BRIEF REPORTS

Mutation of the Tumor Suppressor Gene TP53 Is Not Detected in Psoriatic Skin

Jean-Pierre Moles,* Charles Theillet,t Nicole Basset-Seguin,* and Jean-Jacques Guilhou* 'Laboratoire de Dermatologie Molcculaire, CNRS/CRBM; and tURA-CNRS 1191, Laboratoire de Biologic Moleculaire, Montpellier, France

-------------------------------------------------------------------------------------------------------, We investigated the tumor-suppressor gene, TP53, in psori­atic skin at gene (GP53) and protein (p53) levels. No muta­tion was detected in the seven exons analyzed using a combi­nation of polymerase chain reaction and single-strand conformation polymorphism techniques. In addition, by im­munohistochemistry using three different anti-p53 antibod-

ies, no positive staining, reported to be associated with muta\ tions and/or abnormal expression of the TP53 gene, w~ observed in psoriatic skin biopsies, in contrast to recent re\ ports. These results suggest that the proliferative status ot psoriatic keratinocytes does not implicate the TP53 gene, ] Invest Dermato!101:100-102, 1993

-------------------------------------------------------------------------------------------------------,

Psoriasis is a benign skin disease with a complex inheri­tance pattern, characterized by hyperproJiferation (1,2J and abnormal differentiation [3,4J of keratinocytes. Many genes, earticularly oncogenes (5) and tumor-sup­pressor genes [6), can be involved in dysregulation of the

cell-cycling process. It is well known that oncogenes can stimulate and promote cell division, whereas tumor-suppressor genes are de­fined as being genes that can repress cell proliferation. Inactivation of the TP53 tumor-suppressor gene by point mutations and/or alle­lic loss actually represents the most frequent genomic alteration in human cancers (for review see [7]). However, the cellular function of the gene product p53 as well as the way by which it acts is still unclear (8] .

There has been recent interest in studies of p53 alterations in benign diseases such as psoriasis. Tadini and co-workers reported abnormal nuclear p53 immunohistochemical staining in the basal layer of lesional psoriatic skin (9]. This suggests th~ occurrence of TP53 gene alterations in psoriasis, because the half-hfe of a mutated p53 protein was shown to be prolonged in vitro [10].

In the present study, we looked for mut~tions i~ the ~P53. gene in a series of 15 extracted DNAs from skm psonatlc bIOpSies by a combination of polymerase chain reaction (PCR) and single­stranded conformation polymorphism (SSCP). Moreover, p53 ex­pression was investigated in 12 psoriatic skin biopsies by immuno­histochemical analysis.

MATERIALS AND METHODS

Patients Fifteen 4-mm punch biopsies from eight psoriatic pa­tients (eight lesional and seven non-lesionaJ psoriatic skin biopsies) were collected for DNA extraction at the Dermatological Depart­ment of the H6pital Saint Charles (Montpellier, France). Two of these, and ten additionallesional psoriatic skin 4-mm punch biop­sies were collected to obtain tissue sections for immunohistochemi­cal analysis. After surgical excision, all samples were rapidly frozen in liquid nitrogen and subsequently stored at - 80°C until used.

Manuscript received October 29, 1992; accepted for publication March 15,1993.

Reprint requests to:).J. Guilhou, Service de Detmatologie ct Phlebologie, H6pital Saint Charles, Rue A. Broussonet, 34059 Montpellier Ccdex.

Abbreviations: ds, double-strand DNA; ss, single-strand DNA; SSCP, single-strand conformation polymorphism.

DNA Extraction and PCR-SSCP Analysis Genomic ON~ from psoriatic skin were extracted from powdered punch biopsie, (4 mm) using the phenol/chloroform method as previously de, scribed [11]. Radioactive PCRs were performed for 35 cycles cou, sisting of 30 seconds at 94 ° C, 20 seconds in a temperature range ot 40-63°C depending on the primers and 1 min at noc. Regio~ screened covered exon 2 and exons 4 through 9 (Fig 1). The SSCI< analysis was performed according to the technique described b)' Spinardi et al [12]. Briefly, PCR products were diluted in loadin& buffer (95% formamide, 5% ethylenediaminetetraacetic aci~ 0.5 M, 0.025% bromophenol blue, 0.025% xylene cyanol blue), heat denatured, and loaded onto 4.5% or 6% non-denaturing aery, lamide gel containing or not containing 5% glycerol. Gels were fUlt

at constant power and at room temperature for those containing glycerol or at 4 ° C for those without glycerol. After migration, gels were subjected to autoradiography against a Kodak XAR-5 film at -80°e. Couples of primers used for TP53 gene analysis were as follows [13]: exon 2, 5'-TGCAGCAGCTAGACTGCCTTCC; 3'-CAATGGATCCACTCACAGTTTCC; 3' end of the exon 4, 5' - TGCACCAGCAGCTCCT ACAC/3' - CATGGAAGCCAG­CCCCTCAG; exon 5, 5'-GCCGTGTTCCAGTTGCTTT ATC/ 3' -GT AGATGGCCATGGCGCGGACG; exon 5',5' -GTGGAT­TCCACACCCCCGCCCGG/3' -TCAGTGAGGAA TCAGAG­GCC; exon 6, 5' -CTGGAGAGACGACAGGGCTG /3' -GCCA­CTGACAACCACCCTTA; exon 7, 5' -CCTCATCTTGGGCC­TGTGTT/3'-TCAGCGGCAAGCAGAGGCTG; exon 8-9, 5'­AGGACCTGATTTCCTTACTG/3' - CTTTCCACTTGATA­AGAGGTe.

Reagents Three different anti-p53 antisera were used: polyclonal antibody (PoAb) CM!, mOlloclonal antibody (MoAb) D07 (Novo­castra, UK) and MoAb 1801 (Oncogene Science, USA). All of these antibodies recognized both the wild-type and mutated form of the p53 protein. The epitopes of both D07 and 1801 MoAbs were located in the NH2-terminal portion of the protein, and the CM1 PoAb was raised against a recombinant wild-type p53 protein.

Immunohistochemical Analysis Tissue sections (5 f.1.m thick) from OCT compound (Miles, USA) -embedded psoriatic skin were fixed with acetone/methanol (SO/50, v/v) at -20°e. Anti­bodies were used at 1/50 dilution and revealed using an avidin-bio­tin peroxidase complex system according to the manufacturer's in­structions (OPC, France). The peroxidase reaction was performed

0022-202X/93/S06.00 Copyright © 1993 by The Society for Investigative Dermatology, Inc.

100

VOL. 101, NO.1 JULY 1993

Figure 1. Schematic representation of the TP53 gene. White boxes, exons analyzed; arrows, the pair of primers used. Black boxes, conserved amino acid sequence blocks of the protein.

with 3-3' -diaminobenzidine chfomogene (Sigma, France); slides were then counterstained with Mayer's hemalun (Ral, France). The T47D breast cancer cell line and a previously characterized mutated basal cell carcinoma [12] were used as positive controls. For negative controls, the slides were incubated with a solution of phosphate­buffered saline/l % bovine serum albumin lacking the first anti­body.

RESULTS

PCR-SSCP Analysis of the TP53 Gene After PCR amplifica­tion of various portions of the TP53 gene (Fig 1) by PCR, we detected point mutations using a SSCP technique based on the con­formation of the single-stranded DNA [14]. Under non-denaturing electrophoretic conditions, migration of single-stranded DNAs is a function of their conformation that depends on their sequence. As little as a single point mutation can be visualized by a variant migra­tion pattern (see control DNA in lane C and arrow). An identical wild-type migration pattern was observed in all psoriatic DNAs including lesional and non-Iesional psoriatic biopsies (Fig 2). How­ever, a shifted band, thus indicating a point mutation, was detected in a previously sequenced mutated basal cell carcinoma DNA used as control (Fig 2) .

Immunohistochemical Analysis of the p53 protein Using three anti-p53 antibodies (PoAb CM1, MoAbs D07 and 1801), we did not observe any nuclear staining in the 12 biopsies analyzed, whereas the positive controls (T47D cell line and a previously de­scribed mutated basal cell carcinoma) were normally stained (Fig 3) . Moreover, five of these frozen specimens covered the edge of a psoriatic lesion, and we did not observe any difference in p53 stain­ing between lesional and the flanking non-lesional skin (Fig 3).

DISCUSSION

Alteration of the TP53 tumor sUPJ:Jfessor gene is the most frequent event reported in human cancers l7]. TP53 mutations are observed with variable incidence in all cancers, including epithelial skin cancers. The frequency of mutation is elevated in basal cell carcino­mas [12] and in squamous cell carcinomas [15,16]. Because TP53 mutations frequently occur in skin-tumoral processes, they could also be involved in psoriatic keratinocyte hyperproliferation.

In this study, with a combination of PCR and SSCP techniques, no mutation of the TP53 gene could be detected in DNAs extracted from 15 lesional or non-Iesional psoriatic skins. Exon 2 and exons 4 through 9 were screened for this study. They correspond to the region containing the mutational hot-spot sites described in human cancers [17]. These regions also include the coding sequence for the most conserved amino acid domains of the protein in all species [18]

1 2 3 4 5 6 7 8 9 10 1112 13 14 15 C

ss~--. :~:: ... .. -'r 55--__ -_·21. -....... -.---

Figure 2. Results obtained by PCR-SSCP of exon 5 on the TP53 gene. By this technique, double-stranded PCR products are heat denatured and the single-stranded ONAs (SS) obtained are loaded into a non-denaturing acry­lamide gel. Odd latles, ONAs extracted from lesional psoriatic skin; evetllalles, those extracted from non-Iesional psoriatic skin. Lalles associated w ith a bar correspond to ONAs extracted from the same patient.

p53 GENE IN PSORIASIS 101

Figure 3. Immunohistochemical results with anti-p53 antibodies. The mutated basal cell carcinoma used as positive control is presented on A and the negative control slide on B. Absence of staining in a psoriatic skin biopsy covering the non-lesional skin and the lesional skin is shown on C and D, respectively. Bar, 50 j1m.

(Fig 1). The method used is empirical and very sensitive because diluted mutated DNAs, as low as 10%, can still be easily detected (unpublished results) . Because a technique as sensitive as PCR­SSCP cannot detect all mutations, and although we have not ob­served any mutations, we cannot totally exclude the possibility that TP53 mutations occur in psoriasis, particularly in other parts of the gene.

We also used an immunohistochemical technique to analyze TP53 gene expression. With this procedure, positive staining could indicate the presence of a mutation in the TP53 gene, because most p53-mutated proteins have a prolonged half-life [10]. With three commercial antibodies (PoAb CM1, MoAbs D07 and 1801) that recognize different epitopes, we did not observe nuclear staining in lesional and non-lesional psoriatic skins. Assays were controlled with both a positive breast cancer cell line (T47D) and a mutated basal cell carcinoma. The absence of p53 staining with these three antibodies was in accordance with the absence of genomic muta­tions in the TP53 gene.

Nevertheless, Tadini and co-workers reported p53 nuclear stain­ing in the basal layer oflesional psoriatic skin, using PoAbs 421 and 1801 [9]. More recently, Helander et al:!: observed p53 cytoplasmic staining with MoAb 421 and MoAb 1801 in basal and suprabasal layers of psoriatic lesions. These differences in results obtained by each group, even though at leas t one identical antibody was used in the three studies, underline the difficulty of interpreting immuno­histochemical results with anti-p53 antibodies. We have found that it is very important to use adequate controls so as to avoid fa lse interpretations. This is emphasized by the recent observation of cross-reactivity of anti-p53 antibodies with other proteins like kera­tins [19] . Moreover, it has been recently shown that ultraviolet

:j: Helander SO, Peters MS, Pittelkow MR: p53 expression and localiza­tion in normal skin, psoriasis, cutaneous carcinoma and cultured keratino­cytes (abstr). J Invest Oermatol 98:636, 1992.

102 MOLES ET AL

irradiation induces pS3 expression in in vivo normal human skin that returns to undetectable basal level within 15 d [20] . As psoriatic patients often undergo psoralen plus ultraviolet A therapy, we wonder whether this could explain why p53 expression can be detected in some instances. It should be kept in mind that detection of the p53 protein does not necessarily indicate the existence of a mutation of the gene but can also come from a dysregularion of its expression.

In conclusion, the TPS3 gene was not altered in the seven exons analyzed, and TP53 gene product was not detected, in psoriatic skin. Dysregulation of the cell-cycle process in this disease might come from other genes, such as still unstudied tumor-suppressor genes or oncogenes; we recently demonstrated a decrease in c-FOS expres­sion in lesional psoriatic skin [21]. More studies are required to understand the possible involvement of oncogene and/or tumor suppressor genes in psoriasis.

This work was slIpported by ARC grant # 6708 and INSERM grant # 910203 . Jean-Pierre Moles was recipient of a predoctoral fellowship Imder the Association pOllr In Recherche cOlltre Ie Catlcer grant # CG91.

REFERENCES

1. Van Scott], Ekel TM: Kinetics of hyperplasia in psoriasis. Arch Der­matol 88:373-381,1963

2. Weinstein GD, McCullough ]L, Ross PA: Cell kinetic basis for patho­physiology of psoriasis.] Invest Dermatol 85:579-583, 1985

3. Weiss RA, Eichner R, Sun TT: Monoclonal antibodies analysis of keratin expression in epidermal diseases: a 48 and 56 kilodalton keratin as molecular markers for hyperprolifcrative keratinocytes. J Cell BioI 98: 1397 - 1406, 1984

4. Bernard BA, Asselineau D, Schalfar-Deshayes L, Darmon MY: Ab­normal sequence of expression markers in psoriatic epidermis: in­version of two steps in the differentiation programme? J Invest Dermatol 90:801 - 805, 1988

5. Bishop ]M: Molecular themes in oncogenesis. Cell 64:235-248, 1991 6. Marshall CJ: Tumor suppressor genes. Cell 64:313 - 326, 1991 7. Hollstein M, Sidransky D, Vogels tein B, Harris CC: p53 mutations in

human cancers. Science 253:49 - 53, 1991

THE JOURNAL OF INVESTIGATIVE DERMATOLOG,\,

8. Lane DP: p53, guardian of the genome. Nature 358:15-16,1992 9. Tadini G, Cerri A, Crosti L, Cattoretti G, Berti E: p53 and oncogen~

expression in psoriasis. Acta Derm VenereoI146:33-35, 1989 10. Finlay CA, Hinds PW, Tan T-H, Eliyahu D, Oren M, Levine AJ,

Activating mutations for transforming by p53 produce a gene prod~ uct that forms an hsc70-p53 complex with an altered half-life. Mo\ Cell BioI 8(2):531-539, 1988

11. Adnane J, Gaudray P, Simon MP, Simony-Lafontaine], Jeanteur P Theillet C: Proto-oncogene amplification and human breast tumo~ phenotype. Oncogene 4: 1389 -1395, 1989

12. Spinardi L, Mazars R, Theillet C: Protocols for an improved detecti0l\ of point mutations by SSCP. Nucl Acid Res 14:1009, 1991

13. Moles J-p, Moyret C, Guillot B, Jeanteur P, Guilhou J-J, Theillet C, Basset-Seguin N: p53 mutations in human epithelial skin cancers, Oncogene 8:583 - 588, 1993

14. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T: Detection ot polymorphisms of human DNA by gel electrophoresis as single, strand conformation polymorphisms. Proc Natl Acad Sci USA, 86:2766-2770,1989

15. Brash DE, RudolphJA, SimonJA, Lin A, McKenna GJ, Baden HP, Halperin A], Ponten J: A role for sunlight in skin cancer: UV-in­duced p53 mutations in squamous cell carcinoma. Proc Nat! Acad Sci USA 88:10124-10128,1991

16. Pierceall WE, Mukhopadhyay T, Goldberg LH, Ananthaswamy HN: Mutations in the p53 rumor suppressor gene in human cutaneous squamous cell carcinomas. Mol Carcinogen 4:445-449,1992

17. Caron de Fromentel C, Soussi T: TP53 rumor suppressor gene: a model for investigating human mutagenesis. Genes Chrom Cancer 4:1-15,1992

18. Soussi T, Caron de Fromentcl C, May P: Structural aspects of the p53 protein in relation to gene evolution. Oncogene 5:945-952,1990

19. Horak E, Smith K, Bromley L, Lejeune S, Greenall M, Lane D, Harris AL: Mutant p53, EGF receptor and c-erbB-2 expression in human breast cancer. Oncogene 6:2277 -2284, 1991

20. Hall PA, McKec PH, du P, Mcnage H, Dover R, Lane DP: High level of p53 protein in UV-irradiated normal skin. Oncogene 8:203-204, 1993

21. Basset-Seguin N, Escot C, Moles J-p, Blanchard J-M, Kerai C, Guil­hou J-J: C-FOS and C-JUN proto-oncogene expression is decreased in psoriasis: an in sitn quantitative analysis. J Invest Dermatol 97:672-678,1991

ANNOUNCEMENT

A workshop on Photoimmunology will be held in Capocaccia, near Alghero, Sardinia, Italy, October 8 - 10, 1993. The workshop will take place during the summerschool, entitled Photo­biology in Medicine.

Organizers of the Photoimmul1010gy workshop are P. Bergstresser, Th . Dubbelman, and BJ. Vermeer.

The following topics will be discussed. 1. Introduction immunology of the skin . 2. Modulation of the immune system by UV light (antigen presentation, T-cell recognition,

cytokine production, adhesion molecules). 3. Genetic polymorphism of UV -induced immune suppression. 4. Photoreceptor for UV-induced immune suppression. 5. Effect ofUV light on infections (HIV, Herpes simplex). 6. Clinical relevance of photoimmunology (e.g., skin cancer in immune compromised host). 7 . Therapeutic use ofUV-induced immunosuppression (e.g., thrombocyte transfusion). 8. Immunologic aspects of photophoresis and photodynamic therapy. 9 . Effect of sunscreen on photoimmunological aspects. For registration contact B.]. Vermeer, Department of Dermatology, University Hospital,

Leiden, P.O. Box 9600, 2300 RC Leiden, The Netherlands. Fax: 31 71 144348.