4. Only cells at an early
passage (P1–P2) were used in this study. After the cells had reached 70%–80%
confluence, the medium was changed completely with DMEM containing 100 U/mL
of penicillin, 100 μg/mL of streptomycin, and 10% FBS supplemented with
50 μg/mL of ascorbic acid, 10 nM of dexamethasone, and 8 mM of β-
glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The medium was
changed every 2–3 days for the duration of the experiment. IDG-SW3 cells were
expanded in proliferation conditions -33 °C in α-MEM (12571, Gibco) with 10%
FBS, 100 U/mL of penicillin, 50 µg/mL of streptomycin, and 50 U/mL of IFN-γ
(PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in 0.2 M acetic acid)-
coated plates. IDG-SW3 cells were induced to differentiate towards osteocytes by
plating out 80,000 cells/cm2 in osteogenic differentiation conditions (37 °C with the
supplementation of 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the
absence of IFN-γ). Collagen-coated plates were necessary for both proliferation and
differentiation culture [256]. To inhibit the Notch signalling pathway, DAPT
![Page 67: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/67.jpg)
Chapter 3: Research Part One 41
(D5942, Sigma) diluted in DMSO was added to the culture at concentrations
indicated. The same amount of DMSO was applied as a control.
3.3.4 Western blot
The whole cell lysates were collected by adding 250 µL cell lysis buffer with
protease inhibitor (cOmplete, EDTA-free 04693132001, Roche) and phosphatase
inhibitor (PhosSTOP, 04906845001, Roche) for the Western blotting detection. A
total of 15 μg of proteins from each sample were separated on SDS-PAGE gels and
then transferred onto a nitrocellulose membrane (Pall Corporation). After being
blocked in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences),
the membranes were incubated with primary antibodies against Hes1 (1:1000,
ab71559, Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from
Professor Jerry Feng of the Texas A&M University Baylor College of Dentistry), and
α-Tubulin (1:2000, ab15246, Abcam) overnight at 4 °C. The membranes were then
incubated with anti-mouse/rabbit fluorescence conjugated secondary antibodies at
1:10000 dilutions for 1 h at room temperature. The protein bands were visualised
using the Odyssey Infrared Imaging System (LI-COR Biosciences). The relative
intensity of protein bands was quantified using Image J software. The experiments
were repeated three times and a representative blot is displayed.
3.3.5 Quantitative reverse transcription polymerase chain reaction (RT-qPCR)
Total RNA was extracted using TRIzol reagent (15596-018, Life Technologies) for
RT-qPCR detection. Measurement of RNA yield was performed using a NanoDrop
1000 spectrophotometer (Thermo Fisher Scientific). Complementary DNA was
synthesised from 500 ng of total RNA using DyNAmoTM cDNA Synthesis Kit (F-
470L, Finnzymes, Thermo Scientific) following the manufacturer’s instructions. RT-
qPCR primers (Table 1) were designed based on cDNA sequences from the NCBI
Sequence database. SYBR Green qPCR Master Mix (4344463, Invitrogen) was used
for detection, and the target mRNA expressions were assayed on the 7500 Fast Real-
Time PCR System (Applied Biosystems). Experiments were performed in triplicate.
The mean cycle threshold (Ct) value of each target gene was normalised to the Ct
value of the housekeeping gene GAPDH.
![Page 68: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/68.jpg)
42 Chapter 3: Research Part One
Table 1: The primers for RT-qPCR
Fwd_Hes1 CAGCTGACAAGGAGGACTGA
Rev_Hes1 GTCACCTCGTTCATGCACTC
Fwd_Notch1 TGTTGTGCTCCTGAAGAACG
Rev_Notch1 TCCATGTGATCCGTGATGTC
Fwd_Rbpj CTCCACCCAAACGACTCACT
Rev_Rbpj CATCCATCTCGCTTCCATTT
Fwd_Universal_GAPDH TCAGCAATGCCTCCTGCAC
Rev_Universal_GAPDH TCTGGGTGGCAGTGATGGC
3.3.6 Rbpj luciferase reporter assay
The Cignal Rbpj reporter kit (CCS-014L) was purchased from QIAGEN. IDG-SW3
cells were seeded in 96-well plates and transfected with the reporter vector using
Lipofectamine 2000 (11668019, Thermo Fisher) as per the manufacturer’s
instructions. Luciferase activity was tested by Dual luciferase assay kit (E1910,
Promega) and detected using a POLARstar Omega Microplate Reader (BMG
LABTECH).
3.3.7 Statistical analysis
Different statistical methods and comparisons were used as indicated in the figures
and legends.
3.4 RESULTS
3.4.1 Osteocytes express high levels of Notch signalling related markers
In order to examine the pattern of Notch expression in osteocytes, we chose Hes1, a
downstream target of Notch signalling for immunohistochemistry staining of rat
femur. We found that Hes1 is highly expressed in the osteocytes buried in bone
matrix, while osteoblasts located at the surface of the bone matrix were almost
negatively stained (Fig. 8). An in vitro osteogenic culture model of rat bone marrow–
![Page 69: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/69.jpg)
Chapter 3: Research Part One 43
derived mesenchymal stromal cells (rBMSCs) was also used to confirm the
expression of Hes1. After 14 days of osteogenic culture, which represented the late
stage of osteogenesis, Hes1 was highly expressed in rBMSCs compared with a 7-day
culture, as shown by immunofluorescent staining (Fig. 9). This result was consistent
with the Western blot and qRT-PCR analysis that Hes1 was upregulated during the
osteogenic culture at both protein and mRNA levels (Fig. 10, 11). The IDG-SW3
cells under osteogenic conditions also showed the same pattern of Notch expression.
Figure 8: Immunohistochemistry staining of Hes1 in rat femur.
Immunohistochemistry staining of Hes1 in rat femur showed positive staining in
osteocytes (black arrow) and negative staining in osteoblasts (triangle).
Figure 9: Immunofluorescence staining of Hes1 in rBMSCs in the osteogenic culture
of 7 days and 14 days. The rBMSCs cultured in osteogenic conditions for 14 days
![Page 70: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/70.jpg)
44 Chapter 3: Research Part One
representing late differentiation stage expressed a high level of Hes1. The bar graph
displays the ratio of Hes1 positive cells. The number of Hes1 positive cells
significantly increased in osteogenic differentiation at 14 days compared with 7 days.
n=3. * p < 0.05, unpaired Student’s t test, comparisons between day 7 and day 14.
Scale bar: 50 μm.
To further confirm these findings, we used a Rbp-jκ luciferase reporter to transfect
the IDG-SW3 cells, and we found that there was a significant increase of Rbpj
activities in the late differentiation stage of osteocytes (Fig. 12). Also, the mRNA
levels of Notch1 and Rbp-jκ were upregulated in IDG-SW3 cells’ differentiation (Fig.
11).
Expression of Notch in osteocytes is a new topic as Notch is usually related to stem
cells and cancer, while osteocytes are terminally differentiated cells without
proliferation ability. Our results here were consistent with a study on transcriptome
changes during the transition from osteoblasts to osteocytes, which showed a more
than 10-fold increase of Hey1 in osteocytes [12], and another recent study based on
Notch reporter transgenic mouse models [13].
![Page 71: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/71.jpg)
Chapter 3: Research Part One 45
Figure 10: Western blots of Hes1 and β-catenin in rBMSCs and IDG-SW3 cell line.
Hes1 expression at protein level increased during late osteogenic differentiation of
rBMSCs and IDG-SW3 cell line. The bar graph represents relative bands intensity.
Protein expression has been normalised to α-tubulin. n=3 wells per group. * p < 0.05,
compared as indicated (one-way ANOVA with Bonferroni post hoc test).
![Page 72: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/72.jpg)
46 Chapter 3: Research Part One
Figure 11: RT-qPCR results showed the transcription of Hes1, Notch1, and Rbpj all
increased during differentiation. n=3 wells per group. * p < 0.05, compared with
day 1 (one-way ANOVA with Bonferroni post hoc test).
Figure 12: Luciferase reporter assay showed Rbpj activity also increased during the
differentiation of IDG-SW3 cell line. n=3 wells per group. ** p < 0.01, compared
with day 1 (one-way ANOVA with Bonferroni post hoc test).
3.4.2 Wnt signalling is downregulated during osteocyte formation
Although is has been established that Wnt antagonists, such as Dkk2 and Sost, are
expressed at appreciable levels in osteocytes, there is still a lack of direct data from
in vitro models to illustrate the intensity of Wnt signalling duringthe differentiation
of the mature osteoblasts . In this part of the research, we chose β-catenin as the
indicator of the Wnt signalling pathway and conducted immunofluorescent staining
in rat BMSC osteogenic culture. The results showed that expression of β-catenin had
significantly declined from day 7 to day 14 of osteogenic culture, which represents
![Page 73: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/73.jpg)
Chapter 3: Research Part One 47
the terminally differentiated stage of osteoblastic lineage (Fig. 13). The Western bolt
results using both BMSC and the IDG-SW3 cell line were consistent with the
immunostaining. The β-catenin at protein level was reduced from day 7 to day 14 in
BMSC and day 3 to day 7 in the IDG-SW3 cell line. And there is no significant
difference between day 7 and day 14 in the IDG-SW3 cell line (Fig. 10).
Figure 13: Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture.
Immunofluorescent staining of β-catenin in rat BMSC osteogenic culture indicated
that Wnt signalling was decreased during the terminal differentiation of osteoblasts;
meanwhile, Notch signalling increased. Scale bar: 50 μm.
3.5 DISCUSSION
Bone matrix is deposited by osteoblasts, followed by mineralisation, which is
executed by osteocytes. Osteoblasts and osteocytes belong to the same lineage and
represent continuous differentiation stages. The mineralisation process accompanies
the transition from osteoblasts to osteocytes and fundamental epigenetic changes. It
has been reported that Hey1, a downstream target of Notch signalling, is upregulated
more than 10-fold during cell differentiation towards osteocytes [12]. Consistent with
![Page 74: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/74.jpg)
48 Chapter 3: Research Part One
this observation, we also reported here that Rbp-jκ, a nuclear effector for Notch
signalling transduction, increased in osteocytes. It has been reported that the function
of Notch in bone is Rbpj dependent. Tao et al. reported that the inactivation of Rbp-
jκ in a Notch gain-of-function model presented no phenotype, while Notch gain-of-
function solely induced osteosclerosis. However, this osteosclerosis phenotype was
due to the proliferation of immature osteoblasts that were restrained from terminal
differentiation; therefore, the high bone mass was of low quality. This can be proved
by the Notch gain-of-function mouse displaying a thickened skeleton but smaller
body size [166]. Our results here clearly showed that Notch is expressed at a high
level that involved the mineralisation modulated by osteocytes. However, because
Notch signalling is a complex and fundamental pathway related to various biological
activities, especially in cell fate decision and cancer [8, 275, 276], it is still difficult
to reach a conclusion as to why and how Notch signalling is expressed by osteocytes,
the terminally differentiated cells without proliferation ability. Research follow-up
would try to address this confusing problem.
Osteocytes are derived from osteoblasts, which are generated from BMSCs through
osteogenic differentiation [22]. During osteogenesis, Notch maintains the
osteoblastic progenitor pool located in bone marrow, and then it needs to be
downregulated to initiate osteogenesis; therefore, osteoblasts express Notch at a
relatively low level [163, 167, 267]. Osteocytes represent osteoblasts at the terminal
differentiation stage without redundant functions. It is well accepted that osteoblasts
are the collagenous matrix–producing cells and osteocytes are responsible for
mineralisation and load sensing [86, 277]. A possible mechanism of those functional
changes could be the high expression of Notch in osteocytes but not in osteoblasts.
Wnt signalling is another regulatory signal in osteogenesis and presents complex
crosstalk with Notch signalling [278]. Wnt induces osteoblastic differentiation and
bone formation and inhibits bone resorption [279, 280]. It is of interest to note that
Wnt is inhibited in osteocytes, as Dkk2, a Wnt antagonist, is required for
mineralisation [281]. The expression of Sost, another Wnt antagonist, is restricted in
osteocytes and some chondrocytes [22, 181]. It seems that the expression pattern of
Wnt in osteogenic differentiation is opposite to that of Notch. This phenomenon can
be explained by the different processes of bone matrix secretion and mineralisation.
More specifically, Wnt promotes osteoblasts’ differentiation and organic bone matrix
![Page 75: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/75.jpg)
Chapter 3: Research Part One 49
production, whereas Notch is expressed in osteocytes and takes charge in the
mineralisation process. When enough bone matrix is produced, Wnt is switched to
Notch to prevent excessive production of bone; otherwise, it may lead to
osteopetrosis. A similar temporal switch between Wnt and Notch has been observed
in muscle stem cells, where Notch and Wnt affect each other through GSK-3β
phosphorylation regulation [271]. We suppose this interaction of Notch and Wnt can
also affect osteogenesis and mineralisation and the effects can be different because
Notch signalling has a cell context-dependent nature. However, other research using
an overexpression model suggested that Notch can enhance Wnt signalling in
osteocytes by suppressing Sost [168]. It is possible that the function of Notch is also
concentration-dependent. Therefore, further studies are warranted to determine the
interaction of Notch and Wnt in osteocytes.
3.6 CONCLUSIONS
During the transition from osteoblasts to osteocytes, Notch signalling is increased,
whereas Wnt signalling is downregulated. The functions of Notch in terminal
differentiation and the exact interaction between Notch and Wnt signalling pathways
needs to be elucidated in future research.
![Page 76: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/76.jpg)
![Page 77: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/77.jpg)
Chapter 4: Research Part Two 51
Chapter 4: Research Part Two
Notch signalling pathway is required for
cell cycle arrest, morphological change, and
mineralisation of osteocytes
—To demonstrate the inhibition of
Notch signalling causes abnormal cell
proliferation, morphology, and
mineralisation
![Page 78: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/78.jpg)
52 Chapter 4: Research Part Two
![Page 79: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/79.jpg)
Chapter 4: Research Part Two 53
Suggested Statement of Contribution of Co-Authors for Chapter by
Published Paper
In the case of this chapter
Title: Notch signalling pathway is required for osteocytes differentiation
Date, status, journal: Nov 2017, Submitted, received comments and under revision,
Bone
Contributor Signature Statement of contribution
Jin Shao Designed of the research, performed laboratory
experiments, data analysis and interpretation. Wrote
the manuscript.
Yinghong Zhou Assisted with data analysis and reviewed the
manuscript
Yin Xiao Involved in the conception and design of the
project, supervised this work.
Principal Supervisor Confirmation
I have sighted email or other correspondence from all Co-authors confirming their
certifying authorship.
Name: Prof Yin Xiao Signature: Date:
04/Dec/2017
![Page 80: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/80.jpg)
54 Chapter 4: Research Part Two
![Page 81: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/81.jpg)
Chapter 4: Research Part Two 55
4.1 ABSTRACT
The finding presented in the previous part that Notch was upregulated during the
osteoblastic terminal differentiation generated the requirement to explore the
functions of Notch in osteocytes. During the transition from osteoblasts to osteocytes,
the cubic, proliferation, and collagen-secreting cells become dendritic, static, and
mineralisation-mediating cells. In this study, Notch signalling was inhibited by the
addition of DAPT or through siRNA interference, and changes in cell proliferation,
cell morphology, and mineralisation were evaluated to illustrate the Notch functions
in osteocytes. Specifically, FACS based on EdU labelled proliferation cells was
performed. To assess the cell morphological change, SEM was utilised as well as the
immunostaining of E11 proteins. In the mineralisation aspect, DMP1 expression was
verified plus with SEM and TEM images to evaluate the mineral structure,
transportation, and mechanical properties. The results suggested a comprehensive
role of Notch in osteocytes. After blocking Notch, the proliferation rate was
increased in the late differentiated osteoblasts. Also, it was difficult for cells to
generate dendritic processes when Notch signalling was deficient. Moreover, the
mineral could not infiltrate into the gap zone of collagenous fibrils after Notch
blockage. Under the same conditions, the crystal structure and binding force of
mineral nodules were also impacted. Moreover, intracellular mineral transportation
was abnormal with small particles that were not efficient for normal extracellular
mineral deposition. In summary, the data generated in this part provided relatively
solid evidence to support a critical role of Notch in osteocytes.
4.2 INTRODUCTION
Osteocytes embedded in bone matrix represent the most abundant bone cells. They
are derived from osteoblasts and experience a series of changes during the transition
that includes cessation of proliferation, morphological alteration (generation of
multicell dendrites), and biological function shift from secreting organic matrix to
guiding mineralisation [6]. Proliferation of the buried osteocytes is unlikely due to
the limited space enclosed by bone matrix.
Corresponding to these changes, osteocytes express identical markers like E11, (also
known as gp38 and podoplanin) and dentin matrix protein (DMP1). E11 is an early
osteocyte marker and necessary for the generation of dendritic processes [32]. The
![Page 82: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/82.jpg)
56 Chapter 4: Research Part Two
protein is highly hydrophobic and negatively charged [282]. The structure of the
protein is composed of extracellular and transmembrane domains as well as a
cytoplasm-tail, which can bind to other coeffective proteins. In osteocytes, E11
proteins are located only at the dendritic processes [28] and overexpression of E11
renders elongation of the dendrites in vitro [283]. E11 regulates the generation of
dendritic processes through binding to CD44 and ezrin-radixin-moesin complexes
[284, 285]. The cytoplasmic-tail region of CD44 in combinationwith ezrin-radixin-
moesin complexes is important in regulating the actin cytoskeleton [286-291].
DMP1 has been intensively investigated for its primary role in regulating
mineralisation [292]. DMP1 belongs to the SIBLING (small integrin-binding ligand
N-linked glycoproteins) family, which comprises most noncollagenous proteins in
bone. The highly phosphorylated property of DMP1 makes it possible to regulate
mineral formation and organisation, as well as phosphate homeostasis [2, 82, 293].
DMP1 binds to Ca2+ and then is phosphorylated to form a DMP1 complex. Only this
complex formation of DMP1 can be transferred to the extracellular matrix to direct
biomineralisation [294]. The highly negatively charged nature of DMP1 renders it
bind to the positively charged gap zone of collagenous fibrils and transfer the
calcium and phosphate in an amorphous style into the mineral sites [295-297].
Some evidence showing the regulation of E11 is available. It has been reported that
transcriptional factor Sp1/3 can upregulate E11 expression under the trigger by
hyperoxic pressure [298, 299]. Also, AP-1 regulates the transcription of E11 [300].
However, regulation of DMP1 was poorly understood until a recent study found that
TCF11 regulates DMP1 transcription in both osteocytes and odontoblasts [301].
Interestingly, TCF11 is closely related to the Notch signalling pathway, leading us to
consider the function of Notch in osteocytes [302, 303].
The results presented in the previous chapter showed Notch signalling is increased in
osteocytes, which is consistent with several recent findings [12, 13]. However, the
functions of Notch in osteocytes are largely unknown. So far, accumulating evidence
shows that Notch differentially regulates proliferation in a cell context-dependent
manner. In this chapter, we will discuss the specific function of Notch in the
proliferation of osteocytes. Further, the roles of Notch in osteocytes’ morphological
changes and cell mediated mineralisation will be tested as well.
![Page 83: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/83.jpg)
Chapter 4: Research Part Two 57
4.3 MATERIALS AND METHODS
4.3.1 Immunohistochemistry
The femoral samples from 6-month-old female Wistar rats were decalcified in 10%
EDTA and embedded in paraffin. Serial sections of 5 µm thick were cut from the
paraffin blocks with a microtome. Briefly, after dewaxing and hydration, slides were
heated at 75 °C in a pressure cooker for antigen retrieval. The endogenous
peroxidase activity was eliminated by incubating in 3% H2O2 for 15 min. Non-
specific proteins were blocked with 10% swine serum for 1 h. Samples were
incubated with primary antibodies against ki-67 (ab16667, Abcam; 1:100),
proliferation cell nuclear antigen (PCNA, M0879, DAKO; 1:100) and E11(ab10288,
Abcam;1:100) overnight at 4 ºC, followed by incubation with a biotinylated swine-
anti-mouse, rabbit, goat secondary antibody (DAKO) for 15 min at room
temperature, and then with streptavidin peroxidase (DAKO) for 15 min.
Diaminobenzidine (DAB) solution (DAKO) was then added for 3 min to visualise
the antibody complexes. The samples were counterstained with Mayer’s
haematoxylin for 15 s. Images of the stained slides were then captured using Axion
software under a light microscope (Carl Zeiss Microimaging) at various
magnifications.
4.3.2 Immunofluorescence
IDG-SW3 cells (kind gift from Professor Jerry Feng) and rat bone marrow–derived
mesenchymal stromal cells (BMSCs) were plated on 8-well chamber slides (177445,
Lab-Tek) at a density of 4,000 cells per well. The cells were washed 3 times with
ice-cold PBS followed by fixing with 2% paraformaldehyde (PFA) for 10 min at
room temperature. The cells were then incubated with 0.2% triton for cell
permeabilisation. Nonspecific proteins were blocked with the incubation of 1% BSA
in PBST for 30 min at room temperature. The primary antibodies, rabbit anti-Hes1
(ab71559, Abcam; 1:100) and mouse anti-E11 (ab10288, Abcam; 1:100), in PBST
with 1% BSA were applied and incubated at room temperature for 1 h. The samples
were then incubated with goat anti-mouse Alex Fluor 488 (A31560, Life
Technologies) and goat anti-rabbit Alex Fluor 647 (A21246, Life Technologies) at
room temperature for 30 min to detect the primary antibodies. The slides were
counterstained with DAPI (D1306, Life Technologies) and mounted with ProLong®
![Page 84: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/84.jpg)
58 Chapter 4: Research Part Two
Gold Antifade Reagent (P10144, Life Technologies). The images were captured
using a Nikon EclipseTi-S microscope and a Leica SP5 confocal microscope. Cell
counting was performed using Image J software.
4.3.3 Cell culture
Rat BMSCs were isolated and cultured based on protocols from previous studies
[274]. Briefly, 12-week-old female Wistar rats were sacrificed by CO2 asphyxiation.
Femurs and tibias were dissected from surrounding tissues. The epiphyseal growth
plates were removed, and the marrow was collected by flushing with Dulbecco’s
Modified Eagle Medium (DMEM) (11885, Gibco), containing 100 U/mL of
penicillin, 100 μg/mL of streptomycin, and 10% fetal bovine serum (FBS) with a
21G needle. Single cell suspension was prepared by passing the cell clumps through
an 18G needle. The obtained cells were seeded into the tissue culture flasks
containing DMEM with 100 U/mL of penicillin, 100 μg/mL of streptomycin, and
10% FBS. On day 2, half of the medium containing nonadherent cells was replaced
with fresh medium. The medium was changed completely on day 4. Only cells at an
early passage (P1–P2) were used in this study. After the cells had reached 70%–80%
confluence, the medium was changed completely with DMEM containing 100 U/mL
of penicillin, 100 μg/mL of streptomycin, and 10% FBS supplemented with
50 μg/mL of ascorbic acid, 10 nM of dexamethasone, and 8 mM of β-
glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The medium was
changed every 2–3 days for the duration of the experiment. IDG-SW3 cells were
expanded in proliferation conditions -33 °C in α-MEM (12571, Gibco) with 10%
FBS, 100 U/mL of penicillin, 50 µg/mL of streptomycin, and 50 U/mL of IFN-γ
(PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in 0.2 M acetic acid)-
coated plates. IDG-SW3 cells were induced towards osteocytes differentiation by
plating at 80,000 cells/cm2 in osteogenic differentiation conditions (37 °C with the
supplementation of 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the
absence of IFN-γ). Collagen-coated plates were necessary for both proliferation and
differentiation culture [256]. To inhibit the Notch signalling pathway, DAPT
(D5942, Sigma) diluted in DMSO was added to the culture medium at concentrations
indicated. The same amount of DMSO was applied as a control.
![Page 85: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/85.jpg)
Chapter 4: Research Part Two 59
4.3.4 siRNA knockdown
For knockdown of Hes1, IDG-SW3 cells were transfected with mouse siRNA
oligonucleotides targeting Hes1 (NM_008235, Sigma-Aldrich) using RNAimax
(Invitrogen) according to the manufacturer’s instructions and previous research
[166]. Briefly, IDG-SW3 cells were seeded on 6-well plates at 1*106 cells per well
one day before transfection. 50 nM siRNA targeting Hes1 and fluorescent universal
negative control siRNA (Sigma-Aldrich) were transfected with RNAimax reagent
(Invitrogen) in opti-MEM (Gibco) without serum for 6 h before the cells were
washed with PBS and changed to osteogenic medium. Samples were collected at 1,
3, and 7 days after transfection.
4.3.5 EdU labelling and FACS
Click-iT® EdU Alexa Fluor® 488 Flow Cytometry Assay Kit (C10420, Life
Technologies) was used in this experiment as per the manufacturer’s instructions.
Briefly, 10 μM EdU was added to the culture medium to label the proliferation cells
for 6 h [304]. For FACS, cells were harvested by 0.25% trypsin, followed by fixation
and adding Click-iT® reaction cocktail. The Alexa Fluor 488 quantify was performed
using a BD FACSAria3 cell sorter (BD Biosciences, CA, USA) with 530/30 nm
filter. The data were analysed by FACSDiva version 6.1.3. For fluorescent
microscope observation, cells were fixation directly on the cell plates after 6 hours’
incubation with EdU and detection. Images were taken by Nikon EclipseTiS
microscope.
4.3.6 Western blot
The whole cell lysates were collected by adding 250 µL cell lysis buffer with
protease inhibitor (cOmplete, EDTA-free 04693132001, Roche) and phosphatase
inhibitor (PhosSTOP, 04906845001, Roche) for the Western blotting detection. A
total of 15 μg of proteins from each sample were separated on SDS-PAGE gels and
then transferred onto a nitrocellulose membrane (Pall Corporation). After being
blocked in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences),
the membranes were incubated with primary antibodies against Hes1 (1:1000,
ab71559, Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from
Professor Jerry Feng of the Texas A&M University Baylor College of Dentistry), and
α-Tubulin (1:2000, ab15246, Abcam) overnight at 4°C. The membranes were then
![Page 86: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/86.jpg)
60 Chapter 4: Research Part Two
incubated with anti-mouse/rabbit fluorescence conjugated secondary antibodies at
1:10000 dilutions for 1 h at room temperature. The protein bands were visualised
using the Odyssey Infrared Imaging System (LI-COR Biosciences). The relative
intensity of protein bands was quantified using Image J software. The experiments
were repeated three times and a representative blot is displayed.
4.3.7 Quantitative reverse transcription polymerase chain reaction (RT-qPCR)
Total RNA was extracted using TRIzol reagent (15596-018, Life Technologies) for
RT-qPCR detection. RNA yield was measured using a NanoDrop 1000
spectrophotometer (Thermo Fisher Scientific). Complementary DNA was
synthesised from 500 ng of total RNA using DyNAmoTM cDNA Synthesis Kit (F-
470L, Finnzymes, Thermo Scientific) following the manufacturer’s instructions. RT-
qPCR primers (Table 1) were designed based on cDNA sequences from the NCBI
Sequence database. SYBR Green qPCR Master Mix (4344463, Invitrogen) was used
for detection, and the target mRNA expressions were assayed on the 7500 Fast Real-
Time PCR System (Applied Biosystems). Experiments were performed in triplicate.
The mean cycle threshold (Ct) value of each target gene was normalised to the Ct
value of the housekeeping gene GAPDH.
Table 2: The primers for RT-qPCR
Fwd_DMP1 GCATCCTGCTCATGTTCCTTTG
Rev_DMP1 GAGCCAAATGACCCTTCCATTC
Fwd_E11 GTCCAGGCGCAAGAACAAAG
Rev_E11 GGTCACTGTTGACAAACCATCT
4.3.8 SEM
IDG-SW3 cells cultured for 3 weeks were fixed in 2.5% glutaraldehyde at 4 °C for
1 h and dehydrated through a series of increasing concentrations of ethanol (50%,
70%, 90%, 100%, and 100% vol/vol) for 5 min each. Samples were coated with 1–
2 nm gold–palladium and viewed under a Zeiss Sigma variable-pressure (VP) field-
emission scanning electron microscope (SEM).
![Page 87: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/87.jpg)
Chapter 4: Research Part Two 61
4.3.9 TEM
Mineralised cultures were fixed in 2.5% glutaraldehyde at 4 °C for 1 h, postfixed in
osmium tetroxide, dehydrated in a graded ethanol series, treated with acetonitrile,
and finally infiltrated with a Quetol-based resin. Embedded samples were
polymerised at 60 °C for 24 h, sectioned (75 nm) using a Leica EM UC7 ultra
microtome and collected on bare 300 mesh copper TEM grids followed by post-
staining with uranyl acetate and lead citrate. Transmission electron microscope
(TEM) observation and selected area electron diffraction were performed using
JOEL 1400 at 80 kV.
4.3.10 AFM
The binding forces were measured using a method described previously [305].
Briefly, samples were prepared using a protocol for SEM; images were taken before
and after the AFM tests to calculate the level of mineral removal. The AFM system
Nano surf FlexAFM (Nanosurf AG, Switzerland) and the rectangular cantilever
ACLA (AppNano) were used. The cantilever tip has a pyramidal tip with a front
angle of 9°. The cantilever spring constant was determined to be around 40.46 N/m.
The sensitivity calibration S of the cantilever is performed by indenting a hard
surface to measure the slope of the force–height curve. The lateral detachment force
was determined based on the total compression of the cantilever, probe geometry,
and cantilever orientation.
4.3.11 Calcium concentration
The calcium concentration of cells was determined using the calcium detection kit
(ab102505, Abcam). The optical densities (ODs) were tested on a Bio-Rad
microplate reader at 575 nm. All the results were normalised to the (–DPAT) group.
Three independent experiments were performed in triplicate.
4.3.12 Statistical analysis
Different statistical methods and comparisons were used as indicated in the figures
and legends.
![Page 88: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/88.jpg)
62 Chapter 4: Research Part Two
4.4 RESULTS
4.4.1 Notch inhibits proliferation of late osteoblasts
The fact that osteocytes do not undertake proliferation is widely accepted; however,
the proliferation rate of osteoblasts, especially mature osteoblasts, still causes
controversy [306, 307]. Immunohistostaining of samples from rat femur were
conducted to assess expression of the proliferation markers PCNA and ki-67 to
provide more solid evidence to clarify this question. The results showed negative
staining of those markers in osteocytes, which was consistent with the exist
understanding of osteocytes. We also found that some mature osteoblasts located on
the bone surface still presented proliferation activity (Fig. 14). These findings
supported the view that mature and functional osteoblasts that secreted organic
matrix are still in the cell cycle. Osteoblasts have three destinations: apoptosis, bone
lining cells, and osteocytes [308], so the proliferation of osteoblasts is important to
replenish the cells lost.
Figure 14: Ki-67 and PCNA immunohistochemistry staining of rat femur samples.
Ki-67 (left) and PCNA (right) immunohistochemistry staining of rat femur samples.
Osteoblasts and osteocytes as indicated. None of the osteocytes embedded in the
bone matrix stained positive for the proliferation markers. By contrast, osteoblasts
located on the bone surface stained positive for these markers. Scale bar: 10 μm.
We also conducted osteogenic culture of rat BMSCs and observed the proliferation
rates by EdU labelling at different differentiation time points. The results showed
that the proliferation rate was increased during the early differentiation stages from
day 1 to day 3. Interestingly, however, the proliferation rate was strikingly declined
![Page 89: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/89.jpg)
Chapter 4: Research Part Two 63
at the late stage of differentiation, indicating that most cells presented an osteocyte
phenotype at that stage (Fig. 15).
Figure 15: EdU labelled rat BMSC in osteogenic culture.
At day 7 of osteogenic culture, the cell proliferation rate was dramatically decreased,
indicating that at that stage, differentiated cells composed the majority of the
population. The bar graph shows the counting of EdU positive cells. Scale bar:
50 μm. n=3, unpaired Student’s t test, comparison as indicated, * p < 0.05.
Comparison as indicated.
![Page 90: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/90.jpg)
64 Chapter 4: Research Part Two
Figure 16: FACS based on EdU labelled BMSCs in osteogenic culture.
At late differentiated stages day 7 and day 14, only 4.9% and 2.5% of cells were in
proliferation, showing most of the cells had exited from the cell cycle. When LiCl
was added into the osteogenic culture, the proliferation rates rose to 11.7% and 17.7%
respectively. These results suggested Wnt’s sole role in promoting cell proliferation.
When Notch was inhibited by adding DAPT, the proliferation rate was 4.7% at day 7,
but no significant changes were observable in normal osteogenic culture. But the rate
![Page 91: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/91.jpg)
Chapter 4: Research Part Two 65
increased robustly to 54.0% at day 14, indicating a further late function of Notch in
repressing cell proliferation. The bar graph shows cell proliferation ratios based on
EdU labelled cell counting. Of note, BMSCs in normal culture presented relatively
high proliferation rates at both day 7 and day 14, which further confirmed that most
cells lost proliferation capacity in late osteogenic culture. n=3, unpaired Student’s t
test, comparison as indicated, * p < 0.05. Comparison as indicated.
The EdU labelled cells were also quantified by FACS. Consistent with the above
results, the cells presented low proliferation rates at the terminal differentiation
stages: 4.9% at day 7 and 2.5% at day 14 (Fig. 16). Another interesting finding was
that proliferation rates underwent significant changes when Wnt and Notch
signalling pathways were chemically induced. Specifically, proliferation rate was
increased when Wnt was activated by adding LiCl at both day 7 and day 14. When
Notch signalling was inhibited by DAPT, the proliferation rate was not changed on
day 7 but increased significantly to 54% by day 14, which suggested Notch might
have an important role to stop cell proliferation at the terminal differentiation. This
phenomenon was quite different from the undifferentiated and early differentiated
stages, in which Notch promoted cell proliferation (Fig. 17). Our findings presented
here suggest that Notch indeed regulates proliferation differently in a cell context-
dependent manner. More specifically, although Notch promotes proliferation in stem
cells and early differentiated cells, it facilitates the exit of the cell cycle in the
terminal differentiation, just like its role in the skin [309, 310].
Osteocytes lose the capacity to proliferate since the lacunar space in which
osteocytes are embedded provides limited space for cell growth. However,
osteoblasts are highly metabolic cells with proliferation, which implies that the
cessation of proliferation may represent a major event during the transition from
osteoblasts to osteocytes. The role of Notch in supressing proliferation in late
differentiated osteoblastic cells renders that if Notch does not determine, it is at least
required for, the formation of osteocytes.
Consistent with the arrest of the cell cycle, the Wnt/β-catenin signalling pathway is
decreased during the terminal differentiation, which is highly related to proliferation.
To the best of our knowledge, no report shows that Wnt signalling can inhibit cell
proliferation, indicating the sole role of Wnt in the cell cycle in contrast to the
![Page 92: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/92.jpg)
66 Chapter 4: Research Part Two
versatile Notch signalling pathway [311, 312]. Hence, we suppose here that the
Notch signalling pathway plays an active role in interaction with the Wnt signalling
in regulating the cell cycle in terminal differentiation.
Figure 17: FACS based on EdU labelled BMSCs and MC3T3 cell line in normal
culture after 3 days. Inhibition of Notch by adding DAPT in normal culture medium
caused decreases of proliferation from 33.7% to 29% in rat BMSCs and 26.9% to
16.6% in MC3T3 cell line. These results indicated an opposite function of Notch on
proliferation at the early differentiation stage.
4.4.2 Notch is required for cell mediated mineralisation
Notch is required for the expression of osteocyte markers
For a decade, DMP1 has been considered as a critical marker of osteocyte that has an
important role in mineralisation. The IDG-SW3 cells express GFP under the
direction of the DMP1 promotor. This property makes this cell line a powerful tool
for osteocyte research. We blocked Notch signalling by adding a gradient
concentration of DAPT, a γ-secretase inhibitor and an indirect deactivator of Notch,
to test whether Notch regulates DMP1 expression. IDG-SW3 cells expressed
intensive GFP after 14 days of culture in osteogenic differentiation medium;
however, the intensity of GFP gradually decreased with the increasing concentration
![Page 93: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/93.jpg)
Chapter 4: Research Part Two 67
of DAPT. The GFP could not be detected when IDG-SW3 cells were cultured with
50 μM DAPT (Fig. 19). This downregulation of DMP1 by blocking Notch had also
been confirmed at both transcription and translation levels (Fig. 18).
Figure 18: Western blots showed IDG-SW3 cell line expressed DMP1.
The expression was inhibited remarkably after the supplementation of DAPT to
block Notch signalling. Relative band intensity was calculated based on Western
blotting results. RT-qPCR results were consistent with Western blots. n=3,
* p < 0.05, ** p < 0.01, unpaired Student’s t test, comparisons between –DAPT and
+DAPT groups at the corresponding time points.
qRT-PCRWestern blot
![Page 94: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/94.jpg)
68 Chapter 4: Research Part Two
Figure 19: Live cell fluorescent images showed GFP activity representing DMP1
expression gradually increased during IDG-SW3 cell osteogenic differentiation. The
increasing concentration of DAPT added into the culture system led to a gradual
decrease of GFP intensities. And when the concentration of DAPT reached 50μM,
the GFP was nearly eliminated. Scale bar: 50 μm.
In order to exclude the possibility that DAPT may affect normal cell activities,
siRNA interference was performed to knock down the expression of Hes1. The result
was consistent with the DAPT treated experiment; that is, when Hes1 expression was
interfered by siRNA, the expressions of both DMP1 and E11 were significantly
reduced compared with the groups transfected with universal negative control siRNA.
![Page 95: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/95.jpg)
Chapter 4: Research Part Two 69
Figure 20: RT-qPCR results showed the transcription of Hes1, Notch1, DMP1, and
E11 after Hes1 expression was intefered by siRNA targeting Hes1 after 3 days of
treatment. Control represents normal IDG-SW3 cells, siRNA represents IDG-SW3
cells transfected with universal negative control siRNA, siRNA represents IDG-SW3
cells transfected with siRNA targeting Hes1. n=3 wells per group. * p < 0.05,
comparison made between each two groups. (unpaired Student’s t test). There was no
significant change between control and negative siRNA groups.
Inhibition of Notch signalling disturbs both extracellular and intracellular mineralisation mediated by osteocytes
The general mineralisation was examined by von Kossa staining. After 14-day
osteogenic differentiation, many mineral nodules were formed by IDG-SW3 cells,
while the number and diameter of the nodules were significantly reduced in the
DAPT group (Fig. 21). Moreover, the ultrastructures of the mineral nodules were
observed under TEM. In normal mineralisation, plenty of mineral particles are
closely attached to collagen fibrils; in contrast, the mineral particles were randomly
deposited and showed a lack of tight connection to collagen. As the main function of
DMP1 is to prevent the spontaneous deposition of calcium phosphate and modulate
the transportation and integration of CaP to the gap zone of collagen fibrils [294],
this abnormal mineralisation could be attributed to the lack of DMP1 in the DAPT
group. In accordance with a series of reports on intracellular mineralisation [295,
297, 313, 314], mineral vesicles with appropriate size were observed in the
cytoplasm. However, when cultured with the supplementation of DAPT, the
intracellular mineral particles were much smaller and sparsely distributed in the
![Page 96: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/96.jpg)
70 Chapter 4: Research Part Two
cytoplasm (Fig. 22). Intracellular mineralisation is a key step for normal
biomineralisation, although the mechanism that controls this process is largely
unknown. The calcium concentration in cells had been determined, and the results
showed a decrease in Notch-inhibited IDG-SW3 cells. This evidence supported the
findings of Narayanan and co-workers, which suggested unphosphorylated DMP1
promotes the influx of calcium ions from extracellular fluid [34].
Figure 21: IDG-SW3 cells formed mineralised nodules shown by von Kossa staining
and TEM images. IDG-SW3 cells (–DAPT) formed more mineralised nodules
compared with a group of (+DAPT) as shown by von Kossa staining. TEM images
showed (–DAPT) minerals (upper: A, B, and C) were penetrated into and closely
related to collagen fibrils (red arrow), while (+DAPT) minerals (lower: D, E, and F)
were deposited on the surface of collagen, and it was difficult for the mineral to
infiltrate into the gap zone of the collagenous fibrils (red arrow).
![Page 97: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/97.jpg)
Chapter 4: Research Part Two 71
Figure 22: TEM images of IDG-SW3 showing intracellular mineral particles.
TEM images of IDG-SW3 (–DAPT) cells showed aggregated minerals located in
plasma. In contrast, there were only sparse and small minerals observed in (+DAPT)
cells. The bar graph showed intracellular calcium concentration also decreased in
(+DAPT) cells. n=3, * p < 0.05, unpaired Student’s t test, normalised to –DAPT
group.
Notch signalling influenced the mechanical properties of mineralisation
Most previous studies focused on the quantity of mineral nodules to reflect
mineralisation [13]. However, the quality, more specifically the mechanical
properties of the mineralisation, should also be considered. In this study, we tested
the crystal structure of the nodules using selected area electron diffraction (SAED)
[315]. The nodules formed by IDG-SW3 cells in differentiation condition presented a
similar diffraction pattern to that of normal bone, indicating the structure of normal
nodules resembled normal bone. In contrast, after Notch was inhibited the diffraction
pattern was less distinct, which meant that the crystal structure of nodules formed by
osteocytes was abnormal due to the lack of Notch signalling (Fig. 23). To provide
more convincing evidence, we also performed an AFM test to determine the binding
force of the mineral nodules [316]. After a detachment force of 35 μN was applied,
![Page 98: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/98.jpg)
72 Chapter 4: Research Part Two
there were nearly no nodules that could be removed in the normal group (Fig. 24 A
and B). However, evidently most nodules were removed from cell culture plates in
the DAPT group under the same detachment force (Fig. 25 C and D). For
quantitative analysis, three levels of mineral nodule removal were established
according to the percentage of mineral nodules removed: high (42%), medium
(18%), and low (8%), respectively. Significantly higher detachment force was
required to remove mineral nodules in the IDG-SW3 normal mineralisation group. In
other words, normal mineral nodules combined more tightly to collagen (Fig. 24 E).
Figure 23: SAED analysis revealed the crystal structure of mineral nodules.
The crystal structure of minerals formed by IDG-SW3 (–DAPT) cells resembled that
of normal bone, which was distinct from that of the (+DAPT) group. Arrows indicate
crystalline standard diffraction planes of 002, 211, and 004, which are characteristics
of native bone.
![Page 99: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/99.jpg)
Chapter 4: Research Part Two 73
Figure 24: Binding force assay.
Three levels of removal were defined as high (42%), medium (18%), and low (8%).
At all these levels, the forces applied to detach minerals were higher in the (–DAPT)
group than the (+DAPT) group, indicating the binding force of minerals was greater
in the (–DAPT) group. All the data are shown as mean ± standard deviation;
* p < 0.05 indicated the significant difference of the forces between –DAPT and
+DAPT groups using unpaired Student’s t test.
4.4.3 Notch plays a role in the morphological change from osteoblasts to
osteocytes
E11 is the earliest osteocyte that is expressed on the cell membrane and involves the
generation of dendrites. The immunofluorescent staining of E11 and ki-67 showed
mutually exclusive expression of these two markers, which further confirmed that
osteocytes lose proliferation ability (Fig. 25 A, B). The expression of E11 was
![Page 100: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/100.jpg)
74 Chapter 4: Research Part Two
restricted in osteocytes (Fig. 25.C). All these data suggested that E11 is an osteocyte-
specific marker and an ideal indicator to represent the transition towards osteocytes.
Figure 25: E11 is an osteocyte marker.
(A): Immunofluorescence staining of E11 and ki-67 of rat BMSC osteogenic culture
at 7 and 14 days. The immunofluorescence staining showed that some cells started to
express E11 7 days after osteogenic induction. Interestingly, the E11 positive cells
were surrounded by ki-67 positive cells. Scale bar: 50 μm. (B): Confocal microscope
image of rat BMSC osteogenic culture on day 14. Confocal microscope observation
showed that the cells stained positive for E11 were mainly expressed at the typical
multidendrites as morphological characteristics of osteocytes. Scale bar: 20 μm. (C):
Immunohistochemistry staining of E11 in rat femoral tissues, which confirmed that
E11 was expressed in the osteocytes (as indicated by black arrow) but not in the
osteoblasts.
Scale bar: 20 μm.
![Page 101: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/101.jpg)
Chapter 4: Research Part Two 75
Figure 26: E11 expression at both protein and RNA levels.
Western blots showed the IDG-SW3 cell line expressed E11 as the osteogenic
culture. The expression was inhibited remarkably after the supplementation of DAPT
to block Notch signalling. Relative band intensity was calculated based on Western
blotting results. RT-qPCR results were consistent with Western blots. n=3,
** p < 0.01, unpaired Student’s t test, comparisons between –DAPT and +DAPT
groups.
E11 plays a role in the development of dendrites, which is a unique morphological
characteristic of osteocytes. We conducted immunofluorescent (IF) staining of E11
in IDG-SW3 cells. As the fixation procedure could destroy the GFP activity, the
spontaneous GFP would not affect the IF staining. Confocal images confirmed that
E11 was strongly expressed in the cytoplasm of IDG-SW3 cells cultured in
differentiation medium, while the expression was obviously inhibited when DAPT
was added (Fig. 27), which was consistent with the Western blot and qRT-PCR
results (Fig. 26). Morphological analysis showed a significant decline in both
dendrite length and dendrite number when Notch signalling was inhibited (Fig. 27).
Western blot qRT-PCR
![Page 102: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/102.jpg)
76 Chapter 4: Research Part Two
Figure 27: Morphological characteristics of IDG-SW3 cells.
Immunofluorescent staining of E11 (green) and DAPI (blue) were observed under
confocal microscope. IDG-SW3 (–DAPT) cells presented clear dendrite structure
and high expression of E11 (A). No clear dendrite structure was found in IDG-SW3
(+DAPT) cells (D). Scale bar: 75 μm. SEM images (right column) also revealed
![Page 103: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/103.jpg)
Chapter 4: Research Part Two 77
similar morphological changes in the (+DAPT) group (B, C and E, F). Scale bar:
10 μm. (G) Statistical analysis based on the confocal images using Autoquant and
Imaris software as described by Ren et al.[317] confirmed both length and number of
dendrites were significantly reduced in the (+DAPT) group. n=3, ** p < 0.01,
unpaired Student’s t test, comparisons between –DAPT and +DAPT groups.
4.5 DISCUSSION
The Notch signalling pathway is versatile in nature in correlations with various
contexts [318, 319]. More confusingly, Notch promotes proliferation and tumour
development in some circumstances such as T-cell leukaemia [320, 321] but cell
apoptosis or proliferation suppression in others such as small-cell lung cancer [322-
324]. Notch was even found to present both oncogenic and tumour-suppressive
properties in cervical cancer [325-327]. Osteocytes cannot proliferate because they
are surrounded by hard bone tissue. In other words, exit from the cell cycle is a
prerequisite for cells to become osteocytes. Consistent with those reports, the data
presented here showed that Notch promoted proliferation of BMSCs and osteoblastic
progenitors but inhibited proliferation of late stage osteoblasts. This paradoxical
nature of Notch exactly supports the cell context-dependent manner of its biological
functions, as introduced previously [10].
On the other hand, the relationship between proliferation and the Wnt signalling
pathway is quite simple and direct. The Wnt signalling pathway remarkably
promotes cell proliferation regardless of cell type and differentiated stage [328-330].
So, it is easy to understand that Wnt signalling is suppressed during the terminal
differentiation of osteoblasts because the proliferation is stopped. It seems that in
determining cell cycle exit, Notch signalling plays an active role while Wnt is
passively downregulated due to the high Notch activity. Detailed studies will be
conducted to illustrate the relationship between Notch and Wnt signalling pathways
in the next chapter.
Bones need both rigidity and resilience to maintain physical function. The
compromise between rigidity and resilience can be attributed to the proper ratio of
organic collagen to the mineral component, as well as the structure of mineral
crystallite in terms of shape, size, and crystallinity [331]. Bone matrix is deposited by
![Page 104: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/104.jpg)
78 Chapter 4: Research Part Two
osteoblasts, then mineralisation is executed by osteocytes. As osteoblasts are far
away from the mineral frontline, it is believed that the osteocytes embedded in
osteoid have an important role in the mineralisation process [42]. Feng and
colleagues found that the mineralisation started at the proximal sites of osteocytes,
then extended to the distal sites, and there was a clear boundary between two
fluorochromes [2]. Quantitative information has also been reported, showing that
60% of the minerals reside within a distance less than 1 μm from the canaliculi and
80% of the minerals are located within a distance of 1.4 μm [59]. Even after
apoptosis, because access for other cell types is nonexistent, the lacuno–canalicular
space is infilled with minerals and the remnant osteocyte structures become
mineralised by themselves, leaving the dead osteocytes as a fossil [86]. Taken
together, all the evidence reviewed above indicates it is osteocyte, rather than
osteoblast, that mediates collagen mineralisation.
The collagen acts as the scaffold and template to guide mineralisation. Moreover, it
positively promotes the infiltration of amorphous calcium phosphate [332]. The
major mineral component of bone, hydroxyapatite, does not crystallise spontaneously
as it depends on specific extracellular matrix proteins to form nucleated amorphous
calcium phosphate (ACP) particles. ACP particles then ripen and expand in scale,
and eventually form hydroxyapatite [333]. Intensive studies have focused on the
mineral regulatory function of noncollagenous proteins, among which DMP1 is the
best known player, in matrix-mediated mineralisation. DMP1 has binding sites to
both calcium phosphate and collagen [334]. It has been reported that the c-terminal
fragment of DMP1 mediated osteocyte maturation and mineralisation [2]. In an in
vitro study, DMP1 has been shown to prevent unregulated calcium phosphate
precipitation in solution and promote controlled nucleation of mineral particles by
stabilising calcium phosphate and transferring it to the gap region of collagen where
it would then be deposited and crystallised. This process can also be attributed to that
phosphorylated DMP1 can form negatively charged mineral complexes and this
property helps mineral to infiltrate into collagen fibrils carrying a positive charge
[294, 332]. Consistent with this observation, an unregulated spontaneous mineral
precipitation that is randomly deposited without normal organisation or connection
with collagen has been found in osteocytes lacking DMP1 in our experiment. The
relationship between DMP1 and mineralisation is clear, although the specific
![Page 105: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/105.jpg)
Chapter 4: Research Part Two 79
mechanism involved in this process in vivo is still largely unknown. We have
presented solid evidence in this report that Notch is required for the normal
expression of DMP1, providing clear explanations for the role of Notch in cellular
mineralisation.
In this study, an abnormal intracellular mineralisation has been observed in
osteocytes with Notch signalling blockage. Normally, calcium phosphate deposits are
located intracellularly in osteocytes, especially in mitochondria with an average size
of 50~80 nm, but in Notch-inhibited osteocytes, the globules are smaller with
disordered morphologies [297, 313]. These abnormal mineral particles are secreted
into the extracellular matrix, delivered by vesicles containing calcium phosphate.
Hence, the intracellular mineralisation is a key step in normal biomineralisation.
However, the specific mechanism that controls this process remains unknown [295].
We have provided evidence that shows that intracellular mineralisation is disturbed
when Notch signalling is inhibited. It is possible that Notch not only affects
extracellular mineralisation by inhibiting DMP1 but also interferes with intracellular
mineralisation via unknown mechanisms. Karthikeyan et al. suggested that
nonphosphorylated DMP1 can activate accumulation of intracellular calcium ion.
Furthermore, this influx of calcium into the cell involves controlling gene
transcription [34]. The latest research has already revealed that intracellular transport
of calcium plays a critical role during bone formation and DMP1 can trigger the
release of calcium from endoplasmic reticulum (ER) stores [335]. There is a
possibility that DMP1 can also regulate intracellular mineral activities, which may
explain our observations of disordered intracellular mineralisation in osteocytes
when Notch signalling is inhibited.
The collagen matrix secreted by osteoblasts and the mineral that infiltrates into
collagen under strict direction from osteocytes are essential to normal mineral tissues
with physical function – reaching an equilibrium between rigidity and resilience. Our
study has demonstrated that Notch signalling promotes a highly organised integration
of collagen and mineral through activating DMP1 expression with the possible
involvement of other noncollagenous proteins. Further research on the relationship
between Notch signalling and mineralisation is warranted to provide new knowledge
in this little studied area and form a basis for developing novel approaches and
biomaterials for bone regenerative applications.
![Page 106: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/106.jpg)
80 Chapter 4: Research Part Two
The morphological transformation from a cube-like cell to a multidendritic
appearance is the most intuitionistic change from osteoblasts to osteocytes. E11 is an
important factor controlling the changes in cell skeleton [29]. Here, we showed that
E11 was severely impacted after Notch was inhibited by supplementation with
DAPT during IDG-SW3 cell line differentiation. The formation of dendrites was also
deficient, as expected. In summary, our findings presented in this chapter suggest
that Notch plays a key role in regulating the morphological transformation of cells
during the formation of osteocytes.
4.6 CONCLUSIONS
In conclusion, the data generated in this part of the research provided clear evidence
to support a comprehensive role of Notch in osteocytes in terms of regulating
proliferation, cell morphology, and mineralisation.
![Page 107: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/107.jpg)
Chapter 5: Research Part Three 81
Chapter 5: Research Part Three
The regulatory mechanism of Notch
signalling in osteocyte and its crosstalk with
other signalling pathways
—To explore how Notch regulates
osteocytes markers DMP1 and E11, as well
as the crosstalk between Notch, Akt, and
Wnt signalling pathways
![Page 108: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/108.jpg)
![Page 109: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/109.jpg)
Chapter 5: Research Part Three 83
Suggested Statement of Contribution of Co-Authors for Chapter by
Published Paper
In the case of this chapter
Title: The regulatory mechanism of Notch signalling in osteocyte and its
crosstalk with other signalling pathways
Date, status, journal: Nov 2017, Submitted, received comments and under revision,
Bone
Contributor Signature Statement of contribution
Jin Shao Designed of the research, performed laboratory
experiments, data analysis and interpretation. Wrote
the manuscript.
Yinghong Zhou Assisted with data analysis and reviewed the
manuscript
Yin Xiao Involved in the conception and design of the
project, supervised this work.
Principal Supervisor Confirmation
I have sighted email or other correspondence from all Co-authors confirming their
certifying authorship.
Name: Prof Yin Xiao Signature: Date:
04/Dec/2017
![Page 110: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/110.jpg)
84 Chapter 5: Research Part Three
![Page 111: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/111.jpg)
Chapter 5: Research Part Three 85
5.1 ABSTRACT
In order to gain insight into the mechanisms underlying the functions of Notch in
regulating osteocytes’ metabolism and functions, we performed luciferase assay by
cloning the proximal E11 and DMP1 promotor regions into pGluc-Basic 2 vectors,
which were subsequently transfected into IDG-SW3, MC3T3, and 293T cell lines.
To activate Notch signalling, we utilised two approaches; one was using a Notch1
extracellular antibody coated cell culture plate, and the other was co-transfecting a
Hes1 overexpression vector. The interactions between the Notch and Wnt signalling
pathways were probed by Western blot analysis to assess the expression of a series of
phosphorylated proteins involved in the cascade of both signalling pathways. Our
data suggested that Notch signalling regulates E11 expression through Hes1 activity,
while Hes1 only could not initiate the expression of DMP1. It is of interest that the
regulatory function of E11 by Hes1 was not observed in the 293T cell line, indicating
a cell context-dependent manner of the Notch signalling pathway. In the signals
crosstalk, we found that Notch inhibited Wnt signalling at the late differentiated
stage by both directly repressing phosphorylation of Akt and preventing the nuclear
aggregation of β-catenin.
5.2 INTRODUCTION
In the previous chapters, we have shown that Notch signalling plays a critical role in
osteocyte formation and function. In this research chapter, the mechanism of how
Notch regulates those biological processes will be investigated.
The Notch intracellular domain (NICD) is the sole intracellular active component in
the Notch signalling cascade. However, NICD executes transcriptional regulation by
targeting a broad range of transcriptional factors. Most notably, Notch target genes in
mammals are hairy/enhancer of split (Hes1-7) and Hesrelated transcriptional factor
(Hey1, 2, and l) gene families [9], which both belong to basic helix-loop-helix
(bHLH) transcription factors working as transcriptional repressors [336]. The bHLH
proteins are composed of the basic and HLH domains, which have distinct functions.
Specifically, the basic domain determines to bind with specific DNA sequences,
while the HLH domain helps to form a dimer as an active configuration [337]. Hes
and Hey are subclassified to class C of bHLH proteins and bind to class C sites
(CACGNG), N-box (CACNAG), and (CANGTG), which are subtypes of the E-box
![Page 112: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/112.jpg)
86 Chapter 5: Research Part Three
(CANNTG) [338-341]. Each bHLH family has highly conserved amino acid
sequences, and the distinction between Hes and Hey is a proline residue in the basic
region on Hes while a glycine is on the corresponding site [342].
The Hes family is classified as transcriptional repressor, which does not completely
describe its nature. Actually, the regulatory mechanisms of Hes proteins’ mediated
transcriptional activities are quite complex [343]. Indeed, accumulating evidence
supports its repressive role and reveals the detailed molecular mechanisms [344-347].
In an active model, Hes proteins recruit histone deacetylase to restrain the chromatin
structure and seal the transcriptional start sites [348]. In a passive model, Hes
proteins form a heterodimer with other transactive bHLH proteins, resulting in
repression of those transactive factors [349]. However, there has been some evidence
to suggest that Hes1 can directly activate some genes in combination with
transcriptional complex [350]. For instance, Hes1 has been reported to directly
activate the promotor of mammalian achaete-scute homologue (Mash1) in
neurogenesis with the help of poly adenosine diphosphate–ribose polymerase-
1(PARP1) [324, 351, 352]. Although the molecular mechanisms modulating Hes1
functions remain elusive, accumulating reports have shown the dual function of Hes1
in transcriptional regulation in a cell context-dependent manner.
The main types of receptor and ligand involved in osteogenesis are Notch1 and
Jagged (Jag1) [208]. During the transition from osteoblasts to osteocytes, Hes1 is
upregulated rather than Hes3 and Hes5. Together with the Hes3 and Hes5 null mice
displayed no skeletal phenotype, indicating that Hes1 is a major target of Notch
signalling conduction in the skeleton [353, 354]. Several studies suggest that Sp1/3
regulates E11 expression in lung type I cells [298]. And AP-1 promotes E11
expression in osteosarcoma [300]. A more recent study reveals that TCF-11 regulates
DMP1 expression in odontoblasts and osteocytes [301]. The TCF-11 transcription
factor is closely related to Notch signalling through transcription factor GATA3
[355]. The Dll/Notch combination induces GATA3 mRNA expression in T-lineage
[356]. However, whether the Notch signalling pathway directly regulates E11 and
DMP1 expression in osteocytes remains to be addressed.
The temporal interaction of Notch and Wnt signalling has been found to play a role
in key steps of differentiation in a wide range of tissues and organs including muscle,
liver, cochlea, and breast cancer [271-273]. And a series of intracellular molecules
![Page 113: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/113.jpg)
Chapter 5: Research Part Three 87
have been identified as potential cross points that bridge these two signalling
pathways. For example, glycogen synthase kinase-3 (GSK-3β) is involved in the
temporal switch between Notch and Wnt in mouse myogenesis [271]. Active GSK-
3β induces the degradation of β-catenin when phosphorylated at tyrosine 216,
whereas it stabilises β-catenin when phosphorylated at serine 9 as inactive mode
[186, 357, 358]. An upstream regulator of GSK-3β is the serine-threonine kinase
(Akt) in the PI3K/Akt signalling pathway, which enhances phosphorylation at the
tyrosine 216 site [359, 360]. Akt itself is regulated by Notch signalling in a cell
context-dependent manner. Notch presents a positive relationship with p-Akt through
inhibiting the phosphatase and tensin homologue (PTEN), a suppressor of p-Akt
[190, 192, 361]. However, in the case of absent PTEN, Notch directly inhibits p-Akt
through Hes1 activity [193, 194]. It is still unclear which regulatory mechanism
dominates the relationship between Notch and p-Akt in osteoblastic lineage.
In bone formation, it has been well established that Wnt signalling is downregulated
during the terminal differentiation of osteoblasts [50]. However, few studies had
focused on Notch signalling in the terminal differentiation before Liu et.al showed
that Notch was required in bone mineralisation [13]. Although this new finding
revealed an important role of Notch in the terminal differentiation of osteoblasts, the
mechanism of Notch in the osteoblasts’ fate decision is still largely unknown. In
terms of the crosstalk of Notch and Wnt in the transition from osteoblasts to
osteocytes, there is not any report on this topic, leaving a huge knowledge gap to be
addressed.
In this study, we established an expression pattern of a temporal switch from Notch
to Wnt during the terminal differentiation of osteoblasts. Then, we revealed that
Notch directly regulated the earliest marker of osteocyte, E11, through Hes1 activity,
which was the first evidence of Notch’s essential role in the terminal differentiation
towards osteocytes. To address the crosstalk between Notch and Wnt signalling, we
also found that GSK-3β might be a molecular bridge that contributes an antagonistic
relationship between these two signalling pathways in osteocyte formation.
![Page 114: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/114.jpg)
88 Chapter 5: Research Part Three
5.3 MATERIALS AND METHODS
5.3.1 Cell culture
Rat BMSCs were isolated and cultured based on protocols from previous studies
[274]. Briefly, six 24-week-old female Wistar rats were sacrificed by CO2
asphyxiation. Femurs and tibias were dissected from surrounding tissues. The
epiphyseal growth plates were removed, and the marrow was collected by flushing
with DMEM (11885, Gibco) containing 100 U/mL of penicillin, 100 μg/mL of
streptomycin, and 10% FBS with a 21G needle. Single cell suspension was prepared
by passing the cell clumps through an 18G needle. The obtained cells were seeded
into the tissue culture flasks containing DMEM containing 100 U/mL of penicillin,
100 μg/mL of streptomycin, and 10% FBS. On day 2, half of the medium containing
nonadherent cells was replaced with fresh medium. The medium was changed
completely on day 4. Only early passage (p1) of cells were used in this study. After
cells had reached 70%–80% confluence, the medium was changed completely with
DMEM containing 100 U/mL of penicillin, 100 μg/mL of streptomycin, and 10%
FBS supplemented with 50 μg/ml of ascorbic acid, 10 nM of dexamethasone, and
8 mM of β-glycerophosphate (1043003, D4902, and G9891, Sigma-Aldrich). The
medium was changed every 2–3 days for the duration of the experiment. IDG-SW3
cells were expanded in proliferation conditions 33 °C in α-MEM (12571, Gibco) with
10% FBS, 100 units/mL of penicillin, 50 µg/mL of streptomycin (Gibco), and
50 U/mL of IFN-γ, (PMC4031, Gibco) on rat tail type 1 collagen (0.2 mg/mL in
0.2 M acetic acid) coated plates. IDG-SW3 cells were induced towards osteocyte
differentiation by plating at 80,000 cells/cm2 in osteogenic differentiation conditions
(37 °C adding 50 µg/mL of ascorbic acid and 4 mM β-glycerophosphate in the
absence of IFN-γ). Collagen-coated plates were necessary for both proliferation and
differentiation culture [256]. To inhibit the Notch signalling pathway, DAPT
(D5942, Sigma) diluted in DMSO was added to the culture medium at the
concentration indicated. The same amount of DMSO was added as a control.
5.3.2 Vector construction and plasmid transfection
In order to confirm the mechanism of Notch regulating the osteocytes markers, we
cloned a 762 base pairs human E11 promotor region and a 792 base pairs human
DMP1 promotor region (the sequences are listed in the supplements) into pGluc
Basic 2 vector respectively at EcoRI and Xhol restriction enzyme sites named as
![Page 115: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/115.jpg)
Chapter 5: Research Part Three 89
E11-pGluc and DMP1-pGluc. The promotor fragments were designed by gene
screening and synthesised by TOLO Biotechnology (Shanghai, China). The Hes1
overexpression vector (TetO-FUW-Hes1) was obtained from Addgene #61534. Cells
were plated in 6-well plates and 96-well plates and cultured with medium not
containing antibiotics 2 days before transfection with Lipofectamine® 2000 reagent
following the manufacturer’s instructions. At the transfection day, for the 96-well
plate, 0.2 μg plasmid DNA was incubated with 25 μL Opti-MEM (31985070, Gibco)
without serum and antibiotics for 5 min at room temperature; 1.2 μL Lipofectamine®
2000 was incubated with 25 μL Opti-MEM as well. Then plasmid DNA and
Lipofectamine® 2000 solution was mixed well and incubated at room temperature for
20 min. Fifty microliters of the mixture was added to each well and incubated with
cells for 6 h. Then, fresh medium was changed to prevent cytotoxicity [362]. For the
6-well plate, the reactions were scaled up to 1 μg plasmid DNA and 6 μl
Lipofectamine® 2000 added to each well. For co-transfections, 0.1 μg E11-pGluc and
0.1 μg TetO-FUW-Hes1 was first mixed to form 0.2 μg plasmid DNA mixture; the
mixture was then incubated with 25 μL Opti-MEM and followed by incubation with
Lipofectamine® 2000 as described above. The same ratio used in the case of DMP1-
pGluc and TetO-FUW-Hes1 co-transfection. Tetracycline was added to the medium
at the final concentration of 1 μg/mL to induce Hes1 overexpression [363].
5.3.3 Notch activation
Artificially activating Notch by Notch (8G10) antibody was reported by Conboy et
al. [364] Briefly, culture plates were coated with collagen I as described above.
Further, the plates were coated with anti-Notch1 antibody, extracellular, clone 8G10,
(MAB5414, Merck Millipore) at 1:100 dilution in PBS at 4 °C overnight. For control
groups, the plates were coated with goat IgG. Cells were plated and cultured on the
coated plates as usual.
5.3.4 Luciferase assay
The pGluc-Basic2 vector expresses a secreted gaussia luciferase protein [365]. The
luciferase activity was tested 48 hours after treatment using Pierce Gaussia
Luciferase Flash Assay Kit (16158, Thermo Fisher Scientific). Briefly, 20 μL of
medium was taken from each well and transferred to a white, opaque 96-well plate.
Fifty microliters of Working Solution was added to each well and light signals
![Page 116: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/116.jpg)
90 Chapter 5: Research Part Three
detected with a BMG POLARstar Omega microplate reader (BMG Labtech, Thermo
Fisher Scientific). The raw data was interpreted by MARS Data Analysis Software.
5.3.5 Western blot
The whole cell lysates were collected by adding 250 µL cell lysis buffer with
protease inhibitor (cOmplete, EDTA-free 04693132001, Roche) and phosphatase
inhibitor (PhosSTOP, 04906845001, Roche) for the Western blot detection. A total
of 15 μg of proteins from each sample were separated on SDS-PAGE gels and then
transferred onto a nitrocellulose membrane (Pall Corporation). After being blocked
in Odyssey blocking buffer for 1 h (P/N 927-40000, LI-COR Biosciences), the
membranes were incubated with primary antibodies against Hes1 (1:1000, ab71559,
Abcam), E11 (1:1000, ab10288, Abcam), DMP1(1:1000, a kind gift from Professor
Jerry Feng of the Texas A&M University Baylor College of Dentistry), β-catenin
(#9581, Cell Signaling Technology, 1:1000), total Akt and phosphorylated Akt
(Ser473) (#2920, #4060, Cell Signaling Technology, 1:1000), total PTEN and
phosphorylated PTEN (Ser380) (#9551, #9552, Cell Signaling Technology, 1:1000)
total GSK-3β and GSK-3β (py216) (ab31826, ab75745, Abcam, 1:1000) and α-
Tubulin (1:2000, ab15246, Abcam) overnight at 4 °C. The membranes were then
incubated with anti-mouse/rabbit fluorescence conjugated secondary antibodies at
1:10000 dilutions for 1 h at room temperature. The protein bands were visualised
using the Odyssey Infrared Imaging System (LI-COR Biosciences). The relative
intensity of protein bands was quantified using Image J software. The experiments
were repeated three times and a representative blot is displayed.
5.3.6 Immunofluorescence
IDG-SW3 cells (kind gift from Professor Jerry Feng) and rat bone marrow–derived
mesenchymal stromal cells (BMSCs) were plated on collagen pre-coated 8-well
chamber slides (177445, Lab-Tek) at a density of 4,000 cells per well. The cells were
washed 3 times with ice-cold PBS followed by fixing with 2% paraformaldehyde
(PFA) for 10 minutes at room temperature. The cells were then incubated with 0.2%
Triton for cell permeabilisation. Nonspecific proteins were blocked with the
incubation of 1% BSA in PBST for 30 min at room temperature. The primary
antibodies, rabbit anti-β-catenin (#9581, Cell Signaling Technology, 1:100) in PBST
with 1% BSA and incubated at room temperature for 1 h. Goat anti-mouse Alex
![Page 117: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/117.jpg)
Chapter 5: Research Part Three 91
Fluor 488 (A31560, Life Technologies) and goat anti-rabbit Alex Fluor 647(A21246,
Life Technologies) were incubated at room temperature for 30 min to detect the
primary antibodies. The slides were counterstained with DAPI (D1306, Life
Technologies) and mounted with ProLong® Gold Antifade Reagent (P10144, Life
Technologies). The images were captured using a Nikon EclipseTiS microscope and
a Leica SP5 confocal microscope. Cell counting was performed using Image J
software.
5.4 RESULTS
5.4.1 Notch signalling pathway directly regulates E11 expression through Hes1
activity.
Our previous work both in vivo and in vitro had confirmed that E11 is an important
osteocyte marker that is expressed on the cell membrane and required for dendrite
generation and elongation (Fig. 25, 27). To demonstrate that Notch signalling
regulates the expression of E11, we cloned a 762 bp human E11 promotor region into
a pGluc-Basic 2 vector to transfect IDG-SW3, MC3T3-E1, and 293T cell lines. The
IDG-SW3 and MC3T3 cell lines were cultured in non-osteogenic medium. The
luciferase intensity of the IDG-SW3 cell line was significantly increased in the
condition that Notch signalling was activated by the extracellular antibody (clone
8G10). However, the increase was not significant in the MC3T3-E1 and 293T cell
lines (Fig. 30). We also performed co-transfection with E11-pGluc-Basic 2 and
TetO-FUW-Hes1 into all three cell lines with tetracycline to induce the
overexpression of Hes1. The effect of Hes1 overexpression was confirmed by
Western blot (Fig. 29). The luciferase intensity was significantly increased in both
IDG-SW3 and MC3T3-E1 cell lines. Unsurprisingly, the 293T cell line did not
present a change in luciferase intensity after Hes1 overexpression (Fig. 30). In brief
summary, the results from the luciferase assay suggested Notch signalling directly
promotes E11 expression through Hes1 transcriptional factor in the IDG-SW3 cell
line rather than 293T, a non-osteoblastic cell line.
![Page 118: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/118.jpg)
92 Chapter 5: Research Part Three
Figure 28: Western blot of Hes1 to confirm the effects of both Notch-activating
approaches. Both Notch1 antibody coated and Hes1 overexpression vector
transfection methods were effective to activate Hes1 expression. And the Hes1
overexpression approach presented a stronger effect.
Figure 29: The mechanisms of Notch in regulating the expression of E11 and DMP1.
A: The plasmid maps of the Hes1 overexpression vector, TetO-FUW-Hes1, and the
luciferase reporter vectors, E11-pGluc basic 2 and DMP1-pGluc basic 2. B: The
luciferase assay using the E11-pGluc-Basic 2 vector transfected into the IDG-SW3,
![Page 119: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/119.jpg)
Chapter 5: Research Part Three 93
MC3T3, and 293T cell lines. C: The luciferase intensity after a co-transfection with
the Hes1 overexpression vector significantly increased in both the IDG-SW3,
MC3T3-E1, and 293T cell lines. n=3. P value as indicated, unpaired Student’s t test,
comparisons between the Notch activation groups and the control groups,
respectively.
5.4.2 Notch signalling pathway regulates DMP1 expression in a Hes1
independent manner
To further figure out the function of Notch on osteocytes, we also cloned a 792bp
human DMP1 promotor region into the pGluc Basic 2 vector and transfected the
IDG-SW3 cell line. Surprisingly, we found the luciferase intensity was increased
only when Notch was activated by the extracellular antibody, while overexpression
of Hes1 could not sufficiently induce DMP1 expression, which means that Notch
signalling regulates DMP1 expression through some unknown mechanism rather
than Hes1 (Fig. 32.A, B). Further, as the IDG-SW3 cell line expresses GFP under the
control of DMP1 promotor-a 623 bp fragment of mouse DMP1 promotor (289), the
expression of DMP1 can be directly observed under a fluorescence microscope in
living cells. In contrast with the luciferase assay, GFP could only be observed when
Notch was activated by the extracellular antibody (Fig. 32.C, D). As the culture
medium did not contain any osteogenic component, it seems Notch can promote the
expression of DMP1 by itself in osteoblastic cell types. The expressions of DMP1 at
RNA and protein levels were tested as well, and the results were consistent.
Antibody-induced Notch activation caused upregulation of both DMP1 and E11 at
both RNA and protein levels. However, overexpression of Hes1 only triggered E11
expression (Fig. 31).
![Page 120: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/120.jpg)
94 Chapter 5: Research Part Three
Figure 30: The expressions of DMP1 and E11 at both the RNA and protein levels.
Antibody-induced Notch activation (A–C) caused the upregulation of both DMP1
and E11 at both the RNA and protein levels. However, the overexpression of Hes1
(D–F) only triggered E11 expression. n=3. * p < 0.05, unpaired Student’s t test,
comparisons between Notch activation groups and control groups, respectively.
![Page 121: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/121.jpg)
Chapter 5: Research Part Three 95
Figure 31: A, B: The expression of DMP1 was directly observed by a fluorescence
microscope in live IDG-SW3 cells. GFP could only be observed when Notch was
activated by the extracellular antibody (F), but not when Hes1 was overexpressed
(D). Scale bar: 50 μm. C, D: The luciferase intensity of DMP1-pGluc-Basic 2 in the
IDG-SW3 cell line increased only when Notch was activated by the extracellular
antibody (G), while the overexpression of Hes1 did not sufficiently induce DMP1
expression (E). n=3. P value as indicated, unpaired Student’s t test, comparisons
between the Notch activation groups and control groups, respectively.
5.4.3 The switch of Wnt to Notch in osteocytes formation is mediated by Akt
and PTEN
As mentioned above, the switch from Wnt to Notch occurred spontaneously in
normal osteocyte development. It is of no surprise that Hes1 expression was reduced
when LiCl or DAPT were added to interfere with the natural switching process (Fig.
33). Interestingly, when Wnt was artificially activated at the late stage of
differentiation in the IDG-SW3 cells by LiCl supplementation, we found that β-
catenin continued to decrease as part of the osteogenic culture process. However, this
decreasing trend was inverted when Notch signalling was inhibited (Fig. 33), which
suggested that Notch may be the dominant factor controlling this self-switching
process.
![Page 122: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/122.jpg)
96 Chapter 5: Research Part Three
Figure 32: Western blots of β-catenin and Hes1 in the IDG-SW3 cell line osteogenic
culture, with the supplementation of either LiCl or DAPT. The expression of β-
catenin increased when Notch was inhibited, indicating a functional antagonism
between these two signalling pathways.
To further characterise the crosstalk between the Wnt and Notch signalling pathways
during the terminal differentiation of osteocytes, we tested the phosphorylated
proteins involved in the Wnt signalling cascade using IDG-SW3 cells at the terminal
differentiation stage, during which Notch signalling was inhibited (Fig. 34 A).
Interestingly, the phosphorylation of PTEN was at a low level at the late stage of
differentiation, and in this scenario, phosphorylated Akt increased when DAPT was
added to the culture medium (Fig. 34 A). Under the same condition, we also found
that active GSK-3β was decreased in correlation with the upregulation of β-catenin.
These Western blot results together indicated that, consistent with well-documented
reports [186, 357-360], Akt-GSK-3β- β-catenin formed a signal transduction cascade
and mediated the antagonistic relationship between the Wnt and Notch signalling
pathways. Similar antagonistic expressions of β-catenin and Hes1 were found in
rBMSCs at the late stage of osteogenic differentiation (Fig. 35 A–C).
![Page 123: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/123.jpg)
Chapter 5: Research Part Three 97
Figure 33: A: Western blots of the phosphorylated proteins involved in the signalling
crosstalk between Notch and Wnt in the IDG-SW3 cell line under normal osteogenic
condition and Notch inhibition with DAPT for 21 days. B: Western blots of the
phosphorylated proteins involved in the signalling crosstalk between Notch and Wnt
in the IDG-SW3 cell line plated on the Notch extracellular antibody (left) and IgG
(right). The phosphorylation of Akt at the serine 473 site was inhibited by the Notch
extracellular antibody. On the other hand, activating Notch by an extracellular
antibody inhibited the phosphorylation of Akt at the serine 473 site, leading to the
activation of GSK-3β and β-catenin degradation.
![Page 124: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/124.jpg)
98 Chapter 5: Research Part Three
Figure 34: The crosstalk between the Notch and Wnt signalling pathways in
rBMSCs. A: Immunofluorescence staining of β-catenin and Hes1 in osteogenically
differentiated rBMSCs on day 14. The results showed that more cells expressed β-
catenin after Notch blockade. Scale bar: 50 μm. B, C: The Wnt and Notch signalling
exhibited an antagonist relationship at the late differentiation stage of the rBMSCs
since blocking Notch enhanced β-catenin (B), and the activation of Wnt inhibited
Hes1 expression (C).
Immunofluorescence staining of β-catenin showed that Notch signalling prevented its
nuclear aggregation, whereas β-catenin combined to T-cell factor/lymphoid enhancer
factor (TCF/LEF) to regulate the transcription of Wnt target genes (Fig. 35 A–F).
![Page 125: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/125.jpg)
Chapter 5: Research Part Three 99
Figure 35: Immunofluorescent staining of β-catenin in the IDG-SW3 cell line. In the
control groups (D–F), β-catenin was mainly expressed in the nucleus. When Notch
was activated by the extracellular antibody (A–C), β-catenin was translocated into
the cytoplasm (as indicated by white arrows) where it has no function. Scale bar:
10 μm.
Finally, antagonism does not represent a comprehensive relationship between Wnt
and Notch. For example, solid evidence also suggests a synergistic relationship in
stem cells [366-368]. In the current study, we also found that blocking Notch
signalling in undifferentiated rBMSCs facilitated the membrane anchoring of β-
catenin (Fig. 37 A–F), which was the opposite phenomenon compared with the IDG-
SW3 cells. In addition, we tested the signal transduction cascade in rBMSCs and
confirmed the existence of phosphorylated PTEN, while there was an extremely low
level of activated Akt (Fig. 37 G). In this cell context, the inhibition of p-Akt by
PTEN might be the dominant regulatory mechanism, and thus, Notch did not
regulate β-catenin by repressing p-Akt. Quantitative analysis of Western blots
suggested that there was no significant change in the bands’ intensity between those
two groups (Fig. 38 G).
A B C
D E F
![Page 126: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/126.jpg)
100 Chapter 5: Research Part Three
Figure 36: The relationship between Notch and Wnt in non-osteogenic rBMSCs. A–
F: Immunofluorescent staining of β-catenin in rBMSCs in normal culture. In the
control groups (A–C), β-catenin was mainly expressed in the nucleus as indicated by
the white arrows. When Notch was inhibited by adding DAPT (D–F), β-catenin was
translocated into the cytoplasm where it has no function (as indicated by the white
arrows). Scale bar: 30 μm. G: Western blots of the phosphorylated proteins involved
in the signalling crosstalk between Notch and Wnt in the rBMSCs in normal culture.
5.5 DISCUSSION
This study revealed the molecular regulatory signalling pathway involved in the
osteoblast fate decision during the terminal stage of bone formation and shed light on
functional crosstalk between Notch and Wnt signalling pathways. It has been well
established that Wnt signalling promotes early stage osteoblastic differentiation
while inhibiting terminal differentiation [369, 370]. It induces the expression of a
series of key osteogenic relevant proteins including sp7 and Runx2 [371]. In the case
of the Notch signalling pathway, it prevents the early differentiation of progenitors
and maintains the stem cell pool in the bone marrow [372]. Hence, low Notch
activity is essential to initiate the early stage differentiation of osteoblasts. We have
previously shown that Notch is indispensable in osteocyte function and bone
mineralisation, leading to a full description of Notch and Wnt signalling in the whole
process of bone development from the induction of bone marrow stem cells to the
formation of mineral tissue. Specifically, Notch experiences a U-shaped expression
pattern in osteogenesis and presents an antagonistic relationship with Wnt during the
transition from osteoblasts to osteocytes; in other words, from collagen matrix to
mineral tissue in terms of the functions of these two cell types, respectively.
![Page 127: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/127.jpg)
Chapter 5: Research Part Three 101
Due to the timing of the regulation of the Notch and Wnt signalling pathways, fine-
tuning the temporal up and down of Notch and Wnt activity might regulate normal
osteogenesis. Consistent with this prediction, tuning up Wnt activity by knocking out
Dkk2 in mice promoted premature formation of bone tissue, which contained a large
amount of organic collagen but an absence of mineralisation [50]. The ideal
osteogenesis should be a successive process of osteoblast differentiation, collagen
secretion, and mineralisation, so this abnormal mineralisation has a detrimental effect
on bone formation and regeneration. Our in vitro study also revealed a similar
phenomenon when exogenous Wnt added or inhibited Notch during the terminal
differentiation of osteoblasts. The natural expression pattern of Notch during
osteogenesis also provides a possible explanation for the controversial results
generated by a number of studies using Notch knockout and overexpression
transgenic mouse models [167, 168, 173, 265, 267-270, 373-376]. None of these
studies took the original Notch activity into account. It is reasonable to predict that
knocking out Notch at an early stage of osteoblasts would not present a significant
phenotype when Notch activity is already very low. However, a profound impact can
be seen when Notch is knocked out in bone marrow stromal cells, which normally
have a high level of Notch activity. The existing findings suggested that the cell fate
decision of late stage osteoblasts is controlled by a precise balance between the
Notch and Wnt signalling pathways.
It had been reported that GSK-3β may mediate the crosstalk between Notch and Wnt
signalling [271]. However, in the current study, we further identified that the kinase
activity in PI3K/Akt signalling pathway can be the upstream regulator of GSK-3β
and bridge the Notch and Wnt signalling. During the transition from osteoblasts to
osteocytes, as the Notch signalling increased, the p-Akt activity was decreased,
leading to the low level of phosphorylation at the serine 9 site on GSK-3β as
inactivated status but a high level of phosphorylation at the tyrosine 216 site, which
degraded β-catenin in the canonical Wnt signalling pathway. Notch activation leads
to activation or inhibition of p-Akt according to the different pathways of regulatory
mechanisms. The first mechanism involves the encoding product of PTEN gene that
negatively regulates Akt activity by dephosphorylating PIP3, an upstream activator
of Akt [361]. Notch inhibits PTEN through Hes1 expression, resulting in the
activation of p-Akt [192]. Another mechanism is that Hes1 directly represses p-Akt
![Page 128: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/128.jpg)
102 Chapter 5: Research Part Three
in a PTEN independent manner [193-195]. PTEN is a critical selector that determines
which wiring would exert regulatory function.
The detailed mechanisms whereby Notch facilitates the transition towards osteocytes
remain to be determined. At least, however, our study suggested Hes1 can be an
important downstream effecter adopted by Notch in osteoblast fate determination.
Hes1 is one of seven Hesgene family members that are main nuclear effectors, which
are direct targets of Notch signalling. The upregulation of Hes1 indicates that Notch
is activated in the terminal differentiation of late stage osteoblasts [13]. Moreover,
the results presented here show that Hes1 directly regulates the expression of the
promoter of E11, an earliest osteocytes marker, suggesting that Notch works as a
critical switch to initiate osteocytes’ properties. As shown in the current study, the
activation of E11 by Hes1 was observed only in the MC3T3 and IDG-SW3 cell lines,
which are both of osteoblastic lineage. In contrast, Notch activated by coated
antibody or Hes1 overexpression could not induce the expression of E11 in the 293T
cell line, indicating that the transcriptional regulatory function of Hes1 depends on
cell types. This phenomenon was consistent with previous studies that revealed the
versatile nature of Notch in various contexts [318, 319]. It is worth noting that the
existing evidence cannot exclude other regulatory mechanisms adopted by Hes1.
Hes1 has also been regarded as a transcriptional suppressor, so it is still possible that
Hes1 increases E11 expression through repressing some E11 inhibited transcriptional
factors. The direct activation role of Hes1 on E11 remains to be investigated in the
future through chromatin immunoprecipitation [377] and electrophoretic mobility
shift assay [378].
The differences in cell context involve various modified mechanisms at different
levels. For example, the glycosylation of Notch extracellular domain leads to
selective binding to Dll ligands rather than Jag1, and different ligands involved will
induce different output [102, 379, 380]. Dll4 induced Notch activity inhibits
angiogenesis while Jag1 induced Notch promotes vessel growth in long bones [171,
172]. Other mechanisms include histone acetylation and methylated modification to
present or block the selective genes that are targeted by Notch transcriptional
complex [119, 381, 382]. If it is the true nature of Notch signalling, it seems there
should be a higher dominant mechanism that exists to initiate the response to Notch
signalling; on the other hand, Notch just exerts the “order” regarding the responses
![Page 129: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/129.jpg)
Chapter 5: Research Part Three 103
rather than controlling the switch. There is evidence supporting the existence of those
higher mechanisms that Notch signalling activity is regulated by segmentation clock,
which is a molecular oscillator through negative feedback in the somitogenesis [121,
122]. We can also make a reasonable hypothesis that only certain subsets of genes
are modified to guarantee their accessibility to Notch signalling. Hence, no matter
what level of Notch signalling, it cannot regulate other genes not included in the
subsets. As reported above, in the case of 293T cells, which have no relationship
with osteogenesis, the promotor and enhancer of E11 are not open to being regulated
by Notch signalling. It seems that Notch is a smart signalling pathway that obeys
some basic natural principles.
In the current study, we also observed that Notch activated by extracellular antibody
could induce expression of DMP1 in IDG-SW3 cell lines. However, the expression
of DMP1 was not affected by transfection of Hes1 overexpression vector, which
indicated that the regulatory function on DMP1 by Notch signalling was not
mediated through Hes1 transcriptional factor. It seems that some other elements
targeted by Notch regulate the expression of DMP1 protein, which is indispensable
in bone mineralisation. TCF11/Nrf1 and JunB transcriptional factors were found to
regulate the expression of DMP1, according to the limited literature [383, 384].
Interestingly, both those transcriptional factors present close connections with the
Notch signalling pathway, indicating a putative regulatory function of Notch on
DMP1 [302, 355, 385, 386]. Further studies are preferred to figure out the specific
regulatory mechanism of DMP1.
5.6 CONCLUSIONS
In conclusion, the study presented above supports that Notch plays a critical role in
the transition from osteoblasts to osteocytes, through promoting the expression of
important osteocyte markers through different transcriptional regulatory
mechanisms, even if it does not work as the principal switch. Moreover, a model of
the antagonist relationship between Notch and Wnt signalling during the terminal
transition was established, which is mediated by phosphorylated regulation of Akt.
These findings may contribute to clarify the controversial opinions regarding the
function of Notch on osteogenesis.
![Page 130: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/130.jpg)
104 Chapter 5: Research Part Three
5.7 SUPPLEMENTS
DMP1 promotor: 780bp gtgattgattgaccaacagaatatggaaaaatgatattctaggaactcttggcccccagc cttcaggttgtgagaaggccaagccaaggagaggccatgtaaagaactaaagtgctcaga attacagctccagctgagctctcaggtaacaactatgaaagtggcatctgaaatgttctg ccccaactgagtcttcagatgactacaatgctagctgtgagagataagaaaatggtagtt gttttaaaatgcaaagtattgaagtggtttttgatatagcaatagataacaaaaatgcct agttttattgtaaatgttatccacagttttcaattttgttatctaattgctcctctgttt ttatgtagggatttgaagagagtctaaaataatgtcttgtaatgcaatctgcccaaatct gcccagaatccaattctgtcataagattataaggttcttctagcatagatctcagttaag acccatgaaaccatcagagagtgtaattcagaaccagagcaaatcacagggaatttatag cttccccatatggactttggctttctaatcaaccctaaatgaaaatagacatctctttcc tcattgtctgcaccaccctcccccgcatattatagttcacactaaatatgttgataatcc atatatctgacattagttgcctgaataaattgggcactctaattttctagatccatgtta ggagcatcagctcaattttttttttaacaattaaagcatttttttaaaagttacagtgag
E11 promotor 750bp Ttacctcccactcctccatcctgatcaaaaggtcatgtgaccaaccttctagattctagacacatccgggggtgtgggattagttgcatgtaacccaatctcccccacctaggcttcactgtgtttcaatctttttgaataaagcgggccatctttctttctgtgtgtgaccttggagttacacataagcagaatagatgtgcatctattctccatctaacaggctcaacagacaatgcactattcctcctgtcaacagacattattgacactagagtcataaaatgcatctccaagatggggaagtcagttcaagaaagagtatctgtatcacgagttttctctttacatttccaactccttggctctaggggtgttgccgctacccctcatcttctaggttcaggtgctcagctcctgtttgtagccccaggacaagacgttacctgggagatctttagaaatgcagaatctctccctatcccacaacagaattgcacctgcataaccagtgccccaggtagatctggctgagaagctatgatgaagggcaaggtttgccaaatgttcatggggacaagttctccagcgacactggtttaaaataggaattccgaaaaggtctgattaatgagtttggggtggaacccaggaaactgggcatttatttaaaacaatctctcctgtgattcttagaaagtaaatttataatggggaggggtcaaagataagcatctgaaaacaattttc
![Page 131: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/131.jpg)
Chapter 5: Research Part Three 105
Figure 37: Statistical analysis of Western blot.
A and B: Statistical analysis of relative band intensity from Western blot in Figure 33.
Two-way ANOVA with Bonferroni post hoc test was performed. C and D: Statistical
analysis of relative band intensity from Western blot in Figure 34. One-way ANOVA
with Student’s t test was performed. * p < 0.05. E and F: Statistical analysis of
relative band intensity from Western blot in Figure 35. One-way ANOVA with
Student’s t test was performed. * p < 0.05. G: Statistical analysis of relative band
![Page 132: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/132.jpg)
106 Chapter 5: Research Part Three
intensity from Western blot in Figure 37. One-way ANOVA with Student’s t test was
performed. * p < 0.05.
![Page 133: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/133.jpg)
Chapter 6: Conclusions and Discussion 107
Chapter 6: Conclusions and Discussion
![Page 134: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/134.jpg)
![Page 135: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/135.jpg)
Chapter 6: Conclusions and Discussion 109
6.1 RESEARCH SUMMARY
In the three research chapters, we first discovered a U-shaped expression pattern of
Notch signalling in the whole osteogenic process, which promotes profound
understanding of Notch signalling in osteogenesis, especially in the terminal stage of
osteogenic differentiation (Fig. 39). Next, the functions of Notch signalling in
terminal differentiation were studied, and the results indicated a comprehensive role
of Notch in osteocytes including regulating cell proliferation, morphology, and
mineralisation. Finally, our findings from mechanism research suggested that Notch
regulates cell morphology through direct transcriptional activation of E11 mediated
by Hes1 transcriptional factor. However, Notch impacts mineralisation by regulating
DMP1 expression in a Hes1 dispensable manner. Also, we found an antagonistic
relationship between Notch and Wnt signalling pathways at the late stage of
osteogenesis.
Figure 38: Schematic of the U-shaped Notch expression pattern during osteogenesis.
In BMSC, Notch maintains the pool of stem cells, and it is required to be
downregulated to initiate osteogenic differentiation. During terminal differentiation,
Notch is increased again to alter the cubic, amplifying. and matrix secretion
osteoblasts to the dendritic, static, and mediating mineralisation osteocytes.
![Page 136: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/136.jpg)
110 Chapter 6: Conclusions and Discussion
Figure 39: The schematic shows a potential mechanism in osteoblast fate
determination. 1, 2: The connection between osteoblasts is stable and broad, while
the contact area between osteoblast and osteocyte is limited due to the dendritic
morphology of osteocyte. 3: Osteocytes send burst Notch signalling to the
osteoblasts committed to osteocytes according to the reports in a quantitative study
of Notch signalling intensity that the limited connection presents burst Notch
signalling. 4: Then, the increased Notch enhances the E11 expression through Hes1
activity and promotes DMP1 expression through some unknown mechanisms. E11
plays a role in dendrite formation and DMP1 mediates ordered extracellular
mineralisation. NICD also prevents the nuclear translocation of β-catenin; therefore,
it inhibits the β-catenin transcriptional activity. The intracellular β-catenin may also
combine to E-cadherin to support the generation of cell processes.
6.2 DISCUSSION
Dendritic osteocytes comprise 90% of all bone cells and form complex cellular
networks throughout the mineralised bone matrix [22]. This cellular network enables
bone to function as a dynamic organ in response to hormonal and mechanical
changes [387, 388]. A prerequisite for the proper function of this network is the
ability of osteocytes to recognise and communicate with neighbouring cells. The
![Page 137: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/137.jpg)
Chapter 6: Conclusions and Discussion 111
current understanding of osteocyte communication is limited on the gap junctions
[68], cadherins [69], and the soluble short range intercellular signalling molecules
represented by extracellular adenosine triphosphate (ATP) and purinergic receptors
[389, 390]. All the programs mentioned above lack specificity; therefore, they may
be incompetent to process fine and intricate cellular signals. A previous
morphological study showed the reciprocate expanding and retracting manner of
osteocytes’ dendrites, suggesting the existence of a fine-tuned regulatory mechanism
that relies on cell-to-cell contacts [391]. If it is true, Notch signalling is likely the
candidate among the membrane bounded signalling systems that utilises this
topographic characteristic to control the osteocyte functions and the differentiation
from osteoblasts to osteocytes in the niche context.
Our current study revealed a molecular regulatory mechanism involved in the
osteoblast fate decision during the terminal stage of bone formation and shed light on
the functional crosstalk between the Notch and Wnt signalling pathways. It is well
established that Wnt signalling promotes early stage osteoblast differentiation and
inhibits terminal differentiation [369, 392]. The Notch signalling pathway prevents
early differentiation of progenitors and maintains the stem cell pool in the bone
marrow [372]. Hence, low Notch activity is essential to initiate the early stage
differentiation of osteoblasts. It is of interest that Notch is indispensable during
osteocyte formation and bone mineralisation, as we have reported in the previous
chapters. During the whole osteogenesis process, Notch experiences a U-shaped
expression pattern and interacts with Wnt signalling in different manners at different
developmental stages. Given the fluctuant signalling intensity in the osteoblastic
differentiation, a fine-tuning of the temporal up and down activity of Notch and Wnt
might regulate normal osteogenesis.
To the best of our knowledge, the fundamental question of how Notch signalling
increases in the natural process of osteocyte formation is yet to be answered. Indeed,
many processes of cell fate decision occur concurrently with changes in cell
morphology [393-395], and these changes in cell morphology or contact patterns
may be approaches of modulating the magnitude of signalling. Here, in the case of
Notch signalling, a model is suggested based on a quantitative study that adjacent
cells with a limited contact area transit stronger Notch signalling [396]. We speculate
the reason is that the broader contact involves a more complicated engagement of
![Page 138: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/138.jpg)
112 Chapter 6: Conclusions and Discussion
Notch receptors and ligands, which trigger both the positive and negative effects and
the overall signalling output might be mutually offset, while the limited contact
might focus on the unitary effect. It is possible that osteoblasts present a low Notch
signalling intensity as the contact areas between the osteoblasts are broad due to the
cubic appearance. However, when an osteoblast contacts a dendritic osteocyte, the
contact area is reduced starkly, and the osteoblast receives a burst of Notch signalling
to initiate differentiation towards osteocytes (Fig. 40). In support of this hypothesis,
another report, also based on a mathematic model, predicts that cells with a smaller
contact area are more likely to become signal-sending cells [397]. Here, these signal-
sending cells are represented by osteocytes, using slender dendrites to contact the
cubic osteoblasts, which are the signal-receiving cells.
In terms of the crosstalk between Notch and Wnt signalling pathways, our current
studies have revealed GSK-3β as the bridge molecular linking those two pathways.
Further, a series of phosphlated regulation sites have been identified to illuminate the
mutual relationship of Notch and Wnt. Those phosphlated proteins included but are
not limited to β-catenin, PI3K, Akt, and PTEN. (Discussed in detail in Chapter 5.5.)
It is of note that β-catenin is not only an integral component of Wnt signalling in the
nucleus but is also a component of the cadherin–catenin complex to participate in
dendritic morphogenesis in cytoplasm [398]. In other words, the functions of β-
catenin are dependent upon its location [399, 400]. Yu et al. showed that high levels
of intracellular β-catenin enhance dendritic arborisation in rat neurons in a Wnt
transcriptional independent manner [401]. Rosso et al. further demonstrated that it
was the noncanonical Wnt signalling, rather than canonical Wnt, through the
transcriptional activity of β-catenin, that regulated dendritic development. [402]. The
regulation of β-catenin translocation is well documented. A serine/threonine selective
protein kinase – Casein kinaseⅠ (CKⅠ) phosphorylates the amino terminal region
of β-catenin at the serine 45 site, which is sequentially phosphorylated by GSK-3β
and earmarked for degradation, resulting in keeping β-catenin from reaching the
nucleus [403-406]. Whereasprotein kinase CKⅡ phosphorylates the amino terminal
region of β-catenin at Ser29, Thr102, and Thr112 and stabilises the cadherin–catenin
complex to prevent degradation by CKⅠ and GSK-3β [407, 408]. There was also
evidence showing that CKⅡ positively regulates Notch1 signalling through a direct
![Page 139: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/139.jpg)
Chapter 6: Conclusions and Discussion 113
phosphorylation reaction at the Ser847 site of Notch1 [409]. Moreover, CKⅡ
enhances Notch signalling through a pathway that cross-talks with Hedgehog
signalling [410, 411]. In our immunofluorescence observation, we found that Notch1
prevented the nuclear translocation of β-catenin (Fig. 36 A–F). Taken together that
osteocytes express high levels of CKⅡ, a possible explanation of our findings might
be that CKⅡ stabilises both Notch1 and the cytoplasm cadherin–catenin complex,
which also plays a role in dendrite formation in addition to regulating E11 functions.
Our study suggested that Hes1 might be an important downstream effecter adopted
by Notch in osteoblast fate determination although the detailed mechanisms remain
unknown. We had observed that Hes1 directly regulates the transcriptional activity of
E11 promotor in a cell context-dependent manner. (Discussed in detail in Chapter
5.5.) The differences in cell context involve various regulatory mechanisms at
different levels. For example, the glycosylation of the Notch extracellular domain
leads to the selective binding to Dll ligands rather than Jag1, and different ligands
induce different outputs [97, 102, 361]. Dll4-induced Notch activity inhibits
angiogenesis, while Jag1-induced Notch promotes vessel growth in long bones [171,
172]. Moreover, other mechanisms, which include but are not limited to histone
acetylation and methylated modifications, also regulate the Notch transcriptional
complex [119, 381, 382]. Unfortunately, we had little knowledge about the functions
of those epigenetic mechanisms in bone. Our findings contained in this thesis have
revealed just the tip of the iceberg, and increasing questions needed to be answered
before Notch could be a potential therapeutic target to treat bone and mineral-related
diseases.
In conclusion, the study presented here supports that Notch plays a critical role in the
transition from osteoblasts to osteocytes, through promoting the expression of
important osteocyte markers, even if it does not work as the principal switch.
Moreover, a model of the antagonist relationship between Notch and Wnt signalling
during terminal transition has been established, which is mediated by the
phosphorylated regulation of Akt. These findings may contribute to clarifying the
controversial opinions regarding the functions of Notch in osteogenesis.
![Page 140: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/140.jpg)
114 Chapter 6: Conclusions and Discussion
6.3 LIMITATIONS
Our findings revealed that Notch is highly regulated in osteogenesis. However,
whether this regulation is controlled by itself or some upper mechanisms remains to
be addressed. As the intensity and functions of Notch signalling are different at each
stage of osteogenic differentiation, any small-scale change could induce significant
biological alteration. Our research also raised the importance and necessity of
quantitatively evaluating Notch signalling intensity before we can manipulate the
signalling intensity to treat bone diseases. The quantisation of signalling is still a
greatly challenging area in molecular biology. However, it really represents the
future direction leading to an accurate understanding of signalling in cells. With the
development of bioinformatics, impressive evidence has been accumulated from a
huge range of gene and protein screens, requiring us to update the traditional view of
signalling pathway as linear events. Actually, Notch signalling is affected and
modified by an extraordinarily complex network [113]. The current mainstream
methods, such as testing the expression of certain Notch ligands, receptors, and
effectors, are increasingly unsatisfactory to uncover the real activity of the signalling.
It is possible that the cells that express more ligands and receptors present lower
signalling intensity. To the best of our knowledge, there is no broadly accepted
definition of the unit of measurement of signalling. However, a mathematic model
established in epithelial cells can quantitatively measure the intensity of Notch
signalling [105], which might be a potential approach to developing advanced
systems for quantitative analysis of signalling activity.
The complexity of the signalling network also renders limitations to the transgenic
animal models research. After modifying certain components in the signalling
cascade, other factors involved in the complex interaction with those components
would affect each other in an uncontrollable manner and generate measurable
consequences in the overall signalling outcomes. Without comprehensive
clarification of how the signalling network works, the significance of the research
into modified genes is limited.
At last, all the data in this thesis were generated from animal models and cell lines,
which is favourable to be tested in human cells. However, this is a challenging task
due to the low yield of human osteocytes based on existing technology for cell
extraction and culture [412, 413]. There is demand for an advanced methodology to
![Page 141: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/141.jpg)
Chapter 6: Conclusions and Discussion 115
be developed to gain a substantial yield of osteocytes from human specimens for in
vitro study. Alternatively, it had been reported that researchers used biphasic calcium
phosphate (BCP) constituted by hydroxyapatite (HA) and tricalcium phosphate (TCP)
as the 3D scaffold to host the commercialised human primary osteoblasts to
recapitulate the differentiation towards osteocytes [414]. This method provided a tool
to obtain primary osteocytes in vitro to study the biology of osteocytes, including the
signalling exchange between osteoblasts and osteocytes.
6.4 FUTURE IMPLICATIONS
For future implications, Notch signalling is required to be precisely manipulated
based on the quantitative study to control the outcomes in certain tissue to realise the
therapeutic aims. For example, in the case of hypomineralisation, Notch signalling
can be artificially manipulated to a certain level that can improve the bone
mineralisation and not excess a safe range resulting in hypermineralisation or other
abnormal phenotypes.
In this thesis, we found Notch signalling is highly expressed in osteocytes and has a
regulatory role in the expression of critical osteocytes markers. The terminal
differentiation towards osteocytes is a fine-grained feature that adjacent cells can
adopt distinct fate. According to this, the cell fate determination factors in this
scenario must be specific at single cell level. Unlike gap junctions and secreted
factors working on general or local basis, the cell-to-cell contact dependent Notch
signalling pathway meets the criteria, hence, the nature of Notch and its implication
in osteoblasts fate decision are worthy to be discussed. Here, we try to suggest some
models which apply Notch natures reviewed in Chapter 2 to regulate osteoblast cell
fate.
Implications of lateral induction and lateral inhibition in the transition from
osteoblasts to osteocytes: Jag1 is a documented factor in bone formation and disease.
Jag1 mutation is related to Alagille syndrome featured by low bone mass and high
risk of fracture [123, 415-417]. The detailed analysis has shown that the main
function is on the early stage of osteogenesis [418, 419]. Dll1 function is less
reported in bone tissue; however, in vitro studies suggested Dll1 enhances Notch
activation in osteoblasts [420]. Those data enable us to propose a model in osteoblast
cell fate determination: before transition happening, each osteoblast maintains low
![Page 142: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/142.jpg)
116 Chapter 6: Conclusions and Discussion
Notch signalling by expressing Jag1 ligand and coordinates the behaviour of adjacent
osteoblasts to produce bone matrix synchronously in local area. In contrast, during
the transition, the osteoblast which is committed to osteocyte expresses Dll1 ligand
and inhibits its neighbours to express the same ligand, leading to discrepancy in
Notch signalling intensity, thereby preventing the immediately surrounding cells
from differentiating to osteocytes. This model can explain the histology observations
that there are not two adjacent osteoblasts buried by matrix and becoming osteocytes
together.
![Page 143: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/143.jpg)
Chapter 6: Conclusions and Discussion 117
Figure 40: Lateral induction and inhibition mechanisms in the transition from
osteoblasts to osteocytes. When lateral induction (upper) mechanism is activated,
osteoblasts induce surrounding cells to express the same pattern of ligands, thereby
keeping the coordinated tempo in cells activities, here, all osteoblasts have the same
phenotype and functions-secreting bone matrix. If the committed osteoblasts (red
cubic cells in bottom) receive stimulation from osteocytes, they will express unique
pattern of ligands and inhibit neighbours to express the same one, leading them
maintain osteoblastic phenotype. It is of great interest that the committed cell will
![Page 144: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/144.jpg)
118 Chapter 6: Conclusions and Discussion
differentiate to osteocyte and after it generates new dendrites, it will recruit the next
committed osteoblasts, in other words, attract neighbours to adopt the same fate. This
transform indicates the topology of cell-to-cell contact has a profound impact on the
Notch signalling regulation.
Many cell fate determination processes occur concurrently with changes in cell
morphology [421]. During the transition from osteoblasts to osteocytes, the cell
morphological changes render different contact manner between adjacent cells,
which can contribute to altering signalling during the transition. Based on the
observation suggesting that osteocytes dendrites also present dynamic characteristics,
it is likely that osteocytes send a strong Notch signalling to the osteoblast which has
been chosen as osteocytes candidates. Then, this osteoblast starts to transform
towards osteocyte phenotype, meanwhile, through lateral inhibition mechanism,
prevents its neighbours from receiving high Notch signals.
![Page 145: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/145.jpg)
Chapter 6: Conclusions and Discussion 119
Figure 41: Models of supposed contact dimensions alter Notch signalling. The
ligands of Notch signalling present a dynamic behaviour in nature. They diffuse on
the cell membrane before engagement with receptors and endocytosis. In the context
that a dendritic signals sending cell contact to cubic signals receiving cell (upper),
ligands will diffuse a long distance before endocytosis. Hence, the signals intensity is
![Page 146: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/146.jpg)
120 Chapter 6: Conclusions and Discussion
depended on the amount and convergence of ligands diffusion. When two cubic cells
contact (bottom), the ligands diffuse a short distance before combination with
receptors, in this scenario, the signals intensity is proportional to the contact area.
This research emphasised the regulatory function of Notch on the transition from
osteoblasts to osteocytes. The transition is a fine-grained and carefully regulated
process that only the single committed osteoblasts differentiates to osteocytes and its
surrounding cells cannot adopt the same cell fate. According to this characteristic,
the juxtaposed Notch signalling may be the mechanism that can determinate cell fate
at single cell level. In contrast, other signalling pathways through soluble factors
cannot elicit this precise regulation at single cell level, instead, they regulate cell fate
in at a niche level containing cells cluster.
As osteocytes are close related to the mineralisation and bone remodelling,
application of Notch modulation to improve bone quality springs out our minds.
However, this program confronts great challenges due to the complexity of the
regulatory mechanisms under physical conditions. In the normal differentiation, the
committed osteoblasts need exogenous Notch stimulations, while others are laterally
inhibited which can explain that compulsive activating Notch in mature osteoblasts
resulting in dysregulation of differentiation and high risk of osteoblastic malignant
proliferation. This unique behaviour manner of Notch in osteocytes necessitates more
careful design of approaches when targeting Notch in bone diseases.
The main problems impeded the clinical application of modulating Notch signalling
are: i) the difficulty of precise measurement of Notch signals intensity and ii) the
complexity of Notch signalling itself as well as crosstalk with other signalling
pathways. The traditional molecular biological methods that measure proteins and
genes expression are far from sufficient to reflect the real signals intensity. To
address the first problem, collection of comprehensive data from Notch receptors,
ligands and effectors and establishment mathematical models to calculate the final
signals output could represent the future direction. Several models have been
reported, however, optimisation and test are still required to generate convince
results.
After the Notch signals can be accurately measured, we can move to how to
modulating Notch signalling which is a nascent area [422]. There are several
![Page 147: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/147.jpg)
Chapter 6: Conclusions and Discussion 121
strategies for drug development are being tested at preclinical or clinical stages.
However, almost all those drugs are designed to target tumours from breast cancer to
lymphoblastic leukaemia [422]. It seems there is a long journey to go for modulating
Notch signalling to treat bone diseases. At least, some Notch components have been
identified as mutation sites responsible for bone abnormalities. Such as Dll3
mutation causes spondylocostal dysostosis (SD) [124] and gain-of-function mutation
in Notch is responsible for the rare Hajdu-Cheney syndrome [423, 424]. These
targets may be where the first breakthrough can be made.
![Page 148: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/148.jpg)
![Page 149: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/149.jpg)
References 123
References
1. ennifer J Watts, J.A.-O.a.K.M.S., Osteoporosis costing all Australians: a new burden of disease analysis – 2012 to 2022. . Osteoporosis Australia, 2013.
2. Lu, Y., et al., The Biological Function of DMP-1 in Osteocyte Maturation Is Mediated by Its 57-kDa C-terminal Fragment. Journal of Bone and Mineral Research, 2011. 26(2): p. 331-340.
3. Elder, C.J. and N.J. Bishop, Rickets. Lancet, 2014. 383(9929): p. 1665-1676. 4. Martin, T.J., Bone remodelling: its local regulation and the emergence of
bone fragility. Best Pract Res Clin Endocrinol Metab, 2008. 22(5): p. 701-722.
5. Cordle, J., et al., A conserved face of the Jagged/Serrate DSL domain is involved in Notch trans-activation and cis-inhibition. Nat Struct Mol Biol, 2008. 15(8): p. 849-857.
6. Dallas, S.L., M. Prideaux, and L.F. Bonewald, The Osteocyte: An Endocrine Cell … and More. Endocrine Reviews, 2013. 34(5): p. 658-690.
7. Artavanis-Tsakonas, S., M.D. Rand, and R.J. Lake, Notch Signaling: Cell Fate Control and Signal Integration in Development. Science, 1999. 284(5415): p. 770-776.
8. Kopan, R. and M.X.G. Ilagan, The Canonical Notch Signaling Pathway: Unfolding the Activation Mechanism. Cell, 2009. 137(2): p. 216-233.
9. Andersson, E.R., R. Sandberg, and U. Lendahl, Notch signaling: simplicity in design, versatility in function. Development, 2011. 138(17): p. 3593-3612.
10. Bray, S.J., Notch signalling in context. Nat Rev Mol Cell Biol, 2016. advance online publication.
11. Reya, T., et al., Stem cells, cancer, and cancer stem cells. Nature, 2001. 414(6859): p. 105-111.
12. John, H.C.S., et al., The Osteoblast to Osteocyte Transition: Epigenetic Changes and Response to the Vitamin D3 Hormone. Molecular Endocrinology, 2014. 28(7): p. 1150-1165.
13. Liu, P., et al., Anabolic actions of Notch on mature bone. Proceedings of the National Academy of Sciences, 2016. 113(15): p. E2152-E2161.
14. Reya, T. and H. Clevers, Wnt signalling in stem cells and cancer. Nature, 2005. 434(7035): p. 843-850.
15. Taipale, J. and P.A. Beachy, The Hedgehog and Wnt signalling pathways in cancer. Nature, 2001. 411(6835): p. 349-354.
16. Hogan, B.L., Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes & Development, 1996. 10(13): p. 1580-1594.
17. Lin, G.L. and K.D. Hankenson, Integration of BMP, Wnt, and notch signaling pathways in osteoblast differentiation. Journal of Cellular Biochemistry, 2011. 112(12): p. 3491-3501.
18. Hennessy, B.T., et al., Exploiting the PI3K/AKT Pathway for Cancer Drug Discovery. Nat Rev Drug Discov, 2005. 4(12): p. 988-1004.
19. Mumm, J.S. and R. Kopan, Notch Signaling: From the Outside In. Developmental Biology, 2000. 228(2): p. 151-165.
![Page 150: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/150.jpg)
124 Reference
20. Liu, J., et al., Chapter Twelve - Notch Signaling in the Regulation of Stem Cell Self-Renewal and Differentiation, in Current Topics in Developmental Biology, K. Raphael, Editor. 2010, Academic Press. p. 367-409.
21. Franz-Odendaal, T.A., B.K. Hall, and P.E. Witten, Buried alive: How osteoblasts become osteocytes. Developmental Dynamics, 2006. 235(1): p. 176-190.
22. Bonewald, L.F., The amazing osteocyte. Journal of Bone and Mineral Research, 2011. 26(2): p. 229-238.
23. van Hove, R.P., et al., Osteocyte morphology in human tibiae of different bone pathologies with different bone mineral density — Is there a role for mechanosensing? Bone, 2009. 45(2): p. 321-329.
24. Pazzaglia, U.E., et al., The shape modulation of osteoblast–osteocyte transformation and its correlation with the fibrillar organization in secondary osteons. Cell and Tissue Research, 2010. 340(3): p. 533-540.
25. Marotti, G., The structure of bone tissues and the cellular control of their deposition. Ital J Anat Embryol, 1996. 101(4): p. 25-79.
26. Kamioka, H., et al., Terminal Differentiation of Osteoblasts to Osteocytes Is Accompanied by Dramatic Changes in the Distribution of Actin-Binding Proteins. Journal of Bone and Mineral Research, 2004. 19(3): p. 471-478.
27. Wetterwald, A., et al., Characterization and cloning of the E11 antigen, a marker expressed by Rat Osteoblasts and Osteocytes. Bone, 1996. 18(2): p. 125-132.
28. Schulze, E., et al., Immunohistochemical investigations on the differentiation marker protein E11 in rat calvaria, calvaria cell culture and the osteoblastic cell line ROS 17/2.8. Histochem Cell Biol, 1999. 111(1): p. 61-9.
29. Ramirez, M.I., et al., T1alpha, a lung type I cell differentiation gene, is required for normal lung cell proliferation and alveolus formation at birth. Dev Biol, 2003. 256(1): p. 61-72.
30. Schacht, V., et al., T1alpha/podoplanin deficiency disrupts normal lymphatic vasculature formation and causes lymphedema. EMBO J, 2003. 22(14): p. 3546-56.
31. Scholl, F.G., et al., Identification of PA2.26 antigen as a novel cell-surface mucin-type glycoprotein that induces plasma membrane extensions and increased motility in keratinocytes. J Cell Sci, 1999. 112 ( Pt 24): p. 4601-13.
32. Zhang, K., et al., E11/gp38 Selective Expression in Osteocytes: Regulation by Mechanical Strain and Role in Dendrite Elongation. Molecular and Cellular Biology, 2006. 26(12): p. 4539-4552.
33. Prideaux, M., et al., Extracellular Matrix Mineralization Promotes E11/gp38 Glycoprotein Expression and Drives Osteocytic Differentiation. PLoS ONE, 2012. 7(5): p. e36786.
34. Narayanan, K., et al., Dual Functional Roles of Dentin Matrix Protein 1: IMPLICATIONS IN BIOMINERALIZATION AND GENE TRANSCRIPTION BY ACTIVATION OF INTRACELLULAR Ca2+ STORE. Journal of Biological Chemistry, 2003. 278(19): p. 17500-17508.
35. George, A., et al., Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. Journal of Biological Chemistry, 1993. 268(17): p. 12624-30.
36. Bellahcène, A., et al., Small Integrin-Binding LIgand N-linked Glycoproteins (SIBLINGs): Multifunctional proteins in cancer. Nature reviews. Cancer, 2008. 8(3): p. 212-226.
![Page 151: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/151.jpg)
References 125
37. Toyosawa, S., et al., Dentin Matrix Protein 1 Is Predominantly Expressed in Chicken and Rat Osteocytes But Not in Osteoblasts. Journal of Bone and Mineral Research, 2001. 16(11): p. 2017-2026.
38. Butler, W.T., et al., Extracellular Matrix Proteins and the Dynamics of Dentin Formation. Connective Tissue Research, 2002. 43(2-3): p. 301-307.
39. Rowe, P.S., et al., MEPE has the properties of an osteoblastic phosphatonin and minhibin. Bone, 2004. 34(2): p. 303-19.
40. Nampei, A., et al., Matrix extracellular phosphoglycoprotein (MEPE) is highly expressed in osteocytes in human bone. J Bone Miner Metab, 2004. 22(3): p. 176-84.
41. Harris, S.E., et al., DMP1 and MEPE expression are elevated in osteocytes after mechanical loading in vivo: Theoretical role in controlling mineral quality in the perilacunar matrix. Journal of musculoskeletal & neuronal interactions, 2007. 7(4): p. 313-315.
42. Mikuni-Takagaki, Y., et al., Matrix mineralization and the differentiation of osteocyte-like cells in culture. J Bone Miner Res, 1995. 10(2): p. 231-42.
43. Knippschild, U., et al., The casein kinase 1 family: participation in multiple cellular processes in eukaryotes. Cell Signal, 2005. 17(6): p. 675-89.
44. Paic, F., et al., Identification of differentially expressed genes between osteoblasts and osteocytes. Bone, 2009. 45(4): p. 682-92.
45. Bonewald, L.F. and M.J. Wacker, FGF23 production by osteocytes. Pediatr Nephrol, 2013. 28(4): p. 563-8.
46. Tang, S.Y., et al., Matrix Metalloproteinase-13 is Required for Osteocytic Perilacunar Remodeling and Maintains Bone Fracture Resistance. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2012. 27(9): p. 1936-1950.
47. Inoue, K., et al., A crucial role for matrix metalloproteinase 2 in osteocytic canalicular formation and bone metabolism. J Biol Chem, 2006. 281(44): p. 33814-24.
48. Holmbeck, K., et al., The metalloproteinase MT1-MMP is required for normal development and maintenance of osteocyte processes in bone. Journal of Cell Science, 2005. 118(1): p. 147-156.
49. Bezooijen, R.L.v., et al., SOST/sclerostin, an osteocyte-derived negative regulator of bone formation. Cytokine & Growth Factor Reviews, 2005. 16(3): p. 319-327.
50. Li, X., et al., Dkk2 has a role in terminal osteoblast differentiation and mineralized matrix formation. Nat Genet, 2005. 37(9): p. 945-952.
51. Liu, S., et al., Regulation of Fibroblastic Growth Factor 23 Expression but Not Degradation by PHEX. Journal of Biological Chemistry, 2003. 278(39): p. 37419-37426.
52. Liu, S., et al., Pathogenic role of Fgf23 in <em>Hyp</em> mice. American Journal of Physiology - Endocrinology And Metabolism, 2006. 291(1): p. E38-E49.
53. Feng, J.Q., L. Ye, and S. Schiavi, Do osteocytes contribute to phosphate homeostasis? Current opinion in nephrology and hypertension, 2009. 18(4): p. 285-291.
54. Schiavi, S.C., Bone talk. Nat Genet, 2006. 38(11): p. 1230-1231. 55. Wang, H., et al., Overexpression of fibroblast growth factor 23 suppresses
osteoblast differentiation and matrix mineralization in vitro. J Bone Miner Res, 2008. 23(6): p. 939-48.
![Page 152: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/152.jpg)
126 Reference
56. Scheiner, S., et al., Investigation of nutrient transport mechanisms in the lacunae-canaliculi system. IOP Conference Series: Materials Science and Engineering, 2010. 10(1): p. 012129.
57. Buenzli, P.R. and N.A. Sims, Quantifying the osteocyte network in the human skeleton. Bone, 2015. 75: p. 144-50.
58. Turner, C.H., et al., Do Bone Cells Behave Like a Neuronal Network? Calcified Tissue International, 2002. 70(6): p. 435-442.
59. Kerschnitzki, M., et al., Architecture of the osteocyte network correlates with bone material quality. J Bone Miner Res, 2013. 28(8): p. 1837-45.
60. Blouin, S., et al., Hypermineralization and High Osteocyte Lacunar Density in Osteogenesis Imperfecta Type V Bone Indicate Exuberant Primary Bone Formation. J Bone Miner Res, 2017.
61. Rodionova, N.V., V.S. Oganov, and N.V. Zolotova, Ultrastructural changes in osteocytes in microgravity conditions. Advances in Space Research, 2002. 30(4): p. 765-770.
62. Wysolmerski, J.J., Osteocytic osteolysis: time for a second look? BoneKEy Reports, 2012. 1: p. 229.
63. Pajevic⁎, P.D., et al., Osteocytes and calcium homeostasis. Bone. 47: p. S23. 64. Marenzana, M., et al., Bone as an ion exchange organ: Evidence for
instantaneous cell-dependent calcium efflux from bone not due to resorption. Bone, 2005. 37(4): p. 545-554.
65. Tazawa, K., et al., Osteocytic osteolysis observed in rats to which parathyroid hormone was continuously administered. Journal of Bone and Mineral Metabolism, 2004. 22(6): p. 524-529.
66. Bélanger, L.F., Osteocytic osteolysis. Calcified Tissue Research, 1969. 4(1): p. 1-12.
67. Mosekilde, L. and F. Melsen, A tetracycline-based histomorphometric evaluation of bone resorption and bone turnover in hyperthyroidism and hyperparathyroidism. Acta Med Scand, 1978. 204(1-2): p. 97-102.
68. Genetos, D.C., et al., Oscillating fluid flow activation of gap junction hemichannels induces atp release from MLO-Y4 osteocytes. Journal of Cellular Physiology, 2007. 212(1): p. 207-214.
69. Lai, C.F., et al., Accentuated ovariectomy-induced bone loss and altered osteogenesis in heterozygous N-cadherin null mice. J Bone Miner Res, 2006. 21(12): p. 1897-906.
70. Schaffler, M.B., et al., Osteocytes: master orchestrators of bone. Calcif Tissue Int, 2014. 94(1): p. 5-24.
71. Goodenough, D.A. and D.L. Paul, Gap Junctions. Cold Spring Harbor Perspectives in Biology, 2009. 1(1): p. a002576.
72. Batra, N., et al., Mechanical stress-activated integrin alpha5beta1 induces opening of connexin 43 hemichannels. Proc Natl Acad Sci U S A, 2012. 109(9): p. 3359-64.
73. Cherian, P.P., et al., Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the release of prostaglandin. Mol Biol Cell, 2005. 16(7): p. 3100-6.
74. Veno PA, L.Y., Kamel S, Feng J, Bonewald LF, Dallas SL, A membrane targeted GFP selectively expressed in osteocytes reveals cell and membrane dynamics in living osteocytes. J Bone Miner Res. , 2010. 25(suppl 1)(S56).
75. Sprinzak, D., et al., Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature, 2010. 465(7294): p. 86-90.
![Page 153: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/153.jpg)
References 127
76. Rios, A.C., et al., Neural crest regulates myogenesis through the transient activation of NOTCH. Nature, 2011. 473(7348): p. 532-535.
77. Bray, S.J., Notch signalling in context. Nat Rev Mol Cell Biol, 2016. 17(11): p. 722-735.
78. Kamioka, H., T. Honjo, and T. Takano-Yamamoto, A three-dimensional distribution of osteocyte processes revealed by the combination of confocal laser scanning microscopy and differential interference contrast microscopy. Bone, 2001. 28(2): p. 145-149.
79. Imai, S., et al., Osteocyte-derived HB-GAM (pleiotrophin) is associated with bone formation and mechanical loading. Bone, 2009. 44(5): p. 785-794.
80. Lehmann, W., et al., Absence of mouse pleiotrophin does not affect bone formation in vivo. Bone, 2004. 35(6): p. 1247-55.
81. Sapir-Koren, R. and G. Livshits, Bone mineralization and regulation of phosphate homeostasis. IBMS BoneKEy, 2011. 8(6): p. 286-300.
82. Feng, J.Q., et al., Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet, 2006. 38(11): p. 1310-5.
83. Dorvee, J.R., et al., Peritubular dentin, a highly mineralized, non-collagenous, component of dentin: isolation and capture by laser microdissection. Connect Tissue Res, 2014. 55 Suppl 1: p. 9-14.
84. Goldberg, M., et al., Dentin: Structure, Composition and Mineralization: The role of dentin ECM in dentin formation and mineralization. Frontiers in Bioscience (Elite Edition), 2011. 3: p. 711-735.
85. Azevedo, N. and M. Goldberg, [Post-natal development of tooth structures in Didelphis albiventris]. J Biol Buccale, 1987. 15(1): p. 23-35.
86. Bell, L.S., M. Kayser, and C. Jones, The mineralized osteocyte: a living fossil. Am J Phys Anthropol, 2008. 137(4): p. 449-56.
87. Lu, Y., et al., The biological function of DMP-1 in osteocyte maturation is mediated by its 57-kDa C-terminal fragment. J Bone Miner Res, 2011. 26(2): p. 331-40.
88. Ling, Y., et al., DMP1 Depletion Decreases Bone Mineralization In Vivo: An FTIR Imaging Analysis. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2005. 20(12): p. 2169-2177.
89. George, A., et al., Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. J Biol Chem, 1993. 268(17): p. 12624-30.
90. Rios, H.F., et al., DMP1 is essential for osteocyte formation and function. J Musculoskelet Neuronal Interact, 2005. 5(4): p. 325-7.
91. van de Lest, C.H. and A.B. Vaandrager, Mechanism of cell-mediated mineralization. Current Opinion in Orthopaedics, 2007. 18(5): p. 434-443.
92. Nam, Y., et al., Structural Basis for Cooperativity in Recruitment of MAML Coactivators to Notch Transcription Complexes. Cell, 2006. 124(5): p. 973-983.
93. Wilson, J.J. and R.A. Kovall, Crystal Structure of the CSL-Notch-Mastermind Ternary Complex Bound to DNA. Cell, 2006. 124(5): p. 985-996.
94. Neves, J., et al., Jagged 1 regulates the restriction of Sox2 expression in the developing chicken inner ear: a mechanism for sensory organ specification. Development, 2011. 138(4): p. 735-44.
![Page 154: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/154.jpg)
128 Reference
95. Hartman, B.H., T.A. Reh, and O. Bermingham-McDonogh, Notch signaling specifies prosensory domains via lateral induction in the developing mammalian inner ear. Proc Natl Acad Sci U S A, 2010. 107(36): p. 15792-7.
96. Brooker, R., K. Hozumi, and J. Lewis, Notch ligands with contrasting functions: Jagged1 and Delta1 in the mouse inner ear. Development, 2006. 133(7): p. 1277-86.
97. Petrovic, J., et al., Ligand-dependent Notch signaling strength orchestrates lateral induction and lateral inhibition in the developing inner ear. Development, 2014. 141(11): p. 2313-24.
98. Daudet, N., L. Ariza-McNaughton, and J. Lewis, Notch signalling is needed to maintain, but not to initiate, the formation of prosensory patches in the chick inner ear. Development, 2007. 134(12): p. 2369-78.
99. Pan, W., et al., Notch signaling is required for the generation of hair cells and supporting cells in the mammalian inner ear. Proc Natl Acad Sci U S A, 2010. 107(36): p. 15798-803.
100. Boareto, M., et al., Jagged–Delta asymmetry in Notch signaling can give rise to a Sender/Receiver hybrid phenotype. Proceedings of the National Academy of Sciences, 2015. 112(5): p. E402-E409.
101. D’Souza, B., L. Meloty-Kapella, and G. Weinmaster, Chapter Three - Canonical and Non-Canonical Notch Ligands, in Current Topics in Developmental Biology, K. Raphael, Editor. 2010, Academic Press. p. 73-129.
102. Luca, V.C., et al., Structural basis for Notch1 engagement of Delta-like 4. Science, 2015. 347(6224): p. 847-853.
103. Fehon, R.G., et al., Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell, 1990. 61(3): p. 523-534.
104. Chillakuri, C.R., et al., Structural analysis uncovers lipid-binding properties of Notch ligands. Cell Rep, 2013. 5(4): p. 861-7.
105. Khait, I., et al., Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Reports, 2016. 14(2): p. 225-233.
106. Cohen, M., et al., Dynamic filopodia transmit intermittent Delta-Notch signaling to drive pattern refinement during lateral inhibition. Dev Cell, 2010. 19(1): p. 78-89.
107. Hamada, H., et al., Involvement of Delta/Notch signaling in zebrafish adult pigment stripe patterning. Development, 2014. 141(2): p. 318-24.
108. Mattila, P.K. and P. Lappalainen, Filopodia: molecular architecture and cellular functions. Nat Rev Mol Cell Biol, 2008. 9(6): p. 446-454.
109. Rios, A.C., et al., Neural crest regulates myogenesis through the transient activation of NOTCH. Nature, 2011. 473(7348): p. 532-5.
110. Jiang, J.X., A.J. Siller-Jackson, and S. Burra, Roles of gap junctions and hemichannels in bone cell functions and in signal transmission of mechanical stress. Frontiers in bioscience : a journal and virtual library, 2007. 12: p. 1450-1462.
111. Schirrmacher, K., et al., Characterization of gap junctions between osteoblast-like cells in culture. Calcified Tissue International, 1992. 51(4): p. 285-290.
112. Fortini, M.E., Notch Signaling: The Core Pathway and Its Posttranslational Regulation. Developmental Cell. 16(5): p. 633-647.
![Page 155: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/155.jpg)
References 129
113. Guruharsha, K.G., M.W. Kankel, and S. Artavanis-Tsakonas, The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat Rev Genet, 2012. 13(9): p. 654-666.
114. Bertet, C., et al., Temporal Patterning of Neuroblasts Controls Notch-Mediated Cell Survival through Regulation of Hid or Reaper. Cell, 2014. 158(5): p. 1173-1186.
115. Skalska, L., et al., Chromatin signatures at Notch‐regulated enhancers reveal large‐scale changes in H3K56ac upon activation. The EMBO Journal, 2015. 34(14): p. 1889-1904.
116. Castel, D., et al., Dynamic binding of RBPJ is determined by Notch signaling status. Genes & Development, 2013. 27(9): p. 1059-1071.
117. Wang, H., et al., NOTCH1–RBPJ complexes drive target gene expression through dynamic interactions with superenhancers. Proceedings of the National Academy of Sciences, 2014. 111(2): p. 705-710.
118. Martinez, A.-M., et al., Polyhomeotic has a tumor suppressor activity mediated by repression of Notch signaling. Nat Genet, 2009. 41(10): p. 1076-1082.
119. Endo, K., et al., Chromatin modification of Notch targets in olfactory receptor neuron diversification. Nat Neurosci, 2012. 15(2): p. 224-233.
120. South, A.P., R.J. Cho, and J.C. Aster, The double-edged sword of Notch signaling in cancer. Seminars in Cell & Developmental Biology, 2012. 23(4): p. 458-464.
121. Hirata, H., et al., Oscillatory Expression of the bHLH Factor Hes1 Regulated by a Negative Feedback Loop. Science, 2002. 298(5594): p. 840-843.
122. Hirata, H., et al., Instability of Hes7 protein is crucial for the somite segmentation clock. Nat Genet, 2004. 36(7): p. 750-754.
123. Li, L., et al., Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat Genet, 1997. 16(3): p. 243-251.
124. Bulman, M.P., et al., Mutations in the human Delta homologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis. Nat Genet, 2000. 24(4): p. 438-441.
125. Shimojo, H., T. Ohtsuka, and R. Kageyama, Oscillations in Notch Signaling Regulate Maintenance of Neural Progenitors. Neuron, 2008. 58(1): p. 52-64.
126. Lewis, A.K., et al., Distinct expression patterns of notch family receptors and ligands during development of the mammalian inner ear. Mechanisms of Development, 1998. 78(1–2): p. 159-163.
127. Reed, R.D. and M.S. Serfas, Butterfly Wing Pattern Evolution Is Associated with Changes in a Notch/Distal-less Temporal Pattern Formation Process. Current Biology, 2004. 14(13): p. 1159-1166.
128. Chiba, S., Notch signaling in stem cell systems. Stem Cells, 2006. 24(11): p. 2437-47.
129. Lai, E.C., Notch signaling: control of cell communication and cell fate. Development, 2004. 131(5): p. 965-73.
130. Fre, S., et al., Notch signals control the fate of immature progenitor cells in the intestine. Nature, 2005. 435(7044): p. 964-968.
131. Bjornson, C.R., et al., Notch signaling is necessary to maintain quiescence in adult muscle stem cells. Stem Cells, 2012. 30(2): p. 232-42.
132. Wen, Y., et al., Constitutive Notch Activation Upregulates Pax7 and Promotes the Self-Renewal of Skeletal Muscle Satellite Cells. Molecular and Cellular Biology, 2012. 32(12): p. 2300-2311.
![Page 156: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/156.jpg)
130 Reference
133. Dufraine, J., Y. Funahashi, and J. Kitajewski, Notch signaling regulates tumor angiogenesis by diverse mechanisms. Oncogene, 0000. 27(38): p. 5132-5137.
134. Phng, L.K. and H. Gerhardt, Angiogenesis: A Team Effort Coordinated by Notch. Developmental Cell. 16(2): p. 196-208.
135. Kunisato, A., et al., HES-1 preserves purified hematopoietic stem cells ex vivo and accumulates side population cells in vivo. Blood, 2003. 101(5): p. 1777-83.
136. Hadland, B.K., et al., A requirement for Notch1 distinguishes 2 phases of definitive hematopoiesis during development. Blood, 2004. 104(10): p. 3097-3105.
137. de la Pompa, J.L., et al., Conservation of the Notch signalling pathway in mammalian neurogenesis. Development, 1997. 124(6): p. 1139-48.
138. Hitoshi, S., et al., Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes & Development, 2002. 16(7): p. 846-858.
139. Dong, Y., et al., RBPjkappa-dependent Notch signaling regulates mesenchymal progenitor cell proliferation and differentiation during skeletal development. Development, 2010. 137(9): p. 1461-71.
140. Graña, X. and E.P. Reddy, Cell cycle control in mammalian cells: role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CKIs). Oncogene, 1995. 11(2): p. 211-219.
141. Bertoli, C., J.M. Skotheim, and R.A.M. de Bruin, Control of cell cycle transcription during G1 and S phases. Nature reviews. Molecular cell biology, 2013. 14(8): p. 518-528.
142. Reynolds, T.C., S.D. Smith, and J. Sklar, Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the beta T cell receptor gene in human lymphoblastic neoplasms. Cell, 1987. 50(1): p. 107-17.
143. Ellisen, L.W., et al., TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 1991. 66(4): p. 649-61.
144. Girard, L., et al., Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes & Development, 1996. 10(15): p. 1930-1944.
145. Ronchini, C. and A.J. Capobianco, Induction of Cyclin D1 Transcription and CDK2 Activity by Notchic: Implication for Cell Cycle Disruption in Transformation by Notchic. Molecular and Cellular Biology, 2001. 21(17): p. 5925-5934.
146. Feldman, B.J., T. Hampton, and M.L. Cleary, A carboxy-terminal deletion mutant of Notch1 accelerates lymphoid oncogenesis in E2A-PBX1 transgenic mice. Blood, 2000. 96(5): p. 1906-13.
147. Beverly, L.J. and A.J. Capobianco, Perturbation of Ikaros isoform selection by MLV integration is a cooperative event in NotchIC-induced T cell leukemogenesis. Cancer Cell, 2003. 3(6): p. 551-564.
148. Alonso, L. and E. Fuchs, Stem cells in the skin: waste not, Wnt not. Genes & Development, 2003. 17(10): p. 1189-1200.
![Page 157: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/157.jpg)
References 131
149. Rangarajan, A., et al., Notch signaling is a direct determinant of keratinocyte growth arrest and entry into differentiation. EMBO J, 2001. 20(13): p. 3427-36.
150. Takeda, K., et al., Limb and Skin Abnormalities in Mice Lacking IKKα. Science, 1999. 284(5412): p. 313-316.
151. Seitz, C.S., et al., Alterations in NF-κB function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-κB. Proceedings of the National Academy of Sciences, 1998. 95(5): p. 2307-2312.
152. Nickoloff, B.J., et al., Jagged-1 mediated activation of notch signaling induces complete maturation of human keratinocytes through NF-kappaB and PPARgamma. Cell Death Differ, 2002. 9(8): p. 842-55.
153. Chu, J., et al., Repression of activator protein-1-mediated transcriptional activation by the Notch-1 intracellular domain. J Biol Chem, 2002. 277(9): p. 7587-97.
154. Nicolas, M., et al., Notch1 functions as a tumor suppressor in mouse skin. Nat Genet, 2003. 33(3): p. 416-421.
155. McLaughlin-Drubin, M.E. and K. Münger, The Human Papillomavirus E7 Oncoprotein. Virology, 2009. 384(2): p. 335-344.
156. Helt, A.M., J.O. Funk, and D.A. Galloway, Inactivation of both the retinoblastoma tumor suppressor and p21 by the human papillomavirus type 16 E7 oncoprotein is necessary to inhibit cell cycle arrest in human epithelial cells. J Virol, 2002. 76(20): p. 10559-68.
157. Westbrook, T.F., et al., E7 abolishes raf-induced arrest via mislocalization of p21(Cip1). Mol Cell Biol, 2002. 22(20): p. 7041-52.
158. Sharma, M., W.W. Chuang, and Z. Sun, Phosphatidylinositol 3-kinase/Akt stimulates androgen pathway through GSK3beta inhibition and nuclear beta-catenin accumulation. J Biol Chem, 2002. 277(34): p. 30935-41.
159. Patturajan, M., et al., DeltaNp63 induces beta-catenin nuclear accumulation and signaling. Cancer Cell, 2002. 1(4): p. 369-79.
160. Ma, Y.Y., et al., PIK3CA as an oncogene in cervical cancer. Oncogene, 2000. 19(23): p. 2739-44.
161. Yang, A., et al., p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell, 1998. 2(3): p. 305-16.
162. Engin, F., et al., Dimorphic effects of Notch signaling in bone homeostasis. Nat Med, 2008. 14(3): p. 299-305.
163. Hilton, M.J., et al., Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nat Med, 2008. 14(3): p. 306-14.
164. Tu, X., et al., Physiological Notch Signaling Maintains Bone Homeostasis via RBPjk and Hey Upstream of NFATc1. PLoS Genet, 2012. 8(3): p. e1002577.
165. Salie, R., et al., Ubiquitous overexpression of Hey1 transcription factor leads to osteopenia and chondrocyte hypertrophy in bone. Bone, 2010. 46(3): p. 680-694.
166. Tao, J., et al., Osteosclerosis owing to Notch gain of function is solely Rbpj-dependent. Journal of Bone and Mineral Research, 2010. 25(10): p. 2175-2183.
167. Zanotti, S., et al., Notch Inhibits Osteoblast Differentiation and Causes Osteopenia. Endocrinology, 2008. 149(8): p. 3890-3899.
![Page 158: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/158.jpg)
132 Reference
168. Canalis, E., et al., Osteoblast Lineage-Specific Effects of Notch Activation in the Skeleton. Endocrinology, 2013. 154(2): p. 623-634.
169. Kronenberg, H.M., Developmental regulation of the growth plate. Nature, 2003. 423(6937): p. 332-6.
170. Komori, T., Regulation of skeletal development by the Runx family of transcription factors. Journal of Cellular Biochemistry, 2005. 95(3): p. 445-453.
171. Benedito, R., et al., The Notch Ligands Dll4 and Jagged1 Have Opposing Effects on Angiogenesis. Cell, 2009. 137(6): p. 1124-1135.
172. Ramasamy, S.K., et al., Endothelial Notch activity promotes angiogenesis and osteogenesis in bone. Nature, 2014. 507(7492): p. 376-380.
173. Canalis, E., et al., Canonical Notch activation in osteocytes causes osteopetrosis. American Journal of Physiology - Endocrinology and Metabolism, 2016. 310(2): p. E171-E182.
174. Canalis, E., L. Schilling, and S. Zanotti, Effects of Sex and Notch Signaling on the Osteocyte Cell Pool. Journal of Cellular Physiology, 2016: p. n/a-n/a.
175. Baron, R. and M. Kneissel, WNT signaling in bone homeostasis and disease: from human mutations to treatments. Nat Med, 2013. 19(2): p. 179-192.
176. Krishnan, V., H.U. Bryant, and O.A. MacDougald, Regulation of bone mass by Wnt signaling. The Journal of Clinical Investigation. 116(5): p. 1202-1209.
177. Gaur, T., et al., Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression. Journal of Biological Chemistry, 2005. 280(39): p. 33132-33140.
178. Morvan, F., et al., Deletion of a Single Allele of the Dkk1 Gene Leads to an Increase in Bone Formation and Bone Mass. Journal of Bone and Mineral Research, 2006. 21(6): p. 934-945.
179. Bonewald, L.F. and M.L. Johnson, Osteocytes, mechanosensing and Wnt signaling. Bone, 2008. 42(4): p. 606-615.
180. Li, X., et al., Sclerostin Binds to LRP5/6 and Antagonizes Canonical Wnt Signaling. Journal of Biological Chemistry, 2005. 280(20): p. 19883-19887.
181. Li, X., et al., Targeted Deletion of the Sclerostin Gene in Mice Results in Increased Bone Formation and Bone Strength. Journal of Bone and Mineral Research, 2008. 23(6): p. 860-869.
182. Collette, N.M., et al., Targeted deletion of Sost distal enhancer increases bone formation and bone mass. Proceedings of the National Academy of Sciences, 2012. 109(35): p. 14092-14097.
183. Javaheri, B., et al., Deletion of a Single β-Catenin Allele in Osteocytes Abolishes the Bone Anabolic Response to Loading. Journal of Bone and Mineral Research, 2014. 29(3): p. 705-715.
184. Downward, J., PI 3-kinase, Akt and cell survival. Seminars in Cell & Developmental Biology, 2004. 15(2): p. 177-182.
185. Li, Vivian S.W., et al., Wnt Signaling through Inhibition of β-Catenin Degradation in an Intact Axin1 Complex. Cell, 2012. 149(6): p. 1245-1256.
186. Wu, D. and W. Pan, GSK3: a multifaceted kinase in Wnt signaling. Trends in biochemical sciences, 2010. 35(3): p. 161-168.
187. Foltz, D.R., et al., Glycogen Synthase Kinase-3β Modulates Notch Signaling and Stability. Current Biology, 2002. 12(12): p. 1006-1011.
![Page 159: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/159.jpg)
References 133
188. Espinosa, L., et al., Phosphorylation by Glycogen Synthase Kinase-3β Down-regulates Notch Activity, a Link for Notch and Wnt Pathways. Journal of Biological Chemistry, 2003. 278(34): p. 32227-32235.
189. Yun Hye, J., et al., Regulation of Notch1/NICD and Hes1 Expressions by GSK-3alpha/beta. Mol. Cells, 2009. 27(1): p. 15-19.
190. Liu, X., et al., Lifelong accumulation of bone in mice lacking Pten in osteoblasts. Proceedings of the National Academy of Sciences, 2007. 104(7): p. 2259-2264.
191. Steck, P.A., et al., Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet, 1997. 15(4): p. 356-362.
192. Palomero, T., et al., Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat Med, 2007. 13(10): p. 1203-1210.
193. Jo, H.S., et al., Pten coordinates retinal neurogenesis by regulating Notch signalling. The EMBO Journal, 2012. 31(4): p. 817-828.
194. Gough, N.R., Limiting Notch Signaling with Akt. Science Signaling, 2012. 5(212): p. ec60-ec60.
195. Hales, E.C., et al., Notch1 regulates AKT activation loop (T308) dephosphorylation through modulation of the PP2A phosphatase in PTEN-null T-cell acute lymphoblastic leukemia cells. Journal of Biological Chemistry, 2013.
196. Even, J., M. Eskander, and J. Kang, Bone Morphogenetic Protein in Spine Surgery: Current and Future Uses. Journal of the American Academy of Orthopaedic Surgeons, 2012. 20(9): p. 547-552.
197. Guo, X. and X.F. Wang, Signaling cross-talk between TGF-beta/BMP and other pathways. Cell Res, 2009. 19(1): p. 71-88.
198. Yoon, B.S., et al., Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(14): p. 5062-5067.
199. Salazar, V.S., L.W. Gamer, and V. Rosen, BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol, 2016. 12(4): p. 203-221.
200. Wu, M., G. Chen, and Y.-P. Li, TGF-β and BMP signaling in osteoblast, skeletal development, and bone formation, homeostasis and disease. 2016. 4: p. 16009.
201. Bandyopadhyay, A., et al., Genetic Analysis of the Roles of BMP2, BMP4, and BMP7 in Limb Patterning and Skeletogenesis. PLOS Genetics, 2006. 2(12): p. e216.
202. Wu, L.-a., et al., Development and characterization of a mouse floxed Bmp2 osteoblast cell line that retains osteoblast genotype and phenotype. Cell and tissue research, 2011. 343(3): p. 545-558.
203. Hughes-Fulford, M. and C.F. Li, The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization. J Orthop Surg Res, 2011. 6: p. 8.
204. Tsuji, K., et al., BMP2 activity, although dispensable for bone formation, is required for the initiation of fracture healing. Nat Genet, 2006. 38(12): p. 1424-9.
205. Yang, W., et al., Bmp2 in osteoblasts of periosteum and trabecular bone links bone formation to vascularization and mesenchymal stem cells. J Cell Sci, 2013. 126(Pt 18): p. 4085-98.
![Page 160: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/160.jpg)
134 Reference
206. Mi, M., et al., Chondrocyte BMP2 signaling plays an essential role in bone fracture healing. Gene, 2013. 512(2): p. 211-218.
207. Tezuka, K.-I., et al., Stimulation of Osteoblastic Cell Differentiation by Notch. Journal of Bone and Mineral Research, 2002. 17(2): p. 231-239.
208. Nobta, M., et al., Critical Regulation of Bone Morphogenetic Protein-induced Osteoblastic Differentiation by Delta1/Jagged1-activated Notch1 Signaling. Journal of Biological Chemistry, 2005. 280(16): p. 15842-15848.
209. Santos, A., et al., Mechanical Loading Stimulates BMP7, But Not BMP2, Production by Osteocytes. Calcified Tissue International, 2011. 89(4): p. 318-326.
210. Winkler, D.G., et al., Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. The EMBO Journal, 2003. 22(23): p. 6267-6276.
211. Worthley, D.L., et al., Gremlin 1 identifies a skeletal stem cell with bone, cartilage, and reticular stromal potential. Cell, 2015. 160(1-2): p. 269-84.
212. Khokha, M.K., et al., Gremlin is the BMP antagonist required for maintenance of Shh and Fgf signals during limb patterning. Nat Genet, 2003. 34(3): p. 303-307.
213. Jaeger, E., et al., Hereditary mixed polyposis syndrome is caused by a 40-kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1. Nat Genet, 2012. 44(6): p. 699-703.
214. Chan, Charles K.F., et al., Identification and Specification of the Mouse Skeletal Stem Cell. Cell, 2015. 160(1–2): p. 285-298.
215. Kassem, M. and P. Bianco, Skeletal Stem Cells in Space and Time. Cell, 2015. 160(1–2): p. 17-19.
216. Walsh, D.W., et al., Co-regulation of Gremlin and Notch signalling in diabetic nephropathy. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 2008. 1782(1): p. 10-21.
217. Zuniga, E., et al., Gremlin 2 regulates distinct roles of BMP and Endothelin 1 signaling in dorsoventral patterning of the facial skeleton. Development (Cambridge, England), 2011. 138(23): p. 5147-5156.
218. Wu, X.B., et al., Impaired osteoblastic differentiation, reduced bone formation, and severe osteoporosis in noggin-overexpressing mice. J Clin Invest, 2003. 112(6): p. 924-34.
219. Canalis, E., et al., Conditional inactivation of noggin in the postnatal skeleton causes osteopenia. Endocrinology, 2012. 153(4): p. 1616-26.
220. Spiro, A.S., et al., BMP-7–induced ectopic bone formation and fracture healing is impaired by systemic NSAID application in C57BL/6-mice. Journal of Orthopaedic Research, 2010. 28(6): p. 785-791.
221. Scott, M.A., et al., Brief Review of Models of Ectopic Bone Formation. Stem Cells and Development, 2012. 21(5): p. 655-667.
222. Zhao, B., et al., Heparin Potentiates the in Vivo Ectopic Bone Formation Induced by Bone Morphogenetic Protein-2. Journal of Biological Chemistry, 2006. 281(32): p. 23246-23253.
223. Zara, J.N., et al., High Doses of Bone Morphogenetic Protein 2 Induce Structurally Abnormal Bone and Inflammation In Vivo. Tissue Engineering Part A, 2011. 17(9-10): p. 1389-1399.
224. Shore, E.M., et al., A recurrent mutation in the BMP type I receptor ACVR1 causes inherited and sporadic fibrodysplasia ossificans progressiva. Nat Genet, 2006. 38(5): p. 525-7.
![Page 161: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/161.jpg)
References 135
225. Owen, M. and A.J. Friedenstein, Stromal stem cells: marrow-derived osteogenic precursors. Ciba Foundation symposium, 1988. 136: p. 42-60.
226. Shimizu, T., et al., Notch Signaling Induces Osteogenic Differentiation and Mineralization of Vascular Smooth Muscle Cells. Role of Msx2 Gene Induction via Notch-RBP-Jk Signaling, 2009. 29(7): p. 1104-1111.
227. Shao, J.-S., et al., Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals. Journal of Clinical Investigation, 2005. 115(5): p. 1210-1220.
228. Shimizu, T., et al., Notch Signaling Pathway Enhances Bone Morphogenetic Protein 2 (BMP2) Responsiveness of Msx2 Gene to Induce Osteogenic Differentiation and Mineralization of Vascular Smooth Muscle Cells. Journal of Biological Chemistry, 2011. 286(21): p. 19138-19148.
229. Feng, X.H. and R. Derynck, Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol, 2005. 21: p. 659-93.
230. Seyedin, S.M., et al., Purification and characterization of two cartilage-inducing factors from bovine demineralized bone. Proc Natl Acad Sci U S A, 1985. 82(8): p. 2267-71.
231. Chen, G., C. Deng, and Y.P. Li, TGF-beta and BMP signaling in osteoblast differentiation and bone formation. Int J Biol Sci, 2012. 8(2): p. 272-88.
232. Crane, J.L. and X. Cao, Bone marrow mesenchymal stem cells and TGF-β signaling in bone remodeling. The Journal of Clinical Investigation, 2014. 124(2): p. 466-472.
233. Tang, Y., et al., TGF-beta1-induced migration of bone mesenchymal stem cells couples bone resorption with formation. Nat Med, 2009. 15(7): p. 757-65.
234. Matsunobu, T., et al., Critical roles of the TGF-beta type I receptor ALK5 in perichondrial formation and function, cartilage integrity, and osteoblast differentiation during growth plate development. Dev Biol, 2009. 332(2): p. 325-38.
235. Karsdal, M.A., et al., Matrix Metalloproteinase-dependent Activation of Latent Transforming Growth Factor-β Controls the Conversion of Osteoblasts into Osteocytes by Blocking Osteoblast Apoptosis. Journal of Biological Chemistry, 2002. 277(46): p. 44061-44067.
236. Li, L., et al., Notch-1 Signaling Promotes the Malignant Features of Human Breast Cancer through NF-κB Activation. PLoS ONE, 2014. 9(4): p. e95912.
237. Blaise, R., et al., Involvement of the notch pathway in the regulation of matrix metalloproteinase 13 and the dedifferentiation of articular chondrocytes in murine cartilage. Arthritis & Rheumatism, 2009. 60(2): p. 428-439.
238. Blokzijl, A., et al., Cross-talk between the Notch and TGF-β signaling pathways mediated by interaction of the Notch intracellular domain with Smad3. The Journal of Cell Biology, 2003. 163(4): p. 723-728.
239. Asano, N., et al., Notch1 signaling and regulatory T cell function. J Immunol, 2008. 180(5): p. 2796-804.
240. Carmeliet, P., et al., Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 1998. 394(6692): p. 485-90.
241. Frey, J.L., et al., Hypoxia-inducible factor-1α restricts the anabolic actions of parathyroid hormone. 2014. 2: p. 14005.
242. Gross, T.S., et al., Selected Contribution: Osteocytes upregulate HIF-1α in response to acute disuse and oxygen deprivation. Journal of Applied Physiology, 2001. 90(6): p. 2514-2519.
![Page 162: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/162.jpg)
136 Reference
243. Wang, Y., et al., The hypoxia-inducible factor α pathway couples angiogenesis to osteogenesis during skeletal development. The Journal of Clinical Investigation, 2007. 117(6): p. 1616-1626.
244. Riddle, R.C., et al., Hypoxia-inducible Factor-1α Protein Negatively Regulates Load-induced Bone Formation. Journal of Biological Chemistry, 2011. 286(52): p. 44449-44456.
245. Hirao, M., et al., Oxygen tension is an important mediator of the transformation of osteoblasts to osteocytes. J Bone Miner Metab, 2007. 25(5): p. 266-76.
246. Spencer, J.A., et al., Direct measurement of local oxygen concentration in the bone marrow of live animals. Nature, 2014. 508(7495): p. 269-273.
247. Nombela-Arrieta, C., et al., Quantitative imaging of haematopoietic stem and progenitor cell localization and hypoxic status in the bone marrow microenvironment. Nat Cell Biol, 2013. 15(5): p. 533-543.
248. Gustafsson, M.V., et al., Hypoxia Requires Notch Signaling to Maintain the Undifferentiated Cell State. Developmental Cell, 2005. 9(5): p. 617-628.
249. Cejudo-Martin, P. and R.S. Johnson, A New Notch in the HIF Belt: How Hypoxia Impacts Differentiation. Developmental Cell, 2005. 9(5): p. 574-576.
250. Shah, K.M., et al., Osteocyte isolation and culture methods. BoneKEy Rep, 2016. 5.
251. van der Plas, A. and P.J. Nijweide, Isolation and purification of osteocytes. J Bone Miner Res, 1992. 7(4): p. 389-96.
252. Stern, A.R., et al., Isolation and culture of primary osteocytes from the long bones of skeletally mature and aged mice. Biotechniques, 2012. 52(6): p. 361-73.
253. Kato, Y., et al., Establishment of an osteocyte-like cell line, MLO-Y4. J Bone Miner Res, 1997. 12(12): p. 2014-23.
254. Bellido, T., et al., Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology, 2005. 146(11): p. 4577-83.
255. Papanicolaou, S.E., et al., Modulation of sclerostin expression by mechanical loading and bone morphogenetic proteins in osteogenic cells. Biorheology, 2009. 46(5): p. 389-99.
256. Woo, S.M., et al., Cell line IDG-SW3 replicates osteoblast-to-late-osteocyte differentiation in vitro and accelerates bone formation in vivo. Journal of Bone and Mineral Research, 2011. 26(11): p. 2634-2646.
257. Lu, Y., et al., DMP1-targeted Cre expression in odontoblasts and osteocytes. J Dent Res, 2007. 86(4): p. 320-5.
258. Kramer, I., et al., Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Mol Cell Biol, 2010. 30(12): p. 3071-85.
259. Javaheri, B., et al., Deletion of a single beta-catenin allele in osteocytes abolishes the bone anabolic response to loading. J Bone Miner Res, 2014. 29(3): p. 705-15.
260. Gomez-Barrena, E., et al., Bone regeneration: stem cell therapies and clinical studies in orthopaedics and traumatology. J Cell Mol Med, 2011. 15(6): p. 1266-86.
261. Zaidi, N. and A.J. Nixon, Stem cell therapy in bone repair and regeneration. Ann N Y Acad Sci, 2007. 1117: p. 62-72.
![Page 163: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/163.jpg)
References 137
262. Gegenbaur, C., Untersuchungen zur vergleichenden anatomie der wirbelthiere. 1864, Leipzig: W. Engelmann.
263. McLarren, K.W., et al., The mammalian basic helix loop helix protein HES-1 binds to and modulates the transactivating function of the runt-related factor Cbfa1. J Biol Chem, 2000. 275(1): p. 530-8.
264. Tao, J., S. Chen, and B. Lee, Alteration of Notch signaling in skeletal development and disease. Ann N Y Acad Sci, 2010. 1192: p. 257-68.
265. Zanotti, S. and E. Canalis, NOTCH REGULATION OF BONE DEVELOPMENT AND REMODELING AND RELATED SKELETAL DISORDERS. Calcified Tissue International, 2012. 90(2): p. 69-75.
266. Zanotti, S. and E. Canalis, Notch and the skeleton. Mol Cell Biol, 2010. 30(4): p. 886-96.
267. Deregowski, V., et al., Notch 1 Overexpression Inhibits Osteoblastogenesis by Suppressing Wnt/β-Catenin but Not Bone Morphogenetic Protein Signaling. Journal of Biological Chemistry, 2006. 281(10): p. 6203-6210.
268. Mead, T.J. and K.E. Yutzey, Notch Signaling and the Developing Skeleton, in Notch Signaling in Embryology and Cancer, J. Reichrath and S. Reichrath, Editors. 2012, Springer US: New York, NY. p. 114-130.
269. Chen, S., B.H. Lee, and Y. Bae, Notch signaling in Skeletal Stem Cells. Calcified tissue international, 2014. 94(1): p. 68-77.
270. Zanotti, S. and E. Canalis, The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the RosaNotch Allele. Journal of Cellular Biochemistry, 2016. 117(5): p. 1222-1232.
271. Brack, A.S., et al., A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis. Cell Stem Cell, 2008. 2(1): p. 50-59.
272. Boulter, L., et al., Macrophage-derived Wnt opposes Notch signaling to specify hepatic progenitor cell fate in chronic liver disease. Nat Med, 2012. 18(4): p. 572-579.
273. Takebe, N., et al., Targeting Notch, Hedgehog, and Wnt pathways in cancer stem cells: clinical update. Nature reviews. Clinical oncology, 2015. 12(8): p. 445-464.
274. Kalajzic, I., et al., Use of Type I Collagen Green Fluorescent Protein Transgenes to Identify Subpopulations of Cells at Different Stages of the Osteoblast Lineage. Journal of Bone and Mineral Research, 2002. 17(1): p. 15-25.
275. Rizzo, P., et al., Rational targeting of Notch signaling in cancer. Oncogene, 2008. 27(38): p. 5124-5131.
276. Androutsellis-Theotokis, A., et al., Notch signalling regulates stem cell numbers in vitro and in vivo. Nature, 2006. 442(7104): p. 823-826.
277. Yajima, A., et al., Increased osteocyte death and mineralization inside bone after parathyroidectomy in patients with secondary hyperparathyroidism. J Bone Miner Res, 2010. 25(11): p. 2374-81.
278. Duncan, A.W., et al., Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol, 2005. 6(3): p. 314-322.
279. Krishnan, V., H.U. Bryant, and O.A. MacDougald, Regulation of bone mass by Wnt signaling. Journal of Clinical Investigation, 2006. 116(5): p. 1202-1209.
![Page 164: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/164.jpg)
138 Reference
280. Chen, J. and F. Long, β-catenin promotes bone formation and suppresses bone resorption in postnatal growing mice. Journal of Bone and Mineral Research, 2013. 28(5): p. 1160-1169.
281. Diarra, D., et al., Dickkopf-1 is a master regulator of joint remodeling. Nat Med, 2007. 13(2): p. 156-163.
282. Gonzalez, R.F. and L.G. Dobbs, Purification and analysis of RTI40, a type I alveolar epithelial cell apical membrane protein. Biochim Biophys Acta, 1998. 1429(1): p. 208-16.
283. Sprague, L., A. Wetterwald, U. Heinzman, and M. J. Atkinson. , Phenotypic changes following over-expression of sense or antisense E11 cDNA in ROS 17/2.8 cells. J. Bone Miner. Res. , 1996. 11(S132).
284. Ohizumi, I., et al., Association of CD44 with OTS-8 in tumor vascular endothelial cells. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, 2000. 1497(2): p. 197-203.
285. Arpin, M., et al., Emerging role for ERM proteins in cell adhesion and migration. Cell Adhesion & Migration, 2011. 5(2): p. 199-206.
286. Ponta, H., L. Sherman, and P.A. Herrlich, CD44: From adhesion molecules to signalling regulators. Nat Rev Mol Cell Biol, 2003. 4(1): p. 33-45.
287. Tsukita, S., et al., ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J Cell Biol, 1994. 126(2): p. 391-401.
288. Legg, J.W. and C.M. Isacke, Identification and functional analysis of the ezrin-binding site in the hyaluronan receptor, CD44. Curr Biol, 1998. 8(12): p. 705-8.
289. Yonemura, S., et al., Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol, 1998. 140(4): p. 885-95.
290. Fehon, R.G., A.I. McClatchey, and A. Bretscher, Organizing the Cell Cortex: The role of ERM proteins. Nature reviews. Molecular cell biology, 2010. 11(4): p. 276-287.
291. Saarikangas, J., H. Zhao, and P. Lappalainen, Regulation of the Actin Cytoskeleton-Plasma Membrane Interplay by Phosphoinositides. Physiological Reviews, 2010. 90(1): p. 259-289.
292. Feng, J.Q., et al., Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet, 2006. 38(11): p. 1310-1315.
293. Deshpande, A.S., et al., Primary Structure and Phosphorylation of Dentin Matrix Protein 1 (DMP1) and Dentin Phosphophoryn (DPP) Uniquely Determine Their Role in Biomineralization. Biomacromolecules, 2011. 12(8): p. 2933-2945.
294. He, G., et al., Spatially and Temporally Controlled Biomineralization Is Facilitated by Interaction between Self-Assembled Dentin Matrix Protein 1 and Calcium Phosphate Nuclei in Solution. Biochemistry, 2005. 44(49): p. 16140-16148.
295. Boonrungsiman, S., et al., The role of intracellular calcium phosphate in osteoblast-mediated bone apatite formation. Proceedings of the National Academy of Sciences, 2012. 109(35): p. 14170-14175.
296. Mahamid, J., et al., Amorphous calcium phosphate is a major component of the forming fin bones of zebrafish: Indications for an amorphous precursor
![Page 165: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/165.jpg)
References 139
phase. Proceedings of the National Academy of Sciences, 2008. 105(35): p. 12748-12753.
297. Mahamid, J., et al., Bone mineralization proceeds through intracellular calcium phosphate loaded vesicles: A cryo-electron microscopy study. Journal of Structural Biology, 2011. 174(3): p. 527-535.
298. Cao, Y.X., M.I. Ramirez, and M.C. Williams, Enhanced binding of Sp1/Sp3 transcription factors mediates the hyperoxia-induced increased expression of the lung type I cell gene T1alpha. J Cell Biochem, 2003. 89(5): p. 887-901.
299. Hantusch, B., et al., Sp1/Sp3 and DNA-methylation contribute to basal transcriptional activation of human podoplanin in MG63 versus Saos-2 osteoblastic cells. BMC Mol Biol, 2007. 8: p. 20.
300. Kunita, A., et al., Podoplanin is regulated by AP-1 and promotes platelet aggregation and cell migration in osteosarcoma. Am J Pathol, 2011. 179(2): p. 1041-9.
301. Jacob, A., Y. Zhang, and A. George, Transcriptional regulation of dentin matrix protein 1 (DMP1) in odontoblasts and osteoblasts. Connect Tissue Res, 2014. 55 Suppl 1: p. 107-12.
302. Wei, G., et al., Genome-wide analyses of transcription factor GATA3-mediated gene regulation in distinct T cell types. Immunity, 2011. 35(2): p. 299-311.
303. Radtke, F., H.R. MacDonald, and F. Tacchini-Cottier, Regulation of innate and adaptive immunity by Notch. Nat Rev Immunol, 2013. 13(6): p. 427-37.
304. Haines, K.M., E.L. Feldman, and S.I. Lentz, Visualization of Mitochondrial DNA Replication in Individual Cells by EdU Signal Amplification. 2010(45): p. e2147.
305. Deupree, S.M. and M.H. Schoenfisch, Quantitative Method for Determining the Lateral Strength of Bacterial Adhesion and Application for Characterizing Adhesion Kinetics. Langmuir, 2008. 24(9): p. 4700-4707.
306. Chau, J.F., W.F. Leong, and B. Li, Signaling pathways governing osteoblast proliferation, differentiation and function. Histol Histopathol, 2009. 24(12): p. 1593-606.
307. Raucci, A., et al., Osteoblast proliferation or differentiation is regulated by relative strengths of opposing signaling pathways. Journal of Cellular Physiology, 2008. 215(2): p. 442-451.
308. Salazar, V.S., et al., Specification of osteoblast cell fate by canonical Wnt signaling requires <em>Bmp2</em>. Development, 2016.
309. Blanpain, C. and E. Fuchs, Epidermal Stem Cells of the Skin. Annual review of cell and developmental biology, 2006. 22: p. 339-373.
310. Pan, Y., et al., γ-Secretase Functions through Notch Signaling to Maintain Skin Appendages but Is Not Required for Their Patterning or Initial Morphogenesis. Developmental Cell, 2004. 7(5): p. 731-743.
311. Peifer, M. and P. Polakis, Wnt Signaling in Oncogenesis and Embryogenesis--a Look Outside the Nucleus. Science, 2000. 287(5458): p. 1606-1609.
312. Lie, D.-C., et al., Wnt signalling regulates adult hippocampal neurogenesis. Nature, 2005. 437(7063): p. 1370-1375.
313. Dey, A., et al., The role of prenucleation clusters in surface-induced calcium phosphate crystallization. Nat Mater, 2010. 9(12): p. 1010-1014.
314. Sutfin, L.V., M.E. Holtrop, and R.E. Ogilvie, Microanalysis of Individual Mitochondrial Granules with Diameters Less Than 1000 Angstroms. Science, 1971. 174(4012): p. 947-949.
![Page 166: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/166.jpg)
140 Reference
315. Li, Y. and C. Aparicio, Discerning the Subfibrillar Structure of Mineralized Collagen Fibrils: A Model for the Ultrastructure of Bone. PLoS ONE, 2013. 8(9): p. e76782.
316. Thurner, P.J., Atomic force microscopy and indentation force measurement of bone. Wiley Interdiscip Rev Nanomed Nanobiotechnol, 2009. 1(6): p. 624-49.
317. Ren, Y., et al., A Novel Way to Statistically Analyze Morphologic Changes in Dmp1-Null Osteocytes. Connective tissue research, 2014. 55(0 1): p. 129-133.
318. Hu, X.-B., et al., Blockade of Notch Signaling in Tumor-Bearing Mice May Lead to Tumor Regression, Progression, or Metastasis, Depending on Tumor Cell Types. Neoplasia (New York, N.Y.), 2009. 11(1): p. 32-38.
319. Radtke, F. and K. Raj, The role of Notch in tumorigenesis: oncogene or tumour suppressor? Nat Rev Cancer, 2003. 3(10): p. 756-767.
320. Reynolds, T.C., S.D. Smith, and J. Sklar, Analysis of DNA surrounding the breakpoints of chromosomal translocations involving the β T cell receptor gene in human lymphoblastic neoplasms. Cell, 1987. 50(1): p. 107-117.
321. Ellisen, L.W., et al., TAN-1, the human homolog of the Drosophila Notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell, 1991. 66(4): p. 649-661.
322. Borges, M., et al., An achaete-scute homologue essential for neuroendocrine differentiation in the lung. Nature, 1997. 386(6627): p. 852-855.
323. Sriuranpong, V., et al., Notch Signaling Induces Cell Cycle Arrest in Small Cell Lung Cancer Cells. Cancer Research, 2001. 61(7): p. 3200-3205.
324. Ito, T., et al., Basic helix-loop-helix transcription factors regulate the neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development, 2000. 127(18): p. 3913-3921.
325. Hahn, W.C., et al., Creation of human tumour cells with defined genetic elements. Nature, 1999. 400(6743): p. 464-468.
326. Zagouras, P., et al., Alterations in Notch signaling in neoplastic lesions of the human cervix. Proceedings of the National Academy of Sciences, 1995. 92(14): p. 6414-6418.
327. Weijzen, S., et al., Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nat Med, 2002. 8(9): p. 979-986.
328. Polakis, P., Wnt Signaling in Cancer. Cold Spring Harbor Perspectives in Biology, 2012. 4(5): p. a008052.
329. Polakis, P., Wnt signaling and cancer. Genes & Development, 2000. 14(15): p. 1837-1851.
330. Teo, J.L. and M. Kahn, The Wnt signaling pathway in cellular proliferation and differentiation: A tale of two coactivators. Adv Drug Deliv Rev, 2010. 62(12): p. 1149-55.
331. Addison, W.N., et al., Extracellular matrix mineralization in murine MC3T3-E1 osteoblast cultures: An ultrastructural, compositional and comparative analysis with mouse bone. Bone, 2015. 71: p. 244-256.
332. Nudelman, F., et al., The role of collagen in bone apatite formation in the presence of hydroxyapatite nucleation inhibitors. Nat Mater, 2010. 9(12): p. 1004-1009.
333. He, G., et al., Nucleation of apatite crystals in vitro by self-assembled dentin matrix protein 1. Nat Mater, 2003. 2(8): p. 552-558.
![Page 167: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/167.jpg)
References 141
334. He, G. and A. George, Dentin Matrix Protein 1 Immobilized on Type I Collagen Fibrils Facilitates Apatite Deposition in Vitro. Journal of Biological Chemistry, 2004. 279(12): p. 11649-11656.
335. Eapen, A., et al., Calcium-mediated Stress Kinase Activation by DMP1 Promotes Osteoblast Differentiation. Journal of Biological Chemistry, 2010. 285(47): p. 36339-36351.
336. Borggrefe, T. and F. Oswald, The Notch signaling pathway: Transcriptional regulation at Notch target genes. Cellular and Molecular Life Sciences, 2009. 66(10): p. 1631-1646.
337. Murre, C., et al., Structure and function of helix-loop-helix proteins. Biochim Biophys Acta, 1994. 1218(2): p. 129-35.
338. Ohsako, S., et al., Hairy function as a DNA-binding helix-loop-helix repressor of Drosophila sensory organ formation. Genes Dev, 1994. 8(22): p. 2743-55.
339. Van Doren, M., et al., Negative regulation of proneural gene activity: hairy is a direct transcriptional repressor of achaete. Genes Dev, 1994. 8(22): p. 2729-42.
340. Fisher, A. and M. Caudy, The function of hairy-related bHLH repressor proteins in cell fate decisions. Bioessays, 1998. 20(4): p. 298-306.
341. Jennings, B.H., D.M. Tyler, and S.J. Bray, Target specificities of Drosophila enhancer of split basic helix-loop-helix proteins. Mol Cell Biol, 1999. 19(7): p. 4600-10.
342. Davis, R.L. and D.L. Turner, Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene, 2001. 20(58): p. 8342-57.
343. Iso, T., L. Kedes, and Y. Hamamori, HES and HERP families: Multiple effectors of the notch signaling pathway. Journal of Cellular Physiology, 2003. 194(3): p. 237-255.
344. Gao, F., et al., Hes1 is involved in the self-renewal and tumourigenicity of stem-like cancer cells in colon cancer. Scientific Reports, 2014. 4: p. 3963.
345. Murata, K., et al., Hes1 Directly Controls Cell Proliferation through the Transcriptional Repression of p27(Kip1). Molecular and Cellular Biology, 2005. 25(10): p. 4262-4271.
346. Kobayashi, T. and R. Kageyama, Hes1 regulates embryonic stem cell differentiation by suppressing Notch signaling. Genes to Cells, 2010. 15(7): p. 689-698.
347. Kato, T., et al., Hes1 suppresses acute myeloid leukemia development through FLT3 repression. Leukemia, 2015. 29(3): p. 576-85.
348. Chen, G., et al., A functional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development. Genes Dev, 1999. 13(17): p. 2218-30.
349. Sasai, Y., et al., Two mammalian helix-loop-helix factors structurally related to Drosophila hairy and Enhancer of split. Genes Dev, 1992. 6(12B): p. 2620-34.
350. Kannan, S., et al., Notch/HES1-mediated PARP1 activation: a cell type–specific mechanism for tumor suppression. Blood, 2011. 117(10): p. 2891-2900.
351. Ju, B.-G., et al., Activating the PARP-1 Sensor Component of the Groucho/ TLE1 Corepressor Complex Mediates a CaMKinase IIδ-Dependent Neurogenic Gene Activation Pathway. Cell, 2004. 119(6): p. 815-829.
![Page 168: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/168.jpg)
142 Reference
352. Mannervik, M., et al., Transcriptional Coregulators in Development. Science, 1999. 284(5414): p. 606-609.
353. Zanotti, S., A. Smerdel-Ramoya, and E. Canalis, HES1 (Hairy and Enhancer of Split 1) Is a Determinant of Bone Mass. Journal of Biological Chemistry, 2011. 286(4): p. 2648-2657.
354. Zhang, H., et al., Use of Hes1-GFP reporter mice to assess activity of the Hes1 promoter in bone cells under chronic inflammation. Bone, 2016. 90: p. 80-89.
355. Wan, Y.Y., GATA3: A master of many trades in immune regulation. Trends in immunology, 2014. 35(6): p. 233-242.
356. Taghon, T.N., et al., Delayed, asynchronous, and reversible T-lineage specification induced by Notch/Delta signaling. Genes Dev, 2005. 19(8): p. 965-78.
357. Gao, C., G. Xiao, and J. Hu, Regulation of Wnt/β-catenin signaling by posttranslational modifications. Cell & Bioscience, 2014. 4(1): p. 13.
358. Metcalfe, C. and M. Bienz, Inhibition of GSK3 by Wnt signalling – two contrasting models. Journal of Cell Science, 2011. 124(21): p. 3537-3544.
359. Endo, H., et al., Activation of the Akt/GSK3β Signaling Pathway Mediates Survival of Vulnerable Hippocampal Neurons after Transient Global Cerebral Ischemia in Rats. Journal of Cerebral Blood Flow & Metabolism, 2006. 26(12): p. 1479-1489.
360. Reis, C.R., et al., Crosstalk between Akt/GSK3β signaling and dynamin-1 regulates clathrin-mediated endocytosis. The EMBO Journal, 2015. 34(16): p. 2132-2146.
361. Li, J., et al., PTEN, a Putative Protein Tyrosine Phosphatase Gene Mutated in Human Brain, Breast, and Prostate Cancer. Science, 1997. 275(5308): p. 1943-1947.
362. Dalby, B., et al., Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications. Methods, 2004. 33(2): p. 95-103.
363. Gossen, M. and H. Bujard, Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences of the United States of America, 1992. 89(12): p. 5547-5551.
364. Conboy, I.M., et al., Notch-Mediated Restoration of Regenerative Potential to Aged Muscle. Science, 2003. 302(5650): p. 1575-1577.
365. Wu, C., C. Suzuki-Ogoh, and Y. Ohmiya, Dual-reporter assay using two secreted luciferase genes. Biotechniques, 2007. 42(3): p. 290, 292.
366. Fre, S., et al., Notch and Wnt signals cooperatively control cell proliferation and tumorigenesis in the intestine. Proceedings of the National Academy of Sciences, 2009. 106(15): p. 6309-6314.
367. Munnamalai, V. and D.M. Fekete, Notch-Wnt-Bmp crosstalk regulates radial patterning in the mouse cochlea in a spatiotemporal manner. Development, 2016.
368. Morris, S.-A.L. and S. Huang, Crosstalk of the Wnt/β-catenin pathway with other pathways in cancer cells. Genes & Diseases, 2016. 3(1): p. 41-47.
369. Baron, R. and G. Rawadi, Targeting the Wnt/β-Catenin Pathway to Regulate Bone Formation in the Adult Skeleton. Endocrinology, 2007. 148(6): p. 2635-2643.
![Page 169: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/169.jpg)
References 143
370. Regard, J.B., et al., Wnt Signaling in Bone Development and Disease: Making Stronger Bone with Wnts. Cold Spring Harbor Perspectives in Biology, 2012. 4(12): p. a007997.
371. Stewart, S., et al., Sequential and Opposing Activities of Wnt and BMP Coordinate Zebrafish Bone Regeneration. Cell Reports, 2014. 6(3): p. 482-498.
372. Hilton, M.J., et al., Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nat Med, 2008. 14(3): p. 306-314.
373. Tao, J., S. Chen, and B. Lee, Alteration of Notch signaling in skeletal development and disease. Annals of the New York Academy of Sciences, 2010. 1192: p. 257-268.
374. Zanotti, S. and E. Canalis, Notch and the Skeleton. Molecular and Cellular Biology, 2010. 30(4): p. 886-896.
375. Tao, J., et al., Osteosclerosis Due to Notch Gain of Function Is Solely Rbpj-dependent. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 2010. 25(10): p. 2175-2183.
376. Canalis, E., et al., Notch Signaling in Osteocytes Differentially Regulates Cancellous and Cortical Bone Remodeling. Journal of Biological Chemistry, 2013. 288(35): p. 25614-25625.
377. Gade, P. and D.V. Kalvakolanu, Chromatin Immunoprecipitation Assay as a Tool for Analyzing Transcription Factor Activity. Methods in molecular biology (Clifton, N.J.), 2012. 809: p. 85-104.
378. Smith, A.J. and S.E. Humphries, Characterization of DNA-binding proteins using multiplexed competitor EMSA. J Mol Biol, 2009. 385(3): p. 714-7.
379. Panin, V.M., et al., Fringe modulates Notch-ligand interactions. Nature, 1997. 387(6636): p. 908-912.
380. Petrovic, J., et al., Ligand-dependent Notch signaling strength orchestrates lateral induction and lateral inhibition in the developing inner ear. Development, 2014. 141(11): p. 2313-2324.
381. Hein, K., et al., Site-specific methylation of Notch1 controls the amplitude and duration of the Notch1 response. Science Signaling, 2015. 8(369): p. ra30-ra30.
382. Guarani, V., et al., Acetylation-dependent regulation of endothelial Notch signalling by the SIRT1 deacetylase. Nature, 2011. 473(7346): p. 234-238.
383. Jacob, A., Y. Zhang, and A. George, Transcriptional regulation of dentin matrix protein 1 (DMP1) in odontoblasts and osteoblasts. Connective Tissue Research, 2014. 55(sup1): p. 107-112.
384. Narayanan, K., et al., Transcriptional Regulation of Dentin Matrix Protein 1 by JunB and p300 during Osteoblast Differentiation. Journal of Biological Chemistry, 2004. 279(43): p. 44294-44302.
385. Santaguida, M., et al., JunB Protects against Myeloid Malignancies by Limiting Hematopoietic Stem Cell Proliferation and Differentiation without Affecting Self-Renewal. Cancer Cell, 2009. 15(4): p. 341-352.
386. Zamurovic, N., et al., Coordinated Activation of Notch, Wnt, and Transforming Growth Factor-β Signaling Pathways in Bone Morphogenic Protein 2-induced Osteogenesis: Notch TARGET GENE Hey1 INHIBITS MINERALIZATION AND Runx2 TRANSCRIPTIONAL ACTIVITY. Journal of Biological Chemistry, 2004. 279(36): p. 37704-37715.
![Page 170: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/170.jpg)
144 Reference
387. Neer , R.M., et al., Effect of Parathyroid Hormone (1-34) on Fractures and Bone Mineral Density in Postmenopausal Women with Osteoporosis. New England Journal of Medicine, 2001. 344(19): p. 1434-1441.
388. Robinson, J.A., et al., Wnt/β-Catenin Signaling Is a Normal Physiological Response to Mechanical Loading in Bone. Journal of Biological Chemistry, 2006. 281(42): p. 31720-31728.
389. Iwamoto, T., et al., The role of extracellular ATP-mediated purinergic signaling in bone, cartilage, and tooth tissue. Journal of Oral Biosciences, 2014. 56(4): p. 131-135.
390. Xing, Y., et al., The Roles of P2Y2 Purinergic Receptors in Osteoblasts and Mechanotransduction. PLOS ONE, 2014. 9(9): p. e108417.
391. Veno P, N.D., Sivakumar P, Kalajzic I, Rowe D, Harris SE, Bonewald L, Dallas SL., Live imaging of osteocytes within their lacunae reveals cell body and dendrite motions. Journal of Bone and Mineral Research, 2006. 21(S38).
392. Regard, J.B., et al., Wnt Signaling in Bone Development and Disease: Making Stronger Bone with Wnts. Cold Spring Harbor Perspectives in Biology, 2012. 4(12).
393. Thiery, J.P., Epithelial-mesenchymal transitions in development and pathologies. Curr Opin Cell Biol, 2003. 15(6): p. 740-6.
394. Jakobsson, L., et al., Endothelial cells dynamically compete for the tip cell position during angiogenic sprouting. Nat Cell Biol, 2010. 12(10): p. 943-53.
395. Kornberg, T.B. and S. Roy, Cytonemes as specialized signaling filopodia. Development, 2014. 141(4): p. 729-36.
396. Khait, I., et al., Quantitative Analysis of Delta-like 1 Membrane Dynamics Elucidates the Role of Contact Geometry on Notch Signaling. Cell Rep, 2016. 14(2): p. 225-33.
397. Shaya, O., et al., Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Developmental Cell, 2017. 40(5): p. 505-511.e6.
398. Townsley, F.M., A. Cliffe, and M. Bienz, Pygopus and Legless target Armadillo/[beta]-catenin to the nucleus to enable its transcriptional co-activator function. Nat Cell Biol, 2004. 6(7): p. 626-633.
399. MacDonald, B.T., K. Tamai, and X. He, Wnt/β-catenin signaling: components, mechanisms, and diseases. Developmental cell, 2009. 17(1): p. 9-26.
400. Wu, X., et al., Rac1 Activation Controls Nuclear Localization of β-catenin during Canonical Wnt Signaling. Cell, 2008. 133(2): p. 340-353.
401. Yu, X. and R.C. Malenka, Beta-catenin is critical for dendritic morphogenesis. Nat Neurosci, 2003. 6(11): p. 1169-77.
402. Rosso, S.B., et al., Wnt signaling through Dishevelled, Rac and JNK regulates dendritic development. Nat Neurosci, 2005. 8(1): p. 34-42.
403. Amit, S., et al., Axin-mediated CKI phosphorylation of β-catenin at Ser 45: a molecular switch for the Wnt pathway. Genes & Development, 2002. 16(9): p. 1066-1076.
404. Liu, C., et al., Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell, 2002. 108(6): p. 837-47.
405. He, X., et al., LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development, 2004. 131(8): p. 1663-77.
406. Zeng, X., et al., A dual-kinase mechanism for Wnt co-receptor phosphorylation and activation. Nature, 2005. 438(7069): p. 873-7.
![Page 171: NOTCH SIGALLING PATHWAY REGULATES THE TERMINAL … · 2018. 7. 25. · Shao Jin, Zhou Yinghong, Xiao Yin. Notch in Osteoblasts Fate Decision. (2017) Molecular Aspects of Medicine](https://reader035.vdocuments.us/reader035/viewer/2022071019/5fd291eeb7a4107e5170c5af/html5/thumbnails/171.jpg)
References 145
407. Bek, S. and R. Kemler, Protein kinase CKII regulates the interaction of beta-catenin with alpha-catenin and its protein stability. J Cell Sci, 2002. 115(Pt 24): p. 4743-53.
408. Nelson, W.J. and R. Nusse, Convergence of Wnt, beta-catenin, and cadherin pathways. Science, 2004. 303(5663): p. 1483-7.
409. Zhang, S., et al., Inhibition of CK2α down-regulates Notch1 signalling in lung cancer cells. Journal of Cellular and Molecular Medicine, 2013. 17(7): p. 854-862.
410. Zhang, S., et al., Inhibition of CK2α Down-Regulates Hedgehog/Gli Signaling Leading to a Reduction of a Stem-Like Side Population in Human Lung Cancer Cells. PLOS ONE, 2012. 7(6): p. e38996.
411. Katoh, M., Networking of WNT, FGF, Notch, BMP, and Hedgehog signaling pathways during carcinogenesis. Stem Cell Rev, 2007. 3(1): p. 30-8.
412. Gu, G., et al., Isolated primary osteocytes express functional gap junctions in vitro. Cell and Tissue Research, 2006. 323(2): p. 263-271.
413. A., v.d.P. and N. P.J., Isolation and purification of osteocytes. Journal of Bone and Mineral Research, 1992. 7(4): p. 389-396.
414. Florian, B., et al., Human Primary Osteocyte Differentiation in a 3D Culture System. Journal of Bone and Mineral Research, 2009. 24(11): p. 1927-1935.
415. Oda, T., et al., Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat Genet, 1997. 16(3): p. 235-242.
416. Olsen, I.E., et al., Deficits in size-adjusted bone mass in children with Alagille syndrome. J Pediatr Gastroenterol Nutr, 2005. 40(1): p. 76-82.
417. Bales, C.B., et al., Pathologic lower extremity fractures in children with Alagille syndrome. J Pediatr Gastroenterol Nutr, 2010. 51(1): p. 66-70.
418. Youngstrom, D.W., et al., Jagged1 expression by osteoblast-lineage cells regulates trabecular bone mass and periosteal expansion in mice. Bone, 2016. 91: p. 64-74.
419. Lawal, R.A., et al., The Notch Ligand Jagged1 Regulates the Osteoblastic Lineage by Maintaining the Osteoprogenitor Pool. Journal of Bone and Mineral Research, 2017. 32(6): p. 1320-1331.
420. Zanotti, S. and E. Canalis, Parathyroid hormone inhibits Notch signaling in osteoblasts and osteocytes. Bone, 2017. 103: p. 159-167.
421. Shaya, O., et al., Cell-Cell Contact Area Affects Notch Signaling and Notch-Dependent Patterning. Dev Cell, 2017. 40(5): p. 505-511 e6.
422. Andersson, E.R. and U. Lendahl, Therapeutic modulation of Notch signalling [mdash] are we there yet? Nat Rev Drug Discov, 2014. 13(5): p. 357-378.
423. Isidor, B., et al., Truncating mutations in the last exon of NOTCH2 cause a rare skeletal disorder with osteoporosis. Nat Genet, 2011. 43(4): p. 306-308.
424. Simpson, M.A., et al., Mutations in NOTCH2 cause Hajdu-Cheney syndrome, a disorder of severe and progressive bone loss. Nat Genet, 2011. 43(4): p. 303-305.