Vol. 169, No. 5JOURNAL OF BACTERIOLOGY, May 1987, p. 1818-18230021-9193/87/051818-06$02.00/0Copyright X) 1987, American Society for Microbiology

New Phenotypes Associated with mucAB: Alteration of a MucASequence Homologous to the LexA Cleavage Site

LORRAINE MARSHt AND GRAHAM C. WALKER*Biology Department, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

Received 15 August 1986/Accepted 28 January 1987

Most mutagenesis by UV and many chemicals in Escherichia coli requires the products of the umuDC operonor an analogous plasmid-derived operon mucAB. Activated RecA protein is also required for, or enhances, thisprocess. MucA and UmuD proteins share homology with the LexA protein, suggesting that they might interactwith the RecA protein as LexA does. We used oligonucleotide-directed mutagenesis to alter a site in MucAhomologous to the Ala-Gly cleavage site of LexA. The mutation, termed mucAlOl(Glu26), results in a changeof Gly26 of MucA to Glu26. A kxA(Def) recA441 umuC122::TnS strain carrying a mucA1O1(Glu26)B+ plasmiddid not exhibit the greatly increased frequency of spontaneous mutagenesis in response to RecA activation thata strain carrying a mucA+B+ plasmid did but retained a basal recA-dependent ability to confer increasedspontaneous mutagenesis that was independent of the state ofRecA activation. These results are consistent witha model in which RecA plays two distinct roles in mutagenesis apart from its role in the cleavage of LexA. ApBR322-derived plasmid carrying mucA+B+, but not one carrying mucAlOl(Glu26)B+, inhibited the UVinduction of SOS genes, suggesting that MucA+ and MucA(Glu26) proteins may have different abilities tocompete with LexA for activated RecA protein. The spectrum of UV-induced mutagenesis was also altered instrains carrying the mucAlOl(Glu26) mutation. These results are consistent with the hypothesis that activatedRecA protein interacts with wild-type MucA protein, possibly promoting proteolytic cleavage, and that thisinteraction is responsible for facilitating certain mutagenic processes.

Most mutagenesis of Escherichia coli by UV irradiationand a variety of chemicals is not a passive process butrequires the active participation of cellular proteins includingUmuD and UmuC (or their plasmid-derived analogs MucAand MucB) and RecA (25, 26). The mechanism of thisprocess, termed error-prone repair or SOS processing, is notcurrently understood, although formally it appears to in-volve replication past lesions that would otherwise blockDNA synthesis (5). The umuDC operon of E. coli (12, 21)and the mucAB operon of the plasmid pKM101 (21) aresimilarly organized, partially homologous, and under thecontrol of the SOS regulatory system.The RecA protein appears to play at least two roles in the

mutagenic repair process (2, 4, 8, 24-26). One of these rolesis in the induction of the umuDC or mucAB operon. Likeother genes in the SOS regulatory network, the umuDC andmucAB operons are repressed by the LexA protein (1, 6). Inresponse to an SOS-inducing treatment, the RecA proteinbecomes activated and mediates the proteolytic cleavage ofLexA at an Ala-Gly bond, thus inducing the expression ofumuDC and other SOS-regulated genes (25, 26). Little (13)has reported that incubation of highly purified LexA at highpH in the presence of a divalent cation but in the absence ofRecA results in the cleavage of LexA at this Ala-Gly bond.This observation suggests that RecA acts by facilitating anautodigestion of LexA rather than as a normal protease. Inaddition to its role in inducing umuDC or mucAB, RecA isrequired for at least one other step in the mutagenic process,since lexA(Def) strains, which constitutively express SOSgenes, are not mutable if they are also defective in recA (2,8, 24). The molecular function of RecA in this second role is

* Corresponding author.t Present address: Department of Biochemistry and Biophysics,

University of California, San Francisco, CA 94143.

not currently understood and is one of the issues we addressin this paper.The proteolytic cleavage of LexA and related bacterio-

phage repressors such as X cI at a specific Ala-Gly sequenceinvolves the interaction of activated RecA protein with theircarboxy-terminal domains (9, 13, 14, 25, 26). AlthoughRecA+ protein normally becomes activated in response to anSOS-inducing treatment (e.g., DNA damage), the RecA441protein can also be activated in vivo simply by an increase intemperature (25, 26). We have recently shown that bothMucA and UmuD share extensive amino acid homology withthe carboxy-terminal domains of LexA and X cI proteins(21). This homology includes an Ala-Gly bond of MucA(amino acids 25 and 26) in a position corresponding to theAla-Gly proteolytic cleavage site of LexA and X cI. Ourdiscovery of this homology has led us to consider thepossibility that MucA and UmuD interact with RecA proteinand perhaps become proteolytically modified. If such aninteraction or proteolytic cleavage led to the activation ofmuc or umu functions, it might explain the requirement forRecA in mutagenesis.As a step toward addressing this question, we have

created a mutation at the potential proteolytic cleavage siteof MucA, and we show here that the phenotype it producesis consistent with an interference with a MucA-RecA inter-action. We have also developed a novel in vivo approach toattempt to measure competition between MucA and LexAfor binding to activated RecA protein, and we presentevidence suggesting that such competition may occur. Al-though we have not yet been able to determine directlywhether the MucA protein is cleaved at its Ala-Gly bond,our results provide genetic evidence for the model that thewild-type MucA protein interacts with activated RecA andthat this interaction facilitates certain mutagenic processes.

1818

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

MucA-RecA INTERACTION 1819

TABLE 1. Bacterial strains and plasmids

ParentalStrains and Relevant strain or Source orplasmids genotype plasmid reference

vector

E. coliGW1000 Alac lexA+ recA441 GC3217 11GW2100 umuC122::TnS his4 AB1157 7

argE3GW3232 umuC36 uvrA his4 AB1157 K. Perry and

argE3 G. C. WalkerGW5242 lexASJ(Def) recA441 GC3217 This study

umuC122::TnSGW5245 lexASI(Def) GC3217 This study

recA938: :catumuC122::TnS

KM1190 lexASI(Def) recA + 6RB901 1exASI(Def) ArecA2l 7

PlasmidspBR322 Tcr Apr Laboratory stockpGW1700 mucA+B+ Tcr pBR322 22pLM310 mucA1O1(Glu26)B+ pBR322 This study

TcrpSE140 umuD-lac'Z Kmr pSC101 6

MATERIALS AND METHODS

Bacterial strains and plasmids. The bacterial strains andplasmids used in this study are listed in Table 1. Strains wereconstructed by P1 transduction (18). Plasmid-bearing strainswere constructed by calcium chloride transformation (16).The construction of the recA938::cat allele has been de-scribed previously (27).

Mutagenesis of mucA. Site-directed mutagenesis ofmucABcloned into M13mp8 was done by a modified version of themismatched primer method of Zoller and Smith (28) withthe oligonucleotide AGAATTTCTGCGGAATTCCCCAGCCCG (mismatches with the wild-type GGG Gly codon [21]are underlined). The heteroduplex DNA product wastransfected into a mutS: :TnS strain (20) to prevent mismatchrepair. Mutants were detected (yield, about 11%) by differ-ential hybridization to the mutagenic primer. Restrictionmapping of these phages confirmed that they contained theEcoRI site introduced by the change in DNA sequence.

Transfer of mutation. The mutation that we term mucA101[or, to emphasize its most important feature, mucA101(Glu26)] was transferred from an M13mp8 derivative topGW1700, a Tcr pBR322-derived plasmid carryingmucA+B+ (22), by M13-mediated transduction of the plas-mid. The M13 phage, which had two amber mutations inessential phage genes and carried the mutated mucA gene,was grown on a Rec+ strain carrying pGW1700, and theresulting phage particles were adsorbed to a Sup- F+ strain.Phage-infected cells were plated on medium containingtetracycline. We have found that under these conditions,phage-plasmid cointegrates resolve by homologous recom-bination and yield strains carrying plasmids that have under-gone forced double recombinational events within the regionof homology to the M13 transducing phage. Approximately20% of these plasmids carried the new restriction site andconferred only partial mutability in a semiquantitative test.One of these recombinants, designated pLM310, was chosenfor further study. The mucAJOJ(Glu26) mutation was con-firmed by DNA sequencing of fragments subcloned from thisplasmid.

Mutagenesis assays. Media and methods for determiningmutability have been described previously (23). Arg+ rever-tants of the ochre argE3 strains containing the ochre his4mutation were classified as true revertants if they failed togrow on media lacking histidine and as suppressor revertantsif they grew on media lacking histidine (10). We use theterms true and suppressor for convenience, although we didnot further characterize these revertants.Other procedures. 1-Galactosidase units were adjusted for

cell density (18). General microbiological methods were asdescribed previously (17, 18). Two-dimensional polyacryl-amide gel electrophoresis was performed essentially as de-scribed by O'Farrell et al. (19). Cultures and maxicellpreparations were labeled with [35S]methionine as describedpreviously (7, 17).

RESULTS

Alteration of a site in MucA homologous to the LexAcleavage site. In an attempt to assess the significance of theamino acid homology observed between MucA and LexA,we used oligonucleotide-directed mutagenesis to changecodon 26 ofMucA from Gly to Glu. We refer to this mutationdescriptively as mucAJOJ(Glu26). An analogous mutation atthe Ala-Gly proteolytic cleavage site in X cI repressor (whichcauses a Gly-to-Glu change at codon 112) creates a repressorthat is functional in DNA binding and dimerization but is notcleaved in the presence of activated RecA (9). A similarmutation in lexA, lexA3(Ind-), changes Gly at the cleavagesite to Asp (14) and results in a functional protein that is notcleaved. The mucAJOl(Glu26) mutation was created on anM13 derivative carrying the mucAB region and subsequentlycrossed onto a pBR322-derived plasmid carrying mucAB,pGW1700, by M13-mediated transduction as described inMaterials and Methods. DNA sequencing of fragmentssubcloned from this plasmid showed that the desired muta-tion had indeed been introduced.To confirm that an altered MucA protein was actually

being produced in the mucAJOJ(Glu26) mutant, we separatedproteins synthesized both in intact cells and in maxicellpreparations on two-dimensional gels (19). Both MucA+ andMucA(Glu26) are resolved in this system (Fig. 1). Spotscorresponding to radiolabeled MucA+ and MucA(Glu26)proteins were also visible by Coomassie blue staining oftwo-dimensional gels of whole-cell extracts from the strainscarrying the mucA+B+ or mucA1OJ(Glu26)B+ plasmid (datanot shown). As predicted, the MucA(Glu26) protein migratedsimilarly to the wild-type in the sizing dimension but to amore acidic position in the isoelectric focusing dimension.This change in the isoelectric point was confirmed by mixingexperiments with maxicell-labeled wild-type and mutantMucA proteins.

In the course of these experiments, we noted a poorlylabeled protein that migrated to a position that would beconsistent with its being the larger putative RecA-mediatedcleavage product of MucA (about 3 kilodaltons smaller andslightly more acidic). This protein was observed only on gelsof a recA+ strain carrying the mucA+B+ plasmid. It was notseen on gels of a recA+ strain carrying the mucAJOJ(Glu26)B+ plasmid or on gels of maxicells prepared from a recAdeletion strain carrying the mucA+B+ plasmid. However,the recA+ cells were not exposed to SOS-inducing treat-ments in these experiments, and further work is required todetermine whether the labeled protein observed is, in fact,derived from MucA by a specific RecA-mediated proteolyticevent. Our attempts to establish whether UmuD or MucA

VOL. 169, 1987

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

1820 MARSH AND WALKER

can be cleaved in vitro have not yet met with success. Therelatively short half-life of these proteins both in vivo and invitro (as judged by monitoring bands on gels) has so farprevented us from purifying them to homogeneity; this shorthalf-life seems to result from a nonspecific degradationrather than cleavage of the site homologous to the LexAcleavage site, since we have not observed accumulation ofsmaller polypeptides of the expected size. Our efforts to lookfor evidence of cleavage by using MucA or UmuD proteinslabeled by the maxicell method were hampered by the rapidnonspecific degradation of these proteins in labeled cellextracts (L. Dodson and G. C. Walker, unpublished results).

Effect of activating RecA441 on spontaneous mutagenesis.In our initial investigations of the mucAJOJ(Glu26) mutation,we wished to study a situation in which a mucA+B+-dependent effect is strongly influenced by the state ofactivation of the RecA protein. Our goal was to comparemucA+B+ and mucA1O1(Glu26)B+ activity as a function ofthe degree of activation ofRecA. We found that introductionof a plasmid carrying mucA+B+ into a lexASl(Def) recA441umuC122::TnS strain led to a strikingly temperature-depen-

IEF-w

0

COco

JMucA(Wt)

Bla FIG. 2. Spontaneous mutagenesis rate at various temperatures in* GW5242, containing or not containing muc plasmids. Symbols: A,

--V no plasmid (control); *, pGW1700 (mucA+B+); 0, pLM310[mucA1O1(Glu26)B+].

MucA(Wt)

*lA

MucA(Wt)._

B

MucA(Wt)

/MMucA(glu

dent spontaneous mutation rate, which dramatically in-creased at higher temperatures (Fig. 2; Table 2); such atemperature-dependent increase in spontaneous mutagene-sis was not seen in the parental strain lacking the mucA+B+plasmid. This result confirms previously reported resultswith mucA+B+ on pKM101 and with umuD+C+ (3, 8, 24)and extends them to include the cloned mucA+B+ genes.This mucA+B+-dependent spontaneous mutagenesis was nottemperature dependent in a recA+ strain. Under the condi-tions used, the RecA441 protein becomes increasingly acti-

* vated as the temperature is elevated; in its activated state,the RecA441 protein is able to facilitate the cleavage of

A LexA and A cI (25, 26). In lexA(Def) strains, such as the oneused here, SOS genes (including mucAB) are constitutivelyexpressed. Thus, the increased spontaneous mutation rate at

26 higher temperatures that was seen with the above strain is

TABLE 2. Effect of mucA+B+, mucA1O1(Glu26)B+, and recA onspontaneous reversion of his-4a

C DFIG. 1. Two-dimensional polyacrylamide gel electrophoretic

separation of 3"S-labeled proteins (19). Only a portion of each gel isshown. Equilibrium isoelectric focusing (IEF) dimension (left sidebasic) 0.1% pH 3 to 10 ampholines, 0.4% pH 5 to 7 ampholines, 8 Murea, 2% Nonidet P-40; and sodium dodecyl sulfate-polyacrylamidegel electrophoresis (SDS-PAGE) dimension (origin at top) are indi-cated. Positions of 1-lactamase (Bla), MucA+ protein, MucA(Glu26)protein, and a possible cleavage product of MucA+ (X) are indi-cated. (A) Plasmid proteins specifically labeled by the maxicellmethod (22); RB901(pGW1700), [MucA+]. (B to D) Stationary-phase cultures of KM1190 plasmid-containing derivatives werepulse-labeled for 5 min at 30°C (17). (B) pBR322 (vector); (C)pGW1700 (mucA+B+); (D) pLM310 [mucA1O1(Glu'6)B+]. MucBprotein is too basic to appear on this two-dimensional gel sytem. The,B-lactamase gene of pBR322 is interrupted in pGW1700 andpLM310.

His'revertants/platebStrain and recA allele Genes on

plasmid plasmid Minus Plusadenine adenine

GW5242 recA441 1 0GW5242 recA441 mucA +B 136 331(pGW1700)

GW5242 recA441 mucA1O1(Glu26)B+ 20 13(pLM310)

GW5245 recA938::cat 1 NTCGW5245 recA938::cat mucA+B+ 0.3 NT(pGW1700)

GW5245 recA938::cat mucA1O1(G1u76)B+ 2 NT(pLM310)a Experiments were carried out at 37rC.b Average of three independent cultures.c NT, Not tested.

100-

a)co

a.a.

co

L.

> 10-

+CoIr

1 I a30

Temperature

37

(0C)43.5

J. BACTERIOL.

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

MucA-RecA INTERACTION 1821

due to an effect of activated RecA distinct from its role incleaving LexA.

In contrast, a lexA5J(Def) recA441 umuCJ22::TnS straincontaining the mucA10J(Glu26)B+ plasmid behaved differ-ently. Although its spontaneous reversion frequency wasseveralfold higher than that of a strain lacking the mucgenes, the spontaneous reversion frequency did not show atemperature-dependent increase. This observation suggeststhat a component of Muc protein action that is dependent onthe activation of RecA has been lost in the mucAJOJ(Glu26)mutant.As well as the strong activation of the RecA441 protein by

elevated temperature, the addition of adenine to culturemedia modestly increases the in vivo ability of RecA441 tofacilitate cleavage of LexA and X cI (3, 25). We found thatthe addition of 100 ,ug of adenine per ml to the medium alsomodestly increased the spontaneous mutagenesis frequencyof a strain carrying a mucA+B+ plasmid but not that of astrain carrying a mucA(Glu26)B+ plasmid (Table 2). Thisobservation is consistent with the view that the increasedspontaneous mutagenesis seen at elevated temperatures witha lexASI(Def) recA441 umuCJ22::TnS strain carrying amucA+B+ plasmid is due to an increase in the degree ofactivation of RecA441 and not to some other effect oftemperature. Furthermore, it supports the suggestion thatthe MucA(Glu26) protein is in some way altered in its abilityto respond to RecA activation.The strain carrying a mucAJ0J(Glu26)B+ plasmid exhibited

an increased spontaneous reversion rate over a strain lackingany muc plasmid although it did not show an increased ratein response to increased RecA activation. This allowed us toask whether RecA plays yet another role in mutagenesis. Weexamined the rate of spontaneous mutagenesis in recA(Def)derivatives of our strains. The high rate of spontaneousmutagenesis conferred by the wild-type and mutant mucABplasmids in recA441 strains is not seen in recA(Def) strains(Table 2). Thus the increased spontaneous mutagenesis seenin a strain carrying the mucAJOI(Glu26B+ plasmid is depen-dent on RecA even though it does not further increase inresponse to increased RecA activation.

Effect of MucA+B+ and MucA(Glu26)B+ on SOS induction.The simplest model to account for the above results is thatthe MucA+ protein interacts with RecA and, in particular,that it undergoes some special form of interaction withactivated RecA. Thus, we hypothesized that ifMucA proteinwere to bind to RecA in a fashion similar to the binding ofLexA protein to RecA, then MucA might compete withLexA for binding to RecA in vivo under some circumstancesand inhibit the inactivation of LexA and hence SOS induc-tion. To see whether such inhibition of SOS induction mightin fact occur, we introduced the mucA+B+ and mucA101(Glu26)B+ plasmids into a strain carrying an SOS-inducibleumuD-lacZ fusion and determined the induction of ,B-galactosidase after UV irradiation. The pBR322-derivedmucAB plasmids that we have used in this study have a highbasal level of expression even in a lexA+ strain (6).The wild-type mucA+B+ plasmid strongly inhibits the UV

induction of the SOS response as monitored by the expres-sion of the umuD-lacZ fusion (Fig. 3). In contrast, themucA101(Glu26)B+ plasmid had almost no effect on SOSinduction, at most delaying it slightly. None of the strainswere sensitive to the UV dose used in this experiment, andall were umuD+C+ and were capable of a full complement ofrepair processes. Thus it is unlikely that the difference weobserved is due to a defect in DNA repair. One explanationfor these results is that wild-type MucA protein can compete

with LexA for binding to activated RecA and that mutantMucA(Glu26) protein has a decreased affinity for activatedRecA protein. However, alternative explanations are possi-ble. For example, mucA+B+ might in some way inhibit theactivation of RecA rather than compete for the activatedform of the protein.

Altered UV-induced mutagenic spectrum. To compare therelative effects of the mucA+B+ and mucAJ0J(Glu26)B+plasmids on UV mutagenesis, we studied the reversion ofthe ochre mutation argE3 in various derivatives of anAB1157 umuCJ22::TnS strain. The mutations that convertan argE3 strain to arginine prototrophy can be convenientlyclassified by whether they suppress other ochre mutations(10). Although the mucAJ0J(Glu26)B+ plasmid permittedsubstantial UV mutagenesis, the proportion of ochre sup-pressor mutations among the Arg' revertants was muchhigher than among revertants of the strain carrying themucA+B+ plasmid (Table 3). Thus the mucA.OJ(Glu26) mu-tation leads to a change in the spectrum of UV mutagenesisin this strain. This change in mutagenic specificity wasobserved with both uvrA+ and uvrA strains, suggesting thatthe change in specificity was not due to a selective effect onremoval of UV-induced cyclobutane dimers or 6-4 photo-products (Table 3). The ratio of true to suppressor mutationshas been previously used to study mutagenic specificity (3,10). The effect shows strong strain specificity, perhaps owingto a hotspot for mutagenesis in a variable tRNA codingregion (10). For example, the strain background (GW5242)used in our studies of spontaneous mutagenesis yielded over90% true revertants with both the mucA+B+ andmucA101(Glu26)B+ plasmids; the contribution of the recA441allele present in GW5242 tb this effect has not been evalu-ated.

3000

v2000-

0

CD

cm~ /

,1040;g

0)

0 1 2 3 4

Time (hr)FIG. 3. Effect of mucA+B+ and mucA1O1(Glu26)B+ plasmids on

induction of P-galactosidase after UV irradiation. Derivatives ofGW1000 carried various plasmids in addition to an SOS-inducibleumuD::1acZ operon fusion on pSE140 (7). Cultures growing at 30°Cwere exposed to 20 J m-2, and samples were withdrawn and assayedat the times indicated. Symbols: A, pBR322 (vector); *, pGW1700(mucA+B+); *, pLM310 [mucA1O1(Glu26)B+]. Growth of all threestrains as determined by A6w, was identical during the course of theexperiment.

VOL. 169, 1987

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

1822 MARSH AND WALKER

TABLE 3. Effect of mucA+B+ and mucAJOJ(G1u26)B+ on the frequency of true and suppressor UV-induced argE3 revertants

Arg+ revertants per 105

Strainand plasmid Genotype UV Fraction survivors True/total(j mr2) surviving True Suppressor ratio

GW3232(pGW1700) mucA+B+ 1.4 0.73 6.8 23.2 0.24GW3232(pLM310) mucAJO1(Glu26)B+ 1.4 0.45 0.18 3.4 0.05GW2100(pGW1700) mucA+B+ 30 0.45 14 40 0.25GW2100(pLM310) mucAJO1(Glu26)B+ 30 0.17 2.8 54 0.05

DISCUSSION

One of the premier examples of posttranslational controlof activity in E. coli is observed during SOS induction. Theinteraction of activated RecA protein with LexA repressorleads to a specific proteolytic cleavage and hence to inacti-vation of LexA, allowing induction of genes normally re-pressed by it (24). An unresolved puzzle in the study ofUV-induced mutagenesis lies in the fact that simplederepression of genes known to be required for this process(mucAB or umuDC) does not allow mutagenesis: there is acontinuing requirement for activated RecA (8, 24). Ourdiscovery of sequence homology between the derived pro-tein sequences of MucA and UmuD and the portion of LexAthat is known to interact with RecA led us to consider thepossibility that MucA and UmuD interact with RecA proteinand that such an interaction or perhaps subsequentproteolytic modification is required to facilitate mutagenesis(21). That is, perhaps mucAB and umuDC activities are

controlled by RecA activation both transcriptionally (viaSOS control) and posttranslationally.We mutated a site in the gene encoding MucA protein

homologous to the site in LexA at which RecA-facilitatedproteolytic cleavage occurs. The mucAJOJ(Glu26) mutationconferred an altered phenotype on mucAB plasmid-bearingstrains that was not consistent with a simple overall reduc-tion of function. Although the spontaneous mutagenesisfrequency of a strain with wild-type mucAB was propor-tional to RecA activation, that of a strain carrying themucAJOJ(Glu26) mutation was above background but wasunaffected by the degree of RecA activation. This suggeststhat the mucAJOJ(Glu26) mutation may interfere with someMucA interaction with activated RecA that facilitates muta-genesis but that the mucAJOJ(Glu26) mutant retains a basallevel of activity independent of RecA activation. An inter-esting difference between the chromosomal genes umuDCand the plasmid-derived genes mucAB is that mucAB, butnot umuDC, are capable of promoting mutagenesis in astrain carrying the recA430 allele (defective in some of theproteolysis-facilitating activity of recA), although mutagen-esis is much more effective in a recA+ strain (3, 25). Sincethe mucAB operon was isolated from a broad-host-rangeself-transmissible plasmid (25), perhaps these proteins haveevolved to be somewhat less dependent on specific interac-tions with recA and other host-specified proteins than withumuDC. If so, a mutation in umuD analogous tomucAJOJ(Glu26) might result in a completely defective gene

product.Perhaps our most striking findings were that overproduc-

tion of wild-type MucA and MucB proteins inhibited SOSinduction by UV and that this inhibition was virtuallyabolished by the mucAJOJ(Glu26) mutation. The inhibition ofSOS induction that we observe in the presence of a high genedosage of wild-type mucAB is consistent with a competitionbetween the partially homologous MucA and LexA proteins

for a site on activated RecA molecules. Alternatively, theinhibition of SOS induction might represent interferencewith the activation of RecA.We believe that a variety of alternative interpretations for

this phenomenon are ruled out by the following observa-tions. Using a qualitative plate assay for the induction of,-galactosidase, we have observed that high-copy-numberplasmid clones of mucA+B+ or umuD+C+ inhibit the induc-tion of a variety of SOS-inducible din::Mu dl(Ap lac) fusions(11) by a variety of agents including mitomycin C andnalidixic acid (which does not damage DNA but blocks DNAreplication). These results suggest that the inhibition of SOSinduction is not due to overproduction of MucA or MucBaffecting the processing of a specific DNA lesion. Further-more, we found that high-copy-number plasmid clones ofmucA+B+ or umuD+C+ inhibit the induction of a Mu dl(Aplac) fusion (11) controlled by the A cI repressor. This indicatesthat mucAB and umuDC do not exert their regulatory effectson SOS induction by encoding a repressor with the operatorspecificity of LexA. In other work, we have shown that aplasmid carrying umuD+ alone does not inhibit SOS induc-tion, suggesting that both proteins of the operons may berequired for this effect, as for all other phenotypes associ-ated with umuDC and mucAB that have been studied (21, 25;manuscript in preparation).

In an AB1157 strain background, UV-induced reversion ofargE3 promoted by a mucA1OJ(Glu26)B+ plasmid led to amuch higher proportion of ochre suppressor mutations thandid reversion promoted by a mucA+B+ plasmid. This wouldnot be expected of a mutant in which mucAB activity hadsimply been reduced. This result is reminiscent of an earlierobservation that a higher proportion of mucA+B+-promoted,UV-induced revertants of his4 were suppressor mutants ifthe strain carried recA430 than if the strain were recA+ (ingenetic backgrounds closely related to AB1157) (3). Thus, asimilar altered phenotype may arise from interaction ofwild-type MucA protein with RecA430 protein (which isdefective in its ability to facilitate protelytic cleavage) orfrom interaction of MucA(Glu26) protein (which is altered ata site homologous to the LexA cleavage site) with wild-typeRecA protein. In each case, one might expect a defect ininteraction of MucA with RecA (or in a proteolytic cleavageof MucA facilitated by RecA). It will be of interest tocompare the spectrum of UV-induced mutagenesis pro-moted by mucAB with and without the mucAJOJ(Glu26)mutation in a system measuring mutagenesis at a largernumber of loci. Is mutagenic specificity changed, or is theremore than one mutagenic pathway, each with its ownspecificity and differentially affected by the mucAJOJ(Glu26)mutation?Although mucAJOJ(Glu26) does not respond to increasing

activation of RecA and, by extrapolation, does not requirethe activated state of RecA to function, mucAJOI(Glu26)does require an intact recA gene to effectively promotespontaneous reversion of his4. This suggests that unacti-

J. BACTERIOL.

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

MucA-RecA INTERACTION 1823

vated RecA may have a role in spontaneous, and perhapsUV-induced, mutagenesis dependent on mucAB that is dis-tinct from the role of the activated protein in inducing theSOS response and interacting with MucA. Such a thirdfunction of RecA would be, for example, consistent withsome of the structural roles suggested for RecA in mutagen-esis (4, 15).Although our results support the hypothesis that MucA

(and, by analogy, UmuD) interacts with activated RecAprotein, they do not allow us to establish whether MucAundergoes a proteolytic cleavage facilitated by activatedRecA. It is intriguing that with a recA+ strain carryingmucA+B+, but not with the corresponding strain carryingmucAJO1(Glu26)B+, we observed a labeled protein that mi-grated in a position consistent with its being a proteolyticfragment of MucA generated by cleavage of the Ala-25-Gly-26 bond. However, more work is required to deter-mine whether this is in fact a proteolytic fragment of MucA.We are currently attempting to raise antibodies and purifythe MucAB and UmuDC proteins, which may allow us toaddress this problem biochemically. Our observation thatthe mucAlOl(Glu26) mutation, which by analogy to the lexA3mutation should result in an uncleavable protein, retainsconsiderable ability to promote UV mutagenesis wouldsuggest that specific MucA proteolysis is not required for atleast some components of such mutagenesis but might serve

to regulate activity.Although we have discussed our results in terms of what

seems to us the simplest model, we are aware that other,more complex, explanations of our observations are possi-ble. If proteolytic modification of MucA protein does occur,

however, it could predict the existence of a larger class ofproteins whose activity is modified rather than lost after a

proteolytic cleavage facilitated by the RecA protein and a

new level of control in the SOS response.

ACKNOWLEDGMENTS

We thank Michael Nassal for synthesis of the oligonucleotide,David Sobell for DNA sequencing, Regina Reilly for advice on

site-specific mutagenesis, and Lori Dodson and Fred Gimble forhelpful discussions.

This work was supported by Public Health Service grant CA21615awarded by the National Cancer Institute. L.M. was supported byTraining Grant ES07020 from the National Institutes of Health.

LITERATURE CITED1. Bagg, A., C. J. Kenyon, and G. C. Walker. 1981. Inducibility of

a gene product required for UV and chemical mutagenesis inEscherichia coli. Proc. Natl. Acad. Sci. USA 78:5749-5753.

2. Blanco, M., G. Herrera, P. Collado, J. Rebollo, and L. M.Botelia. 1982. Influence of RecA protein on induced mutagene-sis. Biochimie 64:633-636.

3. Blanco, M., and J. E. Rebollo. 1981. Plasmid pKM101-dependent repair and mutagenesis in Escherichia coli cells withmutations lexB30 tif and zab-S3 in the recA gene. Mutat. Res.81:265-275.

4. Bridges, B. A., and R. Woodgate. 1985. Mutagenic repair inEscherichia coli. X. The umuC gene product may be requiredfor replication past pyrimidine dimers but not for the codingerror in UV-mutagenesis. Proc. Natl. Acad. Sci. USA82:4193-4197.

5. Defais, M. 1983. Role of the E. coli umuC gene product in therepair of single-stranded DNA phage. Mol. Gen. Genet.192:509-511.

6. Eliedge, S. J., and G. C. Walker. 1983. The muc genes ofpKM101 are induced by DNA damage. J. Bacteriol. 155:1306-1315.

7. Eliedge, S. J., and G. C. Walker. 1983. Proteins required forultraviolet light and chemical mutagenesis: identification of theproducts of the umuC locus of Escherichia coli. J. Mol. Biol.164:175-192.

8. Ennis, D. G., B. Fisher, S. Edmiston, and D. W. Mount. 1985.Dual role for E. coli RecA protein in SOS mutagenesis. Proc.Natl. Acad. Sci. USA 82:3325-3329.

9. Gimble, F., and R. Sauer. 1985. Mutations in bacteriophage Xrepressor that prevent RecA-mediated cleavage. J. Bacteriol.162:147-154.

10. Kato, T., Y. Shinoura, A. Templin, and A. J. Clark. 1980.Analysis of ultraviolet light-induced suppressor mutations in thestrain of Escherichia coli K-12 AB1157: an implication formolecular mechanisms of UV mutagenesis. Mol. Gen. Genet.180:283-291.

11. Kenyon, C. J., and G. C. Walker. 1980. DNA-damaging agentsstimulate gene expression at specific loci in Escherichia coli.Proc. Natl. Acad. Sci. USA 77:2819-2823.

12. Kitagawa, Y., E. Akaboshi, H. Shinagawa, T. Horii, H. Ogawa,and T. Kato. 1985. Structural analysis of the umu operonrequired for inducible mutagenesis in Escherichia coli Proc.Natl. Acad. Sci. USA 82:4336-4340.

13. Little, J. W. 1984. Autodigestion of lexA and phage X repres-sors. Proc. Natl. Acad. Sci. USA 81:1375-1379.

14. Little, J. W., S. H. M. Edmiston, L. Z. Paceill, and D. W. Mount.1980. Cleavage of the Escherichia coli lexA protein by the recAprotease. Proc. Natl. Acad. Sci. USA 77:3225-3229.

15. Lu, C., R. H. Scheuermann, and H. Echols. 1986. Capacity ofRecA protein to bind preferentially to UV lesions and inhibit theediting subunit (e) of DNA polymerase III: a possible mecha-nism for SOS-induced targeted mutagenesis. Proc. Natl. Acad.Sci. USA 83:619-623.

16. Mandel, M., and A. Higa. 1970. Calcium-dependent bacterio-phage DNA infection. J. Mol. Biol. 53:159-162.

17. Marsh, L., and G. C. Walker. 1985. Cold sensitivity induced byoverproduction of UmuDC in Escherichia coli. J. Bacteriol.162:155-161.

18. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

19. O'Farrell, P. Z., H. M. Goodman, and P. H. O'Farrell. 1977.High resolution two-dimensional electrophoresis of basic aswell as acidic proteins. Cell 12:1133-1142.

20. Pang, P. P., A. S. Lundberg, and G. C. Waker. 1985. Identifi-cation and characterization of the mutL and mutS gene productsof Salmonella typhimurium LT2. J. Bacteriol. 163:1007-1015.

21. Perry, K. L., S. J. Eliedge, B. B. Mitchell; L. Marsh, and G. C.Walker. 1985. The umuDC and mucAB operons whose productsare required for UV and chemical mutagenesis: UmuD, MucAand LexA proteins share homology. Proc.-Natl. Acad. Sci. USA82:4331-4335.

22. Perry, K. L., and G. C. Walker. 1982. Identification of plasmid(pKM101)-encoded proteins involved in mutagenesis and UVresistance. Nature (London) 300:278-281.

23. Shanabruch, W. G., and G. C. Walker. 1980. Localization of theplasmid (pKM101) gene(s) involved in recA+ lexA+-dependentmutagenesis. Mol. Gen. Genet. 179:289-297.

24. Tessman, E. S., I. Tessman, P. P. Peterson, and J. C. Forestal.1986. Roles of RecA protease and recombinase activities ofEscherichia coli in spontaneous and UV-induced mutagenesisand in Weigle repair. J. Bacteriol. 168:1159-1164.

25. Walker, G. C. 1984. Mutagenesis and inducible responses todeoxyribonucleic acid damage in Escherichia coli. Microbiol.Rev. 48:60-93.

26. Walker, G. C. 1985. Inducible DNA repair. Annu. Rev.Biochem. 54:425-457.

27. Winans, S. C., S. J. Elledge, J. H. Krueger, and G. C. Walker.1985. Site-directed insertion and deletion mutagenesis withcloned fragments in Escherichia coli. J. Bacteriol. 161:1219-1221.

28. Zolier, M. J., and M. Smith. 1983. Oligonucleotide-directedmutagenesis ofDNA fragments cloned in M13 vectors. MethodsEnzymol. 100:468-500.

VOL. 169, 1987

on June 20, 2018 by guesthttp://jb.asm

.org/D

ownloaded from