© 2016. Published by The Company of Biologists Ltd.

Necrotic pyknosis is a morphologically and biochemically distinct event from

apoptotic pyknosis

Lin Hou1,2

, Kai Liu1, Yuhong Li

2, Shuang Ma

2, Xunming Ji

2 and Lei Liu

2

1State Key Laboratory of Membrane Biology, School of Life Sciences, Peking

University, Beijing, 100871, China

2 Aging and Disease Lab of Xuanwu Hospital and Center of Stroke, Beijing Institute

for Brain Disorders, Capital Medical University, Youanmen, Beijing, 100069, China

Correspondence:

jixm@ccmu.edu.cn

leiliu@ccmu.edu.cn

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

JCS Advance Online Article. Posted on 29 June 2016

Abstract

Classification of apoptosis and necrosis by morphological difference has been widely

used for decades. However, this method has been seriously doubt in recent years,

mainly due to lack of functional and biochemical evidence to interpret the

morphology changes. To address these questions, we devised genetic manipulations in

Drosophila to study pyknosis, a process of nuclear shrinkage and chromatin

condensation occurred in apoptosis and necrosis. By following the progression of

necrotic pyknosis, we surprisingly observed a transient state of chromatin detachment

from the nuclear envelope (NE), followed with the NE completely collapsed onto

chromatin. This phenomenon leads us to discover that phosphorylation of

barrier-to-autointegration factor (BAF) mediates this initial separation of NE from

chromatin. Functionally, inhibition of BAF phosphorylation suppressed the necrosis

in both Drosophila and human cells, suggesting necrotic pyknosis is conserved in the

propagation of necrosis. In contrast, apoptotic pyknosis did not show a detached state

of chromatin from NE and inhibition of BAF phosphorylation had no effect on

apoptotic pyknosis and apoptosis. Our research provides the first genetic evidence

supporting morphological classification of apoptosis and necrosis by pyknosis. Jo

urna

l of C

ell S

cien

ce •

Adv

ance

art

icle

Introduction

Morphological difference in cell death has been used to classify apoptosis and

necrosis for a long time. These include apoptotic features such as cell shrinkage,

membrane blebbing, nuclear condensation and apoptotic body formation (Kerr et al.,

1972); and necrotic features such as cell swelling, plasma membrane rupture,

intracellular vacuolization and nuclear chromatin clumping (Raffray and Cohen,

1997). However, many exceptions have been discovered and classification of cell

death by morphology has been controversial (Raffray and Cohen, 1997). Recently, the

Nomenclature Committee on Cell Death (NCCD) has recommended using

biochemical markers for cell death classification instead of morphology (Galluzzi et

al., 2015; Galluzzi et al., 2012). The reasons include that morphology may not link to

functional aspect of cell death, a given morphology may be triggered by

heterogeneous insults, and existence of intermediate morphology shared by both

apoptosis and necrosis (Galluzzi et al., 2015; Galluzzi et al., 2012; Raffray and Cohen,

1997).

Pyknosis has been considered as an irreversible condensation of chromatin and the

nucleus. It commonly occurs in both apoptotic and necrotic cell death. For apoptosis,

the nucleus usually undergoes condensation, chromatin marginalization and

fragmentation into a few large and regular chromatin clumps, which are eventually

packed into apoptotic bodies (Kerr et al., 1972; Niquet et al., 2003). In contrast, nuclei

in necrotic cells condense into to smaller chromatin clumps with irregular and

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

dispersed morphologies, which may be later dissolved (Bortul et al., 2001; Fujikawa

et al., 2000; Hardingham et al., 2002; Niquet et al., 2003). Therefore, based on the

morphology of nuclear fragmentation, pyknosis can be divided into nucleolytic

pyknosis (mainly occurring in apoptosis) and anucleolytic pyknosis (mainly occurring

in necrosis) (Burgoyne, 1999). Although pyknosis has been widely considered as a

marker of cell death in vitro and in vivo (Colbourne et al., 1999; Fujikawa et al., 1999;

Fujikawa et al., 2010; Ji et al., 2013; Niquet et al., 2003; Sohn et al., 1998), it is

unclear whether pyknosis is a regulated process.

Here, we studied the morphological changes of pyknosis during the execution of

apoptosis and necrosis in a temporal manner. We found that necrotic pyknosis

occurred in a distinct pattern compared to apoptotic pyknosis, and phosphorylation of

BAF plays a key role only in necrotic pyknosis.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Materials and methods

Drosophila stocks and maintenance

Flies were raised on standard cornmeal medium. The stocks were kindly provided by

colleagues including: UAS-eiger (Dr. Lei Xue), GMR-hid, GMR-Gal4 (Dr. Andreas

Bergmann) and UAS-IAP1 (Dr. Denise Montell). We generated the following lines

from the w1118

background by P-element insertion: UAS-GFP-BAF-WT,

UAS-GFP-BAF-3A, UAS-GFP-BAF-3D, UAS-BAF-WT-Flag, UAS-BAF-3A-Flag,

UAS-BAF-3D-Flag, UAS-GFP-BAF-2A and UAS-GFP-BAF-1A. UAS-koi.GFP

(BL#26266) and H2Av-mRFP1 (BL#23650) were obtained from the Bloomington

Drosophila Stock Center.

Protein extraction and immunoprecipitation

Fly heads and Ca2+

ionophore (A23187; Tocris Bioscience #1234) treated cells (all

cell lines were obtained from China Infrastructure of Cell Line Resources and tested

for contamination) were lysed in buffer (20 mM Tris pH 7.5, 100 mM NaCl, 0.5%

NP40) supplemented with protease inhibitor cocktail (Roche) and phosphatase

inhibitors (1 mM Na3VO4, 50 mM NaF, 30 mM glycerophosphate and 0.5 mM

EDTA). After sonication and centrifugation, the supernatant was incubated with

normal IgG (1:1000, Santa Cruz Biotechnology sc-2025) and protein A/G-agarose

beads (Thermo Scientific Pierce #20421). After centrifugation, the supernatant was

incubated with GFP antibody (1:200, Abcam ab1218; clone 9F9.F9) or Flag antibody

(1:1000, Sigma-Aldrich F3165; clone M2) for 2h. Then, pre-washed beads were

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

added and incubated overnight. After washing with lysis buffer 6 times, the pellet was

boiled in SDS loading buffer. Tricine-SDS-PAGE was used to separate the small

molecular weight proteins. BAF phosphorylation was detected by a phospho-

threonine antibody (1:500, Cell Signaling #9381).

Nuclear morphology and cell survival in cultured cells

The nuclear pore complex (NPC) antibody (1:1000, Abcam ab24609; clone Mab414)

was used for immunostaining. Mammalian cells were incubated with 20 M Ca2+

ionophore for the indicated times. The ATP level was determined by a CellTiter-Glo®

Luminescent Cell Viability Assay kit (Promega). The relative ATP level (%) = ATP

[with Ca2+

ionophore]/ATP [without Ca2+

ionophore] ×100.

Chromatin Immunoprecipitation (chIP) and quantitative PCR (qPCR)

After calcium ionophore or DMSO treatment for 30 min, chromatin

immunoprecipitation was performed as described (Boyd et al., 1998). The protein

A+G agarose/salmon sperm DNA (Merck Millipore #16-201) and lamin B1 antibody

(ab16048; Abcam) were used. Different size of DNAs were added the same joint at

both ends through multiple annealing and looping-based amplification cycles

(MALBAC) with 27-nucleotide sequence and 8 variable nucleotides as primers

(GTGAGTGATGGTTGAGG TAGTGTGGAGNNNNNNNN) (Zong et al., 2012),

and then quantified by qPCR using the 27-nucleotide sequence

(GTGAGTGATGGTTGAGGTAGTGTGGAG) as the primer. The lamin B1

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

precipitated DNA was quantified as a relative value to the IgG precipitation (IgG chIP

was set as 1).

Statistical Analysis

Student’s t-test and one-way ANOVA analysis with post hoc Tukey algorithm were

performed based on hypothesis of normal distribution and the variances within or

between the groups. All data were collected and analyzed without any preference.

Results and Discussion

Necrotic pyknosis shows a different morphology compared to apoptotic pyknosis

To study necrotic pyknosis, we used a previously established necrosis model in

Drosophila. Using the transient expression of a leaky cation channel, glutamate

receptor 1 Lurcher mutant (GluR1Lc

), calcium is overloaded into cells, which results

in necrosis and fly lethality (Liu et al., 2014). This fly model contains a promoter

Appl-Gal4 (expressed in neurons and a few epithelial cells in the larval anal pad),

UAS-GluR1Lc

and tub-Gal80ts, and it is simplified as the AG (Appl>GluR1

Lc,

tub-Gal80ts) model (Liu et al., 2014). The AG flies are healthy at 18 C due to

inhibition of Gal4 function by Gal80ts. Upon flies shifted to 30 C, Gal80

ts is

deactivated, and necrosis is initiated by GluR1Lc

expression (Liu et al., 2014). To label

the nuclear envelope (NE) and the chromatin, the fluorescent reporters UAS-koi.GFP

and His2Av-mRFP1 (expressing His2Av-mRFP fusion protein in all cells) were used.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

At 30 C for 22 hours, the nuclei of control flies [Appl-Gal4;tub-Gal80ts, labeled as

wild type (WT) in Fig. 1Aa] showed normal morphology, with chromatin occupying

the whole nucleus, and the interaction of chromatin with the NE was clearly visible.

Interestingly, after 18 to 20 hours at 30 C, the chromatin in the epithelial cells of AG

flies dramatically condensed, whereas the NE only slightly shrank, leading to the

detachment of chromatin from the NE (Fig. 1Ab and c). Later, both the NE and the

chromatin were further compacted and eventually collapsed together (Fig. 1Ad). The

morphology is consistent with the features of anucleolytic pyknosis (Fujikawa et al.,

2010; Sohn et al., 1998).

We also studied apoptotic pyknosis in vivo by transient expression reaper (rpr)

(Appl>rpr, tub-Gal80ts, simplified as AR), which induced classical apoptosis (White et

al., 1996). We found that the NE and chromatin physically shrank together, with the

nucleus eventually fragmenting into regular clumps (Fig. 1Ba-d).

Phosphorylation of BAF specifically mediates necrotic pyknosis

Our data suggest that necrotic pyknosis is likely initiated by the detachment of

chromatin from the NE. Previous studies show that barrier-to-autointegration factor

(BAF) plays a key role in chromatin tethering to the NE through its interaction with

LEM (LAP2/Emerin/MAN1)-domain containing proteins and dsDNA in a sequence

non-specific manner (Umland et al., 2000; Zheng et al., 2000).

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Based on the function of BAF, it is possible that the dissociation of chromatin from

the NE is induced by deregulation of BAF in necrosis. To examine BAF localization

in necrosis, we generated a GFP-tagged BAF transgene (UAS-GFP-BAF). It has been

reported that an N-terminal GFP tag does not affect BAF activity (Nichols et al., 2006;

Shimi et al., 2004). In wild-type cells (Appl-Gal4;tub-Gal80ts), GFP-BAF was

distributed on chromatin and interacted with the NE (Fig. 1Ca). In the AG flies, most

GFP-BAF proteins were also localized on the compacted chromatin (Fig. 1Cb),

suggesting that BAF localization is not drastically altered during necrosis. However,

GFP-BAF reduced its distribution in the chromatin and formed ring-like structures in

apoptosis (Fig. 1Cc). This phenomenon is consistent with a previous report stating

that BAF was disassembled and disappeared from the nucleus in apoptosis (Furukawa

et al., 2007).

The N-terminal phosphorylation of BAF has been reported to cause the detachment of

chromatin from the NE in karyosome formation during meiosis of the oocyte in

Drosophila (Lancaster et al., 2007). The BAF N-terminus has three potential

phosphorylation sites, including serine 2, threonine 4 and serine 5. To test the

importance of BAF phosphorylation in necrotic pyknosis, we generated transgenic

flies expressing BAF proteins with these three potential phosphorylation sites mutated

to alanine (the non-phosphorylatable form, simplified as "BAF-3A") or aspartic acid

(the phospho-mimic form, simplified as "BAF-3D"). These mutation sites of BAF are

illustrated (Fig. 1D). When these mutant flies were crossed to AG flies to induce

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

necrosis, GFP-BAF-3A localization appeared more similar to the pattern of

GFP-BAF-WT under normal condition (Fig. 1Cd). Whereas GFP-BAF-3D showed a

similar dissociation phenotype as that of the GFP-BAF-WT under the AG background

(Fig. 1Ce). This data suggests that chromatin disassociation from NE during necrosis

is likely inhibited by GFP-BAF-3A expression. To further confirm the role of

BAF-3A, we quantified the early stage of necrotic pyknosis with the chromatin and

NE labeled by His2Av-mRFP1 and koi.GFP. In the AG flies, 58% of cells displayed

the early morphology of necrotic pyknosis (Fig. 1Ea, b, and 1F). Strikingly, the

early-stage morphology defect of necrotic pyknosis was completely abolished by the

BAF-3A expression (Fig. 1Ec and Fig. 1F). Similarly, expression of BAF-3A rescued

the late-stage morphology of necrotic pyknosis (Fig. 1G a-c and 1H). For apoptotic

pyknosis, BAF-3A expression had no inhibitory effect (Fig. 1Gd-e and 1H), indicating

different molecule(s) might be required.

Anucleolytic pyknosis plays a functional role in necrotic cell death

Although anucleolytic pyknosis has been considered to be a marker of necrosis, its

function in cell death is unclear. To address this question, we investigated the survival

of AG flies under different transgenic BAF mutant backgrounds. Transient

overexpression of BAF-3A or BAF-3D in neurons had no effect on fly survival (Fig.

2A). Upon induction of necrosis, the survival rate of adult AG flies decreased to

38.4% (Fig. 2A). Overexpression of wild-type BAF (BAF-WT) resulted in a similar

survival rate (Fig. 2A). Strikingly, the overexpression of BAF-3A increased the

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

survival rate to 70.0%, whereas the expression of BAF-3D reduced the survival rate to

11.7% (Fig. 2A). At the cellular level, BAF-3A suppressed the necrotic morphology,

whereas BAF-3D enhanced it, and BAF-WT had no effect (Fig 2B and 2C).

Altogether, BAF phosphorylation alone is not sufficient to induce cell death, but it is

necessary for necrotic pyknosis and the propagation of cell death. In contrast, the

expression of BAF-3A or BAF-3D had no effect on fly models of apoptosis, including

the eye defects of GMR-Hid (Grether et al., 1995) and GMR>eiger (Hid and Eiger

induce caspase-mediated and JNK-mediated apoptosis, respectively) (Moreno et al.,

2002) (Fig. 2D).

Due to lack of antibody to directly detect the phosphorylation of Drosophila BAF, we

assessed BAF phosphorylation by the immunoprecipitation of GFP-BAF proteins

with a GFP antibody followed by Western blotting with a phospho-threonine antibody.

The result showed that BAF phosphorylation indeed increased in the AG flies, and the

expression of BAF-3A abolished the phosphorylation (Fig. 2E). The subtle change in

BAF phosphorylation is likely due to only approximately 1% of neurons undergoing

necrosis, which was sufficient to cause fly lethality in the AG flies (Liu et al., 2014).

No signal could be detected when a phospho-serine antibody was applied. This result

suggests that threonine 4 in the N-terminal of BAF is the functional site that is

phosphorylated during necrotic pyknosis. To test this hypothesis, we generated

transgenes to express BAF proteins with both threonine 4 and serine 5 mutated to

alanine (BAF-2A) or threonine 4 alone mutated to alanine (BAF-1A) (Fig. 1D). We

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

found that both BAF-2A and BAF-1A could rescue the lethality of the AG flies,

similar to BAF-3A (Fig. 2A).

BAF phosphorylation regulates necrotic pyknosis in mammalian cells

Because of the conserved function of BAF in chromatin anchoring in metazoans

(Segura-Totten and Wilson, 2004), we asked whether BAF phosphorylation regulates

necrotic pyknosis in mammalian cells. To induce necrosis, human neuroblastoma

SH-SY5Y cells were treated with calcium ionophore to overload calcium. Calcium

ionophore treatment led to nuclear shrinkage into PI-positive, small round and bright

chromatin clumps within 30 minutes (Fig. 3Aa, a', b and b'). However, we did not

observe the transient detachment of chromatin from the NE in SH-SY5Y cells and in

several other cultured mammalian cells (Fig. 3Ac and Fig. S1). This variation might

be due to the difference between in vivo and in vitro systems. In tissues, the cellular

contacts play important role to set the threshold of cell death (Raffray and Cohen,

1997). In fact, the intermediate state of NE detached from chromatin has been

observed in the retinoblastoma patients (Buchi et al., 1994). In mammalian cells, the

nucleus is highly compacted and the dissociation of NE from chromatin may be less

obvious at the cell morphological level. To study the interaction between NE and

chromatin in mammalian cells, the DNA that tethered on the inner nuclear membrane

was precipitated by a lamin B1 antibody. Then, the precipitated DNA was quantified

by an agarose gel and a qPCR assay. The result showed that the lamin B1 bound DNA

was significantly decreased during necrosis in the SY5Y cells (Fig. 3B and C). This

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

result indicated that the dissociation of chromatin and NE might also take place

during necrosis in the mammalian cells.

The potential phosphorylation sites of human BAF (BANF1) include threonine 2,

threonine 3 and serine 4 (Fig. 3D). Because the site equivalent to the Drosophila BAF

threonine 4 was unclear (Lancaster et al., 2007), we mutated all three sites (Fig. 3D,

BANF1-3A), and expressed the mutant constructs in SH-SY5Y cells. The result

showed that expression of BANF1-3A (a non-phosphorylatable mutant) abolished the

reduction of lamin B1-bound DNA during necrosis (Fig. 3B and C). For the functional

role of BANF1 phosphorylation on necrosis, calcium ionophore treatment induced

approximately 30.4% PI-positive nuclei (Fig. 3E and Fig. 3F). However, expression

of BANF1-3A reduced the ratio of cell death to 14.4% (Fig. 3Ec and d and Fig. 3F).

BANF1-3A also blocked the ATP depletion (Fig. 3G).

To examine BANF1 phosphorylation, BANF1-Flag proteins were precipitated with a

Flag antibody and assessed by a phospho-threonine antibody. The result showed that

the phosphorylation of BANF1-WT-Flag was not detectable under normal condition,

and it was greatly increased upon treatment with calcium ionophore (Fig. 3H).

Importantly, there was no detectable phosphorylation of BANF1 when

BANF1-3A-Flag was expressed (Fig. 3H). This result indicates that BAF

phosphorylation is a conserved event of necrosis.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Our study identified BAF phosphorylation as a specific biochemical marker for

necrotic pyknosis in certain types of cells, suggesting that classical apoptotic and

necrotic pyknosis may be distinct processes at the molecular level. A schematic model

of necrotic pyknosis is shown (Fig. 4). For classification of cell death, identification

of more biochemical markers that directly regulate morphology should greatly

improve the uncertainty to categorize more complicated cell death (Raffray and

Cohen, 1997). In fact, several regulators of apoptosis and necrosis have been

identified, including caspase-activated DNase (CAD), endonuclease G and DNase I in

nuclear fragmentation (Enari et al., 1998; Li et al., 2001; Liu et al., 1997; Oliveri et al.,

2001), and phospholipase A2 in necrotic pyknosis (Shinzawa and Tsujimoto, 2003).

Here, we provide an example of morphological regulation of necrotic pyknosis by a

biochemical event.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Acknowledgements

This work is supported by grants provide to L.L. by the Chinese Ministry of Science

and Technology (2013CB530700), and the National Science Foundation for

Distinguished Young Scholars (81325007) to X.J.

Author contributions

LH, KL, XJ and LL designed the experiments; KL and SM performed the initial

Drosophila study; LH performed the Drosophila and mammalian cell study; YL

generated the Drosophila transgenes; and LH, KL, XJ and LL wrote the manuscript.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

References

Bortul, R., Zweyer, M., Billi, A. M., Tabellini, G., Ochs, R. L., Bareggi, R., Cocco, L. and

Martelli, A. M. (2001). Nuclear changes in necrotic HL-60 cells. Journal of Cellular Biochemistry

Supplement 36, 19-31.

Boyd, K. E., Wells, J., Gutman, J., Bartley, S. M. and Farnham, P. J. (1998). c-Myc target

gene specificity is determined by a post-DNAbinding mechanism. Proc Natl Acad Sci U S A 95,

13887-92.

Buchi, E. R., Bernauer, W. and Daicker, B. (1994). Cell death and disposal in retinoblastoma:

an electron microscopic study. Graefes Arch Clin Exp Ophthalmol 232, 635-45.

Burgoyne, L. A. (1999). The Mechanisms of Pyknosis: Hypercondensation and Death.

Experimental Cell Research 248, 214-222.

Colbourne, F., Sutherland, G. R. and Auer, R. N. (1999). Electron Microscopic Evidence

against Apoptosis as the Mechanism of Neuronal Death in Global Ischemia. The Journal of

Neuroscience 19, 4200-4210.

Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A. and Nagata, S. (1998). A

caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 391,

43-50.

Fujikawa, D. G., Shinmei, S. S. and Cai, B. (1999). Lithium-pilocarpine-induced status

epilepticus produces necrotic neurons with internucleosomal DNA fragmentation in adult rats. Eur J

Neurosci 11, 1605-14.

Fujikawa, D. G., Shinmei, S. S. and Cai, B. (2000). Kainic acid-induced seizures produce

necrotic, not apoptotic, neurons with internucleosomal DNA cleavage: implications for programmed

cell death mechanisms. Neuroscience 98, 41-53.

Fujikawa, D. G., Zhao, S., Ke, X., Shinmei, S. S. and Allen, S. G. (2010). Mild as well as severe

insults produce necrotic, not apoptotic, cells: evidence from 60-min seizures. Neurosci Lett 469, 333-7.

Furukawa, K., Aida, T., Nonaka, Y., Osoda, S., Juarez, C., Horigome, T. and Sugiyama, S.

(2007). BAF as a caspase-dependent mediator of nuclear apoptosis in Drosophila. J Struct Biol 160,

125-34.

Galluzzi, L. Bravo-San Pedro, J. M. Vitale, I. Aaronson, S. A. Abrams, J. M. Adam, D.

Alnemri, E. S. Altucci, L. Andrews, D. Annicchiarico-Petruzzelli, M. et al. (2015). Essential versus

accessory aspects of cell death: recommendations of the NCCD 2015. Cell Death Differ 22, 58-73.

Galluzzi, L., Vitale, I., Abrams, J. M., Alnemri, E. S., Baehrecke, E. H., Blagosklonny, M. V.,

Dawson, T. M., Dawson, V. L., El-Deiry, W. S., Fulda, S. et al. (2012). Molecular definitions of cell

death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death

Differ 19, 107-20.

Grether, M. E., Abrams, J. M., Agapite, J., White, K. and Steller, H. (1995). The head

involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes &

Development 9, 1694-1708.

Hardingham, G. E., Fukunaga, Y. and Bading, H. (2002). Extrasynaptic NMDARs oppose

synaptic NMDARs by triggering CREB shut-off and cell death pathways. Nat Neurosci 5, 405-14.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Ji, W. T., Lee, C. I., Chen, J. Y., Cheng, Y. P., Yang, S. R., Chen, J. H. and Chen, H. R. (2013).

Areca nut extract induces pyknotic necrosis in serum-starved oral cells via increasing reactive oxygen

species and inhibiting GSK3beta: an implication for cytopathic effects in betel quid chewers. PLoS

ONE 8, e63295.

Kerr, J. F. R., Wyllie, A. H. and Currie, A. R. (1972). Apoptosis: a Basic Biological

Phenomenon with Wide-ranging Implications in Tissue Kinetics. Br.J. Cancer 26, 239-257.

Lancaster, O. M., Cullen, C. F. and Ohkura, H. (2007). NHK-1 phosphorylates BAF to allow

karyosome formation in the Drosophila oocyte nucleus. J Cell Biol 179, 817-24.

Li, L. Y., Luo, X. and Wang, X. (2001). Endonuclease G is an apoptotic DNase when released

from mitochondria. Nature 412, 95-9.

Liu, K., Ding, L., Li, Y., Yang, H., Zhao, C., Lei, Y., Han, S., Tao, W., Miao, D., Steller, H. et

al. (2014). Neuronal necrosis is regulated by a conserved chromatin-modifying cascade. Proc Natl

Acad Sci USA 111, 13960-5.

Liu, X., Zou, H., Slaughter, C. and Wang, X. (1997). DFF, a Heterodimeric Protein That

Functions Downstream of Caspase-3 to Trigger DNA Fragmentation during Apoptosis. cell 89,

175-184.

Moreno, E., Yan, M. and Basler, K. (2002). Evolution of TNF Signaling Mechanisms:

JNK-Dependent Apoptosis Triggered by Eiger, the Drosophila Homolog of the TNF Superfamily. Curr

Biol 12, 1263–1268.

Nichols, R. J., Wiebe, M. S. and Traktman, P. (2006). The vaccinia-related kinases

phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the

nucleus. Mol Biol Cell 17, 2451-64.

Niquet, J., Baldwin, R. A., Allen, S. G., Fujikawa, D. G. and Wasterlain, C. G. (2003).

Hypoxic neuronal necrosis: protein synthesis-independent activation of a cell death program. Proc Natl

Acad Sci U S A 100, 2825-30.

Oliveri, M., Daga, A., Cantoni, C., Lunardi, C., Millo, R. and Puccetti, A. (2001). DNase I

mediates internucleosomal DNA degradation in human cells undergoing drug-induced apoptosis. Eur J

Immunol 31, 743-51.

Raffray, M. and Cohen, G. M. (1997). Apoptosis and necrosis in toxicology: a continuum or

distinct modes of cell death? Pharmacol Ther 75, 153-77.

Segura-Totten, M. and Wilson, K. L. (2004). BAF: roles in chromatin, nuclear structure and

retrovirus integration. Trends Cell Biol 14, 261-6.

Shimi, T., Koujin, T., Segura-Totten, M., Wilson, K. L., Haraguchi, T. and Hiraoka, Y. (2004).

Dynamic interaction between BAF and emerin revealed by FRAP, FLIP, and FRET analyses in living

HeLa cells. J Struct Biol 147, 31-41.

Shinzawa, K. and Tsujimoto, Y. (2003). PLA2 activity is required for nuclear shrinkage in

caspase-independent cell death. J Cell Biol 163, 1219-30.

Sohn, S., Kim, E. Y. and Gwag, B. J. (1998). Glutamate neurotoxicity in mouse cortical neurons:

atypical necrosis with DNA ladders and chromatin condensation. Neurosci Lett 240, 147-50.

Umland, T. C., Wei, S. Q., Craigie, R. and Davies, D. R. (2000). Structural basis of DNA

bridging by barrier-to-autointegration factor. Biochemistry 39, 9130-8.

White, K., Tahaoglu, E. and Steller, H. (1996). Cell Killing by the Drosophila Gene reaper.

Science 271, 805-807.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Zheng, R., Ghirlando, R., Lee, M. S., Mizuuchi, K., Krause, M. and Craigie, R. (2000).

Barrier-to-autointegration factor (BAF) bridges DNA in a discrete, higher-order nucleoprotein complex.

Proc Natl Acad Sci U S A 97, 8997-9002.

Zong, C., Lu, S., Chapman, A. R. and Xie, X. S. (2012). Genome-Wide Detection of

Single-Nucleotide and Copy-Number Variations of a Single Human Cell. Science 338, 1622-1626.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figures

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 1. Characterization of pyknosis in Drosophila

A) Observation of necrotic pyknosis in vivo. In the larval anal pad epithelial cells, the

nuclear envelope (NE) and chromatin were labeled by UAS-koi.GFP and

H2Av-mRFP1, respectively. a, The NE and chromatin in wild type (WT) cells

(Appl-Gal4;tub-Gal80ts). b and c, The early stage of NE and chromatin changes in AG

flies (Appl-Gal4;tub-Gal80ts, UAS-GluR1

Lc/cyo). d, The late stage of NE and

chromatin changes in AG flies. Trial N = 10. For each trial, 50 cells were observed. B)

Observation of apoptotic pyknosis in vivo. The NE and chromatin were labeled by

UAS-koi.GFP and H2Av-mRFP1, respectively. C) BAF protein localization in vivo.

The micrographs show pattern of GFP-tagged wild type BAF (GFP-BAF-WT) under

wild type (a), AG (b) and AR (c) backgrounds. In addition, the patterns of

GFP-BAF-3A (d) and GFP-BAF-3D (e) under the AG background were shown. D)

List of potential phosphorylation sites in the N-terminus of BAF. Red letters highlight

the mutations made. E) An example of BAF-3A effect on the early-stage of necrotic

pyknosis (disassociation of chromatin from NE). F) Quantification of data from E.

The bar graph shows the ratio of normal nuclei without NE and chromatin

disassociation. Trial N = 5 and data quantified from 4, 7, and 7 larvae respectively. G)

Effect of BAF-3A on late-stage of necrotic and apoptotic pyknosis. The chromatin

changes revealed by H2Av-mRFP1 in the larval anal pad. White dotted lines mark the

boundary of the anal pad. H) Quantification of G. The bar graph shows the number of

fragmented, anucleolytic pyknotic or normal nuclei in the larval anal pad. Trial N = 3

and data quantified from 5 larvae. Data of all bar graphs are means + s.d. * for p<0.05,

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

** for p<0.01 and *** for p<0.001; NS for not significant. Two-tailed, One-way

ANOVA with post hoc Tukey algorithm were performed for three or more sample

comparison. For two sample comparisons, two-tailed Student’s t-test were used.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 2. Functional role of BAF phosphorylation on necrosis and apoptosis

A) The effect of BAF mutants on the survival of AG flies. The flies were incubated at

30 C for 12 hours. Then, the flies were returned to 18 C, and the fly survival was

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

recorded 48 hours later. Trial N = 3, 3, 3, 7, 7, 7, 7, 7, and 7. Fifty flies were tested for

each trial. B) The effect of BAF mutants on necrosis in larval anal pads. A later time

point (26 h) is shown to demonstrate the rescue effect of BAF-3A, and an earlier time

point (20 h) is shown to demonstrate the enhanced effect of BAF-3D. Trial N = 4, 5,

and 4. C) Quantification of cell number in B. N = 6, 7, and 7 larvae. D) Effects of

BAF mutants on the caspase-dependent apoptosis and the JNK-dependent cell death

models in Drosophila eyes. Overexpression of IAP1 and bskDN

are shown as the

positive controls, which suppress the indicated cell death pathways. E)

Immunoprecipitation (IP) and immunoblot to detect BAF phosphorylation during

necrosis. Trial N = 3. The asterisk indicates a none specific band appeared in all

samples, which run slightly higher than the phosphorylated GFP-BAF band (labeled

with "<").

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 3. Characterization of necrotic pyknosis in the human SH-SY5Y cells

A) The change of nuclear morphology upon the induction of necrosis. a, a', b and b',

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

the same view with different staining. In b, b' and c, the cell cultures were treated

with calcium ionophore (20 M) for 30 minutes. b and b' show the chromatin

condensation (DAPI) in necrotic cells (PI-positive). c, Chromatin (DAPI) and the NE

(NPC antibody) are co-stained. B) Quantification of lamin B1 bound DNA by agarose

gel electrophoresis. Trial N = 3. With the relative level of the control (IgG

precipitation without adding calcium ionophore) to be set as 1, the density of other

samples are shown, means ± s.d. C) Quantification of the lamin B1 bound DNA by

qPCR. For each sample, the Ct value of the chIP DNA fraction was normalized to its

own input DNA fraction; and the DNA level of the normalized background (IgG chIP)

was set as 1. chIP Trial N = 3. For each trial, the MALBAC and qPCR were

performed twice. D) Comparison of the N-terminal sequences of Drosophila BAF

(dBAF) and human BANF1 (hBANF1). The potential phosphorylation sites are

indicated by blue arrowheads. Red letters indicate non-phosphorylatable mutation

sites. E) Effect of BANF1 on necrosis. Stable cell lines expressing GFP (a and b),

wild type BANF1 (BANF1-WT, c) or non-phosphorylatable BANF1 (BANF1-3A, d)

were treated with DMSO or calcium ionophore for 30 minutes and necrotic cells are

revealed by PI staining. The upper panels are the same views as lower panels with

DAPI or PI staining, respectively. F) The quantification of E. Trial N = 3 and data

quantified from 6, 8, 8, 8 images respectively. G) Cell viability quantified by an ATP

assay. Trial N = 4. H) Immunoprecipitation (IP) and immunoblot (IB) to detect

BANF1 phosphorylation during necrosis. Trial N = 3.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Figure 4. A schematic model for necrotic pyknosis

At early stages of necrotic pyknosis, BAF phosphorylation promotes condensed

chromatin to dissociate from the NE. Then, at later stages, the NE collapses onto the

chromatin with damaged plasma membrane.

Jour

nal o

f Cel

l Sci

ence

• A

dvan

ce a

rtic

le

Supplementary information

Figure S1. Nuclear morphology during necrosis in cultured mammalian cells

B16 (mouse melanoma cell), C6 (rat glioma cell), HEK-293 (human embryonic

kidney cell) and HeLa cells (human adenocarcinoma cell) are used. The normal

nuclear morphology (DAPI staining) are shown in a-d, and nuclear morphologies are

observed after 20 µM calcium ionophore treatment for a short time (a’-d’) and a

longer time (a’’-d’’). Chromatin (DAPI) and NE (NPC) are co-stained. single section

images are shown.

J. Cell Sci. 129: doi:10.1242/jcs.184374: Supplementary information

Jour

nal o

f Cel

l Sci

ence

• S

uppl

emen

tary

info

rmat

ion