nat standards for clinical virology sally baylis, nibsc sogat xx, warsaw 12-13 june 2007
TRANSCRIPT
NAT Standards for NAT Standards for Clinical VirologyClinical Virology
Sally Baylis, NIBSCSally Baylis, NIBSC
SoGAT XX, Warsaw 12-13 June SoGAT XX, Warsaw 12-13 June 20072007
Standardisation – Clinical VirologyStandardisation – Clinical Virology
NIBSC is working with the UK Clinical NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Virology Network (CVN) & the Health Protection Agency (HPA) to develop a Protection Agency (HPA) to develop a standardisation programme to standardisation programme to provide run controls for diagnostic provide run controls for diagnostic laboratorieslaboratories
Initial StudiesInitial Studies
Panels of viruses have been distributed to Panels of viruses have been distributed to participating laboratories to select suitable participating laboratories to select suitable run control formulations, these have run control formulations, these have included:included:
Influenza A (H1N1, H3N2)Influenza A (H1N1, H3N2) Influenza BInfluenza B Herpes simplex virus (HSV-1 & HSV-2)Herpes simplex virus (HSV-1 & HSV-2) CytomegalovirusCytomegalovirus Norovirus GIINorovirus GII
Initial Studies contd.Initial Studies contd.
Viruses diluted into virus transport medium & Viruses diluted into virus transport medium & distributeddistributed
to the participating laboratoriesto the participating laboratories
Participants requested to test materials using routineParticipants requested to test materials using routineextraction & amplification/detection proceduresextraction & amplification/detection procedures
Data is returned electronically to NIBSC for analysis Data is returned electronically to NIBSC for analysis
Returned data is used to make decisions on suitableReturned data is used to make decisions on suitableformulations for further evaluationformulations for further evaluation
HCVM Stock Material Used in HCVM Stock Material Used in Phase I StudiesPhase I Studies
Human cytomegalovirus (HCMV), Towne Human cytomegalovirus (HCMV), Towne strain was cultured strain was cultured in vitroin vitro at the West of Scotland Specialist Virology Centre, Glasgow
Analysis of HCMV Results - Phase IAnalysis of HCMV Results - Phase I
Virus Dilution Ct Value (copies/ml)
Lab B Lab C Lab D Lab E Lab F
HCMV 10-4 22.79 32.65 26.23(1.9 x 106
copies/ml)6.8 x 105
copies/ml
-ve**
10-5 26.37 35.78 30.33(1.1 x 105
copies/ml)4.4 x 104
copies/ml
-ve**
10-6 30.00 39.27 34.15(7.5 x 103
copies/ml)3.5 x 103
copies/ml
-ve**
Extraction MDx MagNA MDx MDx Qiagen manual
Amplification/Detection Probe Probe Probe Probe Probe
Equiv. vol. of sampleamplified
16 μl 20 μl 26.5 μl ? ?
** Run controls as expected
ResultsResults
Laboratory F failed to generate Ct values for Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the studyHCMV distributed in Phase I of the study
Extensive follow up was performed to identify Extensive follow up was performed to identify why this and another laboratory using the why this and another laboratory using the same assay had unexpected resultssame assay had unexpected results
Analysis of reactions on agarose gels Analysis of reactions on agarose gels revealed that product of the expected size revealed that product of the expected size was being amplified was being amplified
Alignment of Towne Strain with Alignment of Towne Strain with TaqMan ProbeTaqMan Probe
Assay targets glycoprotein gene of HCMVAssay targets glycoprotein gene of HCMV Analysis of the primer sequences revealed Analysis of the primer sequences revealed
a mismatch in the middle of the reverse a mismatch in the middle of the reverse primerprimer
Analysis of sequence of probe vs Towne Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches:strain of HCMV revealed 2 mismatches:
GAGCGCCATCTGTTCCTTGTCGAGCAACATACGACGCACAGGGTCTTGAC TGTCGAGCAGCATACGGCGCA
Evaluation of Candidate Run Evaluation of Candidate Run Controls for Norovirus GIIControls for Norovirus GII
+
Evaluation of Candidate Run Controls Evaluation of Candidate Run Controls for Norovirus GIIfor Norovirus GII
Norovirus (previously known as the Norwalk-like Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritisviruses) is a common cause of gastroenteritis
Detection has traditionally relied upon EMDetection has traditionally relied upon EM
Two genetic clusters of NoV occur; GI and GIITwo genetic clusters of NoV occur; GI and GII
Phase I of a study identified a suitable concentration of Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run controlNoV GII isolate to use as a candidate run control
ll
Faecal norovirus (GII) sample was obtainedFaecal norovirus (GII) sample was obtained
Sample was disrupted using glass beads in 10 mM Tris-Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was preparedchloroform, from which a virus stock was prepared
Norovirus GII Results Phase INorovirus GII Results Phase I
Virus Dilution Ct Value
Lab A Lab B Lab C Lab D
NoV GII 10-3 30.97 22.70 35.20 30.10
10-4 34.80 25.98 37.30* 36.37
10-5 38.23 28.68* -ve -ve
Extraction MagNA MDx MagNA MDx
Amplification/Detection Probe SYBR Probe Probe
Equiv. vol. of sampleamplified
80 μl 16 μl 10 μl 26.5 μl
* One or more replicate tested negative
Evaluation of Candidate Run Controls Evaluation of Candidate Run Controls for Norovirus GIIfor Norovirus GII
This has been distributed to 15 laboratories for This has been distributed to 15 laboratories for on going analysison going analysis
Standards will eventually be -markedStandards will eventually be -marked
Norovirus GII Phase IINorovirus GII Phase II
0 5 10 15 20 250
5
10
15
20
25
30
35
40
Norovirus ResultsC
ross
ing p
oin
t (C
t)
Assay number
Lab A Lab B (16.9l) Lab G (5l) Lab H (40l) Lab J (13.9l) Lab K (12l) Lab M (10l) Lab N (20l) Lab O (40l)
Lab H failed to detect NoV GII
Future WorkFuture Work
Clinical panels have been proposed that include:Clinical panels have been proposed that include:
CSFCSF HSV-1, HSV-2, HCMV, EBV, VZVHSV-1, HSV-2, HCMV, EBV, VZVenterovirus, paraenterovirusenterovirus, paraenterovirus
TransplantTransplant HCMV, EBV, adenovirusHCMV, EBV, adenovirus
GenitalGenital HSV-1, HSV-2, HSV-1, HSV-2, TreponemaTreponema(ulcer)(ulcer)
Eye swabsEye swabs HSV-1, HSV-2, VZV, adenovirus, HSV-1, HSV-2, VZV, adenovirus, ChlamydiaChlamydia
Future Work cont.Future Work cont.
GastroenteritisGastroenteritis NoV, astrovirusNoV, astrovirus
RespiratoryRespiratory Influenza A (H1, H3), influenza B,Influenza A (H1, H3), influenza B,parainfluenza, RSV……parainfluenza, RSV……
Vaginal swabsVaginal swabs HSV-1, HSV-2, HSV-1, HSV-2, N. gonorrhoeaN. gonorrhoea, , M. genitalis, M. genitalis, C. trachomatisC. trachomatis
UrethritisUrethritis N. gonorrhoeaN. gonorrhoea, M. genitalis, , M. genitalis, C. trachomatisC. trachomatis
ProposalProposal
Prepare International Standards for Prepare International Standards for HCMV and EBVHCMV and EBV