mouse genetic engineering - washington university...
TRANSCRIPT
Mouse Genetic Engineering
David Ornitz Department of Developmental Biology
Novosibirsk, Russia
Time line for mouse genetic engineering
Development of chimeras between embryos with different genotypes
Genetically modified mice first derived by infecting embryos with retroviruses
First DNA injection into mouse eggs First use of the term “Transgenic”
First embryonic stem cells developed
Germline contribution of ES cells
First genetic modification of an ES cell (HPRT gene)
Improved vectors for homologous recombination
1960s
1974, 1976
1980 1981
1981
1984
1987
1987
Tarkowski, Mintz, Gardner
Jaenisch and Mintz
Gordon, Brinster, Constantini, Lacy, Wagner Martin, Evans, Kaufman
Bradley
Smithies
Thomas and Capecchi.
Time line for mouse genetic engineering - cont.
Phenotypic consequences of targeted genes
Conditional gene targeting-cre/lox
Conditional gene targeting-flip/FRT
Multiple conditional alleles, cre, flip
Somatic cloning of mice
Lentiviral vectors for transgenesis
RNAi in mice
Sleeping Beauty transposon mutagenesis
Conditional Mouse Knockout Project
Genomic editing
1990+
1992/1993
1996
1998-
1998
2002
2002
2005
2006 -
2010 -
Marth, Rajewsky
Dymecki
Martin
Wakayama et al
Lois, Baltimore
Conklin,Rosenquist
Jenkins,Copeland
EUCOMM, KOMP, IMPC
The Nobel Prize in Physiology or Medicine 2007
"for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells"
Mario R. Capecchi Sir Martin J. Evans Oliver Smithies
How do we analyze gene function in mice?
Gene addition (transgenic approach)Permits GOF, DN, and knockdown experimentsEctopic (spatial or temporal) expressionAllows gene regulatory elements to be testedAllows populations of cells to be marked with a reporter gene
Targeted mutationsSpecific genes can be targetedUnexpected phenotypes (lethal phenotype may result prior to the spatial and temporal site of interest)Must be very careful to make a null allele
Tissue-specific (conditional) targeted mutationsProvides some of the best features of gene targeting and transgenic approaches
May be combined with enhancer trap and gene trap experiments.An effective method to circumvent embryonic lethality.
How do we analyze gene function in mice?
Gene addition (transgenic approach)Permits GOF, DN, and knockdown experimentsEctopic (spatial or temporal) expressionAllows gene regulatory elements to be testedAllows populations of cells to be marked with a reporter gene
Targeted mutationsSpecific genes can be targetedUnexpected phenotypes (lethal phenotype may result prior to the spatial and temporal site of interest)Must be very careful to make a null allele
Tissue-specific (conditional) targeted mutationsProvides some of the best features of gene targeting and transgenic approaches
May be combined with enhancer trap and gene trap experiments.An effective method to circumvent embryonic lethality.
How do we analyze gene function in mice?
Gene addition (transgenic approach)Permits GOF, DN, and knockdown experimentsEctopic (spatial or temporal) expressionAllows gene regulatory elements to be testedAllows populations of cells to be marked with a reporter gene
Targeted mutationsSpecific genes can be targetedUnexpected phenotypes (lethal phenotype may result prior to the spatial and temporal site of interest)Must be very careful to make a null allele
Tissue-specific (conditional) targeted mutationsProvides some of the best features of gene targeting and transgenic approaches
May be combined with enhancer trap and gene trap experiments.An effective method to circumvent embryonic lethality.
Breeding mice gestation period-19 days
(range is 18-21 days depending on strain) age at weaning-21 dayssexual maturity-females 4-5 weeks, males-6-8 weeksbirthweight-1 gmweaning-8-12 gmadult-30-40 gm
Preimplantation mouse development
Aggregation chimerasBefore the use of microinjection aggregation chimeras were the only way to genetically modify cells and test them during mouse development
Morula aggregation, used to make chimeras between two different genetic backgrounds
ES/EC cell chimeraadd genetically modified cells to a mouse
Routes for Introducing Genes into Mice
1) Microinjection of DNA into zygotes (TALEN, CRISPR)
2) Injection of embryos with recombinant virus
3) Transfection of ES cells with cloned DNA
Transgenic Mice
Selection, Characterization
Chimera formation
Transgenic Mice: Gene addition
Random insertion of DNA into the mouse genome
Permits GOF, DN and knockdown experiments
Allows gene regulatory elements to be tested
Allows populations of cells to be marked with a reporter gene
Occasionally allows endogenous genes to be trapped
Components of a Transgene
promoter + enhancergene coding sequence or cDNApolyadenylation signal
promoter cDNA splice/poly A
Things that are good:introns
Things that are bad:plasmid sequence, lack of introns
example: Elastase Promoter
cell-type specific expression200 bp is sufficient for expression
Pr/En hGH Pr/En splice/poly Apoly A v-rascDNA
Transgenic mouse issues:Tissue specificity
ectopic expression chromosomal integration site may affect expression
Temporal specificityLevel of expressionInsertional mutagenesis
How to make a transgenic mouse1. Fusion Gene Construct 2. Superovulated Female
PromoterATG
Coding Sequence p(A)
Microinjection
3. Germline Integration
Fertilized Eggs
TRANSGENIC MOUSE
4. DNA Analysis
5. Breeding
from Manipulating the Mouse Embryoa laboratory manual, CSHL press
http://mgc.wustl.edu/
Homologous recombination using embryonic stem cells • First completely unbiased experiment of gene function in an entire mammalian organism.• Discover unanticipated early embryonic roles
Potential problems:
• Embryonic lethality • Redundancy
Events leading to the development of Embryonic Stem Cells
Teratoma
tumors composed of various tissues foreign to their site of origin.
can be formed by transplanting pieces of embryos to extra uterine sites.
Teratocarcinoma
undifferentiated malignant stem cells, metastasize, lethal
made by transplanting day 6-7 mouse embryos under the kidney capsule
resulting tumors can be passaged and cultured to yield embryonal carcinoma cells - EC cells
Embryonic Stem Cells-cont.EC cell linesvariety of stages of differentiation and variable capacity to differentiate
exponential growth and feeder cells are required to prevent differentiation
differentiation can be induced by aggregation
differentiation can be induced by drugs, RA or DMSO.
ES cells
a normal pleuripotent cell line isolated from normal embryo without passing through a tumor stage.
when reintroduced into the embryonic environment ES cells can generate high grade chimeras.
essential to grow on feeder cells (STO fibroblasts or MEFs).
LIF/DIA is required to maintain pleuripotency of ES cells.
Establishment of ES cell lines: transfer intact blastocysts into culturegrow to stage of early post implantation embryodissociate embryonic from extraembryonic tissuecontinue to culture ICM.
2 days afterdisaggregation of ICM
4 days afterdisaggregation
First passage
Chimeric mouse
ES cells derived from 129/SV strain, agouti coat colorinjected into a C57/B6 blastocyst.
Mate chimeric mouse to ‘Black mouse’ (C57/B6J)identify agouti offspring
Gene Knockout
exonexonexonexon
exonexonexonexon
critical exon
X
Gene Knockout
exonexonexonexon
exonexonexonexon
genetic engineering using embryonic stem cells
critical exon
X
Practical issues for basic gene targeting: ✴ length of homology
✴ probes to detect homologous recombination
✴ vector design (with or without negative selection)
Target gene
Targeting vector
Targeted allele
homologous recombinationTarget gene
Targeting vector
Targeted allele
random integration
Homolgous recombination vs. random integration
Issues in interpreting targeted mutationsMust be very careful to make a null allele
haplotype insufficientrecessive
Prove that an allele is nullgene expressionprotein expressionassay for activity of protein
Other types of alleleshypomorphic alleledominant negativelinked random mutation - generate multiple ES linesrecessive
Issues in interpreting targeted mutationsMust be very careful to make a null allele
haplotype insufficientrecessive
Prove that an allele is nullgene expressionprotein expressionassay for activity of protein
Other types of alleleshypomorphic alleledominant negativelinked random mutation - generate multiple ES linesrecessive
Issues in interpreting targeted mutationsMust be very careful to make a null allele
haplotype insufficientrecessive
Prove that an allele is nullgene expressionprotein expressionassay for activity of protein
Other types of alleleshypomorphic alleledominant negativelinked random mutation - generate multiple ES linesrecessive
Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I., Ornitz, D. M., Leder, P., and Deng, C. (1998). Fibroblast growth factor receptor 2 (FGFR2)-mediated regulation loop between FGF8 and FGF10 is essential for limb induction, Development 125, 753-765.
Arman, E., Haffnerkrausz, R., Chen, Y., Heath, J. K., and Lonai, P. (1998). Targeted disruption of fibroblast growth factor (Fgf) receptor 2 suggests a role for fgf signaling in pregastrulation mammalian development, Proc. Natl. Acad. Sci., U S A 95, 5082-5087.
Issues in interpreting targeted mutations - cont.Neighboring gene effect
✴ PGK promoter - neo may influence a nearby gene
✴ remove the selection cassette to avoid this potential problem
Unexpected phenotype
✴ lethal phenotype may result prior to the developmental stage of interest
Targeted allele
PGK-Neo
Olson EN, Arnold HH, Rigby PW, Wold BJ (1996) Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell 85: 1-4.
loxP loxP flox = flanked by lox
Removing the Neo selection cassette
exon
X
exonPGK-NEOexon
exonexonexonexon
genetic engineering using embryonic stem cells
Xexonexonexon
critical exon
PGK-NEO
X
loxP loxP flox = flanked by lox
Removing the Neo selection cassette
exon
X
exonPGK-NEOexon
exonexonexonexon
genetic engineering using embryonic stem cells
Xexonexonexon
critical exon
PGK-NEO
X
loxP loxP flox = flanked by lox
Removing the Neo selection cassette
exon
X
exonPGK-NEOexon
exonexonexonexon
genetic engineering using embryonic stem cells
Xexonexonexon
critical exon
germline promoter - Cre recombinase
PGK-NEO
X
loxP loxP flox = flanked by lox
Removing the Neo selection cassette
exon
X
exonPGK-NEOexon
exonexonexonexon
genetic engineering using embryonic stem cells
Xexonexonexon
critical exon
germline promoter - Cre recombinase
X
Advanced gene targeting issues
Targeting one allele versus both alleles
Gene replacement using recombinases
Knockin mice
Conditional tissue-specific targeted mutations
✴ provides some of the best features of gene targeting and transgenic approaches
✴ may be combined with enhancer trap and gene trap experiments
✴ the targeted gene can be modified using cre and flip recombinases
✴ may be used in conjunction with inducible promoters
exon
critical exon
loxP loxP flox = flanked by lox
exon
X
exonexonexon
Xexonexonexon
critical exon
Regulated activation/inactivation of a gene using CreER fusion proteins
exon
critical exon
loxP loxP flox = flanked by lox
exon
X
exonexonexon
Xexonexonexon
critical exon
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase Cytosol
exon
critical exon
loxP loxP flox = flanked by lox
exon
X
exonexonexon
Xexonexonexon
critical exon
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase
+ tamoxifennuclear translocation
Cytosol
loxP loxP flox = flanked by lox
exon
X
exonexonexon
Xexonexonexon
critical exon
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase
+ tamoxifennuclear translocation
Cytosol
EUCOMM gene targeting vector
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
EUCOMM gene targeting vector
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
Cre
null, reporter allele
EUCOMM gene targeting vector
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
Cre
null, reporter allele
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homology
Flp
conditional allele
SA-βgeo-PA PGK -neo
Criticalexon
Frt LoxP
5' homology 3' homologySA-T2A-CreER-PA
Zinc finger nucleases (ZFNs)
TAL effector nucleases (TALENs)
CRISPR/Cas9 RNA-guided nuclease (RGNs)
(RGNs)
Genomic Editing
General principle is to target a non-specific nuclease (FokI, Cas9) to a specific DNA sequence
Double stranded break will induce: • Error-prone non-homologous end-joining (NHEJ), which
leads to variable length insertion/deletion mutations (indels)
• Homology-directed repair (HDR), which can be used to introduce precise alterations directed by a homologous DNA template
Genomic Editing
Genomic Editing
Sander JD & Joung JK (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32(4):347-355.
Modular assembly of individual zinc fingers Left and Right target sequence with 5 nt spacer
Zinc finger nucleases (ZFNs)
Rémy, 2010
L
R
Nonspecific FokI nuclease domain fused to a customizable DNA-binding domain to target a single genomic locus
FokI nuclease functions as a dimer to cleave double stranded DNA - can form unwanted dimers
- off-target mutagenesis is relatively frequent
Engineered TALEN variant exhibits equal on-target cleavage activity but tenfold lower average off-target activity in human cells
TAL Effector Nucleases (TALENs)
Guilinger JP, et al. (2014) Broad specificity profiling of TALENs results in engineered nucleases with improved DNA-cleavage specificity. Nat Methods 11(4):429-435.
TAL Effector Nucleases (TALENs)
GATGCATGCACTGTAGTCACTGCA GCT…GTT
TALEN repeats (DNA binding domain)
FokI nuclease domain
FokI nuclease domain
cleavage within
spacer region
DNA target
TALEN repeats (DNA binding domain)
L
R
CRISPR/Cas9 System
CRISPR (clustered regularly interspaced short palindromic repeats)
Streptococcus pyogenes SF370 type II CRISPR locus - 4 genes: Cas9 nuclease two noncoding CRISPR RNAs (crRNAs) trans-activating crRNA (tracrRNA) precursor crRNA (pre-crRNA) array containing nuclease guide
Facilitates RNA-guided site-specific DNA cleavage
Cas9 nucleases can be directed by short guide RNAs (gRNA) to induce precise cleavage at endogenous genomic loci
Cas9 can also be converted into a nicking enzyme
Cong et al., Science 2013; Mali et al, Nature Methods 2013
Multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome
Modified version of the CRISPR-Cas9 system has been developed to recruit heterologous domains that can regulate endogenous gene expression or label specific genomic loci in living cells
Sander JD & Joung JK (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32(4):347-355.
CRISPR/Cas9 System cont.
Two components must be introduced into and/or expressed in cells or an organism to perform genome editing:
1. Cas9 nuclease 2. guide RNA (gRNA)
guide RNA: protospacer/crRNA fused to a fixed trans-activating RNA (tracrRNA)
Twenty nucleotides at the 5’ end of the gRNA direct Cas9 to a specific target DNA site using standard RNA-DNA complementarity base-pairing rules
Target sites must lie immediately 5′of a PAM sequence (protospacer adjacent motif) that matches the canonical form 5’-NGG Cas9 nuclease activity can be directed to any DNA sequence of the form N20-NGG simply by altering the first 20 nt of the gRNA to correspond to the target DNA sequence
CRISPR/Cas9 System cont.
Cas9-sgRNA targeting complexes
sgRNA (short guide RNA)
Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence 3′ of the protospacer
PAM - Protospacer-adjacent motif
Type II CRISPR specificity suggest that target sites must perfectly match the PAM sequence NGG and the 8- to 12-base “seed sequence” at the 3′ end of the gRNA.
The importance of the remaining 8 to 12 bases is less well understood and may depend on the binding strength of the matching gRNAs or on the inherent tolerance of Cas9 itself.
Mali et al, Nature Methods, 2013
Cas9-sgRNA targeting complexes sgRNA (short guide RNA)
Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence 3′ of the protospacer
Cas9 enables programmable localization of dsDNA, RNA, and proteins. Proteins can be targeted to any dsDNA sequence by simply fusing them to Cas9
PAM - Protospacer-adjacent motif
Overview of various Cas9-based applications
Sander JD & Joung JK (2014) CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32(4):347-355.
Key issues to consider with CRISPR/Cas9 genomic editing technology
Off-target modifications:
Does a given engineered nuclease act at genomic locations other than its intended site?
Critically important because unintended, off-target modifications in cell populations can lead to unexpected functional consequences in both research and therapeutic contexts
- current consensus is that the off-target mutation frequency is relatively low
Tsai SQ, Joung JK (2014) What's Changed with Genome Editing? Cell Stem Cell 15: 3-4.
Lineage tracing using inducible Cre recombinase
Estrogen regulated Cre (CreER)Tetracycline induced Cre expression (TRE-Cre)
Issues:Threshold levels of CRE required to induce recombination.Expression of Cre in multiple lineages or leaky expression.Different reporter mice vary in their sensitivity to CRE.
mTomato
before recombination
loxP loxP flox = flanked by lox
mGFPmTomatoROSA26 promoter
mGFPROSA26 promoter
Regulated activation/inactivation of a gene using CreER fusion proteins
mTomato
before recombination
loxP loxP flox = flanked by lox
mGFPmTomatoROSA26 promoter
mGFPROSA26 promoter
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase Cytosol
loxP loxP flox = flanked by lox
mGFPmTomatoROSA26 promoter
mGFPROSA26 promoter
Regulated activation/inactivation of a gene using CreER fusion proteins
tissue specific promoter -CreER
recombinase
+ tamoxifennuclear translocation
Cytosol
Lgr5-expressing cells give rise to mature taste cells
Lgr5-EGFP-IRES-creERT2, Rosa26-tdTomato
Days after a single tamoxifen induction
Yee et al. Lgr5-EGFP marks taste bud stem/progenitor cells in posterior tongue. Stem Cells. 2013; 31(5): 992-1000
Lgr5 stem/progenitor cells generate all three types of taste bud cells
Type I taste cells with NTPDase2
Type II taste receptor cells with Trpm5
Type III taste receptor cells with serotonin