Upload File

normal allele pku allele # 1 dna mrna protein intron exon the amino acids that signal the enzyme to...

  • Home
  • Documents
  • Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting
6
Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting in the DNA not being cut as it normally would. This deletion could also cause a frame shift that could change the amino acids that occur after the mutation. This could lead to the base sequence that the enzyme cuts to appear more or less frequently than normal, causing the DNA to be cut differently. This would affect the Group # 1: Questions : 1. Mental retardation 2. Dihydropteridine reductase 3. Autosomal recessive 4. Incidence: 1 in 10,000 Allele Frequency: 1 in 100 Deletion of Exon results in loss of 52 amino acids protein would be smaller than normal and take on a different shape because the charges of the amino acid and alter the way they bind together

Upload: richard-shelton

Post on 21-Jan-2016

225 views

Category:

Documents


0 download

Report

TRANSCRIPT

Page 1: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

Normal allele PKU allele # 1

DNA

mRNA

protein

IntronExon

The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting in the DNA not being cut as it normally would. This deletion could also cause a frame shift that could change the amino acids that occur after the mutation. This could lead to the base sequence that the enzyme cuts to appear more or less frequently than normal, causing the DNA to be cut differently. This would affect the size, shape, and function of the protein created, causing a deficiency of phenylalanine hydroxylase resulting in PKU.

Group # 1:

Questions:1. Mental retardation 2. Dihydropteridine reductase 3. Autosomal recessive4. Incidence: 1 in 10,000 Allele Frequency: 1 in 100

Deletion of Exon results in loss of 52 amino acids

protein would be smaller than normal and take on a different shape because the charges of the amino acid and alter the way they bind together

Page 2: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

Normal allele PKU allele # 4

DNA

mRNA

protein

IntronExon

Phenylketonuria

Glu280 Lys280

gaa

gaa

aaa

aaa

•The codon for Glutamate (gaa) was mutated to a codon for Lysine (aaa).

•This would cause the loss of a negatively charged amino acid which is then replaced with a positively charged amino acid.

Page 3: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

Questions

1. Light pigmentation, epilepsy,

“moosy” odor

2. PAH

3. Autosomal recessive

4. 1 per 10,000; 1/100

Group # 22

Normal allele PKU allele # _11__

DNA

mRNA

protein

IntronExon

ARG

PAH

STOP CODON

CGA TGA

CGA UGA

Page 4: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

1. Mental Retardation, mousy odor, light pigmentation, peculiarities of gait, stance, and sitting posture, eczema, and epilepsy.

2. Phenylalanine hydroxylase enzyme.

3. Autosomal recessive

4. Incidence is 1 per 10,000 allele frequency = 0.01 or 1/100

Group # 25

Normal allele PKU allele # 23

DNA

mRNA

protein

IntronExon

TCC TTC

UCC UUC

SER PHE

Serine is an uncharged polar amino acid, which is replaced with phenylalanine an uncharged nonpolar amino acid. Changing from polar to nonpolar would be crucial to the enzyme phenylalanine hydroxylase, which normally converts phenylalanine to the amino acid, tyrosine.

273 273

Page 5: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

Questions

1. Symptoms of PKUa. Untreated: mental retardation, “mousy” odor, light pigmentation, peculiarities of gait,

stance, and sitting posture, eczema, and epilepsy

b. Treated: mildly depressed IQ

2. PKU results from a mutation in the structural gene for phenylalanine hydroxylase.

3. The mode of inheritance is autosomol recessive.

4. The incidence of PKU in Europeans at birth is 1 per 10,000.

a. The predicted allele frequency of the PKU allele is 1/100

b. The predicted carrier frequency is 198 per 10,000 or .0198.

Group #28

Normal allele PKU allele # 46

DNA

mRNA

protein

IntronExon

DNA

mRNA

protein

In-frame deletion occurs to exon 11

Protein has section missing due to deletion of exon 11, there for it is

lacking 5 amino acids

Exon 11

Page 6: Normal allele PKU allele # 1 DNA mRNA protein Intron Exon The amino acids that signal the enzyme to cut the DNA could be lost in the deletion resulting

Questions1. Mental retardation, light pigmentation,

eczema, and epilepsy

2. Phenylalanine hydroxylase 3. Autosomal recessive

4. PKU in Europeans is 1 in 10,000.

Predicted allele frequency is 1 in 100.

Group #Names

Normal allele PKU allele # __61_

DNA

mRNA

protein

IntronExon

The deletions of the bases in codon 376 and 377 caused a

stop codon to be created at 399, making a premature termination in the protein.

32


Targeting, disruption, replacement, and allele rescue: Integrative DNA transformation in yeast

Cabling Guidelines for INTRON-D / INTRON-D plus Systems · PDF fileCabling Guidelines for INTRON-D / INTRON-D plus Systems . Doc. no. 330-001-403 • Rev. 9 • EN ... Y... (according

PRODUCT INFORMATION INTRON A Interferon alfa … 1 PRODUCT INFORMATION INTRON® A Interferon alfa-2b, recombinant For Injection WARNING Alpha interferons, including INTRON ® A, cause

In vivo and in vitro analyses of an intron-encoded DNA

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State

Error Correction in Single-Cell DNA Sequencing · Error Correction in Single-Cell DNA Sequencing: Finding Rare Allele for MRD Clone Dong Kim1, Manimozhi Manivannan1, Sombeet Sahu1,

Investigations into Etiology of Breast, Esophageal, and Gastric Cancers: Allele-specific Gene Expression and DNA Methylation Signature Maxwell Lee, Ph.D

CRS1, a Chloroplast Group II Intron Splicing Factor ... · Intron Folding through Specific Interactions with Two Intron Domains W Oren Ostersetzer,1 Amy M. Cooke, Kenneth P. Watkins,

Allele Frequency Data · Minimum allele frequency = 0.0123 Null allele frequency = 0.0123 Min Allele Frequency and Null Allele Frequency calculated as 5/2N where N = 203 Note: single-allele

Heredity and Genetics Mr. Erick Santizo. DEFINE the following Allele Chromosome Metaphase DNA Interphase

Three generations of DNA testing DQ-alpha TEST STRIP Allele = BLUE DOT RFLP AUTORAD Allele = BAND Automated STR ELECTROPHEROGRAM Allele = PEAK

Genetics Heredity DNA Chromosomes Genes Genome Genotype Phenotype Traits Allele Dominant Recessive Homozygous Heterozygous

GENETICS VOCABULARY QUIZ 2 · GENETICS VOCABULARY QUIZ 2 Allele Dominant Allele Recessive Allele Phenotype Genotype Heterozygous/Hybrid Homozygous/Purbred 1. 2 Allele Allele- one

Alternative Splicing Genomic DNA Sequence GmGm AAAAA Exon Intron Exon GmGm AAAAA Transcription mRNA RNA Processing pre-mRNA

Gene- segment of DNA that codes for a trait Gene- segment of DNA that codes for a trait Dominant- trait that normally is expressed, only need one allele

REVIEW Open Access Origin and evolution of spliceosomal ......Keywords: Intron sliding, Intron gain, Intron loss, Spliceosome, Splicing signals, Evolution of exon/intron structure,

Intron LTE

Biology 12. Definitions Allele - alternative form of a gene Chromosome – chunk of DNA DNA – the genetic information in a nucleus Gene – section of chromosome

Utility of nuclear DNA intron markers at lower taxonomic levels.pdf

DNA Study Guide - Vegas satisfiesnicksmithhoover.weebly.com/uploads/1/3/3/1/13311271/dna... · 2019. 11. 13. · allele and a gene. •A gene is the basic physical and functional

Exon coconversion biases accompanying intron homing ...genesdev.cshlp.org/content/10/17/2158.full.pdf · Exon coconversion biases accompanying intron homing: battle of the ... Intron-containing

Lesson 59 Gene Combo. Allele Dominant model Probability Random Key Vocabulary Recessive Gene DNA Mutation Fertilization Inherit

Intron correlations evolution intron/exon

Genetic Control of Cell Chemistry Using Serratia … DNA molecule. Within the nucleus, the DNA nucleotide sequence or allele for the gene produces a complimentary RNA nucleotide sequence

Autosomal STR Interpretation Guidelines · 2017. 12. 20. · 2. Allele designation – calling peaks as alleles 3. Interpretation of DNA typing results – using the allele information

Intron Evolution: Testing Hypotheses of Intron Evolution

Combining allele frequency uncertainty and population … · 2015-10-07 · Combining allele frequency uncertainty and population substructure corrections in forensic DNA calculations

INTRON TECHNOLOGY HOLDINGS LIMITED

SnapShot: High-Throughput Sequencing Applicationssites.utoronto.ca/intron/snapshot_han_et_al.pdf · DNA-Protein Interactions and Epigenome Sequencing Chromatin immunoprecipitation

Rules for DNA target-site recognition by a lactococcal group II intron

Automated STR Analysis for DNA Databases - ncjrs.gov · Automated STR Analysis for DNA Databases 2OOO-IJ-CX-KoO5 Allele designation. Using its internal database of DNA sizes and concentrations,

INTRON-D plus

Use of Thermostable Group II Intron Reverse Transcriptases (TGIRTs) for Single-Stranded DNA-seq of Cell-Free DNA in Human Plasma

Original Article DNA repair genotype and lung …with lung cancer risk at the gene level (p=0.02), and the A allele of rs246079 was associated with an increased risk (per A allele

Use of Thermostable Group II Intron Reverse Transcriptases (TGIRTs) for Single- Stranded DNA-seq of Cell-Free DNA in Human Plasma and Molecular Diagnostics