multiple sequence alignments and motif discovery
DESCRIPTION
Tutorial 5. Multiple sequence alignments and motif discovery. Multiple sequence alignments and motif discovery. Multiple sequence alignment ClustalW Muscle Motif discovery MEME Jaspar. A. C. D. B. Multiple Sequence Alignment. More than two sequences DNA Protein - PowerPoint PPT PresentationTRANSCRIPT
Multiple sequence alignments and motif discovery
Tutorial 5
• Multiple sequence alignment– ClustalW– Muscle
• Motif discovery– MEME– Jaspar
Multiple sequence alignments and motif discovery
• More than two sequences– DNA– Protein
• Evolutionary relation– Homology Phylogenetic tree– Detect motif
Multiple Sequence Alignment
GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC
A
D B
CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC
• Dynamic Programming– Optimal alignment– Exponential in #Sequences
• Progressive– Efficient– Heuristic
Multiple Sequence Alignment
GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC
A
D B
CGTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC
ClustalW
“CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice”, J D Thompson et al
Pairwise alignment – calculate distance
matrix
Guided tree
Progressive alignment using the
guide tree
ClustalW
• Progressive– At each step align two existing alignments or
sequences– Gaps present in older alignments remain fixed
-TGTTAAC-TGT-AAC-TGT--ACATGT---CATGT-GGC
ClustalW - Inputhttp://www.ebi.ac.uk/Tools/clustalw2/index.html
Input sequences
Gap scoring
Scoring matrix
Email address
Output format
ClustalW - Output
Match strength in decreasing order: * : .
ClustalW - Output
ClustalW - Output
ClustalW - Output
ClustalW - Output
Pairwise alignment scores
Building alignment
Final score
Building tree
ClustalW - Output
ClustalW Output
Sequence names Sequence positions
Match strength in decreasing order: * : .
ClustalW - Output
ClustalW - Output
Branch length
ClustalW - Output
ClustalW - Output
Muscle - output
What’s the difference between Muscle and ClustalW?
ClustalW Muscle
http://www.megasoftware.net/index.html
Can we find motifs using multiple sequence alignment?
1 2 3 4 5 6 7 8 9 10
A 0 0 0 0 0 0.5 1/6 1/3 0 0
D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6
E 0 0 2/3 1 0 0 0 0 1 5/6
G 0 1/6 0 0 1 1/3 0 0 0 0
H 0 1/6 0 0 0 0 0 0 0 0
N 0 1/6 0 0 0 0 0 0 0 0
Y 1 0 0 0 0 0 0.5 0.5 0 0
1 3 5 7 9..YDEEGGDAEE....YDEEGGDAEE....YGEEGADYED....YDEEGADYEE....YNDEGDDYEE....YHDEGAADEE.. * :** *:
MotifA widespread pattern with a biological significance
Can we find motifs using multiple sequence alignment?
YES! NO
MEME – Multiple EM* for Motif finding
• http://meme.sdsc.edu/• Motif discovery from unaligned sequences
– Genomic or protein sequences• Flexible model of motif presence (Motif can be absent in
some sequences or appear several times in one sequence)
*Expectation-maximization
MEME - InputEmail address
Input file (fasta file)
How many times in each
sequence?
How many motifs?
How many sites?
Range of motif
lengths
MEME - Output
Motif score
MEME - Output
Motif length
Number of times
Motif score
MEME - Output
Low uncertainty
=
High information content
MEME - Output
Multilevel Consensus
Sequence names
Position in sequence
Strength of match
Motif within sequence
MEME - Output
Overall strength of motif matches
Motif location in the input sequence
MEME - OutputSequence names
MAST
• Searches for motifs (one or more) in sequence databases:– Like BLAST but motifs for input– Similar to iterations of PSI-BLAST
• Profile defines strength of match– Multiple motif matches per sequence– Combined E value for all motifs
• MEME uses MAST to summarize results: – Each MEME result is accompanied by the MAST result for
searching the discovered motifs on the given sequences.
http://meme.sdsc.edu/meme4_4_0/cgi-bin/mast.cgi
MEME - Input
Email address
Input file (motifs)
Database
JASPAR
• Profiles – Transcription factor binding sites– Multicellular eukaryotes– Derived from published collections of experiments
• Open data accesss
JASPAR• profiles
– Modeled as matrices.– can be converted into PSSM for scanning genomic
sequences.
1 2 3 4 5 6 7 8 9 10
A 0 0 0 0 0 0.5 1/6 1/3 0 0
D 0 0.5 1/3 0 0 1/6 5/6 1/6 0 1/6
E 0 0 2/3 1 0 0 0 0 1 5/6
G 0 1/6 0 0 1 1/3 0 0 0 0
H 0 1/6 0 0 0 0 0 0 0 0
N 0 1/6 0 0 0 0 0 0 0 0
Y 1 0 0 0 0 0 0.5 0.5 0 0
scoreorganism logoName of gene/protein