This article was downloaded by: [Maharshi Dayanand University], [Sapna Sharma]On: 10 July 2015, At: 00:11Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: 5 Howick Place, London, SW1P 1WG

Click for updates

Oriental InsectsPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/toin20

Mitochondrial DNA of two forensicallyimportant species of Chrysomya(Diptera: Calliphoridae) from IndiaSapna Sharmaa & Devinder Singha

a Department of Zoology, Punjabi University, Patiala 147 002, IndiaPublished online: 08 Jun 2015.

To cite this article: Sapna Sharma & Devinder Singh (2015): Mitochondrial DNA of two forensicallyimportant species of Chrysomya (Diptera: Calliphoridae) from India, Oriental Insects, DOI:10.1080/00305316.2015.1013181

To link to this article: http://dx.doi.org/10.1080/00305316.2015.1013181

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the“Content”) contained in the publications on our platform. However, Taylor & Francis,our agents, and our licensors make no representations or warranties whatsoever as tothe accuracy, completeness, or suitability for any purpose of the Content. Any opinionsand views expressed in this publication are the opinions and views of the authors,and are not the views of or endorsed by Taylor & Francis. The accuracy of the Contentshould not be relied upon and should be independently verified with primary sourcesof information. Taylor and Francis shall not be liable for any losses, actions, claims,proceedings, demands, costs, expenses, damages, and other liabilities whatsoever orhowsoever caused arising directly or indirectly in connection with, in relation to or arisingout of the use of the Content.

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &

Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

Mitochondrial DNA of two forensically important species ofChrysomya (Diptera: Calliphoridae) from India

Sapna Sharma1* and Devinder Singh

Department of Zoology, Punjabi University, Patiala 147 002, India

(Received 7 March 2014; accepted 26 November 2014)

Morphological identification of the immature stages of blow flies is difficultespecially when only fragmented specimens are found. Mitochondrial cytochromeoxidase I (mtCOI) gene sequence data coupled with its phylogenetic analysis are aquick technique in such cases. Hence, the partial sequence of this gene followed byits parsimony analysis was tested for the identification of two species ofChrysomya,i.e. C. rufifacies (Macquart) and C. megacephala (Fabricius) commonly foundassociated with cadavers from India. An attempt has also been made to assess theintraspecific and geographical variations. The intraspecific variation was found tobe ,1% for the C. megacephala samples but not so in C. rufifacies. These twospecies were found to be monophyletic and were correctly identified. The 480bpCOI region was found to be good enough to distinguish these.

Keywords: blow flies; Chrysomya rufifacies; C. megacephala; forensics;mtCO1; intraspecific

Introduction

The ecological importance of blow flies has long been known, and their forensic significance

is gaining importance. Carrion breeding blow flies provide information regarding the time,

place andmanner of death (Catts and Goff 1992). Accurate identification of these based on the

morphological characters is not always possible when immature or incomplete specimens are

involved (Avise 1991; Chen et al. 2004). Moreover, time is also a constraint in most forensic

situations. Molecular studies involving mitochondrial DNA (mtDNA) as a diagnostic

character have shown that sequence analysis results in correct and quick identifications in

most cases (Wallman and Donnellan 2001; Zhang et al. 2007). Of the seven species of blow

flies of the genus Chrysomya from north-western India (Sidhu and Singh 2002), C. rufifacies

(Macquart) andC. megacephala (Fabricius) have forensic importance (Singh and Bharti 2000;

Bharti and Singh 2003), and molecular data on these are inadequate. Therefore, two short,

overlapping fragments (195 and 304 bp) of mitochondrial cytochrome oxidase I (mtCOI) gene

resulting in a 480bp region were chosen for this study. In addition, an attempt was made to

assess the intraspecific and geographical variations, through comparison of earlier data.

Materials and methods

Dried adult specimens (stored at room temperature for 2–5 years) of C. rufifacies and

C. megacephala collected from different regions of north-west India were used. One fresh

q 2015 Taylor & Francis

*Corresponding author. Email: dreamshm@yahoo.co.in

Oriental Insects, 2014

http://dx.doi.org/10.1080/00305316.2015.1013181

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

frozen specimen in each has also been included. The relevant details are given in Table 1.

Calliphora vicina was used as an outgroup (AY842603). Previously published nucleotide

sequences available from NCBI GenBank for this segment of mtCOI of the two species

were used to assess the inter- and intraspecific distances (Table 2).

The thorax was removed and subjected to DNA extraction using a DNeasy Tissue Kit

(Qiagen, Hilden, Germany). Manufacturer’s protocols were followed for the isolation of

DNA, the isolated DNA was eluted in 100ml of elution buffer. PCR amplifications were

carried out in a reaction volume of 50ml. The reaction mixture consisted of 0.2mM of

each dNTP, 1.5mM of MgCl2, 2mM of each primer (Qiagen Operon, Alameda, CA), 5mlof 10 £ buffer (Fermentas International, Inc., Burlington, CA), 10ml of DNA extract and

enough sterile water to complete the total 50ml volume. During the initial denaturation

phase, 2.5 U of Dr Taq DNA polymerase (Biogene, USA) was added to each tube. Primers

C1-J-2319/C1-N-2514 and C1-J-2495/C1-N-2800 (Wells and Sperling 2001) as given in

Table 1. Details of specimens sequenced.

Species LocationDate ofcollection

Method and duration ofpreservation

Accessionnumber

C. rufifacies PatialaRajgarhRishikeshKalsi

27 March 200422 October 200016 June 200027 May 2000

FF, ,5 monthsP & D, 3 years & 5 monthsP & D, 4 years & 5 monthsP & D, 4 years & 7 months

DQ098932DQ098935DQ098933DQ098934

C. megacephala PatialaRishikeshKala AmbKarsog

27 March 200416 June 200021 September 200013 October 2000

FF, ,5 monthsP & D, 3 years & 9 monthsP & D, 4 years & 1 monthP & D, 4 years & 2 months

DQ119585DQ119586DQ119587DQ119584

Note: FF, fresh frozen; P & D, pinned and dried.

Table 2. Details of NCBI GenBank accessions (mtCO1) analysed.

Species Accession number Locality Reference

C. rufifacies AY909055AY092760AB112828AB112845AY842621AY842623AY842624AF083658

MalaysiaTaiwanPerthPerthAustraliaAustraliaAustraliaUSA

Tan et al. (2009)Chen et al. (2004)Harvey et al. (2003)Harvey et al. (2003)Wallman et al. (2005)Wallman et al. (2005)Wallman et al. (2005)

Wells and Sperling (1999)C. megacephala AY909053

AY092761AB112830AB112841AB112846AB112847AB112848AB112861AY842619AF295551

MalaysiaTaiwanKwaZulu-NatalBrisbanePerthPerthPretoriaKitweAustraliaUSA

Tan et al. (2009)Chen et al. (2004)Harvey et al. (2003)Harvey et al. (2003)Harvey et al. (2003)Harvey et al. (2003)Harvey et al. (2003)Harvey et al. (2003)Wallman et al. (2005)Wells and Sperling (2001)

C. vicina AY842603 Australia Wallman et al. (2005)

2 S. Sharma and D. Singh

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

Table 3 were used for the amplifications. Amplification reactions were carried out on

Perkin-Elmer Gene Amp PCR system 2400 thermocycler (Applied Biosystems, Foster

City, CA, USA). The thermal cycling conditions include an initial denaturation phase of

948C for 3min, followed by an annealing at 528C and an extension at 758C for 1min each.

This was followed by 35 cycles of 938C for 45 s, 528C for 45 s, 728C for 1min and a final

extension at 728C for 6min. The PCR products were checked in 1.7% ethidium bromide

stained gel and purified using PCR purification kit (Qiagen, Valencia, CA, USA).

Manufacturer’s protocol was followed to obtain sequences for both the forward and

reverse strands, using ABI Prism BigDye Terminator v3.0 Ready Reaction Cycle

Sequencing Kit (Applied Biosystems), with the same set of primers as used for

amplification. Sequencing reaction products were cleaned using the ethanol/sodium

acetate precipitation method and electrophoresed in an ABI Prism 3100 Genetic Analyzer.

The forward and reverse sequences were submitted to GenBank and the accession

numbers are as given in Table 1.

Table 3. Details of PCR primers used.

S. no. Location Sequence Primer paired with

1234

C1-J-2319C1-J-2495C1-N-2514C1-N-2800

TAGCTATTGGAC/TTATTAGGCAGCTACTTTATGAGCTTTAGGAACTCCAGTTAATCCTCCTACCATTTCAAGT/CTGTGTAAGCATTC

3412

Table 4. Pairwise sequence divergence between species (% 467 base pairs).

[1] : C.R- DQ098932 (Patiala), [2]: C.R- DQ098933 (Rishikesh), [3]: C.R- DQ098934 (Kalsi), [4]: C.R-AY909055 (Malaysia), [5]: C.R- DQ098935 (Rajgarh), [6]: C.R- AY842624 (Australia), [7]: C.R- AY842621(Australia), [8]: C.R- AY842623 (Australia), [9]: C.R-AF083658 (USA), [10]: C.R- AB112828 (Perth), [11]: C.R- AB112845 (Perth), [12]: C.R-AY092760 (Taiwan), [13]: C.M- AF295551 (USA), [14]: C.M- AY909053(Malaysia), [15]: C.M- AB112861 (Kitwe), [16]: C.M-AB112847 (Perth), [17]: C.M- AB112848 (Pretoria), [18]:C.M- AB112830 (KwaZulu-Natal), [19]: C.M- AY842619 (Australia), [20]: C.M-AB112846 (Perth), [21]: C.M-AB112841 (Brisbane), [22]: C.M- DQ119585 (Patiala), [23]: C.M- DQ119587 (Kala Amb), [24]: C.M-DQ119584 (Karsog), [25]: C.M- DQ119586 (Rishikesh), [26]: C.M- AY092761 (Taiwan), [27]: C.V- AY842603(Australia); C.R- C. rufifacies; C.M- C. megacephala; C.V- Calliphora vicina

Oriental Insects 3

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

Chromas Lite v2.0 (http://www.technelysium.com.au) was used for manual checking

of electrophorograms obtained after sequencing. The discrepancies and ambiguities were

corrected by comparing the forward and reverse sequences. Multiple alignments were

carried out using Clustal W (Thompson et al. 1994). Parsimony analysis was performed

with 1000 bootstrap replicates using Mega v4 (Tamura et al. 2007).

Results and discussion

A total of 480 sites were aligned for the 27 sequences included, which comprise the

combined data obtained for primer pair 1 and 3 with primer pair 2 and 4, respectively. The

primer pairs have a 19 bp overlapping region, and the trees were constructed based on 467

sites, and 1000 replicates were used for bootstrapping. Sequence divergence among the

Figure 1. Parsimonious phylogenetic tree of C. rufifacies and C. megacephala; C.R – C. rufifacies;C.M – C. megacephala; for the species names relevant to the accession numbers refer Tables 1, 2and 4.

4 S. Sharma and D. Singh

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

taxa ranged from 0 to 12.2%, with the same species having a divergence ranging from 0 to

1.1% for C. megacephala, and 0 to 1.5% for C. rufifacies – the former showed 11 variable

base positions, mostly in the third codon position.

Maximum divergence in C. rufifacies was found to be 1.5% between sample

AY092760 (Chen et al. 2004) and AB112845, AB112828 (Harvey et al. 2003) and

DQ098935. The Taiwanese sample showed maximum divergence from most samples

(#1%). The genetic distances amongst all the other samples of C. rufifacies were found to

be #1% as pointed out earlier (Wells and Sperling 1999, 2001). One Indian sample

DQ098935 showed a divergence of 1.3% from that of Perth, and 0.4% from those of other

Indian samples. An Indian C. megacephala sample DQ119586 showed a maximum

divergence of 1.1% from the Taiwanese sample (AY092761) (Chen et al. 2004). A similar

trend whereby the intraspecific sequence divergence rarely exceeded 1% was also

observed for C. megacephala.

It has been observed that mitochondrial haplotypes show intraspecific variations

(Wagner and Wells 2000) and geographical variations (Stevens et al. 2002). This study

brings out these variations among various geographical populations of C. rufifacies and

C. megacephala. The intraspecific genetic distances based on the small stretch of 480 bp

region of the COI gene were found to be #1% divergent for the C. rufifacies samples

across India (Table 4).

The interspecific genetic distances were found to be.3% which support the results of

many studies on Calliphoridae. The results revealed 100% bootstrap support for mtCOI

monophyly in both the species (Figure 1). In the case of C. rufifacies, the sample from

Malaysia (AY909055) (Tan et al. 2009) was placed with the Indian samples with a

bootstrap value of 73%. This suggests that Malaysian regions might perhaps make use of

these data for the identification of C. rufifacies. A mtCOI-based phylogenetic approach

appears to be valid for distinguishing C. rufifacies and C. megacephala from India. The

results conclude that the 480 bp region of mtCOI is good enough for this purpose. More

elaborate population studies are warranted to arrive at the inter- and intraspecific limits.

Acknowledgements

The authors are grateful to Dr RS Verma, then Director, for providing the facilities at CentralForensic Science Laboratory, Chandigarh. Thanks are also due to Dr JD Wells for help in themethods and phylogeny aspects; also to Dr MC Jost of Western New Mexico University forsuggestions on the manuscript.

Note

1. Present address: Department of Genetics, Maharshi Dayanand University, Rohtak 124001 India.

References

Avise JC. 1991. Ten unorthodox perspectives on evolution prompted by comparative populationgenetic finding on mitochondrial DNA. Annual Review of Genetics. 25:45–69.

Bharti M, Singh D. 2003. Insect faunal succession on decaying rabbit carcasses in Punjab, India.Journal of Forensic Science. 48(5):1133–1143.

Catts EP, Goff ML. 1992. Forensic entomology in criminal investigations. Annual Review ofEntomology. 37:253–272.

Chen WY, Hung TH, Shiao SF. 2004. Molecular identification of forensically important blow flyspecies (Diptera: Calliphoridae) in Taiwan. Journal of Medical Entomology. 41(1):47–57.

Oriental Insects 5

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015

Harvey ML, Mansell MW, Villet MH, Dadour IR. 2003. Molecular identification of someforensically important blow flies of southern Africa and Australia. Medical and VeterinaryEntomology. 17:363–369.

Sidhu IS, Singh D. 2002. Blow flies (Diptera: Calliphoridae) collected from North-western regionincluding two new records from India. Uttar Pradesh Journal of Zoology. 22(1):93–95.

Singh D, Bharti M. 2000. Forensically important blow flies (Diptera: Calliphoridae) of Punjab, India.Uttar Pradesh Journal of Zoology. 20(3):249–251.

Stevens JR, Wall R, Wells JD. 2002. Paraphyly in Hawaiian hybrid blow fly populations and theevolutionary history of anthropophilic species. Insect Molecular Biology. 11(2):141–148.

Tamura K, Dusley J, Nei M, Kumar S. 2007. MEGA4: molecular evolutionary genetic analysis(MEGA) software version 4.0. Molecular Biology and Evolution. 24:1596–1599.

Tan SH, Mohd-Aris E, Surin J, Omar B, Kurahashi H, Mohamed Z. 2009. Sequence variation in thecytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomyamegacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) inMalaysia. Tropical Biomedicine. 26(2):173–181.

Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressivemultiple sequence alignment through sequence weighting, position specific gap penalties andweight matrix choice. Nucleic Acids Research. 22:4673–4680.

Wagner DH, Wells JD. 2000. An investigation of reported regional genetic variation in theforensically important blowfly, Phormia regina, using mitochondrial DNA abstract. Proceedingof American Academy of Forensic Sciences. 6:181.

Wallman JF, Donnellan SC. 2001. The utility of mitochondrial DNA sequences for the identificationof forensically important blowflies (Diptera: Calliphoridae) in southeastern Australia. ForensicScience International. 120(1):60–67.

Wallman JF, Leys R, Hogendoorn K. 2005. Molecular systematics of Australian carrion-breedingblowflies (Diptera: Calliphoridae) based on mitochondrial DNA. Invertebrate Systematics.19:1–15.

Wells JD, Sperling FAH. 1999. Molecular phylogeny of Chrysomya albiceps and C. rufifacies(Diptera: Calliphoridae). Journal of Medical Entomology. 36:222–226.

Wells JD, Sperling FAH. 2001. DNA-based identification of forensically important Chrysomyinae(Diptera: Calliphoridae). Forensic Science International. 120:109–114.

Zhang Y, Park SH, Yu DH, Yu GY, Jung HJ, Jo TH, Hwang JJ. 2007. Identification of blow flyspecies in Korea by mitochondrial DNA ‘Barcodes’. Korean Journal of Legal Medicine.31:51–58.

6 S. Sharma and D. Singh

Dow

nloa

ded

by [

Mah

arsh

i Day

anan

d U

nive

rsity

], [

Sapn

a Sh

arm

a] a

t 00:

11 1

0 Ju

ly 2

015