non-pcr-based molecular methods

NON-PCR-BASED MOLECULAR METHODS OF BACTERIAL

CLASSIFICATION

Abdulrahman Mohammed

L-2012-V-21-D

School of Public Health & Zoonoses

INTRODUCTIONTaxonomy

– Science of biological classification– Consists of three separate but interrelated parts• classification – arrangement of organisms into

groups (taxa, sing.taxon)• nomenclature – assignment of names to taxa• identification – determination of taxon to

which an isolate belongs

INTRODUCTIONMethods in bacterial identification

1. Microscopic morphology - Gram Staining, shapes, arrangements, motility

2. Macroscopic morphology – colony appearance, motility3. Physiological / biochemical characteristics – aerobic,

anaerobic, photosynthetic, growth on selective media4. Chemical analysis – e.g.peptides and lipids in cell

membranes5. Phage Typing – which phage infects the bacterium6. Serological analysis – what antibodies are produced against

the bacterium7. Pathogenicity – what diseases does the bacterium cause.8. Genetic and molecular analysis

4

Genotypic Methods• Genotypic methods involve examining the

genetic material of the organisms and has revolutionized bacterial identification and classification.

• Genotypic methods include PCR (RT-PCR, RAPD-PCR),use of nucleic acid probes, RFLP and plasmid fingerprinting.

• Increasingly genotypic techniques are becoming the sole means of identifying many microorganisms because of its speed and accuracy.

Three general categories• Restriction analysis

Plasmid profiling Restriction enzyme analysis (REA) Restriction fragment length polymorphism (RFLP) Ribotyping Pulse Field Gel Electrophoresis (PFGE)

• PCR amplification of particular genetic targets Amplified fragment length polymorphism (AFLP) Random Amplified Polymorphic DNA (RAPD) Repetitive element PCR (Rep-PCR) Variable number of tandem repeat (VNTR) analysis and multiple locus VNTR

analysis (MLVA)

• Sequencing-based methods 16S rDNA Sequence analysis Whole genome sequencing

Multilocus sequence typing (MLST) Single nucleotide polymorphism (SNPs)

Plasmid Profiling• Plasmids are extrachromosomal, circular DNA molecules that are located

in the bacterial cytoplasm, that contain at least one origin of replication• Isolation of plasmid DNA released under alkaline and high temperature

conditions that denature the chromosomal DNA • Phenol:chloroform mixture to precipitate the plasmid DNA. • Separated by gel electrophoresis, stained with a dye and viewed. • Typically, supercoiled molecular size standards from E. coli R861 (NCTC

50192) and V517 (NCTC 50193), to determine the sizes of the isolated plasmids

• The number and size of plasmid bands are analyzed to define the plasmid profile for a particular isolate

BACTERIAL PLASMID

hsdhhjjkfdjfdfjfdjdjfdf

dfjkdjfkjdfkjdkjfkdfkjjjfjfkjkjkkjkjkjkjkjkjkjkjj

Schematic drawing of a bacterium with its plasmids (1) Chromosomal DNA. (2) Plasmids

PLASMID• Plasmid is autonomously replicating, extra-chromosomal circular

DNA molecules, distinct from the normal chromosomal DNAs and non-essential for cell survival under nonselective conditions

• They usually occur in bacteria, sometimes in eukaryotic organisms (e.g., the 2-um-ring in yeast S. cerevisiae).

• Sizes: 1 to over 400 kbp

• Copy numbers: 1 - hundreds in a single cell, or even thousands of copies

• Every plasmid contains at least one DNA sequence that serves as an origin of replication or ori (a starting point for DNA replication, independently from the chromosomal DNA).

CONFORMATIONS OF PLASMID DNAs

Plasmid DNA may appear in the following five conformations:

1) "Supercoiled" (or "Covalently Closed-Circular") DNA is fully intact with both strands uncut

2) "Relaxed Circular" DNA is fully intact, but "relaxed" (supercoils removed).

3) "Supercoiled Denatured" DNA. Both strands are uncut but are not correctly paired, resulting in a compacted plasmid form

4) "Nicked Open-Circular" DNA has one strand cut.

5) "Linearized" DNA has both strands cut at only one site.

Super Coiled

SC

Relaxed region

Nicked DNAs

Linear DNA

Conformation cont….

•The relative electrophoretic mobility (speed) of these DNA conformations in a gel is as follows:

•Nicked Open Circular (slowest)

•Linear

•Relaxed Circular

•Supercoiled Denatured

•Supercoiled (fastest)

• Conformational changes in plasmids may affect the migration properties of plasmids

• If copies of the same plasmid are in different conformation, they will appear as multiple bands

• Strains can contain multiple plasmids of similar molecular weights, which will co-migrate and appear as a single plasmid band on a gel.

• Digested with restriction enzymes such as HindIII, to generate a

restriction profile that can be used for plasmid typing

• Separated by agarose gel electrophoresis, and the banding profiles can be compared to one another to distinguish the isolates

• Limitations : Number of strains lack plasmids Plasmids are transferable between bacterial strains Can be detrimental in deciphering the genetic relatedness

Plasmid Profiling

PLASMID DNA ISOLATION

• When only a single plasmid is present, restriction endonucleases can be used to provide further evidence of the similarities and differences between strains

• Restriction endonucleases, or restriction enzymes, cleave DNA at specific sequences Plasmids and other DNA molecules that have identical sequences produce the same set of fragments after digestion with a restriction endonuclease

• Restriction endonucleases are sensitive to many of the chemicals used to isolate plasmid DNA, such as phenol, detergent, ethanol, or chelators, so care must be taken to remove these chemicals before digestion.

ELECTROPHORESIS OF DNA CUT BY RESTRICTION ENZYMES

Restriction Enzyme Analysis (REA)Restriction Enzyme Analysis (REA)

• Extraction of plasmid or chromosomal DNA

• Digestion of the DNA at particular sites using specific restriction enzymes

• Hundreds of DNA fragments of various sizes (0.5-50Kb) separated by gel electrophoresis

• LIMITATION: Complex profiles with hundreds of unresolved or overlapping bands

Cutting locations

Gel-Electrophoresis

Size of fragments

Restriction Enzyme Analysis (REA)Restriction Enzyme Analysis (REA)

Restriction fragment length polymorphism (RFLP)

• Restriction fragment length polymorphism uses restriction enzymes (RE) to cut DNA at specific 4-6 bp recognition sites

• Sample DNA is cut (digested) with one or more RE's and resulting fragments are separated according to molecular size using gel electrophoresis

• Molecular size standards are used to estimate fragment size

• Ethidium bromide staining is used to reveal the fragments under UV light

• Restriction fragment length polymorphism (RFLP) is most suited to studies at the intraspecific level or among closely related taxa

• When a frequent cutting restriction enzyme is used, the DNA fingerprints are typically difficult to interpret

• Because there are often morebthan 100 fragments

• Comparison between the bacterial isolates

• 2 general approaches1. Use of a rare cutting restriction enzyme and specialized

electrophoresis methods to separate the large DNA fragments

2. Transfer the large number of DNA fragments to membranes & hybridize the DNA fragments with a labeled probe for specific repetitive DNA fragments

Restriction fragment length polymorphism (RFLP)

Pulse Field Gel Electrophoresis

• Pulsed-field gel electrophoresis is based on the digestion of bacterial DNA with restriction endonucleases that recognize few sites along the chromosome, generating large DNA fragments (30-800 Kb) that cannot be effectively separated by conventional electrophoresis.

• The basis for PFGE separation is the size-dependent time-associated reorientation of DNA migration achieved by periodic switching of the electric field in different directions.

• The DNA fragments will form a distinctive pattern of bands in the gel, which can be analyzed visually and electronically.

• Bacterial isolates with identical or very similar band patterns are more likely to be related genetically than bacterial isolates with more divergent band patterns.

ELECTROPHORESIS

• Widespread use in biological assays, and in the purification and separation of proteins and nucleic acids.

• DNA fragments from 100 to 200 base pairs (bp) up to 50 kilobase pairs (kb) are routinely separated by conventional gel electrophoresis techniques.

• Above 50 kb, because of the size of the molecules, the sieving action of the gel is lost, and fragments run as a broad, unresolved band with anomalously high mobility.

PFGE:

• 1982: Schwartz et al. introduced the concept that DNA molecules larger than 50 kb can be separated by using two alternating electric fields (i.e. PFGE).

• Pulsed field gel electrophoresis is a technique used for the separation of large DNA molecules by applying to a gel matrix an electric field that periodically changes direction.

Electric current 18-20 hours

buffer 14 Celectrodes

ELECTROPHORESIS OF DNA CUT BY RESTRICTION ENZYMES

PULSED FIELD GEL ELECTROPHORESIS (PFGE)

Nucleic Acid Sequencing

• most powerful and direct method for comparing genomes

• sequences of 16S (prokaryotes) and 18S (eukaryotes) ribosomal RNA (rRNA) are used most often in phylogenetic studies

• complete chromosomes can now be sequenced and compared

25

DNA Sequencing

• Computer analysis of 16S rRNA sequence has revealed the presence of signature sequences, short oligonucleotides unique to certain groups of organisms and useful in their identification.

• rRNA sequence can be used to fine tune identity at the species level e.g differentiating between Mycobacterium and Legionella.

• 16s rRNA sequence can also be used to identify microorganisms from a microbial community.

rDNA analysis• The rRNA gene is the most conserved (least variable)

DNA in all cells. Portions of the rDNA sequence from distantly related organisms are remarkably similar. This means that sequences from distantly related organisms can be precisely aligned, making the true differences easy to measure. For this reason, genes that encode the rRNA (rDNA) have been used extensively to determine taxonomy, phylogeny (evolutionary relationships), and to estimate rates of species divergence among bacteria. Thus the comparison of 16S rDNA sequence can show evolutionary relatedness among microorganisms.

• Carl Woese, who proposed the three Domain system of classification - Archaea, Bacteria, and Eucarya - based on such sequence information, pioneered this work

Ribosomal RNA

Universal phylogenetic tree as determined from comparative ribosomal RNA sequencing.

• Although the three domains of living organisms were originally defined by ribosomal RNA sequencing, subsequent studies have shown that they differ in many other ways

• Large public databases available for comparison.

• Ribosomal Database Project currently contains >1.5 million rRNA sequences.

Detailed phylogenetic tree of the major lineages (phyla) of Bacteria based on 16S ribosomal RNA

sequence comparisons

RIBOSOMAL RNA

• To infer relationships that span the diversity of known life, it is necessary to look at genes conserved through the billions of years of evolutionary divergence.

• Examples of genes in this category are those that define the ribosomal RNAs (rRNAs).

• In Bacteria, Archaea, Mitochondria, and Chloroplasts, the small ribosomal subunit contains the 16S

• rRNA (where the S in 16S represents Svedberg units). The large ribosomal subunit contains two rRNA species (the 5S and 23S rRNAs).

• Most prokaryotes have three rRNAs, called the 5S, 16S and 23S rRNA. Bacterial 16S, 23S, and 5S rRNA genes are typically organized as a co-transcribed operon.

• There may be one or more copies of the operon dispersed in the genome (for example, E coli has seven).

• The Archaea contains either a single rDNA operon or multiple copies of the operon

• rRNA targets were studied originally, most researchers now target the corresponding ribosomal DNA (rDNA) because DNA is more stable and easier to analyse

Types• In prokaryotes: 23S, 5S,16S• In eukaryotes: 28S, 5.8S, 5S, 18S

Ribosomal RNAs in Prokaryotes:NAME SIZE (NUCLEOTIDES) LOCATION

5S 120 Large subunit of ribosome

16S 1500 Small subunit of ribosome

23S 2900 Large subunit of ribosome

• The 16s rDNA sequence has hypervariable regions, where sequences have diverged over evolutionary time.

• Strongly conserved regions often flank these hypervariable regions.

• Primers are designed to bind to conserved regions and amplify variable regions.

• The DNA sequence of the16S rDNA gene has been determined for an extremely large number of species. In fact, there is no other gene that has been as well characterized in as many species.

• Sequences from tens of thousands of clinical and environmental isolates are available over the Internet through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) and the Ribosomal Database Project (http://rdp.cme.msu.edu/).

• These sites also provide search algorithms to compare new sequences to their database.

Why is the small subunit rRNA gene so useful ?

Conserved in parts – highly variable in other parts. Thus it a very good phylogenetic marker

VERY large database of sequences

Cell have many ribosomes which can be targeted with probes (e.g. FISH, &TRFLP) for community analysis

16S rRNA gene sequencing is now the gold standard for community analysis

Which hyper-variable regions to sequence?

Region Position # b.p.

V1 69-99 30

V2 137-242 105

V3 338-533 195

V4 576-682 106

V5 822-879 57

V6 967-1046 79

V7 1117-1173 56

V8 1243-1294 51

V9 1435-1465 30

E.coli 16S SSU rRNA hyper-variable regions

Some Databases• National Center for Biotechnology Information

(www.ncbi.nlm.nih.gov)• Ribosomal Database Project II

(http://rdp.cme.msu.edu/html/)• Ribosomal Differentiation of Medical

Microorganisms (www.ridom.com)• MicroSeq 16S 500 Library (Applied Biosystems)• GenBank• Mayo Database

Definitions

“A bacterium species is defined as ‘confidently identified by 16S rRNA gene sequencing’ if there is >3% difference between the16S rRNA gene sequence of the species and those of other medically important bacteria species. A bacterium species is defined as ‘not confidently identified by 16S rRNA gene sequencing’ if there is <2% difference between the 16S rRNA gene sequence of the species and that of one or more medically important aerobic Gram-positive bacterium species. A bacterium species is defined as ‘only doubtfully identified by 16S rRNA gene sequencing’ if there is 2–3 % difference between the 16S rRNA gene sequence of the species and that of one or more medically important aerobic Gram-positive bacterium species. (Woo et al., 2009)

RFLP Fingerprinting Analysis• RFLP = restriction fragment length polymorphism• RFLP analysis involves cutting DNA into fragments using one

or a set of restriction enzymes. • For chromosomal DNA the RFLP fragments are separated by

gel electrophoresis, transferred to a membrane, and probed with a gene probe.

• One advantage of this fingerprinting technique is that all bands are bright (from chromosomal DNA) because they are detected by a gene probe. AP-PCR, ERIC-PCR, and REP-PCR all have bands of variable brightness and also can have ghost bands.

• For PCR products a simple fragment pattern can be distinguised immediately on a gel. This is used to confirm the PCR product or to distinguish between different isolates based on restriction cutting of the 16S-rDNA sequence “ribotyping”. Also developed into a diversity measurement technique called “TRFLP”.

Southern Blot Hybridization• SBH analysis is a method named after its developer, Southern, E, M.

(1979) that facilitates detection of a DNA fragment of interest among hundreds of other fragments generated by REA

• Allows restriction digestion electrophoresis patterns to become interpretable

• Restriction DNA fragments separated in agarose gel are transferred (blotted) onto a piece of nitrocellulose or nylon membrane

• The membrane is then exposed to a DNA probe that has been labeled with a molecule that facilitates visual detection of a selected target DNA fragment

• The probe, which is a piece of single-stranded DNA, specifically binds (hybridizes) to its complementary DNA sequence embedded in the membrane under appropriate conditions

• When the SBH typing method uses ribosomal operon genes (rrn) found among restriction-digested fragments in a membrane as the target, it is called ribotyping

Southern Blotting

• Uses radioactive probes that bind to the specific DNA segments

• Steps: Soak gel in basic solution to separate DNA strandsTransfer DNA on to a nylon membrane (spacing of DNA is

maintained) Incubate with radioactive probe for specific segmentWash away unbound probeDetect probes using x-ray film autoradiograph

Nucleic Acid Hybridization

Nucleic Acid Hybridization • measure of sequence homology

( molecular relatedness)• common procedure for hybridisation:– bind nonradioactive DNA to nitrocellulose filter– incubate filter with radioactive single-stranded DNA– The quantity of radioactivity bound to the filter reflects

the amount of hybridisation between the 2 DNA and thus similarity of the 2 sequences.

…Nucleic Acid Hybridization

– measure amount of radioactive DNA attached to filter.

– The degree of similarity is expressed as the % of experimental DNA radioactivity retained on the filter as compared to other sps. of the same genus under the same conditions.

– Usually less than 5 % difference in melting point ( T m ) is considered as members of same sps.

47

Nucleic acid probes• Nucleic acid hybridization is one of the most

powerful tools available for microbe identification.

• Hybridization detects for a specific DNA sequence associated with an organism.

• The process uses a nucleic acid probe which is specific for that particular organism.

• The target DNA (from the organism) is attached to a solid matrix such as a nylon or nitrocellulose membrane.

48

Nucleic Acid Probes

• A single stranded probe is added and if there is sequence complementality between the target and the probe a positive hybridization signal will be detected.

• Hybridization is detected by a reporter molecule (radioactive, fluorescent, chemiluminescent) which is attached to the probe.

• Nucleic acid probes have been marketed for the identification of many pathogens such as N. gonorrhoeae.

49

Two Component Probes

• Molecular probes are also finding wide spread use in the food industry and food regulatory agencies.

• The pathogen DNA is attached to a “dipstick” to hybridize to the pathogen DNA from the food.

• A two component probe is used (reporter and a capture probe which are attached to each other).

• Following hybridization the dipstick with the capture probe (usually poly dT to capture poly dA on the probe) is inserted into the hybridization solution.

• It is traps the hybridized DNA for removal and measurement.

Direct probe testing

• Hybridization – to come together through complementary base-pairing. – Can be used in identification. – In colony hybridization the colony is treated to release the

nucleic acid which is then denatured to single strands. • Labeled single-stranded DNA (a probe) unique to the organism

you are testing for is added and hybridization is allowed to occur.• Unbound probe is washed away and the presence of bound probe

is determined by the presence of the label.

Direct probe testing

52

Two Component Probe

53

Advantages of Nucleic Acid Probes

• Nucleic acid probes has many advantages over immunological methods.

• Nucleic acid are more stable at high temperature, pH, and in the presence of organic solvents and other chemicals.

• This means that the specimen can be treated very harshly to destroy interfering materials.

• Nucleic acid probes can be used to identify microorganisms which are no longer alive.

• Furthermore nucleic acid probes are more specific than antibodies.

Microarray Comparisons

• The availability of complete genome sequences has provided another way to compare whole genomes based on hybridization patterns generated from thousands of short pieces of DNA (probes) of known sequence arranged on a glass slide or nitrocellulose membrane. This arrangement of DNA probes on a membrane is called microarray or “gene chip”.

• Microarrays can also be made from DNA fragments constructed from PCR products spotted onto a glass slide by an automated arrayer.

GeneChip microarrays consist of small DNA fragments (referred to also as probes), chemically synthesized at specific locations on a coated quartz surface. By extracting, amplifying, and labeling nucleic acids from experimental samples, and then hybridizing those prepared samples to the array, the amount of label can be monitored at each feature, enabling either the precise identification of hundreds of thousands of target sequence (DNA Analysis) or the simultaneous relative quantitation of the tens of thousands of different RNA transcripts, representing gene activity(Expression Analysis).

MicroarraysConstructed using probes for a known nucleic acid sequence or for a series of targets, a nucleic acid sequence whose abundance is being detected.

The intensity and color of each spot provide information on the specific gene from the tested sample.

…Nucleic Acid Sequencing

Comparative Analysis of 16S rRNA Sequences:• Oligonucleotide signature sequences are short conserved

sequences specific for a phylogenetically defined group of organisms

• either complete or, more often, specific rRNA fragments can be compared

• when comparing rRNA sequences between 2 organisms, their relatedness is represented by an association coefficient or Sab value

• the higher the Sab value, the more closely related the organisms

Use of DNA Sequences to Determine Species Identity

DNA sequences can also be used to determine species strains in addition to genus

• It requires analysis of genes that evolve more quickly than rRNA encoding genes

• Multilocus sequence typing (MLST), the sequencing and comparison of 5 to 7 housekeeping genes instead of single gene is done.

• This is to prevent misleading results from analysis of one gene.

Sequence alignment is crucial for inferring how DNA sites have changed.

Poor alignmentImplies that species “I” is divergent from the others, but this is not the case.

Good alignment.Species “I” has probably experienced a deletion event at position #6 or #7.

4. Estimate relationships based on extent of DNA similarity.

G

B

C

D

A

J

F

E

K

H

I

ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAAGC

ATGTTGGCAGTCCGATGTAACC

ACGGTAGCAGTCTGATGTATCC



CTGCTGGTAGTCGTTTGTAACC

CTGCTGGTAGTCGTTTGTAACC

CTGCTGGCAGTCGGTTGTAACC

ATGCTGGCAGTCGGGTGTAACC

ATGGTGGCAGTCGGGTGTCACCColored letters = different from top sequence (taxon G)

Molecular phylogeny of taxa A-I.

At variable DNA positions, related groups will tend to share the same nucleotide.

The sheer number of characters is helpful to distinguish the ‘phylogenetic signal’ from noise.

Example: Molecular phylogenies have revealed unexpected features of bacterial evolution.

For instance, an endosymbiotic lifestyle has evolved several times independently.

Moran and Wernegreen (2000)

How does this organism fit into the world of available sequence data?

ACAGATGTCTTGTAATCCGGCCGTTGGTGGCATAGGGAAAGGACATTTAGTGAAAGAAATTGATGCGATGGGTGGATCGATGGCTTATGCTATCGATCAATCAGGAATTCAATTTAGAGTACTTAATAGTAGCAAAGGAGCTGCTGTTAGAGCAACACGTGCTCAGGCAGATAAAATATTATATCGTCAAGCAATACGT

Sequence thePCR product

“Blast” sequence to Genbank

GENBANK = NIH genetic database with all publicly available DNA sequences. As of 2004: > 44 billion bp, and > 40 million sequences

Blast output: Lists sequences that are most similar to yours

Comparison of Molecular Methods

Method Typingcapacity

Discriminatory power

Reproducibility Ease ofuse

Ease of interpretation

Plasmid analysis

Good Good Good High Good

PFGE High High High Moderate Goodmoderate

Genomic RFLP

High Good Good High Moderate–poor

Ribotyping High High High Good High

PCR-RFLP Good Moderate Good High High

RAPD High High Poor High Good–high

AFLP High High Good Moderate High

Repetitive elements

Good Good High High High

Sequencing High High High Moderate Good–high

THANK YOU FOR YOUR ATTENTION

non-pcr-based molecular methods

Documents