molecular genetics of epilepsy and mental retardation ... · molecular genetics of epilepsy and...
TRANSCRIPT
Molecular Genetics of Epilepsy and Mental
Retardation Limited to Females (EFMR)
A thesis submitted for the degree of Doctor of Philosophy
to the University of Adelaide
By Kim Hynes
School of Molecular and Biomedical Science, Division of
Genetics, University of Adelaide
December 2009
References
References- 309
Abrahams, B. S. & Geschwind, D. H. (2008) Advances in autism genetics: on the threshold of
a new neurobiology. Nat Rev Genet, 9, 341-55.
Abranches, E., Silva, M., Pradier, L., Schulz, H., Hummel, O., Henrique, D. & Bekman, E.
(2009) Neural differentiation of embryonic stem cells in vitro: a road map to
neurogenesis in the embryo. PLoS One, 4, e6286.
Ahmed, Z. M., Riazuddin, S., Aye, S., Ali, R. A., Venselaar, H., Anwar, S., Belyantseva, P.
P., Qasim, M. & Friedman, T. B. (2008) Gene structure and mutant alleles of
PCDH15: nonsyndromic deafness DFNB23 and type 1 Usher syndrome. Hum Genet,
124, 215-23.
Ahmed, Z. M., Riazuddin, S., Bernstein, S. L., Ahmed, Z., Khan, S., Griffith, A. J., Morell, R.
J., Friedman, T. B. & Wilcox, E. R. (2001) Mutations of the protocadherin gene
PCDH15 cause Usher syndrome type 1F. Am J Hum Genet, 69, 25-34.
Alagramam, K. N., Yuan, H., Kuehn, M. H., Murcia, C. L., Wayne, S., Srisailpathy, C. R.,
Lowry, R. B., Knaus, R., Van Laer, L., Bernier, F. P., Schwartz, S., Lee, C., Morton,
C. C., Mullins, R. F., Ramesh, A., Van Camp, G., Hageman, G. S., Woychik, R. P. &
Smith, R. J. (2001) Mutations in the novel protocadherin PCDH15 cause Usher
syndrome type 1F. Hum Mol Genet, 10, 1709-18.
Amir, R. E., Van Den Veyver, I. B., Wan, M., Tran, C. Q., Francke, U. & Zoghbi, H. Y.
(1999) Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-
CpG-binding protein 2. Nat Genet, 23, 185-8.
Angst, B. D., Marcozzi, C. & Magee, A. I. (2001) The cadherin superfamily. J Cell Sci, 114,
625-6.
Annegers, J. F., Rocca, W. A. & Hauser, W. A. (1996) Causes of epilepsy: contributions of
the Rochester epidemiology project. Mayo Clin Proc, 71, 570-5.
Annesi, F., Gambardella, A., Michelucci, R., Bianchi, A., Marini, C., Canevini, M. P.,
Capovilla, G., Elia, M., Buti, D., Chifari, R., Striano, P., Rocca, F. E., Castellotti, B.,
Cali, F., Labate, A., Lepiane, E., Besana, D., Sofia, V., Tabiadon, G., Tortorella, G.,
Vigliano, P., Vignoli, A., Beccaria, F., Annesi, G., Striano, S., Aguglia, U., Guerrini,
R. & Quattrone, A. (2007) Mutational analysis of EFHC1 gene in Italian families with
juvenile myoclonic epilepsy. Epilepsia, 48, 1686-90.
Aoki, E., Kimura, R., Suzuki, S. T. & Hirano, S. (2003) Distribution of OL-protocadherin
protein in correlation with specific neural compartments and local circuits in the
postnatal mouse brain. Neuroscience, 117, 593-614.
Arnold, A. P. & Burgoyne, P. S. (2004) Are XX and XY brain cells intrinsically different?
Trends Endocrinol Metab, 15, 6-11.
Arulanandam, R., Vultur, A., Cao, J., Carefoot, E., Elliott, B. E., Truesdell, P. F., Larue, L.,
Feracci, H. & Raptis, L. (2009) Cadherin-cadherin engagement promotes cell survival
via Rac1/Cdc42 and signal transducer and activator of transcription-3. Mol Cancer
Res, 7, 1310-27.
Balabanian, K., Lagane, B., Infantino, S., Chow, K. Y., Harriague, J., Moepps, B., Arenzana-
Seisdedos, F., Thelen, M. & Bachelerie, F. (2005) The chemokine SDF-1/CXCL12
binds to and signals through the orphan receptor RDC1 in T lymphocytes. J Biol
Chem, 280, 35760-6.
Barrett, J. C., Hansoul, S., Nicolae, D. L., Cho, J. H., Duerr, R. H., Rioux, J. D., Brant, S. R.,
Silverberg, M. S., Taylor, K. D., Barmada, M. M., Bitton, A., Dassopoulos, T., Datta,
L. W., Green, T., Griffiths, A. M., Kistner, E. O., Murtha, M. T., Regueiro, M. D.,
Rotter, J. I., Schumm, L. P., Steinhart, A. H., Targan, S. R., Xavier, R. J., Libioulle,
C., Sandor, C., Lathrop, M., Belaiche, J., Dewit, O., Gut, I., Heath, S., Laukens, D.,
Mni, M., Rutgeerts, P., Van Gossum, A., Zelenika, D., Franchimont, D., Hugot, J. P.,
De Vos, M., Vermeire, S., Louis, E., Cardon, L. R., Anderson, C. A., Drummond, H.,
Nimmo, E., Ahmad, T., Prescott, N. J., Onnie, C. M., Fisher, S. A., Marchini, J.,
Ghori, J., Bumpstead, S., Gwilliam, R., Tremelling, M., Deloukas, P., Mansfield, J.,
References- 310
Jewell, D., Satsangi, J., Mathew, C. G., Parkes, M., Georges, M. & Daly, M. J. (2008)
Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's
disease. Nat Genet, 40, 955-62.
Battaglia, A. (2003) Genetics of mental retardation. Am. J. Med. Genet. C. Semin. Med. Gent.,
117C, 1-2.
Bentley, D. R., Balasubramanian, S., Swerdlow, H. P., Smith, G. P., Milton, J., Brown, C. G.,
Hall, K. P., Evers, D. J., Barnes, C. L., Bignell, H. R., Boutell, J. M., Bryant, J.,
Carter, R. J., Keira Cheetham, R., Cox, A. J., Ellis, D. J., Flatbush, M. R., Gormley, N.
A., Humphray, S. J., Irving, L. J., Karbelashvili, M. S., Kirk, S. M., Li, H., Liu, X.,
Maisinger, K. S., Murray, L. J., Obradovic, B., Ost, T., Parkinson, M. L., Pratt, M. R.,
Rasolonjatovo, I. M., Reed, M. T., Rigatti, R., Rodighiero, C., Ross, M. T., Sabot, A.,
Sankar, S. V., Scally, A., Schroth, G. P., Smith, M. E., Smith, V. P., Spiridou, A.,
Torrance, P. E., Tzonev, S. S., Vermaas, E. H., Walter, K., Wu, X., Zhang, L., Alam,
M. D., Anastasi, C., Aniebo, I. C., Bailey, D. M., Bancarz, I. R., Banerjee, S.,
Barbour, S. G., Baybayan, P. A., Benoit, V. A., Benson, K. F., Bevis, C., Black, P. J.,
Boodhun, A., Brennan, J. S., Bridgham, J. A., Brown, R. C., Brown, A. A., Buermann,
D. H., Bundu, A. A., Burrows, J. C., Carter, N. P., Castillo, N., Chiara, E. C. M.,
Chang, S., Neil Cooley, R., Crake, N. R., Dada, O. O., Diakoumakos, K. D.,
Dominguez-Fernandez, B., Earnshaw, D. J., Egbujor, U. C., Elmore, D. W., Etchin, S.
S., Ewan, M. R., Fedurco, M., Fraser, L. J., Fuentes Fajardo, K. V., Scott Furey, W.,
George, D., Gietzen, K. J., Goddard, C. P., Golda, G. S., Granieri, P. A., Green, D. E.,
Gustafson, D. L., Hansen, N. F., Harnish, K., Haudenschild, C. D., Heyer, N. I., Hims,
M. M., Ho, J. T., Horgan, A. M., et al. (2008) Accurate whole human genome
sequencing using reversible terminator chemistry. Nature, 456, 53-9.
Bijlsma, E. K., Gijsbers, A. C., Schuurs-Hoeijmakers, J. H., Van Haeringen, A., Fransen Van
De Putte, D. E., Anderlid, B. M., Lundin, J., Lapunzina, P., Perez Jurado, L. A., Delle
Chiaie, B., Loeys, B., Menten, B., Oostra, A., Verhelst, H., Amor, D. J., Bruno, D. L.,
Van Essen, A. J., Hordijk, R., Sikkema-Raddatz, B., Verbruggen, K. T., Jongmans, M.
C., Pfundt, R., Reeser, H. M., Breuning, M. H. & Ruivenkamp, C. A. (2009)
Extending the phenotype of recurrent rearrangements of 16p11.2: deletions in
mentally retarded patients without autism and in normal individuals. Eur J Med Genet,
52, 77-87.
Birgbauer, E., Cowan, C. A., Sretavan, D. W. & Henkemeyer, M. (2000) Kinase independent
function of EphB receptors in retinal axon pathfinding to the optic disc from dorsal
but not ventral retina. Development, 127, 1231-41.
Blanco, P., Sargent, C. A., Boucher, C. A., Mitchell, M. & Affara, N. A. (2000) Conservation
of PCDHX in mammals; expression of human X/Y genes predominantly in brain.
Mamm Genome, 11, 906-14.
Blank, M., Triana-Baltzer, G. B., Richards, C. S. & Berg, D. K. (2004) Alpha-protocadherins
are presynaptic and axonal in nicotinic pathways. Mol Cell Neurosci, 26, 530-43.
Boggon, T. J., Murray, J., Chappuis-Flament, S., Wong, E., Gumbiner, B. M. & Shapiro, L.
(2002) C-cadherin ectodomain structure and implications for cell adhesion
mechanisms. Science, 296, 1308-13.
Bolz, H., Ebermann, I. & Gal, A. (2005) Protocadherin-21 (PCDH21), a candidate gene for
human retinal dystrophies. Mol Vis, 11, 929-33.
Bong, Y. S., Lee, H. S., Carim-Todd, L., Mood, K., Nishanian, T. G., Tessarollo, L. & Daar,
I. O. (2007) ephrinB1 signals from the cell surface to the nucleus by recruitment of
STAT3. Proc Natl Acad Sci U S A, 104, 17305-10.
Bonn, S., Seeburg, P. H. & Schwarz, M. K. (2007) Combinatorial expression of alpha- and
gamma-protocadherins alters their presenilin-dependent processing. Mol Cell Biol, 27,
4121-32.
References- 311
Bonora, E., Lamb, J. A., Barnby, G., Sykes, N., Moberly, T., Beyer, K. S., Klauck, S. M.,
Poustka, F., Bacchelli, E., Blasi, F., Maestrini, E., Battaglia, A., Haracopos, D.,
Pedersen, L., Isager, T., Eriksen, G., Viskum, B., Sorensen, E. U., Brondum-Nielsen,
K., Cotterill, R., Engeland, H., Jonge, M., Kemner, C., Steggehuis, K., Scherpenisse,
M., Rutter, M., Bolton, P. F., Parr, J. R., Poustka, A., Bailey, A. J. & Monaco, A. P.
(2005) Mutation screening and association analysis of six candidate genes for autism
on chromosome 7q. Eur J Hum Genet, 13, 198-207.
Bouhon, I. A., Kato, H., Chandran, S. & Allen, N. D. (2005) Neural differentiation of mouse
embryonic stem cells in chemically defined medium. Brain Res Bull, 68, 62-75.
Bradley, R. S., Espeseth, A. & Kintner, C. (1998) NF-protocadherin, a novel member of the
cadherin superfamily, is required for Xenopus ectodermal differentiation. Curr Biol, 8,
325-34.
Brinkman, J. A. & El-Ashry, D. (2009) ER re-expression and re-sensitization to endocrine
therapies in ER-negative breast cancers. J Mammary Gland Biol Neoplasia, 14, 67-78.
Bruckner, K., Pasquale, E. B. & Klein, R. (1997) Tyrosine phosphorylation of transmembrane
ligands for Eph receptors. Science, 275, 1640-3.
Brunetti-Pierri, N., Berg, J. S., Scaglia, F., Belmont, J., Bacino, C. A., Sahoo, T., Lalani, S.
R., Graham, B., Lee, B., Shinawi, M., Shen, J., Kang, S. H., Pursley, A., Lotze, T.,
Kennedy, G., Lansky-Shafer, S., Weaver, C., Roeder, E. R., Grebe, T. A., Arnold, G.
L., Hutchison, T., Reimschisel, T., Amato, S., Geragthy, M. T., Innis, J. W.,
Obersztyn, E., Nowakowska, B., Rosengren, S. S., Bader, P. I., Grange, D. K., Naqvi,
S., Garnica, A. D., Bernes, S. M., Fong, C. T., Summers, A., Walters, W. D., Lupski,
J. R., Stankiewicz, P., Cheung, S. W. & Patel, A. (2008) Recurrent reciprocal 1q21.1
deletions and duplications associated with microcephaly or macrocephaly and
developmental and behavioral abnormalities. Nat Genet, 40, 1466-71.
Burns, J. M., Summers, B. C., Wang, Y., Melikian, A., Berahovich, R., Miao, Z., Penfold, M.
E., Sunshine, M. J., Littman, D. R., Kuo, C. J., Wei, K., Mcmaster, B. E., Wright, K.,
Howard, M. C. & Schall, T. J. (2006) A novel chemokine receptor for SDF-1 and I-
TAC involved in cell survival, cell adhesion, and tumor development. J Exp Med, 203,
2201-13.
Campbell, D. B., Li, C., Sutcliffe, J. S., Persico, A. M. & Levitt, P. (2008) Genetic evidence
implicating multiple genes in the MET receptor tyrosine kinase pathway in autism
spectrum disorder. Autism Res, 1, 159-68.
Campbell, D. B., Sutcliffe, J. S., Ebert, P. J., Militerni, R., Bravaccio, C., Trillo, S., Elia, M.,
Schneider, C., Melmed, R., Sacco, R., Persico, A. M. & Levitt, P. (2006) A genetic
variant that disrupts MET transcription is associated with autism. Proc Natl Acad Sci
U S A, 103, 16834-9.
Cang, J., Kaneko, M., Yamada, J., Woods, G., Stryker, M. P. & Feldheim, D. A. (2005)
Ephrin-as guide the formation of functional maps in the visual cortex. Neuron, 48,
577-89.
Cang, J., Niell, C. M., Liu, X., Pfeiffenberger, C., Feldheim, D. A. & Stryker, M. P. (2008)
Selective disruption of one Cartesian axis of cortical maps and receptive fields by
deficiency in ephrin-As and structured activity. Neuron, 57, 511-23.
Carranza, D., Dibbens, L. M., Gecz, J., Berkovic, S. F. & Scheffer, I. E. (2009) Do PCDH19
mutations cause Dravet syndrome or a 'pseudo-Dravet’ phenotype? Online comment.
12 April 2009. Sporadic Infantile Epileptic Encephalopathy Caused by Mutations in
PCDH19 Resembles Dravet Syndrome but Mainly Affects Females. Depienne et al
PLoS Genet. PLoS Genet.
Carrel, L., Cottle, A. A., Goglin, K. C. & Willard, H. F. (1999) A first-generation X-
inactivation profile of the human X chromosome. Proc Natl Acad Sci U S A, 96,
14440-4.
References- 312
Carrel, L. & Willard, H. F. (1999) Heterogeneous gene expression from the inactive X
chromosome: an X-linked gene that escapes X inactivation in some human cell lines
but is inactivated in others. Proc Natl Acad Sci U S A, 96, 7364-9.
Carter, M. S., Doskow, J., Morris, P., Li, S., Nhim, R. P., Sandstedt, S. & Wilkinson, M. F.
(1995) A regulatory mechanism that detects premature nonsense codons in T-cell
receptor transcripts in vivo is reversed by protein synthesis inhibitors in vitro. J Biol
Chem, 270, 28995-9003.
Chang, H. P., Lindberg, F. P., Wang, H. L., Huang, A. M. & Lee, E. H. (1999) Impaired
memory retention and decreased long-term potentiation in integrin-associated protein-
deficient mice. Learn Mem, 6, 448-57.
Chelly, J. & Mandel, J. L. (2001) Monogenic causes of X-linked mental retardation. Nat Rev
Genet, 2, 669-80.
Chen, X. & Gumbiner, B. M. (2006a) Crosstalk between different adhesion molecules. Curr
Opin Cell Biol, 18, 572-8.
Chen, X. & Gumbiner, B. M. (2006b) Paraxial protocadherin mediates cell sorting and tissue
morphogenesis by regulating C-cadherin adhesion activity. J Cell Biol, 174, 301-13.
Chen, X., Molino, C., Liu, L. & Gumbiner, B. M. (2007) Structural elements necessary for
oligomerization, trafficking, and cell sorting function of paraxial protocadherin. J Biol
Chem, 282, 32128-37.
Chen, Y., Lu, J., Pan, H., Zhang, Y., Wu, H., Xu, K., Liu, X., Jiang, Y., Bao, X., Yao, Z.,
Ding, K., Lo, W. H., Qiang, B., Chan, P., Shen, Y. & Wu, X. (2003) Association
between genetic variation of CACNA1H and childhood absence epilepsy. Ann Neurol,
54, 239-43.
Cheng, H. J., Nakamoto, M., Bergemann, A. D. & Flanagan, J. G. (1995) Complementary
gradients in expression and binding of ELF-1 and Mek4 in development of the
topographic retinotectal projection map. Cell, 82, 371-81.
Chien, Y. H., Jiang, N., Li, F., Zhang, F., Zhu, C. & Leckband, D. (2008) Two stage cadherin
kinetics require multiple extracellular domains but not the cytoplasmic region. J Biol
Chem, 283, 1848-56.
Chiurazzi, P., Schwartz, C. E., Gecz, J. & Neri, G. (2008) XLMR genes: update 2007. Eur J
Hum Genet, 16, 422-34.
Choi, B. G. & Mclaughlin, M. A. (2007) Why men's hearts break: cardiovascular effects of
sex steroids. Endocrinol Metab Clin North Am, 36, 365-77.
Christensen, J., Kjeldsen, M. J., Andersen, H., Friis, M. L. & Sidenius, P. (2005) Gender
differences in epilepsy. Epilepsia, 46, 956-60.
Christiansen, J., Dyck, J. D., Elyas, B. G., Lilley, M., Bamforth, J. S., Hicks, M., Sprysak, K.
A., Tomaszewski, R., Haase, S. M., Vicen-Wyhony, L. M. & Somerville, M. J. (2004)
Chromosome 1q21.1 contiguous gene deletion is associated with congenital heart
disease. Circ Res, 94, 1429-35.
Claes, L., Ceulemans, B., Audenaert, D., Smets, K., Lofgren, A., Del-Favero, J., Ala-Mello,
S., Basel-Vanagaite, L., Plecko, B., Raskin, S., Thiry, P., Wolf, N. I., Van
Broeckhoven, C. & De Jonghe, P. (2003) De novo SCN1A mutations are a major
cause of severe myoclonic epilepsy of infancy. Hum Mutat, 21, 615-21.
Clodfelter, K. H., Miles, G. D., Wauthier, V., Holloway, M. G., Zhang, X., Hodor, P., Ray,
W. J. & Waxman, D. J. (2007) Role of STAT5a in regulation of sex-specific gene
expression in female but not male mouse liver revealed by microarray analysis.
Physiol Genomics, 31, 63-74.
Compagni, A., Logan, M., Klein, R. & Adams, R. H. (2003) Control of skeletal patterning by
ephrinB1-EphB interactions. Dev Cell, 5, 217-30.
Consortium, T. I. S. (2008) Rare chromosomal deletions and duplications increase risk of
schizophrenia. Nature, 455, 237-41.
References- 313
Contributed by Melissa M. Thovin, James M. Giron & Hoffman, E. P. (2002) Current
Protocols in Human Genetics, John Wiley & Sons, Inc.
Cooper, M. A., Son, A. I., Komlos, D., Sun, Y., Kleiman, N. J. & Zhou, R. (2008) Loss of
ephrin-A5 function disrupts lens fiber cell packing and leads to cataract. Proc Natl
Acad Sci U S A, 105, 16620-5.
Cutforth, T., Moring, L., Mendelsohn, M., Nemes, A., Shah, N. M., Kim, M. M., Frisen, J. &
Axel, R. (2003) Axonal ephrin-As and odorant receptors: coordinate determination of
the olfactory sensory map. Cell, 114, 311-22.
Davy, A., Aubin, J. & Soriano, P. (2004) Ephrin-B1 forward and reverse signaling are
required during mouse development. Genes Dev, 18, 572-83.
Davy, A., Bush, J. O. & Soriano, P. (2006) Inhibition of gap junction communication at
ectopic Eph/ephrin boundaries underlies craniofrontonasal syndrome. PLoS Biol, 4,
e315.
Davy, A., Gale, N. W., Murray, E. W., Klinghoffer, R. A., Soriano, P., Feuerstein, C. &
Robbins, S. M. (1999) Compartmentalized signaling by GPI-anchored ephrin-A5
requires the Fyn tyrosine kinase to regulate cellular adhesion. Genes Dev, 13, 3125-
35.
De Brouwer, A. P., Yntema, H. G., Kleefstra, T., Lugtenberg, D., Oudakker, A. R., De Vries,
B. B., Van Bokhoven, H., Van Esch, H., Frints, S. G., Froyen, G., Fryns, J. P.,
Raynaud, M., Moizard, M. P., Ronce, N., Bensalem, A., Moraine, C., Poirier, K.,
Castelnau, L., Saillour, Y., Bienvenu, T., Beldjord, C., Des Portes, V., Chelly, J.,
Turner, G., Fullston, T., Gecz, J., Kuss, A. W., Tzschach, A., Jensen, L. R., Lenzner,
S., Kalscheuer, V. M., Ropers, H. H. & Hamel, B. C. (2007) Mutation frequencies of
X-linked mental retardation genes in families from the EuroMRX consortium. Hum
Mutat, 28, 207-8.
Depienne, C., Bouteiller, D., Keren, B., Cheuret, E., Poirier, K., Trouillard, O., Benyahia, B.,
Quelin, C., Carpentier, W., Julia, S., Afenjar, A., Gautier, A., Rivier, F., Meyer, S.,
Berquin, P., Helias, M., Py, I., Rivera, S., Bahi-Buisson, N., Gourfinkel-an, I.,
Cazeneuve, C., Ruberg, M., Brice, A., Nabbout, R. & Leguern, E. (2009a) Sporadic
infantile epileptic encephalopathy caused by mutations in PCDH19 resembles Dravet
syndrome but mainly affects females. PLoS Genet, 5, e1000381.
Depienne, C., Bouteiller, D., Keren, B., Cheuret, E., Poirier, K., Trouillard, O., Brice, A.,
Nabbout, R. & Leguern, E. (2009b) Mutations in PCDH19 (protocadherin 19) are a
frequent cause of isolated infantile epileptic encephalopathy in females The American
Society of Human Genetics, 59th Annual Meeting Honolulu, Hawaii, American
Society of Human Genetics.
Depienne, C., Trouillard, O., Saint-Martin, C., Gourfinkel-an, I., Bouteiller, D., Carpentier,
W., Keren, B., Abert, B., Gautier, A., Baulac, S., Arzimanoglou, A., Cazeneuve, C.,
Nabbout, R. & Leguern, E. (2009c) Spectrum of SCN1A gene mutations associated
with Dravet syndrome: analysis of 333 patients. J Med Genet, 46, 183-91.
Dibbens, L. M., Ekberg, J., Taylor, I., Hodgson, B. L., Conroy, S. J., Lensink, I. L., Kumar,
S., Zielinski, M. A., Harkin, L. A., Sutherland, G. R., Adams, D. J., Berkovic, S. F.,
Scheffer, I. E., Mulley, J. C. & Poronnik, P. (2007) NEDD4-2 as a potential candidate
susceptibility gene for epileptic photosensitivity. Genes Brain Behav, 6, 750-5.
Dibbens, L. M., Feng, H. J., Richards, M. C., Harkin, L. A., Hodgson, B. L., Scott, D.,
Jenkins, M., Petrou, S., Sutherland, G. R., Scheffer, I. E., Berkovic, S. F., Macdonald,
R. L. & Mulley, J. C. (2004) GABRD encoding a protein for extra- or peri-synaptic
GABAA receptors is a susceptibility locus for generalized epilepsies. Hum Mol Genet,
13, 1315-9.
Dibbens, L. M., Mullen, S., Helbig, I., Mefford, H. C., Bayly, M. A., Bellows, S., Leu, C.,
Trucks, H., Obermeier, T., Wittig, M., Franke, A., Caglayan, H., Yapici, Z., Sander,
T., Eichler, E. E., Scheffer, I. E., Mulley, J. C. & Berkovic, S. F. (2009) Familial and
References- 314
sporadic 15q13.3 microdeletions in idiopathic generalized epilepsy: precedent for
disorders with complex inheritance. Hum Mol Genet, 18, 3626-31.
Dibbens, L. M., Tarpey, P. S., Hynes, K., Bayly, M. A., Scheffer, I. E., Smith, R., Bomar, J.,
Sutton, E., Vandeleur, L., Shoubridge, C., Edkins, S., Turner, S. J., Stevens, C.,
O'meara, S., Tofts, C., Barthorpe, S., Buck, G., Cole, J., Halliday, K., Jones, D., Lee,
R., Madison, M., Mironenko, T., Varian, J., West, S., Widaa, S., Wray, P., Teague, J.,
Dicks, E., Butler, A., Menzies, A., Jenkinson, A., Shepherd, R., Gusella, J. F., Afawi,
Z., Mazarib, A., Neufeld, M. Y., Kivity, S., Lev, D., Lerman-Sagie, T., Korczyn, A.
D., Derry, C. P., Sutherland, G. R., Friend, K., Shaw, M., Corbett, M., Kim, H. G.,
Geschwind, D. H., Thomas, P., Haan, E., Ryan, S., Mckee, S., Berkovic, S. F., Futreal,
P. A., Stratton, M. R., Mulley, J. C. & Gecz, J. (2008) X-linked protocadherin 19
mutations cause female-limited epilepsy and cognitive impairment. Nat Genet, 40,
776-81.
Downs, J., Bebbington, A., Woodhead, H., Jacoby, P., Jian, L., Jefferson, A. & Leonard, H.
(2008) Early determinants of fractures in Rett syndrome. Pediatrics, 121, 540-6.
Drescher, U., Kremoser, C., Handwerker, C., Loschinger, J., Noda, M. & Bonhoeffer, F.
(1995) In vitro guidance of retinal ganglion cell axons by RAGS, a 25 kDa tectal
protein related to ligands for Eph receptor tyrosine kinases. Cell, 82, 359-70.
Dziennis, S. & Alkayed, N. J. (2008) Role of signal transducer and activator of transcription 3
in neuronal survival and regeneration. Rev Neurosci, 19, 341-61.
Dziennis, S., Jia, T., Ronnekleiv, O. K., Hurn, P. D. & Alkayed, N. J. (2007) Role of signal
transducer and activator of transcription-3 in estradiol-mediated neuroprotection. J
Neurosci, 27, 7268-74.
Emery, G. & Knoblich, J. A. (2006) Endosome dynamics during development. Curr Opin
Cell Biol, 18, 407-15.
Emond, M. R., Biswas, S. & Jontes, J. D. (2009) Protocadherin-19 is essential for early steps
in brain morphogenesis. Dev Biol.
Esumi, S., Kakazu, N., Taguchi, Y., Hirayama, T., Sasaki, A., Hirabayashi, T., Koide, T.,
Kitsukawa, T., Hamada, S. & Yagi, T. (2005) Monoallelic yet combinatorial
expression of variable exons of the protocadherin-alpha gene cluster in single neurons.
Nat Genet, 37, 171-6.
Fabisiak, K. & Erickson, R. P. (1990) A familial form of convulsive disorder with or without
mental retardation limited to females: extension of a pedigree limits possible genetic
mechanisms. Clin Genet, 38, 353-8.
Feldheim, D. A., Kim, Y. I., Bergemann, A. D., Frisen, J., Barbacid, M. & Flanagan, J. G.
(2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in
multiple aspects of retinocollicular mapping. Neuron, 25, 563-74.
Fernandez-Monreal, M., Kang, S. & Phillips, G. R. (2009) Gamma-protocadherin homophilic
interaction and intracellular trafficking is controlled by the cytoplasmic domain in
neurons. Mol Cell Neurosci, 40, 344-53.
Folstein, S. E. & Rosen-Sheidley, B. (2001) Genetics of autism: complex aetiology for a
heterogeneous disorder. Nat Rev Genet, 2, 943-55.
Foryst-Ludwig, A., Clemenz, M., Hohmann, S., Hartge, M., Sprang, C., Frost, N., Krikov,
M., Bhanot, S., Barros, R., Morani, A., Gustafsson, J. A., Unger, T. & Kintscher, U.
(2008) Metabolic actions of estrogen receptor beta (ERbeta) are mediated by a
negative cross-talk with PPARgamma. PLoS Genet, 4, e1000108.
Fotia, A. B., Ekberg, J., Adams, D. J., Cook, D. I., Poronnik, P. & Kumar, S. (2004)
Regulation of neuronal voltage-gated sodium channels by the ubiquitin-protein ligases
Nedd4 and Nedd4-2. J Biol Chem, 279, 28930-5.
Frank, M., Ebert, M., Shan, W., Phillips, G. R., Arndt, K., Colman, D. R. & Kemler, R.
(2005) Differential expression of individual gamma-protocadherins during mouse
brain development. Mol Cell Neurosci, 29, 603-16.
References- 315
Frank, M. & Kemler, R. (2002) Protocadherins. Curr Opin Cell Biol, 14, 557-62.
Freude, K., Hoffmann, K., Jensen, L. R., Delatycki, M. B., Des Portes, V., Moser, B., Hamel,
B., Van Bokhoven, H., Moraine, C., Fryns, J. P., Chelly, J., Gecz, J., Lenzner, S.,
Kalscheuer, V. M. & Ropers, H. H. (2004) Mutations in the FTSJ1 gene coding for a
novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental
retardation. Am J Hum Genet, 75, 305-9.
Frisen, J., Yates, P. A., Mclaughlin, T., Friedman, G. C., O'leary, D. D. & Barbacid, M.
(1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and
topographic mapping in the mammalian visual system. Neuron, 20, 235-43.
Gaitan, Y. & Bouchard, M. (2006) Expression of the delta-protocadherin gene Pcdh19 in the
developing mouse embryo. Gene Expr Patterns.
Gale, N. W., Holland, S. J., Valenzuela, D. M., Flenniken, A., Pan, L., Ryan, T. E.,
Henkemeyer, M., Strebhardt, K., Hirai, H., Wilkinson, D. G., Pawson, T., Davis, S. &
Yancopoulos, G. D. (1996) Eph receptors and ligands comprise two major specificity
subclasses and are reciprocally compartmentalized during embryogenesis. Neuron, 17,
9-19.
Gale, N. W. & Yancopoulos, G. D. (1997) Ephrins and their receptors: a repulsive topic? Cell
Tissue Res, 290, 227-41.
Gao, P. P., Yue, Y., Cerretti, D. P., Dreyfus, C. & Zhou, R. (1999) Ephrin-dependent growth
and pruning of hippocampal axons. Proc Natl Acad Sci U S A, 96, 4073-7.
Gao, P. P., Yue, Y., Zhang, J. H., Cerretti, D. P., Levitt, P. & Zhou, R. (1998) Regulation of
thalamic neurite outgrowth by the Eph ligand ephrin-A5: implications in the
development of thalamocortical projections. Proc Natl Acad Sci U S A, 95, 5329-34.
Gao, P. P., Zhang, J. H., Yokoyama, M., Racey, B., Dreyfus, C. F., Black, I. B. & Zhou, R.
(1996) Regulation of topographic projection in the brain: Elf-1 in the
hippocamposeptal system. Proc Natl Acad Sci U S A, 93, 11161-6.
Gecz, J., Barnett, S., Liu, J., Hollway, G., Donnelly, A., Eyre, H., Eshkevari, H. S., Baltazar,
R., Grunn, A., Nagaraja, R., Gilliam, C., Peltonen, L., Sutherland, G. R., Baron, M. &
Mulley, J. C. (1999) Characterization of the human glutamate receptor subunit 3 gene
(GRIA3), a candidate for bipolar disorder and nonspecific X-linked mental
retardation. Genomics, 62, 356-68.
Gecz, J., Cloosterman, D. & Partington, M. (2006) ARX: a gene for all seasons. Curr Opin
Genet Dev, 16, 308-16.
Gecz, J., Shoubridge, C. & Corbett, M. (2009) The genetic landscape of intellectual disability
arising from chromosome X. Trends Genet, 25, 308-16.
Geiger, B. & Ayalon, O. (1992) Cadherins. Annu Rev Cell Biol, 8, 307-32.
Giannakopoulos, X., Stagikas, D., Peschos, D., Batistatou, A. & Charalabopoulos, K. (2007)
Implication of protocadherin-PC in the progression of the advanced prostate cancer.
Exp Oncol, 29, 74-5.
Gibbons, R. J. & Higgs, D. R. (2000) Molecular-clinical spectrum of the ATR-X syndrome.
Am J Med Genet, 97, 204-12.
Green, K. J. & Gaudry, C. A. (2000) Are desmosomes more than tethers for intermediate
filaments? Nat Rev Mol Cell Biol, 1, 208-16.
Greenberg, D. A., Cayanis, E., Strug, L., Marathe, S., Durner, M., Pal, D. K., Alvin, G. B.,
Klotz, I., Dicker, E., Shinnar, S., Bromfield, E. B., Resor, S., Cohen, J., Moshe, S. L.,
Harden, C. & Kang, H. (2005) Malic enzyme 2 may underlie susceptibility to
adolescent-onset idiopathic generalized epilepsy. Am J Hum Genet, 76, 139-46.
Gregorio, S. P., Sallet, P. C., Do, K. A., Lin, E., Gattaz, W. F. & Dias-Neto, E. (2009)
Polymorphisms in genes involved in neurodevelopment may be associated with
altered brain morphology in schizophrenia: preliminary evidence. Psychiatry Res, 165,
1-9.
References- 316
Grumbach, M. M. & Auchus, R. J. (1999) Estrogen: consequences and implications of human
mutations in synthesis and action. J Clin Endocrinol Metab, 84, 4677-94.
Grutzner, E. & Gorlin, R. J. (1988) Craniofrontonasal dysplasia: phenotypic expression in
females and males and genetic considerations. Oral Surg Oral Med Oral Pathol, 65,
436-44.
Gumbiner, B. M. (1996) Cell adhesion: the molecular basis of tissue architecture and
morphogenesis. Cell, 84, 345-57.
Guo, H., Miao, H., Gerber, L., Singh, J., Denning, M. F., Gilliam, A. C. & Wang, B. (2006)
Disruption of EphA2 receptor tyrosine kinase leads to increased susceptibility to
carcinogenesis in mouse skin. Cancer Res, 66, 7050-8.
Haas, I. G., Frank, M., Veron, N. & Kemler, R. (2005) Presenilin-dependent processing and
nuclear function of gamma-protocadherins. J Biol Chem, 280, 9313-9.
Hagberg, B., Aicardi, J., Dias, K. & Ramos, O. (1983) A progressive syndrome of autism,
dementia, ataxia, and loss of purposeful hand use in girls: Rett's syndrome: report of
35 cases. Ann Neurol, 14, 471-9.
Hagler, D. J., Jr. & Goda, Y. (1998) Synaptic adhesion: the building blocks of memory?
Neuron, 20, 1059-62.
Hamada, S. & Yagi, T. (2001) The cadherin-related neuronal receptor family: a novel
diversified cadherin family at the synapse. Neurosci Res, 41, 207-15.
Hambsch, B., Grinevich, V., Seeburg, P. H. & Schwarz, M. K. (2005) {gamma}-
Protocadherins, presenilin-mediated release of C-terminal fragment promotes locus
expression. J Biol Chem, 280, 15888-97.
Harbott, L. K. & Nobes, C. D. (2005) A key role for Abl family kinases in EphA receptor-
mediated growth cone collapse. Mol Cell Neurosci, 30, 1-11.
Hardwick, S. A., Reuter, K., Williamson, S. L., Vasudevan, V., Donald, J., Slater, K.,
Bennetts, B., Bebbington, A., Leonard, H., Williams, S. R., Smith, R. L.,
Cloosterman, D. & Christodoulou, J. (2007) Delineation of large deletions of the
MECP2 gene in Rett syndrome patients, including a familial case with a male
proband. Eur J Hum Genet, 15, 1218-29.
Harkin, L. A., Mcmahon, J. M., Iona, X., Dibbens, L., Pelekanos, J. T., Zuberi, S. M., Sadleir,
L. G., Andermann, E., Gill, D., Farrell, K., Connolly, M., Stanley, T., Harbord, M.,
Andermann, F., Wang, J., Batish, S. D., Jones, J. G., Seltzer, W. K., Gardner, A.,
Sutherland, G., Berkovic, S. F., Mulley, J. C. & Scheffer, I. E. (2007) The spectrum of
SCN1A-related infantile epileptic encephalopathies. Brain, 130, 843-52.
Heggem, M. A. & Bradley, R. S. (2003) The cytoplasmic domain of Xenopus NF-
protocadherin interacts with TAF1/set. Dev Cell, 4, 419-29.
Helbig, I., Mefford, H. C., Sharp, A. J., Guipponi, M., Fichera, M., Franke, A., Muhle, H., De
Kovel, C., Baker, C., Von Spiczak, S., Kron, K. L., Steinich, I., Kleefuss-Lie, A. A.,
Leu, C., Gaus, V., Schmitz, B., Klein, K. M., Reif, P. S., Rosenow, F., Weber, Y.,
Lerche, H., Zimprich, F., Urak, L., Fuchs, K., Feucht, M., Genton, P., Thomas, P.,
Visscher, F., De Haan, G. J., Moller, R. S., Hjalgrim, H., Luciano, D., Wittig, M.,
Nothnagel, M., Elger, C. E., Nurnberg, P., Romano, C., Malafosse, A., Koeleman, B.
P., Lindhout, D., Stephani, U., Schreiber, S., Eichler, E. E. & Sander, T. (2009)
15q13.3 microdeletions increase risk of idiopathic generalized epilepsy. Nat Genet,
41, 160-2.
Helbig, I., Scheffer, I. E., Mulley, J. C. & Berkovic, S. F. (2008) Navigating the channels and
beyond: unravelling the genetics of the epilepsies. Lancet Neurol, 7, 231-45.
Helguero, L. A., Lindberg, K., Gardmo, C., Schwend, T., Gustafsson, J. A. & Haldosen, L. A.
(2008) Different roles of estrogen receptors alpha and beta in the regulation of E-
cadherin protein levels in a mouse mammary epithelial cell line. Cancer Res, 68,
8695-704.
References- 317
Heron, S. E., Khosravani, H., Varela, D., Bladen, C., Williams, T. C., Newman, M. R.,
Scheffer, I. E., Berkovic, S. F., Mulley, J. C. & Zamponi, G. W. (2007) Extended
spectrum of idiopathic generalized epilepsies associated with CACNA1H functional
variants. Ann Neurol, 62, 560-8.
Heron, S. E., Phillips, H. A., Mulley, J. C., Mazarib, A., Neufeld, M. Y., Berkovic, S. F. &
Scheffer, I. E. (2004) Genetic variation of CACNA1H in idiopathic generalized
epilepsy. Ann Neurol, 55, 595-6.
Hilschmann, N., Barnikol, H. U., Barnikol-Watanabe, S., Gotz, H., Kratzin, H. & Thinnes, F.
P. (2001) The immunoglobulin-like genetic predetermination of the brain: the
protocadherins, blueprint of the neuronal network. Naturwissenschaften, 88, 2-12.
Hilsenbeck, S. G., Friedrichs, W. E., Schiff, R., O'connell, P., Hansen, R. K., Osborne, C. K.
& Fuqua, S. A. (1999) Statistical analysis of array expression data as applied to the
problem of tamoxifen resistance. J Natl Cancer Inst, 91, 453-9.
Himanen, J. P., Chumley, M. J., Lackmann, M., Li, C., Barton, W. A., Jeffrey, P. D., Vearing,
C., Geleick, D., Feldheim, D. A., Boyd, A. W., Henkemeyer, M. & Nikolov, D. B.
(2004) Repelling class discrimination: ephrin-A5 binds to and activates EphB2
receptor signaling. Nat Neurosci, 7, 501-9.
Hindorff, L. A., Sethupathy, P., Junkins, H. A., Ramos, E. M., Mehta, J. P., Collins, F. S. &
Manolio, T. A. (2009) Potential etiologic and functional implications of genome-wide
association loci for human diseases and traits. Proc Natl Acad Sci U S A, 106, 9362-7.
Hirano, S., Yan, Q. & Suzuki, S. T. (1999) Expression of a novel protocadherin, OL-
protocadherin, in a subset of functional systems of the developing mouse brain. J
Neurosci, 19, 995-1005.
Hirayama, T. & Yagi, T. (2006) The role and expression of the protocadherin-alpha clusters
in the CNS. Curr Opin Neurobiol, 16, 336-42.
Hirose, S. & Mitsudome, A. (2003) X-linked mental retardation and epilepsy: pathogenetic
significance of ARX mutations. Brain Dev, 25, 161-5.
Hirschhorn, J. N. & Daly, M. J. (2005) Genome-wide association studies for common
diseases and complex traits. Nat Rev Genet, 6, 95-108.
Holbrook, J. A., Neu-Yilik, G., Hentze, M. W. & Kulozik, A. E. (2004) Nonsense-mediated
decay approaches the clinic. Nat Genet, 36, 801-8.
Holmberg, J., Clarke, D. L. & Frisen, J. (2000) Regulation of repulsion versus adhesion by
different splice forms of an Eph receptor. Nature, 408, 203-6.
Holthofer, B., Windoffer, R., Troyanovsky, S. & Leube, R. E. (2007) Structure and function
of desmosomes. Int Rev Cytol, 264, 65-163.
Hong, E. & Brewster, R. (2006) N-cadherin is required for the polarized cell behaviors that
drive neurulation in the zebrafish. Development, 133, 3895-905.
Huang Da, W., Sherman, B. T. & Lempicki, R. A. (2009) Systematic and integrative analysis
of large gene lists using DAVID bioinformatics resources. Nat Protoc, 4, 44-57.
Huet, G., Merot, Y., Le Dily, F., Kern, L., Ferriere, F., Saligaut, C., Boujrad, N., Pakdel, F.,
Metivier, R. & Flouriot, G. (2008) Loss of E-cadherin-mediated cell contacts reduces
estrogen receptor alpha (ER alpha) transcriptional efficiency by affecting the
respective contribution exerted by AF1 and AF2 transactivation functions. Biochem
Biophys Res Commun, 365, 304-9.
Hulpiau, P. & Van Roy, F. (2009) Molecular evolution of the cadherin superfamily. Int J
Biochem Cell Biol, 41, 349-69.
Hunter, D. J. (2005) Gene-environment interactions in human diseases. Nat Rev Genet, 6,
287-98.
Hutcheson, H. B., Olson, L. M., Bradford, Y., Folstein, S. E., Santangelo, S. L., Sutcliffe, J.
S. & Haines, J. L. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1
as autism candidate genes. BMC Med Genet, 5, 12.
References- 318
Hynes, K., Tarpey, P., Dibbens, L. M., Bayly, M. A., Berkovic, S. F., Smith, R., Al Raisi, Z.,
Turner, S. J., Brown, N. J., Desai, T. D., Haan, E., Turner, G., Christodoulou, J.,
Leonard, H., Gill, D., Stratton, M. R., Gecz, J. & Scheffer, I. E. (2009) Epilepsy and
mental retardation limited to females with PCDH19 mutations can present de novo or
in single generation families. J Med Genet.
Imoto, I., Izumi, H., Yokoi, S., Hosoda, H., Shibata, T., Hosoda, F., Ohki, M., Hirohashi, S. &
Inazawa, J. (2006) Frequent silencing of the candidate tumor suppressor PCDH20 by
epigenetic mechanism in non-small-cell lung cancers. Cancer Res, 66, 4617-26.
Inaoka, Y., Yazawa, T., Uesaka, M., Mizutani, T., Yamada, K. & Miyamoto, K. (2008)
Regulation of NGFI-B/Nur77 gene expression in the rat ovary and in leydig tumor
cells MA-10. Mol Reprod Dev, 75, 931-9.
Jallon, P., Loiseau, P. & Loiseau, J. (2001) Newly diagnosed unprovoked epileptic seizures:
presentation at diagnosis in CAROLE study. Coordination Active du Reseau
Observatoire Longitudinal de l' Epilepsie. Epilepsia, 42, 464-75.
Janis, L. S., Cassidy, R. M. & Kromer, L. F. (1999) Ephrin-A binding and EphA receptor
expression delineate the matrix compartment of the striatum. J Neurosci, 19, 4962-71.
Jellinger, K. A. (2003) Rett Syndrome -- an update. J Neural Transm, 110, 681-701.
Jensen, L. R., Amende, M., Gurok, U., Moser, B., Gimmel, V., Tzschach, A., Janecke, A. R.,
Tariverdian, G., Chelly, J., Fryns, J. P., Van Esch, H., Kleefstra, T., Hamel, B.,
Moraine, C., Gecz, J., Turner, G., Reinhardt, R., Kalscheuer, V. M., Ropers, H. H. &
Lenzner, S. (2005) Mutations in the JARID1C gene, which is involved in
transcriptional regulation and chromatin remodeling, cause X-linked mental
retardation. Am J Hum Genet, 76, 227-36.
Jiang, W. G. & Mansel, R. E. (2000) E-cadherin complex and its abnormalities in human
breast cancer. Surg Oncol, 9, 151-71.
Jobling, M. A., Lo, I. C., Turner, D. J., Bowden, G. R., Lee, A. C., Xue, Y., Carvalho-Silva,
D., Hurles, M. E., Adams, S. M., Chang, Y. M., Kraaijenbrink, T., Henke, J., Guanti,
G., Mckeown, B., Van Oorschot, R. A., Mitchell, R. J., De Knijff, P., Tyler-Smith, C.
& Parkin, E. J. (2007) Structural variation on the short arm of the human Y
chromosome: recurrent multigene deletions encompassing Amelogenin Y. Hum Mol
Genet, 16, 307-16.
Juberg, R. C. & Hellman, C. D. (1971) A new familial form of convulsive disorder and
mental retardation limited to females. J Pediatr, 79, 726-32.
Jun, G., Guo, H., Klein, B. E., Klein, R., Wang, J. J., Mitchell, P., Miao, H., Lee, K. E., Joshi,
T., Buck, M., Chugha, P., Bardenstein, D., Klein, A. P., Bailey-Wilson, J. E., Gong,
X., Spector, T. D., Andrew, T., Hammond, C. J., Elston, R. C., Iyengar, S. K. &
Wang, B. (2009) EPHA2 is associated with age-related cortical cataract in mice and
humans. PLoS Genet, 5, e1000584.
Kallen, B., Cocchi, G., Knudsen, L. B., Castilla, E. E., Robert, E., Daltveit, A. K., Lancaster,
P. L. & Mastroiacovo, P. (1994) International study of sex ratio and twinning of
neural tube defects. Teratology, 50, 322-31.
Kallenbach, S., Khantane, S., Carroll, P., Gayet, O., Alonso, S., Henderson, C. E. & Dudley,
K. (2003) Changes in subcellular distribution of protocadherin gamma proteins
accompany maturation of spinal neurons. J Neurosci Res, 72, 549-56.
Kalscheuer, V. M., Freude, K., Musante, L., Jensen, L. R., Yntema, H. G., Gecz, J., Sefiani,
A., Hoffmann, K., Moser, B., Haas, S., Gurok, U., Haesler, S., Aranda, B., Nshedjan,
A., Tzschach, A., Hartmann, N., Roloff, T. C., Shoichet, S., Hagens, O., Tao, J., Van
Bokhoven, H., Turner, G., Chelly, J., Moraine, C., Fryns, J. P., Nuber, U.,
Hoeltzenbein, M., Scharff, C., Scherthan, H., Lenzner, S., Hamel, B. C., Schweiger, S.
& Ropers, H. H. (2003a) Mutations in the polyglutamine binding protein 1 gene cause
X-linked mental retardation. Nat Genet, 35, 313-5.
References- 319
Kalscheuer, V. M., Tao, J., Donnelly, A., Hollway, G., Schwinger, E., Kubart, S., Menzel, C.,
Hoeltzenbein, M., Tommerup, N., Eyre, H., Harbord, M., Haan, E., Sutherland, G. R.,
Ropers, H. H. & Gecz, J. (2003b) Disruption of the serine/threonine kinase 9 gene
causes severe X-linked infantile spasms and mental retardation. Am J Hum Genet, 72,
1401-11.
Kaneko, R., Kato, H., Kawamura, Y., Esumi, S., Hirayama, T., Hirabayashi, T. & Yagi, T.
(2006) Allelic gene regulation of Pcdh-alpha and Pcdh-gamma clusters involving both
monoallelic and biallelic expression in single Purkinje cells. J Biol Chem, 281, 30551-
60.
Kang, K. W. & Kim, Y. G. (2008) Bioequivalence studies of tibolone in premenopausal
women and effects on expression of the tibolone-metabolizing enzyme AKR1C (aldo-
keto reductase) family caused by estradiol. J Clin Pharmacol, 48, 1430-7.
Kanthan, G. L., Wang, J. J., Rochtchina, E., Tan, A. G., Lee, A., Chia, E. M. & Mitchell, P.
(2008) Ten-year incidence of age-related cataract and cataract surgery in an older
Australian population. The Blue Mountains Eye Study. Ophthalmology, 115, 808-814
e1.
Kim, H. & Joo, C. K. (2008) The prevalence and demographic characteristics of anterior polar
cataract in a hospital-based study in Korea. Korean J Ophthalmol, 22, 77-80.
Kim, S. Y., Chung, H. S., Sun, W. & Kim, H. (2007) Spatiotemporal expression pattern of
non-clustered protocadherin family members in the developing rat brain.
Neuroscience, 147, 996-1021.
Kirov, G., Georgieva, L., Williams, N., Nikolov, I., Norton, N., Toncheva, D., O'donovan, M.
& Owen, M. J. (2003) Variation in the protocadherin gamma A gene cluster.
Genomics, 82, 433-40.
Klein, K. O., Martha, P. M., Jr., Blizzard, R. M., Herbst, T. & Rogol, A. D. (1996) A
longitudinal assessment of hormonal and physical alterations during normal puberty in
boys. II. Estrogen levels as determined by an ultrasensitive bioassay. J Clin
Endocrinol Metab, 81, 3203-7.
Klein, R. (2009) Bidirectional modulation of synaptic functions by Eph/ephrin signaling. Nat
Neurosci, 12, 15-20.
Knoll, B., Zarbalis, K., Wurst, W. & Drescher, U. (2001) A role for the EphA family in the
topographic targeting of vomeronasal axons. Development, 128, 895-906.
Kohmura, N., Senzaki, K., Hamada, S., Kai, N., Yasuda, R., Watanabe, M., Ishii, H., Yasuda,
M., Mishina, M. & Yagi, T. (1998) Diversity revealed by a novel family of cadherins
expressed in neurons at a synaptic complex. Neuron, 20, 1137-51.
Komar, C. M. (2005) Peroxisome proliferator-activated receptors (PPARs) and ovarian
function--implications for regulating steroidogenesis, differentiation, and tissue
remodeling. Reprod Biol Endocrinol, 3, 41.
Koppelman, G. H., Meyers, D. A., Howard, T. D., Zheng, S. L., Hawkins, G. A., Ampleford,
E. J., Xu, J., Koning, H., Bruinenberg, M., Nolte, I. M., Van Diemen, C. C., Boezen,
H. M., Timens, W., Whittaker, P. A., Stine, O. C., Barton, S. J., Holloway, J. W.,
Holgate, S. T., Graves, P. E., Martinez, F. D., Van Oosterhout, A., Bleecker, E. R. &
Postma, D. S. (2009) Identification of PCDH1 as a Novel Susceptibility Gene for
Bronchial Hyperresponsiveness. Am J Respir Crit Care Med.
Krishna, K. & Redies, C. (2009) Expression of cadherin superfamily genes in brain vascular
development. J Cereb Blood Flow Metab, 29, 224-9.
Kryukov, G. V., Pennacchio, L. A. & Sunyaev, S. R. (2007) Most rare missense alleles are
deleterious in humans: implications for complex disease and association studies. Am J
Hum Genet, 80, 727-39.
Kung, A. W., Chu, E. Y. & Xu, L. (2009) Bazedoxifene: a new selective estrogen receptor
modulator for the treatment of postmenopausal osteoporosis. Expert Opin
Pharmacother, 10, 1377-85.
References- 320
Kuroda, H., Inui, M., Sugimoto, K., Hayata, T. & Asashima, M. (2002) Axial protocadherin is
a mediator of prenotochord cell sorting in Xenopus. Dev Biol, 244, 267-77.
Kwan, P. & Brodie, M. J. (2000) Early identification of refractory epilepsy. N Engl J Med,
342, 314-9.
Lai, K. O., Chen, Y., Po, H. M., Lok, K. C., Gong, K. & Ip, N. Y. (2004) Identification of the
Jak/Stat proteins as novel downstream targets of EphA4 signaling in muscle:
implications in the regulation of acetylcholinesterase expression. J Biol Chem, 279,
13383-92.
Lele, Z., Folchert, A., Concha, M., Rauch, G. J., Geisler, R., Rosa, F., Wilson, S. W.,
Hammerschmidt, M. & Bally-Cuif, L. (2002) parachute/n-cadherin is required for
morphogenesis and maintained integrity of the zebrafish neural tube. Development,
129, 3281-94.
Leonard, H. & Wen, X. (2002) The epidemiology of mental retardation: challenges and
opportunities in the new millennium. Ment Retard Dev Disabil Res Rev, 8, 117-34.
Li, S. & Carmichael, S. T. (2006) Growth-associated gene and protein expression in the
region of axonal sprouting in the aged brain after stroke. Neurobiol Dis, 23, 362-73.
Lim, Y. S., Mclaughlin, T., Sung, T. C., Santiago, A., Lee, K. F. & O'leary, D. D. (2008)
p75(NTR) mediates ephrin-A reverse signaling required for axon repulsion and
mapping. Neuron, 59, 746-58.
Liu, D. P., Wang, Y., Koeffler, H. P. & Xie, D. (2007) Ephrin-A1 is a negative regulator in
glioma through down-regulation of EphA2 and FAK. Int J Oncol, 30, 865-71.
Liu, Q., Chen, Y., Kubota, F., Pan, J. J. & Murakami, T. (2009) Expression of protocadherin-
19 in the nervous system of the embryonic zebrafish. Int J Dev Biol.
Lombardi, G., Zarrilli, S., Colao, A., Paesano, L., Di Somma, C., Rossi, F. & De Rosa, M.
(2001) Estrogens and health in males. Mol Cell Endocrinol, 178, 51-5.
Lower, K. M., Turner, G., Kerr, B. A., Mathews, K. D., Shaw, M. A., Gedeon, A. K.,
Schelley, S., Hoyme, H. E., White, S. M., Delatycki, M. B., Lampe, A. K., Clayton-
Smith, J., Stewart, H., Van Ravenswaay, C. M., De Vries, B. B., Cox, B., Grompe, M.,
Ross, S., Thomas, P., Mulley, J. C. & Gecz, J. (2002) Mutations in PHF6 are
associated with Borjeson-Forssman-Lehmann syndrome. Nat Genet, 32, 661-5.
Lu, M., Miller, K. D., Gokmen-Polar, Y., Jeng, M. H. & Kinch, M. S. (2003) EphA2
overexpression decreases estrogen dependence and tamoxifen sensitivity. Cancer Res,
63, 3425-9.
Lu, Q., Sun, E. E., Klein, R. S. & Flanagan, J. G. (2001) Ephrin-B reverse signaling is
mediated by a novel PDZ-RGS protein and selectively inhibits G protein-coupled
chemoattraction. Cell, 105, 69-79.
Luckasson, R., Borthwick-Duffy, S., Buntinx, W. H. E., Coulter, D. L., Craig, E. M., Reeve,
A., Schalock, R. L., Snell, M., Spitalnik, D. M., Spreat, S. & Tasse, M. J. (2002)
Mental retardation: Definition, classification, and systems of supports (10th edition),
Washington, DC, American Association on Mental Retardation.
Macgillivray, M. H., Morishima, A., Conte, F., Grumbach, M. & Smith, E. P. (1998) Pediatric
endocrinology update: an overview. The essential roles of estrogens in pubertal
growth, epiphyseal fusion and bone turnover: lessons from mutations in the genes for
aromatase and the estrogen receptor. Horm Res, 49 Suppl 1, 2-8.
Makarenkova, H., Sugiura, H., Yamagata, K. & Owens, G. (2005) Alternatively spliced
variants of protocadherin 8 exhibit distinct patterns of expression during mouse
development. Biochim Biophys Acta, 1681, 150-6.
Maller, J., George, S., Purcell, S., Fagerness, J., Altshuler, D., Daly, M. J. & Seddon, J. M.
(2006) Common variation in three genes, including a noncoding variant in CFH,
strongly influences risk of age-related macular degeneration. Nat Genet, 38, 1055-9.
References- 321
Mann, F., Peuckert, C., Dehner, F., Zhou, R. & Bolz, J. (2002) Ephrins regulate the formation
of terminal axonal arbors during the development of thalamocortical projections.
Development, 129, 3945-55.
Manolio, T. A., Collins, F. S., Cox, N. J., Goldstein, D. B., Hindorff, L. A., Hunter, D. J.,
Mccarthy, M. I., Ramos, E. M., Cardon, L. R., Chakravarti, A., Cho, J. H.,
Guttmacher, A. E., Kong, A., Kruglyak, L., Mardis, E., Rotimi, C. N., Slatkin, M.,
Valle, D., Whittemore, A. S., Boehnke, M., Clark, A. G., Eichler, E. E., Gibson, G.,
Haines, J. L., Mackay, T. F., Mccarroll, S. A. & Visscher, P. M. (2009) Finding the
missing heritability of complex diseases. Nature, 461, 747-53.
Maquat, L. E. (2004) Nonsense-mediated mRNA decay: splicing, translation and mRNP
dynamics. Nat Rev Mol Cell Biol, 5, 89-99.
Marcus, R. C., Matthews, G. A., Gale, N. W., Yancopoulos, G. D. & Mason, C. A. (2000)
Axon guidance in the mouse optic chiasm: retinal neurite inhibition by ephrin "A"-
expressing hypothalamic cells in vitro. Dev Biol, 221, 132-47.
Marini, C., Mei, D., Temudo, T., Ferrari, A. R., Buti, D., Dravet, C., Dias, A. I., Moreira, A.,
Calado, E., Seri, S., Neville, B., Narbona, J., Reid, E., Michelucci, R., Sicca, F., Cross,
H. J. & Guerrini, R. (2007) Idiopathic epilepsies with seizures precipitated by fever
and SCN1A abnormalities. Epilepsia, 48, 1678-85.
Marini, C., Scheffer, I. E., Crossland, K. M., Grinton, B. E., Phillips, F. L., Mcmahon, J. M.,
Turner, S. J., Dean, J. T., Kivity, S., Mazarib, A., Neufeld, M. Y., Korczyn, A. D.,
Harkin, L. A., Dibbens, L. M., Wallace, R. H., Mulley, J. C. & Berkovic, S. F. (2004)
Genetic architecture of idiopathic generalized epilepsy: clinical genetic analysis of 55
multiplex families. Epilepsia, 45, 467-78.
Marquardt, T., Shirasaki, R., Ghosh, S., Andrews, S. E., Carter, N., Hunter, T. & Pfaff, S. L.
(2005) Coexpressed EphA receptors and ephrin-A ligands mediate opposing actions
on growth cone navigation from distinct membrane domains. Cell, 121, 127-39.
Marrs, J. A. & Nelson, W. J. (1996) Cadherin cell adhesion molecules in differentiation and
embryogenesis. Int Rev Cytol, 165, 159-205.
Marshall, C. R., Noor, A., Vincent, J. B., Lionel, A. C., Feuk, L., Skaug, J., Shago, M.,
Moessner, R., Pinto, D., Ren, Y., Thiruvahindrapduram, B., Fiebig, A., Schreiber, S.,
Friedman, J., Ketelaars, C. E., Vos, Y. J., Ficicioglu, C., Kirkpatrick, S., Nicolson, R.,
Sloman, L., Summers, A., Gibbons, C. A., Teebi, A., Chitayat, D., Weksberg, R.,
Thompson, A., Vardy, C., Crosbie, V., Luscombe, S., Baatjes, R., Zwaigenbaum, L.,
Roberts, W., Fernandez, B., Szatmari, P. & Scherer, S. W. (2008) Structural variation
of chromosomes in autism spectrum disorder. Am J Hum Genet, 82, 477-88.
Mateus, A. R., Simoes-Correia, J., Figueiredo, J., Heindl, S., Castro Alves, C., Suriano, G.,
Luber, B. & Seruca, R. (2009) E-cadherin mutations and cell motility: A genotype-
phenotype correlation. Exp Cell Res.
Matsushita, M., Yamadori, T., Kato, S., Takemoto, Y., Inazawa, J., Baba, Y., Hashimoto, S.,
Sekine, S., Arai, S., Kunikata, T., Kurimoto, M., Kishimoto, T. & Tsukada, S. (1998)
Identification and characterization of a novel SH3-domain binding protein, Sab, which
preferentially associates with Bruton's tyrosine kinase (BtK). Biochem Biophys Res
Commun, 245, 337-43.
Mccarthy, S. E., Makarov, V., Kirov, G., Addington, A. M., Mcclellan, J., Yoon, S., Perkins,
D. O., Dickel, D. E., Kusenda, M., Krastoshevsky, O., Krause, V., Kumar, R. A.,
Grozeva, D., Malhotra, D., Walsh, T., Zackai, E. H., Kaplan, P., Ganesh, J., Krantz, I.
D., Spinner, N. B., Roccanova, P., Bhandari, A., Pavon, K., Lakshmi, B., Leotta, A.,
Kendall, J., Lee, Y. H., Vacic, V., Gary, S., Iakoucheva, L. M., Crow, T. J., Christian,
S. L., Lieberman, J. A., Stroup, T. S., Lehtimaki, T., Puura, K., Haldeman-Englert, C.,
Pearl, J., Goodell, M., Willour, V. L., Derosse, P., Steele, J., Kassem, L., Wolff, J.,
Chitkara, N., Mcmahon, F. J., Malhotra, A. K., Potash, J. B., Schulze, T. G., Nothen,
M. M., Cichon, S., Rietschel, M., Leibenluft, E., Kustanovich, V., Lajonchere, C. M.,
References- 322
Sutcliffe, J. S., Skuse, D., Gill, M., Gallagher, L., Mendell, N. R., Craddock, N.,
Owen, M. J., O'donovan, M. C., Shaikh, T. H., Susser, E., Delisi, L. E., Sullivan, P. F.,
Deutsch, C. K., Rapoport, J., Levy, D. L., King, M. C. & Sebat, J. (2009)
Microduplications of 16p11.2 are associated with schizophrenia. Nat Genet, 41, 1223-
7.
Medina, A., Swain, R. K., Kuerner, K. M. & Steinbeisser, H. (2004) Xenopus paraxial
protocadherin has signaling functions and is involved in tissue separation. Embo J, 23,
3249-58.
Mefford, H. C. & Eichler, E. E. (2009) Duplication hotspots, rare genomic disorders, and
common disease. Curr Opin Genet Dev, 19, 196-204.
Mefford, H. C., Sharp, A. J., Baker, C., Itsara, A., Jiang, Z., Buysse, K., Huang, S., Maloney,
V. K., Crolla, J. A., Baralle, D., Collins, A., Mercer, C., Norga, K., De Ravel, T.,
Devriendt, K., Bongers, E. M., De Leeuw, N., Reardon, W., Gimelli, S., Bena, F.,
Hennekam, R. C., Male, A., Gaunt, L., Clayton-Smith, J., Simonic, I., Park, S. M.,
Mehta, S. G., Nik-Zainal, S., Woods, C. G., Firth, H. V., Parkin, G., Fichera, M.,
Reitano, S., Lo Giudice, M., Li, K. E., Casuga, I., Broomer, A., Conrad, B.,
Schwerzmann, M., Raber, L., Gallati, S., Striano, P., Coppola, A., Tolmie, J. L.,
Tobias, E. S., Lilley, C., Armengol, L., Spysschaert, Y., Verloo, P., De Coene, A.,
Goossens, L., Mortier, G., Speleman, F., Van Binsbergen, E., Nelen, M. R.,
Hochstenbach, R., Poot, M., Gallagher, L., Gill, M., Mcclellan, J., King, M. C.,
Regan, R., Skinner, C., Stevenson, R. E., Antonarakis, S. E., Chen, C., Estivill, X.,
Menten, B., Gimelli, G., Gribble, S., Schwartz, S., Sutcliffe, J. S., Walsh, T., Knight,
S. J., Sebat, J., Romano, C., Schwartz, C. E., Veltman, J. A., De Vries, B. B.,
Vermeesch, J. R., Barber, J. C., Willatt, L., Tassabehji, M. & Eichler, E. E. (2008)
Recurrent rearrangements of chromosome 1q21.1 and variable pediatric phenotypes. N
Engl J Med, 359, 1685-99.
Mei, R., Galipeau, P. C., Prass, C., Berno, A., Ghandour, G., Patil, N., Wolff, R. K., Chee, M.
S., Reid, B. J. & Lockhart, D. J. (2000) Genome-wide detection of allelic imbalance
using human SNPs and high-density DNA arrays. Genome Res, 10, 1126-37.
Mendes, S. W., Henkemeyer, M. & Liebl, D. J. (2006) Multiple Eph receptors and B-class
ephrins regulate midline crossing of corpus callosum fibers in the developing mouse
forebrain. J Neurosci, 26, 882-92.
Merienne, K., Jacquot, S., Pannetier, S., Zeniou, M., Bankier, A., Gecz, J., Mandel, J. L.,
Mulley, J., Sassone-Corsi, P. & Hanauer, A. (1999) A missense mutation in RPS6KA3
(RSK2) responsible for non-specific mental retardation. Nat Genet, 22, 13-4.
Miao, H., Strebhardt, K., Pasquale, E. B., Shen, T. L., Guan, J. L. & Wang, B. (2005)
Inhibition of integrin-mediated cell adhesion but not directional cell migration
requires catalytic activity of EphB3 receptor tyrosine kinase. Role of Rho family small
GTPases. J Biol Chem, 280, 923-32.
Miao, H. & Wang, B. (2009) Eph/ephrin signaling in epithelial development and homeostasis.
Int J Biochem Cell Biol, 41, 762-70.
Miao, H., Wei, B. R., Peehl, D. M., Li, Q., Alexandrou, T., Schelling, J. R., Rhim, J. S.,
Sedor, J. R., Burnett, E. & Wang, B. (2001) Activation of EphA receptor tyrosine
kinase inhibits the Ras/MAPK pathway. Nat Cell Biol, 3, 527-30.
Miller, D. T., Shen, Y., Weiss, L. A., Korn, J., Anselm, I., Bridgemohan, C., Cox, G. F.,
Dickinson, H., Gentile, J., Harris, D. J., Hegde, V., Hundley, R., Khwaja, O., Kothare,
S., Luedke, C., Nasir, R., Poduri, A., Prasad, K., Raffalli, P., Reinhard, A., Smith, S.
E., Sobeih, M. M., Soul, J. S., Stoler, J., Takeoka, M., Tan, W. H., Thakuria, J., Wolff,
R., Yusupov, R., Gusella, J. F., Daly, M. J. & Wu, B. L. (2009)
Microdeletion/duplication at 15q13.2q13.3 among individuals with features of autism
and other neuropsychiatric disorders. J Med Genet, 46, 242-8.
References- 323
Miyashita, M., Ohnishi, H., Okazawa, H., Tomonaga, H., Hayashi, A., Fujimoto, T. T.,
Furuya, N. & Matozaki, T. (2004) Promotion of neurite and filopodium formation by
CD47: roles of integrins, Rac, and Cdc42. Mol Biol Cell, 15, 3950-63.
Monks, D. A., Getsios, S., Maccalman, C. D. & Watson, N. V. (2001a) N-cadherin is
regulated by gonadal steroids in adult sexually dimorphic spinal motoneurons. J
Neurobiol, 47, 255-64.
Monks, D. A., Getsios, S., Maccalman, C. D. & Watson, N. V. (2001b) N-cadherin is
regulated by gonadal steroids in the adult hippocampus. Proc Natl Acad Sci U S A, 98,
1312-6.
Morishita, H., Kawaguchi, M., Murata, Y., Seiwa, C., Hamada, S., Asou, H. & Yagi, T.
(2004a) Myelination triggers local loss of axonal CNR/protocadherin alpha family
protein expression. Eur J Neurosci, 20, 2843-7.
Morishita, H., Murata, Y., Esumi, S., Hamada, S. & Yagi, T. (2004b) CNR/Pcdhalpha family
in subplate neurons, and developing cortical connectivity. Neuroreport, 15, 2595-9.
Morishita, H., Umitsu, M., Murata, Y., Shibata, N., Udaka, K., Higuchi, Y., Akutsu, H.,
Yamaguchi, T., Yagi, T. & Ikegami, T. (2006) Structure of the cadherin-related
neuronal receptor/protocadherin-alpha first extracellular cadherin domain reveals
diversity across cadherin families. J Biol Chem, 281, 33650-63.
Morishita, H. & Yagi, T. (2007) Protocadherin family: diversity, structure, and function. Curr
Opin Cell Biol, 19, 584-92.
Morrow, E. M., Yoo, S. Y., Flavell, S. W., Kim, T. K., Lin, Y., Hill, R. S., Mukaddes, N. M.,
Balkhy, S., Gascon, G., Hashmi, A., Al-Saad, S., Ware, J., Joseph, R. M., Greenblatt,
R., Gleason, D., Ertelt, J. A., Apse, K. A., Bodell, A., Partlow, J. N., Barry, B., Yao,
H., Markianos, K., Ferland, R. J., Greenberg, M. E. & Walsh, C. A. (2008) Identifying
autism loci and genes by tracing recent shared ancestry. Science, 321, 218-23.
Motegi, S., Okazawa, H., Ohnishi, H., Sato, R., Kaneko, Y., Kobayashi, H., Tomizawa, K.,
Ito, T., Honma, N., Buhring, H. J., Ishikawa, O. & Matozaki, T. (2003) Role of the
CD47-SHPS-1 system in regulation of cell migration. EMBO J, 22, 2634-44.
Muller, K., Hirano, S., Puelles, L. & Redies, C. (2004) OL-protocadherin expression in the
visual system of the chicken embryo. J Comp Neurol, 470, 240-55.
Mulley, J. C. & Dibbens, L. M. (2009) Chipping away at the common epilepsies with
complex genetics: the 15q13.3 microdeletion shows the way. Genome Med, 1, 33.
Mulley, J. C., Kerr, B., Stevenson, R. & Lubs, H. (1992) Nomenclature guidelines for X-
linked mental retardation. Am J Med Genet, 43, 383-91.
Mulley, J. C., Scheffer, I. E., Harkin, L. A., Berkovic, S. F. & Dibbens, L. M. (2005)
Susceptibility genes for complex epilepsy. Hum Mol Genet, 14 Spec No. 2, R243-9.
Murakami, T., Hijikata, T., Matsukawa, M., Ishikawa, H. & Yorifuji, H. (2006) Zebrafish
protocadherin 10 is involved in paraxial mesoderm development and somitogenesis.
Dev Dyn, 235, 506-14.
Mutoh, T., Hamada, S., Senzaki, K., Murata, Y. & Yagi, T. (2004) Cadherin-related neuronal
receptor 1 (CNR1) has cell adhesion activity with beta1 integrin mediated through the
RGD site of CNR1. Exp Cell Res, 294, 494-508.
Nagai, Y., Sano, H. & Yokoi, M. (2005) Transgenic expression of Cre recombinase in
mitral/tufted cells of the olfactory bulb. Genesis, 43, 12-6.
Nakajima, D., Nakayama, M., Kikuno, R., Hirosawa, M., Nagase, T. & Ohara, O. (2001)
Identification of three novel non-classical cadherin genes through comprehensive
analysis of large cDNAs. Brain Res Mol Brain Res, 94, 85-95.
Nakamura, Y., Hornsby, P. J., Casson, P., Morimoto, R., Satoh, F., Xing, Y., Kennedy, M. R.,
Sasano, H. & Rainey, W. E. (2009) Type 5 17beta-hydroxysteroid dehydrogenase
(AKR1C3) contributes to testosterone production in the adrenal reticularis. J Clin
Endocrinol Metab, 94, 2192-8.
References- 324
Narayan, G., Scotto, L., Neelakantan, V., Kottoor, S. H., Wong, A. H., Loke, S. L.,
Mansukhani, M., Pothuri, B., Wright, J. D., Kaufmann, A. M., Schneider, A., Arias-
Pulido, H., Tao, Q. & Murty, V. V. (2009) Protocadherin PCDH10, involved in tumor
progression, is a frequent and early target of promoter hypermethylation in cervical
cancer. Genes Chromosomes Cancer, 48, 983-992.
Narayanan, C. S., Cui, Y., Zhao, Y. Y., Zhou, J. & Kumar, A. (1999) Orphan receptor Arp-1
binds to the nucleotide sequence located between TATA box and transcriptional
initiation site of the human angiotensinogen gene and reduces estrogen induced
promoter activity. Mol Cell Endocrinol, 148, 79-86.
Ng, S. B., Buckingham, K. J., Lee, C., Bigham, A. W., Tabor, H. K., Dent, K. M., Huff, C.
D., Shannon, P. T., Jabs, E. W., Nickerson, D. A., Shendure, J. & Bamshad, M. J.
(2009) Exome sequencing identifies the cause of a mendelian disorder. Nat Genet.
Nollet, F., Kools, P. & Van Roy, F. (2000) Phylogenetic analysis of the cadherin superfamily
allows identification of six major subfamilies besides several solitary members. J Mol
Biol, 299, 551-72.
Noren, N. K., Foos, G., Hauser, C. A. & Pasquale, E. B. (2006) The EphB4 receptor
suppresses breast cancer cell tumorigenicity through an Abl-Crk pathway. Nat Cell
Biol, 8, 815-25.
Nose, A., Nagafuchi, A. & Takeichi, M. (1988) Expressed recombinant cadherins mediate
cell sorting in model systems. Cell, 54, 993-1001.
Nuclear Receptors Nomenclature Committee (1999) A unified nomenclature system for the
nuclear receptor superfamily. Cell, 97, 161-3.
Obata, S., Sago, H., Mori, N., Davidson, M., St John, T. & Suzuki, S. T. (1998) A common
protocadherin tail: multiple protocadherins share the same sequence in their
cytoplasmic domains and are expressed in different regions of brain. Cell Adhes
Commun, 6, 323-33.
Obata, S., Sago, H., Mori, N., Rochelle, J. M., Seldin, M. F., Davidson, M., St John, T.,
Taketani, S. & Suzuki, S. T. (1995) Protocadherin Pcdh2 shows properties similar to,
but distinct from, those of classical cadherins. J Cell Sci, 108 ( Pt 12), 3765-73.
Ober, C., Loisel, D. A. & Gilad, Y. (2008) Sex-specific genetic architecture of human disease.
Nat Rev Genet, 9, 911-22.
Ogiue-Ikeda, M., Tanabe, N., Mukai, H., Hojo, Y., Murakami, G., Tsurugizawa, T., Takata,
N., Kimoto, T. & Kawato, S. (2008) Rapid modulation of synaptic plasticity by
estrogens as well as endocrine disrupters in hippocampal neurons. Brain Res Rev, 57,
363-75.
Orsulic, S. & Kemler, R. (2000) Expression of Eph receptors and ephrins is differentially
regulated by E-cadherin. J Cell Sci, 113 ( Pt 10), 1793-802.
Ose, R., Yanagawa, T., Ikeda, S., Ohara, O. & Koga, H. (2009) PCDH24-induced contact
inhibition involves downregulation of beta-catenin signaling. Mol Oncol, 3, 54-66.
Pagnamenta, A. T., Wing, K., Akha, E. S., Knight, S. J., Bolte, S., Schmotzer, G., Duketis, E.,
Poustka, F., Klauck, S. M., Poustka, A., Ragoussis, J., Bailey, A. J. & Monaco, A. P.
(2009) A 15q13.3 microdeletion segregating with autism. Eur J Hum Genet, 17, 687-
92.
Pal, D. K., Evgrafov, O. V., Tabares, P., Zhang, F., Durner, M. & Greenberg, D. A. (2003)
BRD2 (RING3) is a probable major susceptibility gene for common juvenile
myoclonic epilepsy. Am J Hum Genet, 73, 261-70.
Park, S. H., Cheung, L. W., Wong, A. S. & Leung, P. C. (2008) Estrogen regulates Snail and
Slug in the down-regulation of E-cadherin and induces metastatic potential of ovarian
cancer cells through estrogen receptor alpha. Mol Endocrinol, 22, 2085-98.
Pasquale, E. B. (2005) Eph receptor signalling casts a wide net on cell behaviour. Nat Rev
Mol Cell Biol, 6, 462-75.
References- 325
Pasquale, E. B. (2008) Eph-ephrin bidirectional signaling in physiology and disease. Cell,
133, 38-52.
Patel, S. D., Ciatto, C., Chen, C. P., Bahna, F., Rajebhosale, M., Arkus, N., Schieren, I.,
Jessell, T. M., Honig, B., Price, S. R. & Shapiro, L. (2006) Type II cadherin
ectodomain structures: implications for classical cadherin specificity. Cell, 124, 1255-
68.
Pennanen, P. T., Sarvilinna, N. S., Purmonen, S. R. & Ylikomi, T. J. (2009) Changes in
protein tyrosine phosphatase type IVA member 1 and zinc finger protein 36 C3H type-
like 1 expression demonstrate altered estrogen and progestin effect in
medroxyprogesterone acetate-resistant and estrogen-independent breast cancer cell
models. Steroids, 74, 404-9.
Penning, T. M., Burczynski, M. E., Jez, J. M., Hung, C. F., Lin, H. K., Ma, H., Moore, M.,
Palackal, N. & Ratnam, K. (2000) Human 3alpha-hydroxysteroid dehydrogenase
isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional
plasticity and tissue distribution reveals roles in the inactivation and formation of male
and female sex hormones. Biochem J, 351, 67-77.
Penning, T. M. & Byrns, M. C. (2009) Steroid hormone transforming aldo-keto reductases
and cancer. Ann N Y Acad Sci, 1155, 33-42.
Pereira, F. A., Tsai, M. J. & Tsai, S. Y. (2000) COUP-TF orphan nuclear receptors in
development and differentiation. Cell Mol Life Sci, 57, 1388-98.
Peuckert, C., Wacker, E., Rapus, J., Levitt, P. & Bolz, J. (2008) Adaptive changes in gene
expression patterns in the somatosensory cortex after deletion of ephrinA5. Mol Cell
Neurosci, 39, 21-31.
Phillips, G. R., Tanaka, H., Frank, M., Elste, A., Fidler, L., Benson, D. L. & Colman, D. R.
(2003) Gamma-protocadherins are targeted to subsets of synapses and intracellular
organelles in neurons. J Neurosci, 23, 5096-104.
Pollack, J. R., Perou, C. M., Alizadeh, A. A., Eisen, M. B., Pergamenschikov, A., Williams,
C. F., Jeffrey, S. S., Botstein, D. & Brown, P. O. (1999) Genome-wide analysis of
DNA copy-number changes using cDNA microarrays. Nat Genet, 23, 41-6.
Ponnio, T. & Conneely, O. M. (2004) nor-1 regulates hippocampal axon guidance, pyramidal
cell survival, and seizure susceptibility. Mol Cell Biol, 24, 9070-8.
Postma, D. S. (2007) Gender differences in asthma development and progression. Gend Med,
4 Suppl B, S133-46.
Prevost, N., Woulfe, D. S., Jiang, H., Stalker, T. J., Marchese, P., Ruggeri, Z. M. & Brass, L.
F. (2005) Eph kinases and ephrins support thrombus growth and stability by regulating
integrin outside-in signaling in platelets. Proc Natl Acad Sci U S A, 102, 9820-5.
Rampon, C., Bouillot, S., Climescu-Haulica, A., Prandini, M. H., Cand, F., Vandenbrouck, Y.
& Huber, P. (2008) Protocadherin 12 deficiency alters morphogenesis and
transcriptional profile of the placenta. Physiol Genomics, 34, 193-204.
Rashid, T., Upton, A. L., Blentic, A., Ciossek, T., Knoll, B., Thompson, I. D. & Drescher, U.
(2005) Opposing gradients of ephrin-As and EphA7 in the superior colliculus are
essential for topographic mapping in the mammalian visual system. Neuron, 47, 57-
69.
Rauch, A., Hoyer, J., Guth, S., Zweier, C., Kraus, C., Becker, C., Zenker, M., Huffmeier, U.,
Thiel, C., Ruschendorf, F., Nurnberg, P., Reis, A. & Trautmann, U. (2006) Diagnostic
yield of various genetic approaches in patients with unexplained developmental delay
or mental retardation. Am J Med Genet A, 140, 2063-74.
Redies, C. (2000) Cadherins in the central nervous system. Prog Neurobiol, 61, 611-48.
Redies, C., Vanhalst, K. & Roy, F. (2005) delta-Protocadherins: unique structures and
functions. Cell Mol Life Sci, 62, 2840-52.
Reid, C. A., Berkovic, S. F. & Petrou, S. (2009) Mechanisms of human inherited epilepsies.
Prog Neurobiol, 87, 41-57.
References- 326
Reinius, B., Saetre, P., Leonard, J. A., Blekhman, R., Merino-Martinez, R., Gilad, Y. & Jazin,
E. (2008) An evolutionarily conserved sexual signature in the primate brain. PLoS
Genet, 4, e1000100.
Reiss, K., Maretzky, T., Haas, I. G., Schulte, M., Ludwig, A., Frank, M. & Saftig, P. (2006)
Regulated ADAM10-dependent ectodomain shedding of gamma-protocadherin C3
modulates cell-cell adhesion. J Biol Chem, 281, 21735-44.
Reversade, B., Escande-Beillard, N., Dimopoulou, A., Fischer, B., Chng, S. C., Li, Y.,
Shboul, M., Tham, P. Y., Kayserili, H., Al-Gazali, L., Shahwan, M., Brancati, F., Lee,
H., O'connor, B. D., Schmidt-Von Kegler, M., Merriman, B., Nelson, S. F., Masri, A.,
Alkazaleh, F., Guerra, D., Ferrari, P., Nanda, A., Rajab, A., Markie, D., Gray, M.,
Nelson, J., Grix, A., Sommer, A., Savarirayan, R., Janecke, A. R., Steichen, E.,
Sillence, D., Hausser, I., Budde, B., Nurnberg, G., Nurnberg, P., Seemann, P., Kunkel,
D., Zambruno, G., Dallapiccola, B., Schuelke, M., Robertson, S., Hamamy, H.,
Wollnik, B., Van Maldergem, L., Mundlos, S. & Kornak, U. (2009) Mutations in
PYCR1 cause cutis laxa with progeroid features. Nat Genet, 41, 1016-21.
Ropers, H. H. (2008) Genetics of intellectual disability. Curr Opin Genet Dev, 18, 241-50.
Ropers, H. H. & Hamel, B. C. (2005) X-linked mental retardation. Nat Rev Genet, 6, 46-57.
Ropers, H. H., Hoeltzenbein, M., Kalscheuer, V., Yntema, H., Hamel, B., Fryns, J. P., Chelly,
J., Partington, M., Gecz, J. & Moraine, C. (2003) Nonsyndromic X-linked mental
retardation: where are the missing mutations? Trends Genet, 19, 316-20.
Ryan, S. G., Chance, P. F., Zou, C. H., Spinner, N. B., Golden, J. A. & Smietana, S. (1997)
Epilepsy and mental retardation limited to females: an X-linked dominant disorder
with male sparing. Nat Genet, 17, 92-5.
Sago, H., Kitagawa, M., Obata, S., Mori, N., Taketani, S., Rochelle, J. M., Seldin, M. F.,
Davidson, M., St John, T. & Suzuki, S. T. (1995) Cloning, expression, and
chromosomal localization of a novel cadherin-related protein, protocadherin-3.
Genomics, 29, 631-40.
Salvador-Carulla, L. & Bertelli, M. (2008) 'Mental retardation' or 'intellectual disability': time
for a conceptual change. Psychopathology, 41, 10-6.
Salvucci, O., De La Luz Sierra, M., Martina, J. A., Mccormick, P. J. & Tosato, G. (2006)
EphB2 and EphB4 receptors forward signaling promotes SDF-1-induced endothelial
cell chemotaxis and branching remodeling. Blood, 108, 2914-22.
Sano, K., Tanihara, H., Heimark, R. L., Obata, S., Davidson, M., St John, T., Taketani, S. &
Suzuki, S. (1993) Protocadherins: a large family of cadherin-related molecules in
central nervous system. Embo J, 12, 2249-56.
Santos, S. J., Haslam, S. Z. & Conrad, S. E. (2008) Estrogen and progesterone are critical
regulators of Stat5a expression in the mouse mammary gland. Endocrinology, 149,
329-38.
Scala, E., Ariani, F., Mari, F., Caselli, R., Pescucci, C., Longo, I., Meloni, I., Giachino, D.,
Bruttini, M., Hayek, G., Zappella, M. & Renieri, A. (2005) CDKL5/STK9 is mutated
in Rett syndrome variant with infantile spasms. J Med Genet, 42, 103-7.
Scheffer, I. E., Turner, S. J., Dibbens, L. M., Bayly, M. A., Friend, K., Hodgson, B., Burrows,
L., Shaw, M., Wei, C., Ullmann, R., Ropers, H. H., Szepetowski, P., Haan, E.,
Mazarib, A., Afawi, Z., Neufeld, M. Y., Andrews, P. I., Wallace, G., Kivity, S., Lev,
D., Lerman-Sagie, T., Derry, C. P., Korczyn, A. D., Gecz, J., Mulley, J. C. &
Berkovic, S. F. (2008) Epilepsy and mental retardation limited to females: an under-
recognized disorder. Brain, 131, 918-27.
Scheffer, I. E., Zhang, Y. H., Jansen, F. E. & Dibbens, L. (2009) Dravet syndrome or genetic
(generalized) epilepsy with febrile seizures plus? Brain Dev, 31, 394-400.
Schwarz, J. M. & Mccarthy, M. M. (2008) Cellular mechanisms of estradiol-mediated
masculinization of the brain. J Steroid Biochem Mol Biol, 109, 300-6.
References- 327
Sebat, J., Lakshmi, B., Malhotra, D., Troge, J., Lese-Martin, C., Walsh, T., Yamrom, B.,
Yoon, S., Krasnitz, A., Kendall, J., Leotta, A., Pai, D., Zhang, R., Lee, Y. H., Hicks,
J., Spence, S. J., Lee, A. T., Puura, K., Lehtimaki, T., Ledbetter, D., Gregersen, P. K.,
Bregman, J., Sutcliffe, J. S., Jobanputra, V., Chung, W., Warburton, D., King, M. C.,
Skuse, D., Geschwind, D. H., Gilliam, T. C., Ye, K. & Wigler, M. (2007) Strong
association of de novo copy number mutations with autism. Science, 316, 445-9.
Semela, D., Das, A., Langer, D., Kang, N., Leof, E. & Shah, V. (2008) Platelet-derived
growth factor signaling through ephrin-b2 regulates hepatic vascular structure and
function. Gastroenterology, 135, 671-9.
Sengupta, S. & Jordan, V. C. (2008) Selective estrogen modulators as an anticancer tool:
mechanisms of efficiency and resistance. Adv Exp Med Biol, 630, 206-19.
Shapiro, L. & Colman, D. R. (1999) The diversity of cadherins and implications for a
synaptic adhesive code in the CNS. Neuron, 23, 427-30.
Sharp, A. J. (2009) Emerging themes and new challenges in defining the role of structural
variation in human disease. Hum Mutat, 30, 135-44.
Sharp, A. J., Hansen, S., Selzer, R. R., Cheng, Z., Regan, R., Hurst, J. A., Stewart, H., Price,
S. M., Blair, E., Hennekam, R. C., Fitzpatrick, C. A., Segraves, R., Richmond, T. A.,
Guiver, C., Albertson, D. G., Pinkel, D., Eis, P. S., Schwartz, S., Knight, S. J. &
Eichler, E. E. (2006) Discovery of previously unidentified genomic disorders from the
duplication architecture of the human genome. Nat Genet, 38, 1038-42.
Sharp, A. J., Mefford, H. C., Li, K., Baker, C., Skinner, C., Stevenson, R. E., Schroer, R. J.,
Novara, F., De Gregori, M., Ciccone, R., Broomer, A., Casuga, I., Wang, Y., Xiao, C.,
Barbacioru, C., Gimelli, G., Bernardina, B. D., Torniero, C., Giorda, R., Regan, R.,
Murday, V., Mansour, S., Fichera, M., Castiglia, L., Failla, P., Ventura, M., Jiang, Z.,
Cooper, G. M., Knight, S. J., Romano, C., Zuffardi, O., Chen, C., Schwartz, C. E. &
Eichler, E. E. (2008) A recurrent 15q13.3 microdeletion syndrome associated with
mental retardation and seizures. Nat Genet, 40, 322-8.
Sherman, B. T., Huang Da, W., Tan, Q., Guo, Y., Bour, S., Liu, D., Stephens, R., Baseler, M.
W., Lane, H. C. & Lempicki, R. A. (2007) DAVID Knowledgebase: a gene-centered
database integrating heterogeneous gene annotation resources to facilitate high-
throughput gene functional analysis. BMC Bioinformatics, 8, 426.
Shevell, M., Ashwal, S., Donley, D., Flint, J., Gingold, M., Hirtz, D., Majnemer, A., Noetzel,
M. & Sheth, R. D. (2003) Practice parameter: evaluation of the child with global
developmental delay: report of the Quality Standards Subcommittee of the American
Academy of Neurology and The Practice Committee of the Child Neurology Society.
Neurology, 60, 367-80.
Shiels, A., Bennett, T. M., Knopf, H. L., Maraini, G., Li, A., Jiao, X. & Hejtmancik, J. F.
(2008) The EPHA2 gene is associated with cataracts linked to chromosome 1p. Mol
Vis, 14, 2042-55.
Shinawi, M., Liu, P., Kang, S. H., Shen, J., Belmont, J. W., Scott, D. A., Probst, F. J.,
Craigen, W. J., Graham, B., Pursley, A., Clark, G., Lee, J., Proud, M., Stocco, A.,
Rodriguez, D., Kozel, B., Sparagana, S., Roeder, E., Mcgrew, S., Kurczynski, T.,
Allison, L., Amato, S., Savage, S., Patel, A., Stankiewicz, P., Beaudet, A., Cheung, S.
W. & Lupski, J. R. (2009a) Recurrent reciprocal 16p11.2 rearrangements associated
with global developmental delay, behavioral problems, dysmorphism, epilepsy, and
abnormal head size. J Med Genet.
Shinawi, M., Schaaf, C. P., Bhatt, S. S., Xia, Z., Patel, A., Cheung, S. W., Lanpher, B., Nagl,
S., Herding, H. S., Nevinny-Stickel, C., Immken, L. L., Patel, G. S., German, J. R.,
Beaudet, A. L. & Stankiewicz, P. (2009b) A small recurrent deletion within 15q13.3 is
associated with a range of neurodevelopmental phenotypes. Nat Genet.
Shoichet, S. A., Hoffmann, K., Menzel, C., Trautmann, U., Moser, B., Hoeltzenbein, M.,
Echenne, B., Partington, M., Van Bokhoven, H., Moraine, C., Fryns, J. P., Chelly, J.,
References- 328
Rott, H. D., Ropers, H. H. & Kalscheuer, V. M. (2003) Mutations in the ZNF41 gene
are associated with cognitive deficits: identification of a new candidate for X-linked
mental retardation. Am J Hum Genet, 73, 1341-54.
Simons, K. & Toomre, D. (2000) Lipid rafts and signal transduction. Nat Rev Mol Cell Biol,
1, 31-9.
Singh, N. A., Pappas, C., Dahle, E. J., Claes, L. R., Pruess, T. H., De Jonghe, P., Thompson,
J., Dixon, M., Gurnett, C., Peiffer, A., White, H. S., Filloux, F. & Leppert, M. F.
(2009) A role of SCN9A in human epilepsies, as a cause of febrile seizures and as a
potential modifier of Dravet syndrome. PLoS Genet, 5, e1000649.
Song, K. H., Park, J. I., Lee, M. O., Soh, J., Lee, K. & Choi, H. S. (2001) LH induces orphan
nuclear receptor Nur77 gene expression in testicular Leydig cells. Endocrinology, 142,
5116-23.
Stefansson, H., Rujescu, D., Cichon, S., Pietilainen, O. P., Ingason, A., Steinberg, S., Fossdal,
R., Sigurdsson, E., Sigmundsson, T., Buizer-Voskamp, J. E., Hansen, T., Jakobsen, K.
D., Muglia, P., Francks, C., Matthews, P. M., Gylfason, A., Halldorsson, B. V.,
Gudbjartsson, D., Thorgeirsson, T. E., Sigurdsson, A., Jonasdottir, A., Bjornsson, A.,
Mattiasdottir, S., Blondal, T., Haraldsson, M., Magnusdottir, B. B., Giegling, I.,
Moller, H. J., Hartmann, A., Shianna, K. V., Ge, D., Need, A. C., Crombie, C., Fraser,
G., Walker, N., Lonnqvist, J., Suvisaari, J., Tuulio-Henriksson, A., Paunio, T.,
Toulopoulou, T., Bramon, E., Di Forti, M., Murray, R., Ruggeri, M., Vassos, E.,
Tosato, S., Walshe, M., Li, T., Vasilescu, C., Muhleisen, T. W., Wang, A. G., Ullum,
H., Djurovic, S., Melle, I., Olesen, J., Kiemeney, L. A., Franke, B., Sabatti, C.,
Freimer, N. B., Gulcher, J. R., Thorsteinsdottir, U., Kong, A., Andreassen, O. A.,
Ophoff, R. A., Georgi, A., Rietschel, M., Werge, T., Petursson, H., Goldstein, D. B.,
Nothen, M. M., Peltonen, L., Collier, D. A., St Clair, D. & Stefansson, K. (2008)
Large recurrent microdeletions associated with schizophrenia. Nature, 455, 232-6.
Steinlein, O. K., Mulley, J. C., Propping, P., Wallace, R. H., Phillips, H. A., Sutherland, G.
R., Scheffer, I. E. & Berkovic, S. F. (1995) A missense mutation in the neuronal
nicotinic acetylcholine receptor alpha 4 subunit is associated with autosomal dominant
nocturnal frontal lobe epilepsy. Nat Genet, 11, 201-3.
Stogmann, E., Lichtner, P., Baumgartner, C., Bonelli, S., Assem-Hilger, E., Leutmezer, F.,
Schmied, M., Hotzy, C., Strom, T. M., Meitinger, T., Zimprich, F. & Zimprich, A.
(2006) Idiopathic generalized epilepsy phenotypes associated with different EFHC1
mutations. Neurology, 67, 2029-31.
Stromme, P., Mangelsdorf, M. E., Scheffer, I. E. & Gecz, J. (2002) Infantile spasms, dystonia,
and other X-linked phenotypes caused by mutations in Aristaless related homeobox
gene, ARX. Brain Dev, 24, 266-8.
Sugino, H., Hamada, S., Yasuda, R., Tuji, A., Matsuda, Y., Fujita, M. & Yagi, T. (2000)
Genomic organization of the family of CNR cadherin genes in mice and humans.
Genomics, 63, 75-87.
Suzuki, S. T. (1996) Protocadherins and diversity of the cadherin superfamily. J Cell Sci, 109
( Pt 11), 2609-11.
Suzuki, S. T. (2000) Recent progress in protocadherin research. Exp Cell Res, 261, 13-8.
Suzuki, T., Delgado-Escueta, A. V., Aguan, K., Alonso, M. E., Shi, J., Hara, Y., Nishida, M.,
Numata, T., Medina, M. T., Takeuchi, T., Morita, R., Bai, D., Ganesh, S., Sugimoto,
Y., Inazawa, J., Bailey, J. N., Ochoa, A., Jara-Prado, A., Rasmussen, A., Ramos-Peek,
J., Cordova, S., Rubio-Donnadieu, F., Inoue, Y., Osawa, M., Kaneko, S., Oguni, H.,
Mori, Y. & Yamakawa, K. (2004) Mutations in EFHC1 cause juvenile myoclonic
epilepsy. Nat Genet, 36, 842-9.
Takeichi, M. (1990) Cadherins: a molecular family important in selective cell-cell adhesion.
Annu Rev Biochem, 59, 237-52.
References- 329
Takeichi, M. (1991) Cadherin cell adhesion receptors as a morphogenetic regulator. Science,
251, 1451-5.
Takeichi, M. (1995) Morphogenetic roles of classic cadherins. Curr Opin Cell Biol, 7, 619-
27.
Tamura, K., Shan, W. S., Hendrickson, W. A., Colman, D. R. & Shapiro, L. (1998) Structure-
function analysis of cell adhesion by neural (N-) cadherin. Neuron, 20, 1153-63.
Tanaka, H., Shan, W., Phillips, G. R., Arndt, K., Bozdagi, O., Shapiro, L., Huntley, G. W.,
Benson, D. L. & Colman, D. R. (2000) Molecular modification of N-cadherin in
response to synaptic activity. Neuron, 25, 93-107.
Tao, J., Van Esch, H., Hagedorn-Greiwe, M., Hoffmann, K., Moser, B., Raynaud, M.,
Sperner, J., Fryns, J. P., Schwinger, E., Gecz, J., Ropers, H. H. & Kalscheuer, V. M.
(2004) Mutations in the X-linked cyclin-dependent kinase-like 5 (CDKL5/STK9) gene
are associated with severe neurodevelopmental retardation. Am J Hum Genet, 75,
1149-54.
Tarpey, P., Parnau, J., Blow, M., Woffendin, H., Bignell, G., Cox, C., Cox, J., Davies, H.,
Edkins, S., Holden, S., Korny, A., Mallya, U., Moon, J., O'meara, S., Parker, A.,
Stephens, P., Stevens, C., Teague, J., Donnelly, A., Mangelsdorf, M., Mulley, J.,
Partington, M., Turner, G., Stevenson, R., Schwartz, C., Young, I., Easton, D.,
Bobrow, M., Futreal, P. A., Stratton, M. R., Gecz, J., Wooster, R. & Raymond, F. L.
(2004) Mutations in the DLG3 gene cause nonsyndromic X-linked mental retardation.
Am J Hum Genet, 75, 318-24.
Tarpey, P. S., Smith, R., Pleasance, E., Whibley, A., Edkins, S., Hardy, C., O'meara, S.,
Latimer, C., Dicks, E., Menzies, A., Stephens, P., Blow, M., Greenman, C., Xue, Y.,
Tyler-Smith, C., Thompson, D., Gray, K., Andrews, J., Barthorpe, S., Buck, G., Cole,
J., Dunmore, R., Jones, D., Maddison, M., Mironenko, T., Turner, R., Turrell, K.,
Varian, J., West, S., Widaa, S., Wray, P., Teague, J., Butler, A., Jenkinson, A., Jia, M.,
Richardson, D., Shepherd, R., Wooster, R., Tejada, M. I., Martinez, F., Carvill, G.,
Goliath, R., De Brouwer, A. P., Van Bokhoven, H., Van Esch, H., Chelly, J.,
Raynaud, M., Ropers, H. H., Abidi, F. E., Srivastava, A. K., Cox, J., Luo, Y., Mallya,
U., Moon, J., Parnau, J., Mohammed, S., Tolmie, J. L., Shoubridge, C., Corbett, M.,
Gardner, A., Haan, E., Rujirabanjerd, S., Shaw, M., Vandeleur, L., Fullston, T.,
Easton, D. F., Boyle, J., Partington, M., Hackett, A., Field, M., Skinner, C., Stevenson,
R. E., Bobrow, M., Turner, G., Schwartz, C. E., Gecz, J., Raymond, F. L., Futreal, P.
A. & Stratton, M. R. (2009) A systematic, large-scale resequencing screen of X-
chromosome coding exons in mental retardation. Nat Genet, 41, 535-43.
Tasic, B., Nabholz, C. E., Baldwin, K. K., Kim, Y., Rueckert, E. H., Ribich, S. A., Cramer,
P., Wu, Q., Axel, R. & Maniatis, T. (2002) Promoter choice determines splice site
selection in protocadherin alpha and gamma pre-mRNA splicing. Mol Cell, 10, 21-33.
Terry, S., Queires, L., Gil-Diez-De-Medina, S., Chen, M. W., De La Taille, A., Allory, Y.,
Tran, P. L., Abbou, C. C., Buttyan, R. & Vacherot, F. (2006) Protocadherin-PC
promotes androgen-independent prostate cancer cell growth. Prostate, 66, 1100-13.
Toniolo, D. (2000) In search of the MRX genes. Am J Med Genet, 97, 221-7.
Trivier, E., De Cesare, D., Jacquot, S., Pannetier, S., Zackai, E., Young, I., Mandel, J. L.,
Sassone-Corsi, P. & Hanauer, A. (1996) Mutations in the kinase Rsk-2 associated with
Coffin-Lowry syndrome. Nature, 384, 567-70.
Tsui, L. C., Buchwald, M., Barker, D., Braman, J. C., Knowlton, R., Schumm, J. W., Eiberg,
H., Mohr, J., Kennedy, D., Plavsic, N. & Et Al. (1985) Cystic fibrosis locus defined
by a genetically linked polymorphic DNA marker. Science, 230, 1054-7.
Tsuiji, H., Xu, L., Schwartz, K. & Gumbiner, B. M. (2007) Cadherin conformations
associated with dimerization and adhesion. J Biol Chem, 282, 12871-82.
Turner, G. (1996) Finding genes on the X chromosome by which homo may have become
sapiens. Am J Hum Genet, 58, 1109-10.
References- 330
Twigg, S. R., Kan, R., Babbs, C., Bochukova, E. G., Robertson, S. P., Wall, S. A., Morriss-
Kay, G. M. & Wilkie, A. O. (2004) Mutations of ephrin-B1 (EFNB1), a marker of
tissue boundary formation, cause craniofrontonasal syndrome. Proc Natl Acad Sci U S
A, 101, 8652-7.
Twigg, S. R., Matsumoto, K., Kidd, A. M., Goriely, A., Taylor, I. B., Fisher, R. B.,
Hoogeboom, A. J., Mathijssen, I. M., Lourenco, M. T., Morton, J. E., Sweeney, E.,
Wilson, L. C., Brunner, H. G., Mulliken, J. B., Wall, S. A. & Wilkie, A. O. (2006) The
origin of EFNB1 mutations in craniofrontonasal syndrome: frequent somatic
mosaicism and explanation of the paucity of carrier males. Am J Hum Genet, 78, 999-
1010.
Uemura, T. (1998) The cadherin superfamily at the synapse: more members, more missions.
Cell, 93, 1095-8.
Unterseher, F., Hefele, J. A., Giehl, K., De Robertis, E. M., Wedlich, D. & Schambony, A.
(2004) Paraxial protocadherin coordinates cell polarity during convergent extension
via Rho A and JNK. Embo J, 23, 3259-69.
Vagnerova, K., Koerner, I. P. & Hurn, P. D. (2008) Gender and the injured brain. Anesth
Analg, 107, 201-14.
Van Blarikom, W., Tan, I. Y., Aldenkamp, A. P. & Van Gennep, A. T. (2006) Epilepsy,
intellectual disability, and living environment: a critical review. Epilepsy Behav, 9, 14-
8.
Van Bon, B. W., Mefford, H. C., Menten, B., Koolen, D. A., Sharp, A. J., Nillesen, W. M.,
Innis, J. W., De Ravel, T. J., Mercer, C. L., Fichera, M., Stewart, H., Connell, L. E.,
Ounap, K., Lachlan, K., Castle, B., Van Der Aa, N., Van Ravenswaaij, C., Nobrega,
M. A., Serra-Juhe, C., Simonic, I., De Leeuw, N., Pfundt, R., Bongers, E. M., Baker,
C., Finnemore, P., Huang, S., Maloney, V. K., Crolla, J. A., Van Kalmthout, M., Elia,
M., Vandeweyer, G., Fryns, J. P., Janssens, S., Foulds, N., Reitano, S., Smith, K.,
Parkel, S., Loeys, B., Woods, C. G., Oostra, A., Speleman, F., Pereira, A. C., Kurg,
A., Willatt, L., Knight, S. J., Vermeesch, J. R., Romano, C., Barber, J. C., Mortier, G.,
Perez-Jurado, L. A., Kooy, F., Brunner, H. G., Eichler, E. E., Kleefstra, T. & De
Vries, B. B. (2009) Further delineation of the 15q13 microdeletion and duplication
syndromes: a clinical spectrum varying from non-pathogenic to a severe outcome. J
Med Genet, 46, 511-23.
Van Karnebeek, C., Atkins, P., Du Souich, C., Rupps, R., Woodward, T., Demos, M. &
Boerkoel, C. (2009) Dysfunctional Estrogen Signaling: A Novel Cause of Intellectual
Disability. The American Society of Human Genetics, 59th Annual Meeting Honolulu,
Hawaii, American Society of Human Genetics.
Vanhalst, K., Kools, P., Staes, K., Van Roy, F. & Redies, C. (2005) delta-Protocadherins: a
gene family expressed differentially in the mouse brain. Cell Mol Life Sci, 62, 1247-
59.
Vasconcelos, M. M. (2004) [Mental retardation]. J Pediatr (Rio J), 80, S71-82.
Visscher, P. M. (2008) Sizing up human height variation. Nat Genet, 40, 489-90.
Vissers, L. E., De Vries, B. B., Osoegawa, K., Janssen, I. M., Feuth, T., Choy, C. O.,
Straatman, H., Van Der Vliet, W., Huys, E. H., Van Rijk, A., Smeets, D., Van
Ravenswaaij-Arts, C. M., Knoers, N. V., Van Der Burgt, I., De Jong, P. J., Brunner,
H. G., Van Kessel, A. G., Schoenmakers, E. F. & Veltman, J. A. (2003) Array-based
comparative genomic hybridization for the genomewide detection of submicroscopic
chromosomal abnormalities. Am J Hum Genet, 73, 1261-70.
Waha, A., Guntner, S., Huang, T. H., Yan, P. S., Arslan, B., Pietsch, T. & Wiestler, O. D.
(2005) Epigenetic silencing of the protocadherin family member PCDH-gamma-A11
in astrocytomas. Neoplasia, 7, 193-9.
Wallis, D., Lacbawan, F., Jain, M., Der Kaloustian, V. M., Steiner, C. E., Moeschler, J. B.,
Losken, H. W., Kaitila, Ii, Cantrell, S., Proud, V. K., Carey, J. C., Day, D. W., Lev,
References- 331
D., Teebi, A. S., Robinson, L. K., Hoyme, H. E., Al-Torki, N., Siegel-Bartelt, J.,
Mulliken, J. B., Robin, N. H., Saavedra, D., Zackai, E. H. & Muenke, M. (2008)
Additional EFNB1 mutations in craniofrontonasal syndrome. Am J Med Genet A,
146A, 2008-12.
Wang, J., Shiozawa, Y., Wang, Y., Jung, Y., Pienta, K. J., Mehra, R., Loberg, R. &
Taichman, R. S. (2008a) The role of CXCR7/RDC1 as a chemokine receptor for
CXCL12/SDF-1 in prostate cancer. J Biol Chem, 283, 4283-94.
Wang, J., Wang, W., Li, R., Li, Y., Tian, G., Goodman, L., Fan, W., Zhang, J., Li, J., Guo, Y.,
Feng, B., Li, H., Lu, Y., Fang, X., Liang, H., Du, Z., Li, D., Zhao, Y., Hu, Y., Yang,
Z., Zheng, H., Hellmann, I., Inouye, M., Pool, J., Yi, X., Zhao, J., Duan, J., Zhou, Y.,
Qin, J., Ma, L., Li, G., Zhang, G., Yang, B., Yu, C., Liang, F., Li, W., Li, S., Ni, P.,
Ruan, J., Li, Q., Zhu, H., Liu, D., Lu, Z., Li, N., Guo, G., Ye, J., Fang, L., Hao, Q.,
Chen, Q., Liang, Y., Su, Y., San, A., Ping, C., Yang, S., Chen, F., Li, L., Zhou, K.,
Ren, Y., Yang, L., Gao, Y., Yang, G., Li, Z., Feng, X., Kristiansen, K., Wong, G. K.,
Nielsen, R., Durbin, R., Bolund, L., Zhang, X. & Yang, H. (2008b) The diploid
genome sequence of an Asian individual. Nature, 456, 60-5.
Wang, L., Andersson, S., Warner, M. & Gustafsson, J. A. (2001) Morphological
abnormalities in the brains of estrogen receptor beta knockout mice. Proc Natl Acad
Sci U S A, 98, 2792-6.
Wang, X., Su, H. & Bradley, A. (2002a) Molecular mechanisms governing Pcdh-gamma gene
expression: evidence for a multiple promoter and cis-alternative splicing model. Genes
Dev, 16, 1890-905.
Wang, X., Weiner, J. A., Levi, S., Craig, A. M., Bradley, A. & Sanes, J. R. (2002b) Gamma
protocadherins are required for survival of spinal interneurons. Neuron, 36, 843-54.
Weaving, L. S., Christodoulou, J., Williamson, S. L., Friend, K. L., Mckenzie, O. L., Archer,
H., Evans, J., Clarke, A., Pelka, G. J., Tam, P. P., Watson, C., Lahooti, H., Ellaway, C.
J., Bennetts, B., Leonard, H. & Gecz, J. (2004) Mutations of CDKL5 cause a severe
neurodevelopmental disorder with infantile spasms and mental retardation. Am J Hum
Genet, 75, 1079-93.
Weaving, L. S., Williamson, S. L., Bennetts, B., Davis, M., Ellaway, C. J., Leonard, H.,
Thong, M. K., Delatycki, M., Thompson, E. M., Laing, N. & Christodoulou, J. (2003)
Effects of MECP2 mutation type, location and X-inactivation in modulating Rett
syndrome phenotype. Am J Med Genet A, 118, 103-14.
Weber, Y. G. & Lerche, H. (2008) Genetic mechanisms in idiopathic epilepsies. Dev Med
Child Neurol, 50, 648-54.
Weinl, C., Drescher, U., Lang, S., Bonhoeffer, F. & Loschinger, J. (2003) On the turning of
Xenopus retinal axons induced by ephrin-A5. Development, 130, 1635-43.
Wheeler, D. A., Srinivasan, M., Egholm, M., Shen, Y., Chen, L., Mcguire, A., He, W., Chen,
Y. J., Makhijani, V., Roth, G. T., Gomes, X., Tartaro, K., Niazi, F., Turcotte, C. L.,
Irzyk, G. P., Lupski, J. R., Chinault, C., Song, X. Z., Liu, Y., Yuan, Y., Nazareth, L.,
Qin, X., Muzny, D. M., Margulies, M., Weinstock, G. M., Gibbs, R. A. & Rothberg, J.
M. (2008) The complete genome of an individual by massively parallel DNA
sequencing. Nature, 452, 872-6.
Wheelock, M. J. & Johnson, K. R. (2003) Cadherins as modulators of cellular phenotype.
Annu Rev Cell Dev Biol, 19, 207-35.
Who (1996) ICD-10 Guide For Mental Retardation Word Health Organisation 10th Edition.
Wieacker, P. & Wieland, I. (2005) Clinical and genetic aspects of craniofrontonasal
syndrome: towards resolving a genetic paradox. Mol Genet Metab, 86, 110-6.
Wieland, I., Jakubiczka, S., Muschke, P., Cohen, M., Thiele, H., Gerlach, K. L., Adams, R. H.
& Wieacker, P. (2004) Mutations of the ephrin-B1 gene cause craniofrontonasal
syndrome. Am J Hum Genet, 74, 1209-15.
References- 332
Wieland, I., Jakubiczka, S., Muschke, P., Wolf, A., Gerlach, L., Krawczak, M. & Wieacker,
P. (2002) Mapping of a further locus for X-linked craniofrontonasal syndrome.
Cytogenet Genome Res, 99, 285-8.
Willecke, M., Hamaratoglu, F., Kango-Singh, M., Udan, R., Chen, C. L., Tao, C., Zhang, X.
& Halder, G. (2006) The fat cadherin acts through the hippo tumor-suppressor
pathway to regulate tissue size. Curr Biol, 16, 2090-100.
Willemsen, R., Oostra, B. A., Bassell, G. J. & Dictenberg, J. (2004) The fragile X syndrome:
from molecular genetics to neurobiology. Ment Retard Dev Disabil Res Rev, 10, 60-7.
Williams, S. E., Mann, F., Erskine, L., Sakurai, T., Wei, S., Rossi, D. J., Gale, N. W., Holt, C.
E., Mason, C. A. & Henkemeyer, M. (2003) Ephrin-B2 and EphB1 mediate retinal
axon divergence at the optic chiasm. Neuron, 39, 919-35.
Wolverton, T. & Lalande, M. (2001) Identification and characterization of three members of a
novel subclass of protocadherins. Genomics, 76, 66-72.
Wu, Q. & Maniatis, T. (1999) A striking organization of a large family of human neural
cadherin-like cell adhesion genes. Cell, 97, 779-90.
Wu, Q. & Maniatis, T. (2000) Large exons encoding multiple ectodomains are a characteristic
feature of protocadherin genes. Proc Natl Acad Sci U S A, 97, 3124-9.
Wu, Q., Zhang, T., Cheng, J. F., Kim, Y., Grimwood, J., Schmutz, J., Dickson, M., Noonan,
J. P., Zhang, M. Q., Myers, R. M. & Maniatis, T. (2001) Comparative DNA sequence
analysis of mouse and human protocadherin gene clusters. Genome Res, 11, 389-404.
Yagi, T. (2003) Diversity of the cadherin-related neuronal receptor/protocadherin family and
possible DNA rearrangement in the brain. Genes Cells, 8, 1-8.
Yagi, T. & Takeichi, M. (2000) Cadherin superfamily genes: functions, genomic
organization, and neurologic diversity. Genes Dev, 14, 1169-80.
Yamagata, K., Andreasson, K. I., Sugiura, H., Maru, E., Dominique, M., Irie, Y., Miki, N.,
Hayashi, Y., Yoshioka, M., Kaneko, K., Kato, H. & Worley, P. F. (1999) Arcadlin is a
neural activity-regulated cadherin involved in long term potentiation. J Biol Chem,
274, 19473-1979.
Yamamoto, A., Kemp, C., Bachiller, D., Geissert, D. & De Robertis, E. M. (2000) Mouse
paraxial protocadherin is expressed in trunk mesoderm and is not essential for mouse
development. Genesis, 27, 49-57.
Yang, X., Chen, M. W., Terry, S., Vacherot, F., Chopin, D. K., Bemis, D. L., Kitajewski, J.,
Benson, M. C., Guo, Y. & Buttyan, R. (2005) A human- and male-specific
protocadherin that acts through the wnt signaling pathway to induce neuroendocrine
transdifferentiation of prostate cancer cells. Cancer Res, 65, 5263-71.
Yang, X., Schadt, E. E., Wang, S., Wang, H., Arnold, A. P., Ingram-Drake, L., Drake, T. A.
& Lusis, A. J. (2006) Tissue-specific expression and regulation of sexually dimorphic
genes in mice. Genome Res, 16, 995-1004.
Yap, A. S., Brieher, W. M. & Gumbiner, B. M. (1997) Molecular and functional analysis of
cadherin-based adherens junctions. Annu Rev Cell Dev Biol, 13, 119-46.
Yasuda, S., Tanaka, H., Sugiura, H., Okamura, K., Sakaguchi, T., Tran, U., Takemiya, T.,
Mizoguchi, A., Yagita, Y., Sakurai, T., De Robertis, E. M. & Yamagata, K. (2007)
Activity-induced protocadherin arcadlin regulates dendritic spine number by
triggering N-cadherin endocytosis via TAO2beta and p38 MAP kinases. Neuron, 56,
456-71.
Ying, Q. L., Stavridis, M., Griffiths, D., Li, M. & Smith, A. (2003) Conversion of embryonic
stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol,
21, 183-6.
Yoshida, K. (2003) Fibroblast cell shape and adhesion in vitro is altered by overexpression of
the 7a and 7b isoforms of protocadherin 7, but not the 7c isoform. Cell Mol Biol Lett,
8, 735-41.
References- 333
Yoshida, K. & Sugano, S. (1999) Identification of a novel protocadherin gene (PCDH11) on
the human XY homology region in Xq21.3. Genomics, 62, 540-3.
Yoshida, K., Watanabe, M., Kato, H., Dutta, A. & Sugano, S. (1999) BH-protocadherin-c, a
member of the cadherin superfamily, interacts with protein phosphatase 1 alpha
through its intracellular domain. FEBS Lett, 460, 93-8.
Young, D. J., Bebbington, A., Anderson, A., Ravine, D., Ellaway, C., Kulkarni, A., De Klerk,
N., Kaufmann, W. E. & Leonard, H. (2008) The diagnosis of autism in a female:
could it be Rett syndrome? Eur J Pediatr, 167, 661-9.
Young, I. D. (1988) The Coffin-Lowry syndrome. J Med Genet, 25, 344-8.
Yu, J., Cheng, Y. Y., Tao, Q., Cheung, K. F., Lam, C. N., Geng, H., Tian, L. W., Wong, Y.
P., Tong, J. H., Ying, J. M., Jin, H., To, K. F., Chan, F. K. & Sung, J. J. (2009)
Methylation of protocadherin 10, a novel tumor suppressor, is associated with poor
prognosis in patients with gastric cancer. Gastroenterology, 136, 640-51 e1.
Yu, J. S., Koujak, S., Nagase, S., Li, C. M., Su, T., Wang, X., Keniry, M., Memeo, L.,
Rojtman, A., Mansukhani, M., Hibshoosh, H., Tycko, B. & Parsons, R. (2008)
PCDH8, the human homolog of PAPC, is a candidate tumor suppressor of breast
cancer. Oncogene, 27, 4657-65.
Yue, Y., Widmer, D. A., Halladay, A. K., Cerretti, D. P., Wagner, G. C., Dreyer, J. L. &
Zhou, R. (1999) Specification of distinct dopaminergic neural pathways: roles of the
Eph family receptor EphB1 and ligand ephrin-B2. J Neurosci, 19, 2090-101.
Zelinski, D. P., Zantek, N. D., Stewart, J. C., Irizarry, A. R. & Kinch, M. S. (2001) EphA2
overexpression causes tumorigenesis of mammary epithelial cells. Cancer Res, 61,
2301-6.
Zelinski, D. P., Zantek, N. D., Walker-Daniels, J., Peters, M. A., Taparowsky, E. J. & Kinch,
M. S. (2002) Estrogen and Myc negatively regulate expression of the EphA2 tyrosine
kinase. J Cell Biochem, 85, 714-20.
Zhang, T., Hua, R., Xiao, W., Burdon, K. P., Bhattacharya, S. S., Craig, J. E., Shang, D.,
Zhao, X., Mackey, D. A., Moore, A. T., Luo, Y., Zhang, J. & Zhang, X. (2009)
Mutations of the EPHA2 receptor tyrosine kinase gene cause autosomal dominant
congenital cataract. Hum Mutat, 30, E603-11.
Zhao, B., Lei, Q. Y. & Guan, K. L. (2008) The Hippo-YAP pathway: new connections
between regulation of organ size and cancer. Curr Opin Cell Biol, 20, 638-46.
Zheng, Q. Y., Yan, D., Ouyang, X. M., Du, L. L., Yu, H., Chang, B., Johnson, K. R. & Liu,
X. Z. (2005) Digenic inheritance of deafness caused by mutations in genes encoding
cadherin 23 and protocadherin 15 in mice and humans. Hum Mol Genet, 14, 103-11.
Zou, C., Huang, W., Ying, G. & Wu, Q. (2007) Sequence analysis and expression mapping of
the rat clustered protocadherin gene repertoires. Neuroscience, 144, 579-603.
Zou, J. X., Wang, B., Kalo, M. S., Zisch, A. H., Pasquale, E. B. & Ruoslahti, E. (1999) An
Eph receptor regulates integrin activity through R-Ras. Proc Natl Acad Sci U S A, 96,
13813-8.
Appendix - A
Dibbens, L.M. et al. (2008) X-linked protocadherin 19 mutations cause female-
limited epilepsy and cognitive impairment.
Nature Genetics, v. 40 (6), pp. 776 - 781, June2008
NOTE: This publication is included in the print copy of the thesis
held in the University of Adelaide Library.
It is also available online to authorised users at:
http://dx.doi.org/10.1038/ng.149
Appendix - B
doi: 10.1136/jmg.2009.0688172009
2010 47: 211-216 originally published online September 14,J Med Genet Kim Hynes, Patrick Tarpey, Leanne M Dibbens, et al. de novo or in single generation families
mutations can presentPCDH19females with Epilepsy and mental retardation limited to
http://jmg.bmj.com/content/47/3/211.full.htmlUpdated information and services can be found at:
These include:
Referenceshttp://jmg.bmj.com/content/47/3/211.full.html#ref-list-1This article cites 23 articles, 8 of which can be accessed free at:
serviceEmail alerting
box at the top right corner of the online article.Receive free email alerts when new articles cite this article. Sign up in the
Notes
http://jmg.bmj.com/cgi/reprintformTo order reprints of this article go to:
http://jmg.bmj.com/subscriptions go to: Journal of Medical GeneticsTo subscribe to
Epilepsy and mental retardation limited to femaleswith PCDH19 mutations can present de novo or insingle generation families
Kim Hynes,1,2 Patrick Tarpey,3 Leanne M Dibbens,1,4 Marta A Bayly,1 Samuel F Berkovic,5
Raffaella Smith,3 Zahyia Al Raisi,1 Samantha J Turner,5 Natasha J Brown,6,7
Tarishi D Desai,5 Eric Haan,1,4 Gillian Turner,8 John Christodoulou,9 Helen Leonard,10
Deepak Gill,11 Michael R Stratton,3 Jozef Gecz,1,2,4 Ingrid E Scheffer5,6
ABSTRACTBackground Epilepsy and mental retardation limited tofemales (EFMR) is an intriguing X-linked disorderaffecting heterozygous females and sparing hemizygousmales. Mutations in the protocadherin 19 (PCDH19)gene have been identified in seven unrelated families withEFMR.Methods and results Here, we assessed the frequencyof PCDH19 mutations in individuals with clinical featureswhich overlap those of EFMR. We analysed 185 femalesfrom three cohorts: 42 with Rett syndrome who werenegative for MECP2 and CDKL5 mutations, 57 withautism spectrum disorders, and 86 with epilepsy with orwithout intellectual disability. No mutations wereidentified in the Rett syndrome and autism spectrumdisorders cohorts suggesting that despite sharing similarclinical characteristics with EFMR, PCDH19 mutations arenot generally associated with these disorders. Among the86 females with epilepsy (of whom 51 had seizure onsetbefore 3 years), with or without intellectual disability, weidentified two (2.3%) missense changes. One(c.1671C/G, p.N557K), reported previously withoutclinical data, was found in two affected sisters, the firstEFMR family without a multigenerational family history ofaffected females. The second, reported here, is a novel denovo missense change identified in a sporadic female.The change, p.S276P, is predicted to result in functionaldisturbance of PCDH19 as it affects a highly conservedresidue adjacent to the adhesion interface of EC3 ofPCDH19.Conclusions This de novo PCDH19 mutation ina sporadic female highlights that mutational analysisshould be considered in isolated instances of girls withinfantile onset seizures and developmental delay, inaddition to those with the characteristic family history ofEFMR.
Epilepsy and mental retardation limited to females(EFMR; MIM 300088) is remarkable as an X-linkeddisorder due to its unusual inheritance pattern,displaying sex limited expression.1 2 TypicallyX-linked disorders are characterised by the presenceof affected males and unaffected carrier females.PCDH19, the gene encoding protocadherin 19, wasrecognised as the causative gene for EFMR in sevenunrelated families, with each family carryinga unique mutation.3 EFMR is easily identified byinspection of large pedigrees where the phenotypeoccurs in multiple affected females connectedthrough unaffected male relatives. However, in
smaller pedigrees, EFMR due to mutations inPCDH19 may well be an under-recognised cause ofseizures and intellectual disability (ID), since thecharacteristic unique inheritance pattern is notobvious in the pedigrees. This prediction has recentlybeen validated by the identification of PCDH19mutations in 12 unrelated individuals (11 femalesand one mosaic male) with severe epileptic enceph-alopathies resembling Dravet syndrome that wereproven de novo in six, and familial in five, with fourunaffected carrier fathers and one with mild ID.4
Our assessment of 27 females with EFMR iden-tified that while seizures beginning by age 3 yearswere the hallmark of this disorder, there wereseveral additional clinical features. Sixty seven percent of affected females had ID or were of borderlineintellect. Early development varied from normal toabnormal; developmental regression commonlyoccurred with seizure onset. A number of psychi-atric features were identified in affected females;obsessive features were present in 33%, aggressivebehaviour in 26% and autism spectrum disorders(ASD) in 22%.2
Here, we aimed to ascertain if there is a broaderspectrum of phenotypes caused by PCDH19mutations, by performing mutation screening inthree cohorts of females with clinical features thatoverlap those of EFMR. These included Rettsyndrome (RS) females, females with ASD, andfemales with epilepsy with or without ID.
SUBJECTS AND METHODSRS patient cohortFemales with EFMR often have normal earlydevelopmental milestones and regress in infancy.They have later autistic features and ID. Thus thecourse of EFMR resembles that of RS, including RSgirls with early onset seizures. RS females from theAustralian Rett database,5 who did not havemutations in MECP2 or CDKL5/STK9, wereselected (n¼42).
Autism spectrum disorder patient cohortIn view of the prominent autistic features observedin girls with EFMR, a cohort of girls with ASD wasselected from the Autism Genetic ResourceExchange (AGRE) database of the Cure AutismNow Foundation, USA (n¼50) and from ourpatient cohort (n¼7). Individuals screened wereselected based on the pedigree information; each
< Supplementary table 1 ispublished online only at http://jmg.bmj.com/content/vol47/issue31SA Pathology at the Women’sand Children’s Hospital, NorthAdelaide, SA, Australia2School of Molecular andBiomedical Science, Universityof Adelaide, Adelaide, Australia3Wellcome Trust SangerInstitute, Hinxton, UK4School of Paediatrics andReproductive Health, Universityof Adelaide, Adelaide, Australia5Epilepsy Research Centre andDepartment of Medicine,University of Melbourne, AustinHealth, Heidelberg, Victoria,Australia6Department of Paediatrics,University of Melbourne, RoyalChildren’s Hospital, Melbourne,Australia7Barwon Health, Geelong,Victoria, Australia8GOLD Service, Hunter Genetics,Waratah, New South Wales2298, Australia9Western Sydney GeneticsProgram, The Children’s Hospitalat Westmead and Disciplines ofPaediatrics and Child Health &Genetic Medicine, University ofSydney, Sydney, Australia10Telethon Institute for ChildHealth Research, Centre forChild Health Research,University of Western Australia,Perth, Australia11TY Nelson Department ofNeurology, The Children’sHospital at Westmead,Westmead, New South Wales,Australia
Correspondence toProfessor Jozef Gecz, SAPathology, Women’s andChildren’s Hospital, 72 KingWilliam Road, North Adelaide,SA 5006, Australia;[email protected]
Received 21 April 2009Revised 14 July 2009Accepted 20 August 2009
J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817 211
Mutation report
proband was selected from a pedigree with multiple affectedfemales across one or more generations and no affected males.
Females with epilepsy, with or without IDIn 51/86 cases, seizure onset was under 3 years, in 6/86 casesseizure onset was after 3 years. The age of seizure onset wasunknown in the remaining 29/86 cases. No other cause forepilepsy was identified.
PCDH19 mutation screeningMutation screening was performed on genomic DNA extractedby standard methods. Primers were designed in intronic andexonic sequences such that coding sequence and a minimum of40 base pairs (bp) of flanking intronic sequence could be analysedby direct sequencing (supplementary table 1). High throughputre-sequencing of exons 1e6, which encompasses the entirecoding region of PCDH19 (GenBank Accession numberNM_001105243), was performed. Due to the high GC content ofPCDH19 exon 1 affecting high throughput sequencing quality,this exon was re-analysed for mutations by denaturing highperformance liquid chromatography for the cohort of epilepsy,with or without ID patients, and by manual sequencing for thecohort of RS and ASD patients. Sequence changes were verifiedon the original DNA sample and segregation analysis wasperformed on all available members of a pedigree. Polymerasechain reaction (PCR), cleanup and sequencing was performed aspreviously reported.3
RESULTSPCDH19 screeningRS cohortSequencing of PCDH19 in 42 females with RS identified nomutations. The RS female cohort had previously been screenedfor mutations in MECP2 and CDKL5/STK9 and all individualswere negative for mutations in either gene. This RS cohort wastherefore a highly enriched cohort for finding additional causativegenes for RS.
Autism spectrum disorder cohortWe did not identify any mutations in PCDH19 in 57 indexfemales with ASD from families with multiple affected femalesand no affected males. This suggests that PCDH19 is unlikely tobe a significant contributor to ASD alone in females.
Epilepsy, with or without ID cohortMutation screening in this cohort of 86 females identified twomissense changes in PCDH19 (2/86 or 2.3%). Both changes wereidentified in the cohort of 51 females with documented seizureonset before 3 years. One of the changes, c.1671C/G (p.N557K), and the associated pedigree have previously beenreported (family 7).3 Here we report detailed clinical data on thisfamily (see below).The second change identified was a novel heterozygous
missense change c.826T/C (p.S276P). The patient’s parents didnot carry the change (figure 1B) and biparental testing using sixmicrosatellite markers confirmed that the pedigree structure wascorrect (figure 1A). Thus this girl carries a de novo change;however, the possibility of gonadal mosaicism in one of theparents cannot be excluded. Unfortunately, neither of the unaf-fected sisters was available for genetic analysis.The c.826T/C nucleotide change is predicted to cause
replacement of the serine (S) amino acid at position p.276 witha proline (P) (figure 1). Serine p.276 is highly conserved acrossa range of protocadherins and PCDH19 of various species
(figure 1C). Serine p.276 is equivalent, based on alignment to theEC1 domains of classical cadherins and protocadherin a4, toresidues Y37 and F38 respectively, which are involved in theformation of the bC strand and adjacent to a highly conservedresidue important for the formation of a hydrophobic cluster(figure 1D).6 7 Based on the serine p.276 conservation, locationwithin the extracellular domain of PCDH19 and its absence fromcontrol chromosomes, we postulate that this change has func-tional significance and thus represents a novel PCDH19mutation.
Nucleotide variation of PCDH19Sequence analysis of PCDH19 also identified six silent and onemissense variants (figure 2A table 1). Three silent changes;c.402C/A (p.I134I), c.1137C/T (p.G379G) and c.1627C/T(p.L543L) had previously been identified as part of the HapMapproject, while the remaining variants are novel.Analysis of the conservation of PCDH19 among the d proto-
cadherins demonstrates that the extracellular domain ofPCDH19 in particular is highly conserved (figure 2B). The level ofconservation is much lower for the cytoplasmic domain. Thishad previously been noted for the protocadherin family ingeneral.8 To date all missense changes identified in the extracel-lular domain of PCDH19 cause EFMR or PCDH19 relatedDravet-like syndrome (figure 1E).3 4 The missense changec.3319C/G (p.R1107G), which occurs in the cytoplasmicdomain, had previously been identified in healthy female indi-viduals as a rare variant.4 We also identified a missense changec.2873G/A (p.R958Q) in the cytoplasmic domain of PCDH19in a female with ASD; however, this is unlikely to be a causativemutation because as part of our large scale X chromosome exonre-sequencing effort,9 we identified this sequence variant in anunrelated family with X-linked ID (Patrick Tarpey, March, 2009).The p.R958Q change did not segregate with the intellectualdisability and was present in three unaffected females. It appearsthat while missense changes in the extracellular domain ofPCDH19 cause EFMR or PCDH19-related Dravet-like syndrome,this particular missense change in the cytoplasmic domain ofPCDH19 is tolerated in normal individuals.
Clinical description of the PCDH19 positive casesSmall family (family 7 in Dibbens et al 20083)
ProbandThe 25-year-old librarian was selected for screening because shehad a history of infantile onset seizures. At 18 months, she hadtwo simple febrile generalised tonic-clonic seizures. At 3 years1 month, she started having afebrile right hemiclonic seizureslasting up to 5 min. Following an allergic reaction to carbama-zepine, she was treated with valproate and later required theaddition of clonazepam. At 8.5 years, she presented with atonicdrop attacks in clusters and received clobazam with valproate, asher behaviour had deteriorated on clonazepam. Her last seizureoccurred at 12.5 years and she was weaned off antiepileptictreatment at 13.5 years. A postictal electroencephalogram (EEG)study at 4 years showed biposterior high voltage slowing morepronounced on the left without epileptiform activity. Magneticresonance imaging (MRI) was not performed.At 10 years, she was diagnosed with Asperger syndrome. She
had obsessional features such as crawling out of bed very care-fully in the morning so that her bed would not be messy and herbedroom was very tidy. Her full scale IQ showed that she was ofaverage intellect; however, she had significant difficulties withvocabulary and visuospatial tasks. Despite these findings, shecoped well academically at school but experienced social diffi-culties. She completed a university degree.
212 J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817
Mutation report
Sister of the probandHer 23-year-old sister presented with right hemiclonic seizuresat 2 years. Her seizures began with a scream, then a fixed gazeand clonic activity of the right arm and face, which sometimesinvolved her leg. After 6 months on carbamazepine, she was
changed to valproate. Seizures were controlled by 6 years andmedication was weaned at 10 years. Seizures recurred after8 months, and she was commenced on valproate with the lateraddition of lamotrigine. By 12 years, seizures began with a 10 scephalic aura of feeling strange, nauseated and dizzy withouttrue vertigo. Her head and eyes would deviate to the right andsometimes she would have right hemiclonic activity. Seizureswould cluster with 20 in 1 day. Seizures remained highlyrefractory until they came under control at 16 years when leve-tiracetam was added to carbamazepine and lamotrigine.Her EEG at 11 years showed a photoparoxysmal response with
high voltage polyspike wave at a number of flash frequencies.VideoeEEGmonitoring at 14 years captured eight seizures whichbegan by the patient calling out to her mother, staring blankly,followed by head and eye deviation to the left and oral autom-atisms. The EEG showed an ictal rhythmwhich began with rightfrontotemporal slowing evolving to sharply contoured thetamaximal at T4, which spread to involve the right hemisphere.MRI of the brain at 13 years was normal apart from mildventriculomegaly.
Figure 1 De novo missense mutation in an affected female. (A) Pedigree of the family; black symbol denotes the affected girl. (B) Sequencechromatograms of PCDH19 exon 1 illustrating the c.826T/C mutation identified in the proband (II-2, bottom panel) but absent in the parents (I-1and I-2); the two unaffected sisters (II-1 and II-3) were unavailable for genetic analysis. (C) Partial alignment of human protocadherins (PCDHs) andorthologs of PCDH19 from available species shows a high degree of conservation of the serine 276 residue. (D) Clustal W alignment of the extracellular(EC) 1 domain of classical cadherins (C, E, and N) and PCDH a4 with the EC3 domain of PCDH19 which contains the S276 residue mutated in the de novocase (circled). Arrows indicate residues involved in the formation of the bC sheet, gray for cadherins and black for PCDHs. Residues involved in theadhesion interface of cadherins and the formation of a hydrophobic cluster in PCDHs are illustrated in bold.6 7 p.S276 is adjacent to a highly conservedresidue involved in the formation of a hydrophobic cluster (p.Y275). (E) Schematic representation of the PCDH19 protein with all PCDH19 mutationsidentified to date. Mutations identified in EFMR patients are illustrated above the protein schematic,3 with the mutation identified in this investigationillustrated in bold. Mutations identified in the Dravet-like (DS) patients4 are illustrated below the schematic.
Table 1 Variation identified in PCDH19 throughsequencing of 186 females
Nucleotidechange
Proteinconsequence
Type ofchange
Frequency(%)
c.6 G/A p.E2E Silent 1.23
c.402 C/A p.I134I Silent 7.80
c.655 C/T p.L219L Silent 0.44
c.1137 C/T p.G379G Silent 3.43
c.1627 C/T p.L543L Silent 20.62
c.1683 G/A p.P561P Silent 0.43
c.2873 G/A p.R958Q Missense 0.46
The line dictates the distinction between the extracellular domainof PCDH19 (above the line) and the cytoplasmic domain (below theline).PCDH19, protocadherin 19.
J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817 213
Mutation report
Her early motor developmental milestones were normal butshe spoke single words late at 15 months and put two wordstogether after 2 years. She did not regress. She was diagnosedwith attention deficit hyperactivity disorder at 6 years and wastreated with dexamphetamine into adult life. Neuropsychologicalassessment at 13 years showed that she was of borderline intel-lect with good preservation of visuospatial function and averageperformances in general knowledge and non-verbal conceptformation. She had difficulties in both verbal and visual domainsof memory function. She also showed planning and organisationproblems. She attended a special school and then completeda certificate in caring for the elderly as a young adult. There wasno further family history of seizures or ID.
De novo caseThis 7-year-old girl presented with her first seizure at 1 year ofage, 5 days after receiving her measles, mumps and rubellaimmunisation. She had clusters of afebrile generalised tonic-clonic seizures and later had seizures with fever. Her EEG at14 months showed left central and frontal epileptiform activity,but was normal at 4 and 6 years. By 7 years, she had episodes ofconvulsive status epilepticus, which responded to phenytoin incombination with lamotrigine and clobazam. She had previouslytried valproate. Early developmental milestones were normal, butby 4 years she had moderate ID. At 7 years, she received a diag-nosis of an autism spectrum disorder; she had not shownneurodevelopmental regression. Examination showed no focal
neurological signs or dysmorphic features. MRI of the brain wasnormal. She was the second child of unrelated Vietnameseparents and had two normal sisters, aged 3 and 9 years. Therewas no family history of seizures or ID.
DISCUSSIONWe sought to ascertain the frequency of PCDH19 mutations infemales who share clinical characteristics with those that occurin EFMR.1 2 The most typical phenotype seen in EFMR femalescomprises a normally developing infant whose seizures beginunder 3 years (mean age of 14 months), sometimes with devel-opmental regression at seizure onset. Two thirds of affectedfemales have borderline intellect or ID, which varies frommild toprofound; autistic features may be prominent.2 We selected threecohorts based on specific phenotypic features to ascertainwhether PCDH19 was a significant cause of these phenotypes.First, a number of phenotypic similarities exist between RS
and EFMR. RS (RTT, MIM 312750) is a severe neuro-developmental disorder which predominantly affects females.RS is characterised by developmental regression between 6 and18 months of age and the development of other featuresincluding stereotypic hand movements and hyperventilation.Additional characteristics include seizures 10 and autisticfeatures.11 12 Mutations in eitherMECP213 or CDKL5 10 14 15 arefound in the majority of girls with RS; however, approximately25% of patients with RS do not carry a mutation of either gene.16
Therefore it is likely that additional genes contribute to RS.11 We
Figure 2 Population variation andconservation of protocadherin 19(PCDH19). (A) Schematicrepresentation of the PCDH19 proteinwith all non-disease causing variantsidentified to date. Silent variants areillustrated above and missense variantsbelow the protein schematic. (B)Conservation score of PCDH19 relativeto all other d-protocadherins.Conservation scores were obtainedfrom Scoreconsdhttp://www.ebi.ac.uk. Each bar on the graph represents theconservation score of a single aminoacid in PCDH19. Grey bars illustrateamino acids in the extracellular domainof PCDH19 and black the cytoplasmicdomain. Missense mutations (n¼7) areillustrated as black lines on top of thegraph. Missense variants (n¼2) areillustrated as grey lines. The PCDH19protein schematic under the graphillustrates the position of functionaldomains of PCDH19. EFMR missensemutations are indicated with a hash(#), Dravet-like syndrome mutationsare indicated with a star (*), and variantmissense changes in grey.
214 J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817
Mutation report
used an enriched RS cohort, where mutations of MECP2 andCDKL5 had been excluded, to screen for PCDH19 mutations.Despite the phenotypic similarities shared between females withRS and EFMR, we did not identify any mutations in PCDH19.This suggests that PCDH19 is unlikely to make a significantcontribution to RS. The possibility remains that PCDH19 couldbe a rare cause of RS. While there are a number of phenotypicsimilarities between EFMR and RS females, the mutant males inthese two disorders show opposite phenotypes. EFMR trans-mitting males do not have seizures or ID while the rare maleswho have RS are more severely affected than their affectedsisters.17 Thus, the absence of PCDH19 mutations in the RScohort, together with the opposing phenotypes in hemizygousmales carrying mutations, strongly suggests that unrelatedmolecular mechanisms are responsible for these two disorders.Second, psychiatric features are prominent in females with
EFMR. In particular, ASD and/or autistic features have beenidentified in 22% of EFMR females.2 ASD has a significant geneticcomponent with at least 76 genes or chromosomal loci proposedto be associated with ASD (reviewed in Abrahams and Gesch-wind18). None of the associated genes account for more than1e2% of cases to date (reviewed in Abrahams and Geschwind18).The PCDH19 gene has not previously been associated withautism; however, two close sequence relatives PCDH9 andPCDH10 (also d protocadherins) have recently been implicated aspotential candidate genes for autism.19 20 Despite this, we foundno evidence that PCDH19 causes isolated ASD within the rela-tively small cohort that we screened.We did nevertheless find thatthe PCDH19 mutations identified in our third cohort occurred inassociation with Asperger syndrome in one proband and ASD inthe other, confirming the association between ASD and EFMR.Third, we screened 86 females with epilepsy with or without
ID where the age of seizure onset was known to be <3 years in51 cases. Half the affected females had a family history ofseizures; however, their families did not show the characteristicinheritance pattern of EFMR over multiple generations. Thisscreen allowed us to identify the smallest EFMR family to datewith just two affected girls in a single generation and a normaltransmitting father who carried a novel de novo PCDH19mutation.3 Taken together, our previous3 and current screeningascertained two PCDH19mutations out of 86 females from smallkindreds and sporadic cases. Thus EFMR is not a common causeof seizures and ID in females; however, a frequency of 2.3%means that EFMR must be considered part of the differentialdiagnosis given its major genetic counselling implications. Eachfemale with a PCDH19 mutation has a 50% risk of havingaffected daughters who may have a more or less severe pheno-type, and a 50% risk of having transmitting sons. Furthermore inmost cases the mutation will have been inherited from a parent.This could have implications for other branches of the family.A novel de novo p.S276P missense mutation was detected in
a sporadic female with refractory tonic-clonic seizures and ID.This girl’s phenotype poses a striking contrast to the proband ofthe small EFMR family who had relatively easily controlledinfantile seizures and was of normal intellect. Previously cases ofEFMR have been recognised based on its distinctive inheritancepattern of affected females through several generations withnormal transmitting males. PCDH19 testing should therefore beconsidered as one of the options in females with seizure onsetwithin the first 3 years with developmental delay or ID.Recently Depienne and co-authors emphasised that females
presenting with a severe encephalopathy resembling Dravetsyndrome may have PCDH19 mutations. They noted that thePCDH19 cases had a later age of onset, less frequent status
epilepticus, myoclonic and absence seizures, and a lesser degree ofID than cases with classical Dravet syndrome with a mutation inthe sodium channel gene SCN1A.4 These PCDH19 mutationpositive cases closely resemble our severe EFMR cases. Indeed,our experience is that the severe EFMR phenotypes, whilesharing some features with Dravet syndrome, lack the charac-teristic temporal evolution of Dravet syndrome.21 In Dravetsyndrome seizure onset occurs at around 6 months, followed byfrequent convulsive seizures over the next year typicallyinvolving episodes of febrile status epilepticus. Between1e4 years, other seizure types emerge and include partial,absence, myoclonic and atonic seizures. Seizures typically remainrefractory. Children with Dravet syndrome develop normally inthe first year of life, then their development slows and cognitiveimpairment is usual. This is quite different from the temporalevolution of EFMR.The three new EFMR positive girls described here do not have
Dravet syndrome. The sisters with the familial mutation hadseizure onset at 18e24 months of age with hemiclonic seizuresin both and febrile generalised tonic-clonic seizures in one.Seizures were brought under control in both by mid-adolescenceand they were of normal intellect. Our third patient witha de novo PCDH19 mutation presented at 1 year with afebrilegeneralised tonic-clonic seizures, which is rather late for Dravetsyndrome. She only had convulsive attacks and her episodes ofstatus epilepticus occurred late at 7 years. Thus detailed pheno-typic information shows that her picture is not that of Dravetsyndrome although her outcome is similarly severe.The p.S276P mutation affects a residue in EC3 of PCDH19,
which is highly conserved across a number of orthologs andparalogs. The p.S276 is predicted, based on the crystal structureof the extracellular (EC) 1 domain of cadherins7 and proto-cadherin-a,6 to be involved in the formation of the bC strand(figure 1D). The EC repeat domains of cadherins and proto-cadherins are believed to be composed of two b sheets packed faceto face. One b sheet is composed of four b strands (bA, bC, bF andbG) and the second b sheet is composed of the remaining threeb strands (bB, bD and bE).6 7 The p.Y275 residue, which is adja-cent to the mutated p.S276 residue, is equivalent to residues p.Y377 and p.F386 in EC1 of cadherins and protocadherins, respec-tively (figure 1D). p.Y37/p.F38 is an important residue involved inthe adhesion interface of cadherins and the complementaryhydrophobic core of protocadherins. We predict that the p.S276Pmutation will disrupt the formation of the bC strand destroyingthe hydrophobic core of the EC3 domain. While the EC1 domainof classical cadherins was originally thought to be entirelyresponsible for the homophilic adhesive activity of cadherins,there is increasing evidence highlighting the importance of theother EC domains including EC3.22 23 We therefore believe thatthis mutation results in a functional knockout of PCDH19.The EC domains of protocadherins appear to be crucial for
normal function. The amino acid sequence of the EC domains ofprotocadherins is highly conserved, while the sequence of thecytoplasmic domains shows more variation between thedifferent protocadherin subclasses.8 Our screening of PCDH19 in186 females, analysed as part of this investigation, failed toidentify any normal missense variation in its EC domain, whiletwo missense changes have been identified in the cytoplasmicdomain.4 The high level of conservation and the absence ofnormal missense variation in the EC domain of PCDH19 suggeststrong evolutionary constraints acting on this part of the protein.This finding also has implications for PCDH19 diagnostic testing,which should be prioritised to the EC and the transmembranedomains. However, truncation mutations in the cytoplasmic
J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817 215
Mutation report
domain, which are subject to nonsense-mediated decay, are likelyto result in EFMR, therefore the cytoplasmic domain should stillbe screened for mutations.Further to this, Mateus et al24 identified that missense muta-
tions in the EC domain or the juxtamembrane domain (whichaffect the integrity of the EC domain) of Cadherin 1 increase cellmotility and EGFR activation, while missense mutations in thecytoplasmic domain have no effect on EGFR activation or cellmotility. An interesting correlate is also seen in the Xenopus laevisparaxial protocadherin, where the EC and transmembranedomains are required for its cell sorting function, while thecytoplasmic domain is not.25Whether the EFMR phenotype maytherefore occur as a result of defects in cell sorting and/ormotility is yet to be investigated.This report describes a sporadic female with EFMR with
a mutation in PCDH19. Our recent report of six new families ledus to conjecture that EFMR could be an under-diagnosed disorderdue to the lack of appreciation of the unusual inheritance patternwith unaffected transmitting males as a major recognisablefeature, which is not visible in small families.2 3 Here we reliedsolely on phenotypic attributes to select the cohort from whichwe identified the first sporadic affected female with EFMR. Inlight of this finding, mutational analysis of PCDH19 should beconsidered in sporadic females with seizures beginning under3 years of age, in particular in the context of developmental delaywith or without ID.
Acknowledgements We are grateful to the families for their support andparticipation in this study. We thank Associate Professor John Mulley for usefuldiscussion and critical assessment of the manuscript, Ms Linda Turelli and Dr KathrynFriend for performing the biparental testing. We gratefully acknowledge theresources provided by the AGRE Consortium and the participating AGRE families. Thiswork has been supported by funding from the Wellcome Trust, National Health andMedial Research Council of Australia, Thyne-Reid Charitable Trusts and The JackBrockhoff Foundation and NIH for the RS cohort.
Funding Other Funders: Wellcome Trust; National Health and Medical ResearchCouncil of Australia.
Competing interests None.
Ethics approval This study was conducted with the approval of the Child Youth andWomen’s Health Service, Adelaide, Australia.
Provenance and peer review Not commissioned; externally peer reviewed.
REFERENCES1. Ryan SG, Chance PF, Zou CH, Spinner NB, Golden JA, Smietana S. Epilepsy and
mental retardation limited to females: an X-linked dominant disorder with malesparing. Nat Genet 1997;17:92e5.
2. Scheffer IE, Turner SJ, Dibbens LM, Bayly MA, Friend K, Hodgson B, Burrows L,Shaw M, Wei C, Ullmann R, Ropers HH, Szepetowski P, Haan E, Mazarib A, Afawi Z,Neufeld MY, Andrews PI, Wallace G, Kivity S, Lev D, Lerman-Sagie T, Derry CP,Korczyn AD, Gecz J, Mulley JC, Berkovic SF. Epilepsy and mental retardation limited tofemales: an under-recognized disorder. Brain 2008;131(Pt 4):918e27.
3. Dibbens LM, Tarpey PS, Hynes K, Bayly MA, Scheffer IE, Smith R, Bomar J, Sutton E,Vandeleur L, Shoubridge C, Edkins S, Turner SJ, Stevens C, O’Meara S, Tofts C,Barthorpe S, Buck G, Cole J, Halliday K, Jones D, Lee R, Madison M, Mironenko T, VarianJ, West S, Widaa S, Wray P, Teague J, Dicks E, Butler A, Menzies A, Jenkinson A,Shepherd R, Gusella JF, Afawi Z, Mazarib A, Neufeld MY, Kivity S, Lev D, Lerman-SagieT, Korczyn AD, Derry CP, Sutherland GR, Friend K, Shaw M, Corbett M, Kim HG,Geschwind DH, Thomas P, Haan E, Ryan S, McKee S, Berkovic SF, Futreal PA, StrattonMR, Mulley JC, Gecz J. X-linked protocadherin 19 mutations cause female-limitedepilepsy and cognitive impairment. Nat Genet 2008;40:776e81.
4. Depienne C, Bouteiller D, Keren B, Cheuret E, Poirier K, Trouillard O, Benyahia B,Quelin C, Carpentier W, Julia S, Afenjar A, Gautier A, Rivier F, Meyer S, Berquin P,Helias M, Py I, Rivera S, Bahi-Buisson N, Gourfinkel-An I, Cazeneuve C, Ruberg M,Brice A, Nabbout R, Leguern E. Sporadic infantile epileptic encephalopathy causedby mutations in PCDH19 resembles Dravet syndrome but mainly affects females.PLoS Genet 2009;5:e1000381.
5. Weaving LS,Williamson SL, Bennetts B, Davis M, Ellaway CJ, Leonard H, Thong MK,Delatycki M, Thompson EM, Laing N, Christodoulou J. Effects of MECP2 mutationtype, location and X-inactivation in modulating Rett syndrome phenotype. Am J MedGenet A 2003;118:103e14.
6. Morishita H, Umitsu M, Murata Y, Shibata N, Udaka K, Higuchi Y, Akutsu H,Yamaguchi T, Yagi T, Ikegami T. Structure of the cadherin-related neuronal receptor/protocadherin-alpha first extracellular cadherin domain reveals diversity acrosscadherin families. J Biol Chem 2006;281:33650e63.
7. Patel SD, Ciatto C, Chen CP, Bahna F, Rajebhosale M, Arkus N, Schieren I, JessellTM, Honig B, Price SR, Shapiro L. Type II cadherin ectodomain structures: implicationsfor classical cadherin specificity. Cell 2006;124:1255e68.
8. Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S,Suzuki S. Protocadherins: a large family of cadherin-related molecules in centralnervous system. EMBO J 1993;12:2249e56.
9. Tarpey PS, Smith R, Pleasance E, Whibley A, Edkins S, Hardy C, O’Meara S, LatimerC, Dicks E, Menzies A, Stephens P, Blow M, Greenman C, Xue Y, Tyler-Smith C,Thompson D, Gray K, Andrews J, Barthorpe S, Buck G, Cole J, Dunmore R, Jones D,Maddison M, Mironenko T, Turner R, Turrell K, Varian J, West S, Widaa S, Wray P,Teague J, Butler A, Jenkinson A, Jia M, Richardson D, Shepherd R, Wooster R, TejadaMI, Martinez F, Carvill G, Goliath R, de Brouwer AP, van Bokhoven H, Van Esch H,Chelly J, Raynaud M, Ropers HH, Abidi FE, Srivastava AK, Cox J, Luo Y, Mallya U,Moon J, Parnau J, Mohammed S, Tolmie JL, Shoubridge C, Corbett M, Gardner A,Haan E, Rujirabanjerd S, Shaw M, Vandeleur L, Fullston T, Easton DF, Boyle J,Partington M, Hackett A, Field M, Skinner C, Stevenson RE, Bobrow M, Turner G,Schwartz CE, Gecz J, Raymond FL, Futreal PA, Stratton MR. A systematic, large-scaleresequencing screen of the X chromosome coding exons in mental retardation.Nat Genet 2009;41:535e43.
10. Scala E, Ariani F, Mari F, Caselli R, Pescucci C, Longo I, Meloni I, Giachino D, BruttiniM, Hayek G, Zappella M, Renieri A. CDKL5/STK9 is mutated in Rett syndrome variantwith infantile spasms. J Med Genet 2005;42:103e7.
11. Hagberg B, Aicardi J, Dias K, Ramos O. A progressive syndrome of autism, dementia,ataxia, and loss of purposeful hand use in girls: Rett’s syndrome: report of 35 cases.Ann Neurol 1983;14:471e9.
12. Young DJ, Bebbington A, Anderson A, Ravine D, Ellaway C, Kulkarni A, de Klerk N,Kaufmann WE, Leonard H. The diagnosis of autism in a female: could it be Rettsyndrome? Eur J Pediatr 2008;167:661e9.
13. Amir RE, Van den Veyver IB, Wan M, Tran CQ, Francke U, Zoghbi HY. Rett syndromeis caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.Nat Genet 1999;23:185e8.
14. Tao J, Van Esch H, Hagedorn-Greiwe M, Hoffmann K, Moser B, Raynaud M,Sperner J, Fryns JP, Schwinger E, Gecz J, Ropers HH, Kalscheuer VM. Mutationsin the X-linked cyclin-dependent kinase-like 5 (CDKL5/STK9) gene are associatedwith severe neurodevelopmental retardation. Am J Hum Genet2004;75:1149e54.
15. Weaving LS, Christodoulou J, Williamson SL, Friend KL, McKenzie OL, Archer H,Evans J, Clarke A, Pelka GJ, Tam PP, Watson C, Lahooti H, Ellaway CJ, Bennetts B,Leonard H, Gecz J. Mutations of CDKL5 cause a severe neurodevelopmentaldisorder with infantile spasms and mental retardation. Am J Hum Genet2004;75:1079e93.
16. Downs J, Bebbington A, Woodhead H, Jacoby P, Jian L, Jefferson A, Leonard H.Early determinants of fractures in Rett syndrome. Pediatrics 2008;121:540e6.
17. Hardwick SA, Reuter K, Williamson SL, Vasudevan V, Donald J, Slater K,Bennetts B, Bebbington A, Leonard H, Williams SR, Smith RL, Cloosterman D,Christodoulou J. Delineation of large deletions of the MECP2 gene in Rett syndromepatients, including a familial case with a male proband. Eur J Hum Genet2007;15:1218e29.
18. Abrahams BS, Geschwind DH. Advances in autism genetics: on the threshold ofa new neurobiology. Nat Rev Genet 2008;9:341e55.
19. Marshall CR, Noor A, Vincent JB, Lionel AC, Feuk L, Skaug J, Shago M, Moessner R,Pinto D, Ren Y, Thiruvahindrapduram B, Fiebig A, Schreiber S, Friedman J,Ketelaars CE, Vos YJ, Ficicioglu C, Kirkpatrick S, Nicolson R, Sloman L, Summers A,Gibbons CA, Teebi A, Chitayat D, Weksberg R, Thompson A, Vardy C, Crosbie V,Luscombe S, Baatjes R, Zwaigenbaum L, Roberts W, Fernandez B, Szatmari P, SchererSW. Structural variation of chromosomes in autism spectrum disorder. Am J HumGenet 2008;82:477e88.
20. Morrow EM, Yoo SY, Flavell SW, Kim TK, Lin Y, Hill RS, Mukaddes NM, Balkhy S,Gascon G, Hashmi A, Al-Saad S, Ware J, Joseph RM, Greenblatt R, Gleason D, ErteltJA, Apse KA, Bodell A, Partlow JN, Barry B, Yao H, Markianos K, Ferland RJ,Greenberg ME, Walsh CA. Identifying autism loci and genes by tracing recent sharedancestry. Science 2008;321:218e23.
21. Carranza D, Dibbens LM, Beroric SF, Scheffer IE. Do PCDH19 mutations cause Dravetsyndrome or a ’pseudo-Dravet’ phenotype? Online comment 2009 Apr 12. Sporadicinfantile epileptic encephalopathy caused by mutations in PCDH19 resemblesDravet syndrome but mainly affects females. Depienne et al. PLoS Genet 2009.
22. Chien YH, Jiang N, Li F, Zhang F, Zhu C, Leckband D. Two stage cadherin kineticsrequire multiple extracellular domains but not the cytoplasmic region. J Biol Chem2008;283:1848e56.
23. Tsuiji H, Xu L, Schwartz K, Gumbiner BM. Cadherin conformations associated withdimerization and adhesion. J Biol Chem 2007;282:12871e82.
24. Mateus AR, Simoes-Correia J, Figueiredo J, Heindl S, Alves CC, Suriano G, Luber B,Seruca R. E-cadherin mutations and cell motility: a genotype-phenotype correlation.Exp Cell Res 2009;315:1393e402.
25. Chen X, Molino C, Liu L, Gumbiner BM. Structural elements necessary foroligomerization, trafficking, and cell sorting function of paraxial protocadherin. J BiolChem 2007;282:32128e37.
216 J Med Genet 2010;47:211e216. doi:10.1136/jmg.2009.068817
Mutation report
Supplementary table 1: PCDH19 specific primers used for PCR amplification and sequencing.
Primer Name Sequence (5’to 3’) Size (bp)
Product (bp)
Annealing Temperature (°C)
PCDH19ex1-F1 TCGGAGGGGTGTGGAGAGG 19 428 64 PCDH19ex1-R1 CTGAACGACAATGCGCCCA 19 PCDH19ex1-F2 ATTGACCGTGATCTGCTGTGC 21 507 64 PCDH19ex1-R2 AAAACTCGCCTCCCAACACA 20 PCDH19ex1-F3 TGACCGACTCCAATGACAACAACC 24 551 62 PCDH19ex1-R3 ACTATTCTGGTGGACGGACGGCTG 24 PCDH19ex1-F4 GCCTTGGTGCGGGTGTCTGAT 21 480 60 PCDH19ex1-R4 TAACCACGAGCAGACCAAGGCG 22 PCDH19ex1-F5 TACCAGGTCATTGTGCAGGAGAAC 24 629 60 PCDH19ex1-R5 AATCTACTTGTCCCCTGCTCTCGA 24 PCDH19ex1-F6 CAGGTCAATGGCGAAGTCAGA 21 383 60 PCDH19ex1-R6 AATCCTGGTGCTTTTGTTTCCTAC 24 PCDH19ex2-F CTGAATGGAGAAGGATGCTGAA 22 352 62 PCDH19ex2-R GTTTTGGACTGGGGTAGGAG 20 PCDH19ex3-F GGAGAAACCCGATGATGTAATG 22 529 60 PCDH19ex3-R GCGAGCAGCTAAAGAAGGAGA 21 PCDH19ex4-F CTTCTAAGTAGGGCAGTTC 19 317 60 PCDH19ex4-R ATTACCAGTGATGTTTATTTAC 22 PCDH19ex5-F TCATTACAGAGCCGACATCATC 22 296 60 PCDH19ex5-R ACATTTTGGGTTCTTTGGAGT 21 PCDH19ex6-F1 TGGGGAGTAACAGTGAATC 19 476 60 PCDH19ex6-R1 CAGGGCAATGGTGTAAGAC 19 PCDH19ex6-F2 CTGAAAGGCAAGAGGACTG 19 429 60 PCDH19ex6-R2 TGGTGAGCAATTAAAACAAGA 21
Appendix - C
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)CFB 3835726 0.000144333 -2.079SBNO2 2946353 0.000179034 -1.622EFNA5 3442514 0.000180141 -2.908GPR133 3709838 0.000198681 -12.123TNFAIP8 3633578 0.000266549 -1.968DLG7 2886174 0.000311588 2.351MET 2818454 0.000323544 3.899GAS7 3335070 0.000407765 -1.946KREMEN1 2392945 0.000655602 -1.635TMTC1 3881443 0.000723578 -11.618NDC80 2438282 0.000767773 1.531ENPP1 2636319 0.000830242 9.905LAMB1 3744800 0.000882644 2.191POLA2 2346934 0.000957987 1.708SLC39A8 3610110 0.00111788 -4.432HDAC9 3138204 0.00118715 1.787LMCD1 2740067 0.00128545 -2.208CBLN3 3240987 0.00130265 -1.758FAM83D 3918535 0.00137482 1.603NTF3 3757970 0.00140864 1.917SPAG5 3630736 0.00177854 1.713HRSP12 2902804 0.00185486 -4.174APOD 3219215 0.00187127 -11.384CXCR7 3263944 0.00196225 -2.491GALNT6 2611056 0.0019718 1.988NXN 2717101 0.00204499 1.892DDIT3 3888522 0.00209703 2.212EXO1 2469213 0.00231903 1.596S1PR2 2991395 0.00247827 -2.725HIST1H3F 4022925 0.00254486 2.094UHRF1 2333136 0.00262331 1.852NR2F2 3408831 0.002718 1.931PRR11 2859667 0.002749 2.198A4GALT 3438061 0.0027625 -2.158LOH3CR2A 2779095 0.00297637 -2.745ITGA6 3954879 0.00301935 6.752SECTM1 3507710 0.00303331 -2.793MAP3K8 3589697 0.00309126 -2.324PDGFC 3607510 0.00312614 3.885TTK 2646818 0.0032121 1.634DAPK2 2507896 0.00324919 -2.523MGC50273 2410522 0.00351667 -1.574CDON 3813297 0.0035283 -5.464PRC1 3588658 0.00355747 2.215TACC3 3653072 0.00358376 1.687ENDOD1 3140213 0.00383857 2.262TCF7L2 3639031 0.00393235 -1.652TCF19 3458587 0.00394341 1.986LPCAT2 3309602 0.00403128 2.574ITGA3 2435735 0.0041971 4.153NPAL3 2592005 0.00428215 2.239
EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
RNASEH2A 2775909 0.00444925 1.606CEP97 3886532 0.00449382 1.651C1RL 3214451 0.00451782 -1.831FANCI 3096271 0.00456019 1.650CENPI 3309112 0.00473583 1.698KLF4 3261886 0.00480534 -3.925RASSF8 2548617 0.00487114 -1.946TOP2A 3756193 0.00529975 2.626RAB43 3110272 0.00555269 2.173RPL39L 2827185 0.00567115 1.518SAR1A 2604254 0.00570971 -1.634SLC7A1 2664209 0.0057896 1.853OXTR 3463112 0.00582871 7.496FZD6 3917938 0.00586388 1.715EN1 3969422 0.00627971 -1.832SOD2 3980560 0.00628844 -2.184C1R 3592511 0.00635134 -3.213TNFAIP2 3061319 0.00640823 -1.732TJP2 2769182 0.00648476 2.028CDC6 3371003 0.00649997 1.974PLK1 2485636 0.00654411 2.190RPS15A 2555252 0.00690641 -2.505C8orf40 3772279 0.00692185 -1.742C3 3308864 0.0070344 -2.871RFC3 3636562 0.00703787 1.714MSC 2957126 0.00712518 -1.794CCNB2 3286776 0.00718261 1.939ABCA6 4054204 0.00720254 -2.795UBE2T 3631397 0.0072077 2.239KIAA1524 3373675 0.00722977 1.562KIF4A 2628785 0.00728368 2.014CDC42EP3 2609347 0.00732741 1.740BCL3 3442475 0.00736729 -2.104ADH1B 3031624 0.00742888 -4.172LMNB1 3415668 0.00760431 1.766NRBF2 3590014 0.00772067 -1.676NDST2 3442322 0.00777123 -1.627MMP16 2772566 0.00779049 1.959ABCA9 3232979 0.00786924 -1.512MDK 3872398 0.00790572 1.680KIF2C 3123541 0.0081744 1.920MCM5 2709606 0.00819643 1.753CPZ 2825629 0.00846528 -3.198AXUD1 2709631 0.00848959 -1.602AKR1C3 2779231 0.00876774 -5.469IL10RB 2394608 0.00897028 -1.753SESN1 3312490 0.00917771 1.509TP53I11 2813414 0.00919847 -2.204C10orf26 2701109 0.00924152 -1.535PPFIBP1 3367338 0.00929616 1.877POMGNT1 2416218 0.00939436 1.532
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
KIF23 2916716 0.00941001 1.803HMGB2 3721658 0.00948578 1.883PPL 2702395 0.00957097 -2.197RRM2 3091797 0.00970319 3.707FAM110B 3623948 0.00975692 -3.089VEPH1 2786322 0.00975714 1.694FAM127B 3356417 0.00980213 -1.637SACS 3599811 0.00983489 2.033BCAT1 3886576 0.0100792 2.603RACGAP1 3175494 0.0101026 1.966BUB1B 3821893 0.0101138 1.502TGFBR1 2451200 0.0101757 -1.729KIF18A 2640449 0.010214 1.692AKR1C2 3145980 0.0102684 -6.194GRK5 3385307 0.0104556 -1.831CEBPD 2401333 0.0105308 -1.728PLAC8 2477073 0.0107269 1.758PPARG 3821263 0.0109845 -1.684STAT3 2838201 0.0109989 -1.690NCAPG 3910785 0.0111063 2.217OR10G9 2914777 0.0111153 -1.726AKR1C1 2779823 0.0111198 -9.188COL12A1 3247757 0.011672 1.729HNMT 3294816 0.0117739 -1.922HMMR 3084950 0.0119043 1.661BUB1 3234760 0.0119644 1.961RGS4 2681114 0.0120625 13.967FOXD1 3339167 0.012078 1.531SERPING1 3409211 0.0120825 -4.053RAD18 2881413 0.0121936 1.568TBC1D16 3728964 0.012352 -1.835PFN2 3400586 0.012425 3.407RIPK3 3944147 0.0124522 -2.493CASC5 3190242 0.0127965 1.598PENK 3644340 0.0128686 -1.568TMEM176B 3363266 0.0130605 -7.371RAB11FIP2 3485074 0.0132067 -2.473FLJ14154 3181728 0.0132176 -1.543MITF 2571457 0.0138376 -1.537TPX2 3350830 0.0140158 2.387XRCC4 2791197 0.0141255 1.528MTF2 2466002 0.0141723 1.688HIST1H2AB 3736636 0.014403 1.862IGSF10 2669930 0.0144485 -2.837FEZ1 3250699 0.0146392 -1.579NETO2 2473284 0.0146455 2.050ALDH1B1 3108859 0.0146843 -1.770CENPK 3962578 0.0146843 1.699SLC3A2 3595979 0.0146907 1.645GLIPR1 2923939 0.0147976 1.963CEBPB 2982319 0.0148626 -1.609
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
HIST1H1D 3770944 0.0149175 1.845DAZAP2 3415229 0.0149661 -1.732FAM133B 3706659 0.0149774 -2.199CPXM2 4004853 0.0150137 3.402OSR1 3331903 0.0154197 -1.943TES 2720251 0.0163287 4.739ADH1A 3274758 0.0164996 -5.302CSPG4 3408733 0.0166679 2.416C14orf4 3850166 0.0167326 -1.532CDCA3 3266408 0.0167721 1.555LOC339803 2933175 0.0168226 1.773MFHAS1 3776139 0.0168936 -1.538SLC38A1 2334098 0.0171338 -2.094LRPAP1 3060332 0.0172455 1.770CHST13 3452231 0.0172976 -1.542NUF2 2525989 0.0173142 1.914UBL3 2991150 0.0173691 2.036LCE3D 3768703 0.0175167 -1.559TNFSF4 2928690 0.0176428 5.148ZNF436 2925953 0.0176474 -2.171NTN1 3821908 0.0178958 -1.660STEAP4 3061438 0.0179291 -1.495CCDC23 3186491 0.0179343 -1.726E2F7 2572909 0.0181689 1.641ALDH3A2 3331355 0.0183593 -1.531TRIP13 3638204 0.0184934 1.921C10orf72 3768791 0.0186969 -1.710ASPM 3593931 0.0187078 1.813CXCL12 2542420 0.0189346 -3.084LNX2 2359483 0.0190485 1.502GLDN 3815116 0.0190959 -3.654ME3 2559494 0.0192793 -1.653IGF1R 3481543 0.0192924 -2.126GCNT1 3248897 0.0194033 1.737SGK1 2793951 0.0196832 -3.044DEPDC1 3550278 0.0198377 2.744CXCL1 3321361 0.0198453 -3.752ZFP36L2 2515627 0.0205234 -1.997FANCI 3398241 0.020578 1.641OCIAD2 2534354 0.0207422 1.778SLC7A11 3143660 0.0207611 3.324TNXB 3447694 0.0208623 -1.871PKIG 2838656 0.021068 -2.123GPR153 3069366 0.0212365 -1.595PSMC3IP 3335029 0.0212657 1.603STEAP2 2378937 0.0212825 -2.506MELK 3078435 0.0213076 1.649HJURP 3293244 0.0213645 1.820ARHGAP20 2731381 0.0214619 -1.549C13orf33 2609414 0.0215403 -2.499FGF7 2530539 0.02162 -3.963
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
GPX3 2595252 0.0219728 -1.537FAM86C 3595691 0.0219977 -1.713TGIF1 3345427 0.0220187 -1.535CDK6 3678462 0.0220781 2.392AIG1 2779199 0.0223521 2.558C3orf64 3838094 0.0224123 1.741C10orf104 3848039 0.0224308 -1.545C1QTNF1 3403168 0.0224761 -1.644KIAA1305 4004575 0.0225886 -1.824STX8 3689880 0.0227551 -1.532FGF9 3553531 0.022926 -3.336SELENBP1 2946219 0.0229945 -1.963CKAP2L 3168385 0.0231074 1.533UACA 2806468 0.0231907 2.887EIF4EBP2 3267036 0.0233213 -1.737ZDHHC14 3726154 0.0237302 -1.501KIAA1324L 3645901 0.0238599 -3.724GJC1 2676854 0.0240108 2.216LCE1F 3714068 0.0241222 -1.839KRT33A 3572869 0.0241482 -1.867FLJ42875 3353876 0.0242117 -1.533ZFP36 3020192 0.0242434 -3.485CYB5A 3661152 0.0242871 -2.194BNC1 3286602 0.0245187 1.740ZBTB44 3020343 0.0246826 -1.743PRDX6 3984655 0.0250494 1.740AADACL1 3449068 0.0254149 2.176LIPC 2955673 0.0254541 -1.752SPRR4 3505319 0.0254772 -1.505TNFRSF10A 2809128 0.0255198 1.682TNKS1BP1 3661718 0.0255419 -1.542TMEM176A 3565663 0.0255534 -5.953JUNB 2803329 0.0256169 -2.959VPREB3 3310953 0.0256674 -1.558SPATA13 2751066 0.0257097 -1.604C2 3011861 0.0257838 -1.621ITGA1 3136271 0.0261505 2.514ITGB3BP 3473378 0.0262557 1.690PALM 3355733 0.0263375 -1.664SRPX 3690154 0.0263614 -1.980CYP7B1 2536071 0.0265017 -1.650PRLHR 2899298 0.0265337 -2.164ITGA11 3289235 0.0271901 2.023C1S 3628832 0.0274148 -2.557FAM111B 3558270 0.0276023 1.640CCNB1 2451693 0.0277572 2.635SPON1 3173880 0.0279479 -1.943CDC42EP2 2805078 0.0280437 -1.683LRRFIP1 2397948 0.0281064 1.618WNT5B 2469252 0.0282393 1.657CCND1 2422722 0.0283645 1.537
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
BOC 2975014 0.0285829 -1.790CNN1 2779271 0.0285956 1.691DOCK10 3416344 0.0286442 2.473PDGFRL 2634027 0.0290396 -2.596LOC440104 3510858 0.0293146 -1.647SAMD9 2449559 0.0294544 2.151SH3BP5 3327057 0.0296048 1.939FMOD 3040363 0.0297819 -2.289DKK3 3756880 0.0301248 2.384SERINC5 2626802 0.030209 1.981BIRC5 3099566 0.0302512 1.651TGFBR3 2325410 0.0307456 -2.281TWIST1 2417528 0.0309176 -1.721HOXC9 3844978 0.0312264 -1.835SIM2 2364438 0.0313593 -1.698CHST2 2902844 0.0314223 -1.603SSPN 2549565 0.0317076 1.592HIST1H3J 3941793 0.0319314 1.896CDH6 3247818 0.0323841 -2.254PNRC1 2714955 0.0324983 -1.540ABL1 3079172 0.0325087 -1.570FTO 3757840 0.0325873 -1.922SLIT3 3454223 0.0326355 -1.843C2orf7 2533999 0.0326509 1.522BDKRB2 2717857 0.0328578 -1.874BASP1 3948640 0.0328851 -1.546FTL 3920171 0.0329281 -2.458NCAM1 2420521 0.0329773 2.686HMCN1 3907524 0.0329978 3.565SLC1A4 3402150 0.0332329 1.675FLJ14213 3134013 0.0333443 1.892NFIL3 2687979 0.0335938 -2.526CENPO 3610958 0.0339255 1.558SQRDL 3507798 0.0343638 -2.555PALLD 3448152 0.0343725 2.027DTL 3773241 0.0344908 2.114HRK 3349858 0.0348409 -1.553NNMT 2662020 0.0349293 -1.622MFGE8 2862317 0.0351287 2.683ZFP36L1 2444283 0.0351721 -2.101RAB9A 2961177 0.0352972 -1.804EPHA2 3169331 0.0353157 1.497CUGBP2 3744965 0.0355978 -2.982CLDN23 3315675 0.0358241 -1.628ZNF671 2364381 0.0358764 1.520NR4A1 2388219 0.0361551 -1.912C20orf19 3683018 0.0362203 -1.767FLI1 3414846 0.0363815 1.643RGS10 2367743 0.0364865 -1.496FBLN1 3781980 0.036539 -3.269EXTL3 3879372 0.0366776 1.786
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
CHDH 3569754 0.0367117 -1.675MKI67 3338192 0.0372003 1.879AURKA 3832978 0.0372202 1.551SMPDL3A 3720896 0.0372212 -1.662FMNL2 2409069 0.0373217 1.511CDC20 3561039 0.0373638 3.282PTPRG 2367843 0.0375304 1.870C2orf43 3558226 0.0375977 1.564UBE2D1 2449104 0.0379042 -2.009MCM3 2510713 0.0379185 1.541ADH1C 3233049 0.0380399 -2.033C9orf19 3147508 0.038137 -2.070PAPPA 3333711 0.0386603 -2.315TENC1 3759335 0.0386699 -1.506ASPA 3059942 0.0390487 -1.753CPS1 2550522 0.0390995 1.606C15orf41 3087703 0.0391053 1.695ANK2 3593408 0.039459 -1.506DNM1 2359431 0.0397299 -2.328C11orf44 3774906 0.0398042 -1.755KIAA0232 3251353 0.040205 1.610ITPR2 3390641 0.0405861 1.642TNFAIP8L3 2601648 0.0406184 -1.761KLF10 2835715 0.0409664 -2.355HIBCH 3416996 0.0409742 1.586SNED1 2902178 0.0413415 -1.922SOCS3 3454892 0.0414684 -2.434SLC38A4 2798915 0.0415091 -2.581OSR2 3607537 0.041664 -4.140SSX2IP 4012154 0.0422927 1.551LTBR 3507003 0.0425149 -1.610SGMS1 3739867 0.042541 -1.562IQGAP3 3191724 0.0426045 1.553C2orf33 3484117 0.0427105 -1.735OR2M7 3468743 0.0427127 -1.779C10orf10 2869880 0.0427347 -2.288CRIM1 2435005 0.0427609 1.672PLTP 3329343 0.0430075 -1.629RPS4X 2768654 0.0431855 2.077B3GALT2 3480885 0.0432971 2.776HUNK 3402444 0.0434849 -1.685SUMO1 2705748 0.0440333 -1.653WISP2 2700585 0.0440871 -3.240WNT2 2371873 0.0443603 -1.655BTN3A2 3746574 0.0445299 1.698IL15RA 3396593 0.0446539 -1.540EMX2 3529951 0.044934 -2.202TSPAN13 3349293 0.0451233 2.963C18orf17 3452417 0.0457119 -1.737DHRS3 2949622 0.0458198 -1.918SNAI1 2864449 0.0458869 -1.875
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Unaffected)EFMR female / control female results P<0.05 and fold change greater that +/- 1.5
ADH5 3396770 0.0459776 -1.497SLC8A1 2570616 0.0460634 2.068PTTG1 3750785 0.0461586 2.077ZIC1 2661992 0.0464511 2.699SLC9A3R2 3422855 0.0465817 1.652KIF20A 3275690 0.0468067 2.386PMP22 3127775 0.0468991 -2.995IL7R 2576608 0.0472184 2.775NT5DC3 3884892 0.0473479 1.638H3F3B 3264621 0.0474247 -1.647MASP1 2968652 0.0478165 -3.362RPS14 2758298 0.0478744 1.738SH3BP5L 2947095 0.0479048 1.547KLF11 3776504 0.0479788 -1.769PDIA4 3736290 0.0481283 1.528DARS2 2397025 0.0483155 1.708NFKBIA 2543066 0.0484472 -2.272ENPP5 2465902 0.0484758 -1.508SCFD2 3817698 0.0486249 2.262STAT5A 2946364 0.0486254 -1.628IFITM1 3888613 0.0486565 -2.045PDCD4 3168508 0.0493248 -1.933FOXO1 3288518 0.0493751 -1.499TMEM47 2830638 0.0493839 -1.545IGJ 2646125 0.0497838 1.537TAGLN 3067302 0.0498871 2.652
Appendix Table C1
Gene Symbol Transcript ID p-value(Status) Fold-Change(Transmitting vs. Control)NFX1 3166880 9.34E-05 1.496N6AMT2 3504392 0.000542238 1.711JMJD4 2459296 0.000653534 -1.504LOC400590 3717034 0.000685502 1.683UQCC 3903889 0.000924353 1.563TRIM22 3318443 0.00145782 2.229ARHGAP12 3283920 0.00173839 1.570HIST1H2AH 2899772 0.00203518 -1.704HMG2L1 3944046 0.00215696 1.548PARN 3681377 0.00260115 1.504TMEM136 3352485 0.00260206 1.676PYGL 3564210 0.00267381 1.523ABTB1 2640916 0.00327271 -1.621LOC147804 3840857 0.00337753 -2.586STAT3 3757840 0.00340748 1.536EPB41L3 3797032 0.00341221 1.663TOP2B 2666478 0.00360563 1.517CCDC56 3758148 0.00384809 1.785CCDC59 3464000 0.00441927 1.703EPHA2 2397948 0.00479116 -1.517PIAS1 3599280 0.00503791 1.523UVRAG 3340697 0.00553045 1.579ESCO1 3800779 0.0063103 1.644PATL1 3374746 0.00648501 1.740TRIM5 3360622 0.00715986 1.556EWSR1 3941907 0.00763759 1.580DENND4C 3164221 0.00791718 1.519ZCCHC6 3212976 0.00826616 1.611GFPT2 2890660 0.0082905 1.593SETX 3228007 0.00875389 1.634JARID1A 3439603 0.00875551 1.496LTA4H 3466740 0.00889094 1.828CENTA1 3034987 0.00903216 -1.619TIMM9 3566652 0.00911823 1.572ZBTB41 2449619 0.00927917 1.520ISCU 3430776 0.00964445 1.506UBE2L3 3938175 0.0102405 1.575SAMHD1 3904691 0.0103613 2.522MRPL10 3760945 0.0109506 1.552NAE1 3695268 0.0110794 1.503TROVE2 2372924 0.0110806 1.644C11orf1 3348748 0.011091 1.497TEX10 3217807 0.011481 1.502SPG11 3621948 0.011483 1.608MGC16169 2780734 0.0120577 1.620MAN1A1 2971801 0.0122405 1.779C1orf78 2406662 0.0126673 -1.551USPL1 3484005 0.0127152 1.588TMEM2 3209384 0.012779 1.844ARHGAP21 3281621 0.012829 2.009UQCRC2 3652218 0.0130186 1.576ZNF507 3828887 0.0132677 1.637IFIT2 3257192 0.0136824 1.925
Transmitting male / control male results P<0.05 and fold change greater that +/- 1.5
Appendix Table C2
Gene Symbol Transcript ID p-value(Status) Fold-Change(Transmitting vs. Control)Transmitting male / control male results P<0.05 and fold change greater that +/- 1.5
ESF1 3898224 0.0137552 1.565SESN3 3387259 0.0139994 3.009TPP2 3499453 0.0142032 1.610LOC152217 2659676 0.0142871 -1.506MCCC1 2707824 0.0147184 1.649FAM118B 3355021 0.0148583 1.539GLT8D2 3468888 0.0148649 1.679ZBTB33 3989089 0.0149521 1.540TST 3959918 0.0152167 -2.050CSF2RB 3944564 0.0153545 -1.564OPCML 3399004 0.015601 -1.700KTI12 2412690 0.0157804 1.553TMEM126A 3343008 0.0158439 1.864HSDL2 3185205 0.0159304 1.760OBFC2A 2520533 0.0160804 1.694LIPA 3299585 0.016171 2.162C11orf48 3375999 0.0162109 2.266FTO 3661152 0.016493 1.523SELL 2443450 0.0172633 -1.738VPS35 3689922 0.0176977 1.607XRN2 3879467 0.0179792 1.556UBE2F 2534564 0.0184649 1.914PGD 2319802 0.0185541 1.782DTX3L 2638962 0.0186412 1.956UNC5B 3250990 0.0191776 -1.775NSMAF 3136782 0.0191911 1.699FIG4 2920962 0.0192706 1.567MRPL15 3098454 0.019328 -2.524NCOA3 3887635 0.0193561 1.558STAT1 2592268 0.0193965 1.979ACO1 3166477 0.020037 1.640IFI16 2362394 0.0200736 1.928IPO8 3449304 0.0201772 1.554
2339328 0.0202563 1.645ATM 3347658 0.0204868 1.685CTR9 3320301 0.0208405 1.667PSMD5 3223646 0.0210303 1.676STARD4 2870828 0.0212093 1.880BTAF1 3257938 0.0212901 1.576EEA1 3465593 0.0213964 1.840EIF2AK1 3037193 0.0215023 1.538SLTM 3626704 0.0219294 1.537EHBP1 2484970 0.0225107 1.634LYRM5 3408573 0.0225977 2.318PBLD 3292590 0.0227243 1.621NOL5A 3873874 0.0229909 -1.655PARP9 2692060 0.0233101 2.052BNC2 3200040 0.0239224 1.797SBF2 3362468 0.0246953 1.672LOXL3 2560286 0.0247208 -2.579AK3L1 2340315 0.0247874 -1.858SCARA3 3091475 0.0248025 1.816NAP1L1 3462843 0.0251459 1.622
Appendix Table C2
Gene Symbol Transcript ID p-value(Status) Fold-Change(Transmitting vs. Control)Transmitting male / control male results P<0.05 and fold change greater that +/- 1.5
COMP 3855218 0.0253724 -3.131MGST3 2365119 0.0258111 1.626ACOX1 3771215 0.0259135 1.671TMEM135 3343546 0.0259349 1.687URM1 3190394 0.0259363 1.496MRPL50 3218067 0.0261884 1.550
2357193 0.0265663 3.233MGC72080 3062665 0.0269627 -1.948WDR45 4007774 0.0270975 -1.505DKFZP434P211 3939952 0.0279223 -2.306ZNF417 3843662 0.0280726 1.906
3893716 0.0283497 1.517BRE 2474791 0.028569 1.593UBR5 3147321 0.0285856 1.518LOC285636 2807862 0.0296148 1.633GPR177 2417390 0.0296343 2.855TFPI 2591421 0.0297131 1.580EPB41L2 2973995 0.0300779 1.741TDG 3429365 0.0301093 1.766USP33 2419113 0.03035 1.498CTNNAL1 3219621 0.0310194 1.676C7orf24 3044129 0.0312739 1.539HOXB3 3761313 0.0316707 -1.628IL1A 2571483 0.0317077 -1.695C18orf17 3781980 0.0320697 1.639PPM2C 3107342 0.0328501 1.539IFIT1 3257246 0.0332179 2.334CENPA 2473991 0.0332256 -1.498ATF5 3839103 0.0334389 -2.292HOXD4 2516912 0.0334479 -1.576AKR1C3 3233049 0.0337528 2.199SH3BP5 2664209 0.0339706 1.496BBS9 2996321 0.0341617 1.508ABCC9 3446919 0.0345437 4.574CYP4A22 2335048 0.0350868 -1.728SNORA44 2403557 0.0351099 1.639KRTAP5-6 3316987 0.0354643 -2.015CYB5A 3813297 0.0355387 2.307C14orf108 3537557 0.0356187 1.574PPP1R7 2536183 0.035734 1.578BLOC1S3 3836135 0.0362499 -1.565USP8 3593652 0.0363073 1.567CACNG8 3841157 0.0364972 -1.514SSTR1 3533184 0.0367379 -1.801IFIT3 3257204 0.0369911 2.182IFIT5 3257268 0.0372414 1.641RBM38 3890597 0.0375678 -1.657MAP3K8 3240987 0.0375775 1.503SLC7A5P1 3684100 0.0376383 -1.745MSI2 3728147 0.0378274 -1.697SNAP23 3591006 0.0379103 1.550TMEM50B 3929664 0.0381312 1.551PAPD1 3283378 0.038525 1.588
Appendix Table C2
Gene Symbol Transcript ID p-value(Status) Fold-Change(Transmitting vs. Control)Transmitting male / control male results P<0.05 and fold change greater that +/- 1.5
VPS13B 3108901 0.0385557 1.578PCMTD2 3894047 0.0386923 1.603LOC157740 3124360 0.0390263 -1.517IL32 3645626 0.0391672 -1.581PAQR4 3645477 0.0400818 -1.713BTN3A3 2899413 0.0402298 2.230TRAF3IP2 2969810 0.0402767 1.704MID1 3999395 0.0404388 1.760REV3L 2969677 0.0405306 2.722C14orf162 3570218 0.0405886 -1.577RPL17 3807487 0.0408302 1.869CCL2 7385547 0.0416219 2.135ZNF367 3216319 0.0417263 -1.498EDN1 2895244 0.0418852 -1.652ADRA1B 2837970 0.0419381 -1.695ISL2 3602634 0.0426696 -1.543BLOC1S1 3416909 0.0427077 -2.046HSPA2 3540136 0.0427323 -2.487UBE2D1 3247757 0.0429564 1.711NUP37 3468261 0.0430644 1.800UBL5 3820161 0.0433763 -1.584EMILIN2 3776279 0.0439531 -1.642LOC116349 2845342 0.0447462 -1.675MGC34796 2339109 0.0454492 -1.804SLC35A1 2916345 0.0457038 1.552PTBP2 2348060 0.0460825 1.616RABGAP1 3188299 0.0466788 1.794SDCBP 3099750 0.0468848 1.582SPATA18 2726910 0.0468942 1.550CALB2 3667508 0.0470496 -1.862PLSCR1 2699726 0.0470877 1.791PIK3R1 2813060 0.0472201 1.726
3551120 0.047344 -3.218MYO1E 3626826 0.0474929 2.257KIAA1826 3389529 0.0475693 1.637POPDC3 2967276 0.0476137 1.540HTR3D 2655308 0.0476616 -1.524HIST1H4E 2899216 0.0478489 -1.581MGC27348 2992936 0.048102 -1.619PAX3 2600881 0.0481901 -1.604EIF1AX 4002148 0.0485908 1.806ZNF468 3869847 0.0489033 1.591LYRM4 2939892 0.0491781 1.585GTF2B 2421753 0.0492796 1.916PSMA2 3047963 0.0496745 1.506MGST1 3406589 0.0497923 1.790
Appendix Table C2
and fold change greater that +/- 1.5Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Control)T1560 3099561 0.000910698 -1.710OR10G9 3353876 0.00100223 -1.562IFI44 2343511 0.00127293 2.102SACS 3505319 0.00130662 1.618VDAC1 2875954 0.001613 -1.720
3724917 0.00162084 -1.625BCL3 3835726 0.0016926 -1.530LOC142937 3233686 0.00196301 -1.551XRCC4 2818454 0.00196924 1.516TCF7L2 3264621 0.00251706 -1.576CLIC6 3919278 0.00262026 -1.620LCE1F 2359431 0.00291481 -1.851C2orf43 2543066 0.00318606 1.549A4GALT 3962578 0.00350144 -1.528GPR19 3445028 0.00446837 -2.871HHLA3 2341645 0.00454418 -1.584ADRB3 4049835 0.00508465 -1.575LOC339803 2555252 0.00509234 1.869FAM111B 3331903 0.00633063 1.621RGS4 2364381 0.00638692 5.356PDGFC 2791197 0.00715098 2.064SH3BP5 2664209 0.00755751 1.605DPPA3 3403414 0.00777364 -1.531
2845417 0.00845196 -1.550APOBEC3B 3945545 0.00894806 1.660NEDD8 2344450 0.00919384 -2.799NEU2 2532681 0.00968077 -1.696CPZ 2717857 0.00972393 -1.848GPR133 3438061 0.0104755 -3.627PCK1 3890640 0.0106633 -1.529ZBTB12 2949570 0.0109488 -1.528RFC3 3485074 0.0111802 1.592OCIAD2 2768654 0.0113261 1.564SPRR1A 2359492 0.0113963 -1.624OR6N2 2439508 0.0115582 -1.825TRIM2 2748061 0.0116125 1.522OR2AT4 3382175 0.0121367 -1.654OR1L8 3224333 0.0124608 -1.799KCNQ1DN 3317482 0.0124729 -1.840C20orf91 3881045 0.0124957 -1.760GZMM 3815005 0.0133313 -1.517PALLD 2751066 0.0136003 1.729LOC220594 3748400 0.0141778 1.848SIM2 3920171 0.014318 -1.557
3959185 0.0143798 -1.519RPL6 3472089 0.014691 -1.753GAS7 3744965 0.0150009 -1.602KRTAP3-1 3756668 0.0153822 -1.803SOD3 2721633 0.0156568 -1.567LRRFIP1 2534456 0.0163243 1.723
EFMR female / all control (n=3 female and n=3 male) results P<0.05
Appendix Table C3
and fold change greater that +/- 1.5Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Control)
EFMR female / all control (n=3 female and n=3 male) results P<0.05
LCE5A 2359282 0.0164104 -1.516DAPK2 3628832 0.0178112 -1.732SNAI1 3888522 0.0179721 -2.020PRKY 4029152 0.0180676 -1.717HUNK 3917938 0.0181047 -1.734HMGB2 2793951 0.0182767 1.607SAMD9 3061438 0.0187522 1.770NCAM1 3349293 0.020411 2.056C14orf178 3545550 0.020697 -1.522AIG1 2928690 0.0208191 1.595PRKAR2B 3018375 0.0213603 1.518SPINT3 3907311 0.022635 -2.077LPCAT2 3661718 0.0227291 1.722EFNB2 3524570 0.0229814 2.499EMX2 3266408 0.0234597 -1.743OR10G7 3395817 0.02358 -1.766IGJ 2772566 0.0242317 1.540CX3CR1 2669979 0.0244163 -1.643ENPP4 2909020 0.024509 -1.691FAM26D 2922732 0.0246811 -2.221GLRB 2749191 0.0246914 1.603RTP4 2657025 0.0247527 -1.677DEPDC1 2417528 0.0250279 2.011B4GALT1 3203413 0.0253888 -1.678OR2M7 2465902 0.0259166 -1.804CXCL2 2773434 0.02607 -1.571MBL1P1 3254091 0.0263732 1.513CENPK 2859667 0.0264495 1.736ARP11 3078948 0.0268526 -1.524NETO2 3690154 0.0276919 1.745FAM18B 3713539 0.0277875 -1.677CXCL6 2731350 0.029091 -1.673
2766532 0.0295247 -1.515ARSK 2820865 0.0297346 1.656C3orf14 2627080 0.0299273 1.649C3 3848039 0.03037 -1.942TFRC 2712632 0.0307907 1.557KIAA0101 3629103 0.0308168 1.550OR2V2 2844987 0.0314177 -1.714HGF 3058944 0.0323519 1.934POMZP3 3057755 0.0324585 -1.546NUF2 2364438 0.0325146 1.711DLG7 3565663 0.032821 1.570HIST1H3J 2947095 0.0330062 1.536FAM110B 3099566 0.0338126 -1.667IFITM3 3357840 0.0341074 -1.808CLEC14A 3561868 0.0341465 1.741ZFY 4028568 0.0344891 -2.132CYP2A6 3862873 0.0346733 2.311ENPP1 2925953 0.0348632 2.949
Appendix Table C3
and fold change greater that +/- 1.5Gene Symbol Transcript ID p-value(Status) Fold-Change(Affected vs. Control)
EFMR female / all control (n=3 female and n=3 male) results P<0.05
WFS1 2716953 0.035254 -1.575CDC6 3720896 0.0355591 1.570HMMR 2838656 0.0363601 1.571SELI 2473784 0.0364902 1.574RAB42 2327572 0.0373365 -1.590MGC34796 2339109 0.0374659 -1.598CSH2 3766453 0.0376662 -1.688PPL 3678462 0.0379456 -1.523OR4N4 3583382 0.0384048 1.642IFNA2 3201319 0.0389999 -1.794A26C1A 2505993 0.0392176 -2.031TJP2 3173880 0.0399409 1.513VWA1 2315894 0.0402292 -1.522LOC286161 3082590 0.0416354 -1.733MET 3020343 0.0420184 1.795SLC38A5 4007437 0.0425189 -1.525IGFBP5 2598828 0.0431064 4.621C8orf13 3124388 0.0440673 -1.514DDX3Y 4030162 0.0447391 -4.087C8orf77 3121002 0.0449023 -1.501BCGF1 3663393 0.0449897 1.700WNT2 3069366 0.045124 -1.524RAB43 3689880 0.0453066 1.556RPS4Y1 4028512 0.0453398 -8.954BUB1 2570616 0.045374 1.527ACCN3 3031800 0.0454387 -1.506CXCL12 3286602 0.0455067 -1.823AKR1C2 3274758 0.0464347 -2.718PFN2 2700585 0.0470573 1.822HIBCH 2592005 0.0474983 1.583TTK 2914777 0.0477382 1.524UQCRFS1 3857691 0.0478125 -1.510DCBLD1 2922972 0.0479219 1.630ABCC3 3726691 0.0479551 -1.524UNQ1829 3498476 0.0486064 1.847C21orf99 2576788 0.049078 -1.631LOC4951 3062738 0.0493403 -1.809
Appendix Table C3
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)NLGN4Y 4030371 2.71E-06 3.561USP9Y 4030063 2.28E-05 3.586RPS4Y1 4028512 2.59E-05 74.835EPHA2 2397948 0.000107194 1.711STAT1 2592268 0.000139913 -2.117TMEM126B 3342983 0.000210038 -1.805KLF4 3219215 0.000239021 -4.470DDX3Y 4030162 0.00033042 18.679OSR2 3108859 0.000472157 -10.282TNFAIP8 2825629 0.000558926 -2.018ZFY 4028568 0.000719864 2.519CYorf15A 4031068 0.000845549 1.947ITPR2 3448152 0.000947717 1.543UTY 4035017 0.000974345 2.284TMTC1 3449068 0.00102152 -11.796N6AMT2 3504392 0.00105834 -1.765RYBP 2682436 0.00110127 -2.232FABP3 2404418 0.00121643 -3.968SPC25 2585933 0.00124507 1.587KRT19 3757108 0.00130048 3.267PMP22 3746574 0.00141736 -3.416GPR177 2417390 0.00147625 -3.297C1R 3442475 0.0016634 -3.018EIF1AY 4031136 0.00171164 6.377RRM2 2469252 0.00174792 3.242ABBA-1 3697183 0.00185594 -1.630ADAMTSL1 3163982 0.00190831 2.201CCBL2 2421782 0.00195557 -1.902ADAMTS5 3927480 0.00205209 -3.134DCN 3465274 0.00209972 -2.491CAT 3326400 0.00214991 -1.639AKR1C3 3233049 0.0022922 -4.534HDAC9 2991395 0.00238267 1.546ENPP1 2925953 0.00255388 6.593RGS4 2364381 0.00267105 3.165GAB1 2745547 0.0026994 -1.570LAMB1 3067302 0.00272439 1.795ZNF313 3888474 0.00272966 -1.607HIST1H3J 2947095 0.00293117 1.947CXCR7 2533999 0.00335555 -2.564RAB9A 3969422 0.00349398 -2.438EIF2S3 3971877 0.00374606 -1.592MITD1 2566645 0.00418361 -1.661LYRM5 3408573 0.00446336 -1.874C1S 3403168 0.00452818 -2.672ITGA3 3726154 0.00481506 3.670EIF3H 3149754 0.00512634 -1.675DAZAP2 3414846 0.00520945 -1.778STAT3 3757840 0.00538839 -1.575EML1 3551485 0.00571306 -1.921CYB5A 3813297 0.00577089 -2.904
Control male / control female results P<0.05 and fold change greater that +/- 1.5
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
CDON 3396770 0.00581547 -5.456CYP1B1 2548699 0.00582809 -2.748KRT18 3415576 0.00586147 5.292HTR3D 2655308 0.0058632 1.513DOK5 3889833 0.00595001 -4.908SMAD2 3806905 0.00603265 -1.515CST6 3335894 0.00603599 2.228CYBRD1 2515240 0.0061245 -1.637CDC14B 3216356 0.00613392 -1.672ADAMTSL1 3164086 0.00623306 2.336TP53I11 3371003 0.00648618 -2.099ADAM33 3895552 0.0066063 -1.617MMP16 3143660 0.00697037 2.022LMCD1 2609347 0.00710048 -2.348BOC 2636319 0.00720732 -1.675TRHDE 3422458 0.00726719 2.253CCDC56 3758148 0.00743544 -1.577C15orf41 3588658 0.00755501 1.569MET 3020343 0.00762705 3.149TMEM97 3715489 0.00767951 -2.158CFB 2902844 0.00772908 -2.163C2orf33 2530539 0.00773054 -2.544UACA 3631397 0.00780411 2.211SNX9 2933331 0.00782761 -2.387ANGPTL2 3225855 0.0082248 -3.327KIF5A 3418298 0.00837411 -1.509PYGL 3564210 0.00837877 -1.752CBX6 3960930 0.00838864 -1.664HSDL2 3185205 0.0083973 -1.829C10orf72 3288518 0.00853703 -1.799RSPO3 2924851 0.00873472 -11.011KREMEN1 3941793 0.00881676 -1.562NTF3 3402150 0.00884083 2.167LNX1 2769346 0.00904578 1.510FBLN1 3948640 0.00906513 -3.502KLF13 3587015 0.00914106 -1.589ZNF436 2401333 0.00914135 -2.533EFNA5 2869880 0.00917373 -2.489LOH3CR2A 2609414 0.00930861 -3.351CAMK2N1 2400177 0.00947539 -2.487PAPPA 3186491 0.00949155 -2.844ITGA6 2515627 0.00965705 6.301RABGAP1 3188299 0.00977795 -1.631ZNF367 3216319 0.00998584 1.503HIST1H2AL 2900091 0.0102802 3.249TMEM135 3343546 0.0104426 -1.652ZNF185 3995392 0.0105402 1.663TBC1D16 3773241 0.0108614 -1.994LNX2 3507003 0.0110553 1.555SYAP1 3970130 0.0110779 -2.341FAM118A 3948543 0.0113685 -2.377
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
SLC9A9 2699145 0.0115078 -3.567GALNT6 3454892 0.0116145 2.391ZNF234 3835467 0.0116575 -1.634WTAP 2934089 0.0118674 -1.570FTH1 3375648 0.0125336 -1.989MAGOH 2413180 0.0127997 -1.954MLLT3 3200982 0.0128155 -1.561C1RL 3442514 0.0128164 -1.790DST 2958325 0.0128336 1.600TGFBR3 2422722 0.0130168 -2.612AK3L1 2340315 0.013112 1.864NUDT11 4008427 0.0137182 -1.583FAM118B 3355021 0.0138185 -1.917GALNT5 2511603 0.0138877 1.741C7orf41 2995254 0.0139472 -1.609EWSR1 3941907 0.0139595 -1.634HOMER2 3636391 0.0140404 1.544SFRS5 3542207 0.0140796 -1.496BIRC5 3736290 0.0142518 1.532CHMP4B 3882681 0.0143034 -1.594DNAJC8 2403470 0.014483 -1.607PPP2R3C 3560864 0.0148497 -1.501TBC1D8 2567447 0.0151679 -1.709PHF11 3489481 0.0155265 -1.725UBE2E3 3969604 0.0155444 1.658SRGN 3250146 0.0158775 4.736GK 3972929 0.0159581 -1.818HIST1H4B 2946208 0.0160906 1.633CTNS 3706700 0.0161136 -1.627SPG20 3509719 0.0162897 -1.884EIF1AX 4002148 0.0166536 -2.808LSM6 2746269 0.0168156 -2.010SLC7A5P1 3684100 0.0168996 1.679UNQ1887 3474697 0.0170189 -1.543MAN1A1 2971801 0.0172126 -2.240ZFP36L2 2550522 0.0173176 -1.992SDPR 2592532 0.0175741 1.703OPCML 3399004 0.017623 1.626PPFIBP1 3409211 0.0177961 1.512NXN 3739867 0.0179153 1.732PMAIP1 3790704 0.0179245 1.559IQGAP3 2438282 0.0179296 1.562BRE 2474791 0.0180482 -1.579ABCA9 3768703 0.0180532 -1.750CPXM2 3310953 0.0180625 3.698DDHD1 3564997 0.0181162 -1.660C18orf17 3781980 0.018546 -2.090MT4 3662086 0.018803 1.517ACO1 3166477 0.0188361 -1.592DOCK5 3090512 0.0188413 1.826PSG4 3863929 0.0189657 -2.861
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
ZFP36L1 3569754 0.0191059 -1.726DOCK10 2601648 0.0193497 1.962FAM44B 2887633 0.0193715 -1.573APOD 4054204 0.0194137 -8.670CDC42EP3 2548617 0.0194241 2.245SIRT2 3861689 0.0197655 -1.791RAB8B 3597476 0.0199584 -1.606C1orf21 2371547 0.0204665 -1.676BNC1 3636562 0.020582 2.130XG 3966891 0.0207266 -2.323ABCC9 3446919 0.0208022 -5.370FEZ1 3396593 0.0211835 -1.573VGLL3 2684851 0.0212443 -2.558TM4SF1 2700365 0.0213269 3.129LRIG1 2680591 0.0215717 -1.685GEMIN8 4000269 0.0218504 -1.643ASPA 3706659 0.0219988 -2.034CXorf15 3970166 0.0220609 -1.721IFT52 3886179 0.0222284 -1.548DPT 2443120 0.0223755 -4.895SUMO2 3770632 0.0224585 -1.683PPAP2B 2414366 0.0224776 -1.571GRK5 3267036 0.0227194 -1.631AHR 2991233 0.0229258 -1.810MCM5 3944147 0.0230664 1.739IL1R1 2496962 0.0230722 -3.369GAS7 3744965 0.0232244 -1.541OPTN 3235726 0.0232617 -1.621SEMA3C 3058759 0.0234683 -2.282PPP1R7 2536183 0.024007 -1.583CACHD1 2340078 0.0240316 -1.849AVPI1 3302495 0.0242858 -1.870YPEL5 2475628 0.0242904 -1.824FLJ14213 3327057 0.0243402 1.826EI24 3354731 0.0245249 -1.818KCNQ5 2913277 0.0250414 3.926PRELP 4053085 0.0250856 -2.893MCCC1 2707824 0.0251346 -1.518GLIPR1 3422855 0.0252565 2.142TBC1D15 3422326 0.0254838 -1.680NTAN1 3681674 0.0255026 -1.565PLEKHM1 3759849 0.0256773 -1.667AGT 2460296 0.0259411 1.939BLOC1S1 3416909 0.0259709 2.104ACADM 2342576 0.0262247 -1.599FAM72A 4052881 0.0263297 1.578HOXD4 2516912 0.0263498 1.615PSME1 3529609 0.0265392 -1.651LOC554174 3963913 0.0266408 1.773TPCN1 3432678 0.0267493 -1.657RPS19 3834465 0.0269202 1.771
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
UBE2F 2534564 0.0270454 -1.902HRSP12 3145980 0.027105 -3.983PLOD1 2320581 0.0272262 1.810CDC20 2333136 0.0274275 4.294ABCA6 3768791 0.0274346 -2.674HIST1H1A 2946194 0.0277095 3.274ATP8B4 3623552 0.027769 -1.577PPARG 2611056 0.0283399 -1.617SLC39A8 2779823 0.0284563 -3.793SLC9A3R2 3644340 0.0286519 2.244SLC7A1 3507710 0.0287461 2.242EIF3E 3148582 0.028981 -2.175HNMT 2507896 0.0292035 -2.039DLG7 3565663 0.0292996 1.906SQRDL 3592511 0.0294231 -3.381CAB39L 3513752 0.0294463 -1.726SSPN 3408831 0.0294841 1.830ZNF238 2388794 0.0296829 1.574KIF18A 3367338 0.0297937 1.840BAG1 3203482 0.0300668 -1.564CSPG4 3633578 0.030153 1.898SUB1 2805581 0.0301699 -1.721PRDX6 2367743 0.0302885 1.538NFIL3 3214451 0.0303451 -2.705PFKFB3 3233605 0.0304714 1.919IGF1R 3610958 0.0305461 -2.056VAMP4 2443989 0.0306354 -1.525FAM92A1 3107151 0.030722 -1.693KIAA1305 3529951 0.0310432 -2.114KIAA0196 3152220 0.0312237 -1.953TWIST1 3040363 0.0315256 -1.567CA5B 3969855 0.0318259 -1.699COL8A1 2633390 0.0319735 2.762
3775147 0.0322613 1.617REV3L 2969677 0.0324732 -2.658WBP5 3985523 0.0326873 -2.143NOV 3113202 0.0327697 -4.253MITF 2628785 0.0328189 -1.579FAT 2797393 0.0328664 1.725ZBTB44 3398241 0.0328878 -1.577DNAJB4 2343289 0.033004 2.449PTRF 3757917 0.033409 1.518ITGA1 2809128 0.0336578 2.351PATL1 3374746 0.0338084 -1.658CCND1 3338192 0.0339143 1.839NFKB1 2737717 0.0339399 -1.599LPCAT2 3661718 0.0340953 1.832C5orf30 2822492 0.0341347 2.181STS 3967689 0.0343942 -2.344SOD2 2982319 0.0344817 -2.398MASP1 2709631 0.0350725 -2.189
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
SGCE 3061805 0.0351759 -2.189RAB7L1 2452667 0.0355441 -2.058CBLN3 3558270 0.0359162 -1.549PTPN14 2455418 0.0360136 1.550NCK1 2644155 0.0362506 -1.763SLC9A7 4006841 0.0362757 1.739BCAT1 3447694 0.0362813 2.012GJC1 3759335 0.0365153 2.051SESTD1 2589929 0.0366015 -1.658SPATA13 3481543 0.0368828 -1.593THRB 2666147 0.0369525 -2.037TPST1 3005444 0.0369588 -2.161SPAG4 3883441 0.036997 1.517GNG2 3535628 0.037174 2.555C22orf9 3963676 0.0372711 -1.981KCNK2 2379974 0.0374222 -1.703EGR3 3127584 0.0378761 1.551ANK2 2740067 0.0379427 -1.955PRR12 3838624 0.0379832 -1.569FAM133B 3247818 0.0383563 -2.038HSD17B11 2777070 0.038573 -2.238WNK4 3722084 0.0386525 2.069PSMD10 4017519 0.0387304 -1.681C15orf15 3625234 0.0389814 -1.572ADH1A 2779199 0.0393858 -6.068KRTAP2-4 3756723 0.0394002 4.740DNM1 3190242 0.0394847 -2.113KLF5 3493543 0.0395406 1.704KLHDC2 3534923 0.0397196 -1.533TLE1 3211579 0.0399181 -1.533IL7R 2806468 0.0400319 2.872AKR1C2 3274758 0.0402226 -4.721GPR133 3438061 0.0402329 -5.255CHURC1 3540353 0.0406285 -1.545FLJ34077 3301609 0.0408708 -1.682DCBLD2 2686023 0.0409146 1.617SLC43A1 3373893 0.041083 -1.588NEGR1 2418078 0.0414658 -2.205TACC3 2714955 0.0416609 1.791MAP2K1IP1 2779408 0.0420786 -1.763ATP13A2 2398736 0.0421845 1.654GSTT1 3955102 0.0423268 -3.925TRAM1 3139882 0.042525 -1.573GABRE 4026010 0.0425327 -1.777SEMA3A 3059464 0.042715 -2.675ADH1B 2779231 0.042756 -4.511SERPING1 3331355 0.042756 -2.883ALDH3A2 3714068 0.0427707 -1.777SLC12A8 2693014 0.0428927 1.590PARP9 2692060 0.0429518 -2.317CXCL12 3286602 0.0431537 -2.264
Appendix Table C4
Gene Symbol Transcript ID p-value(Sex) Fold-Change(Male vs. Female)Control male / control female results P<0.05 and fold change greater that +/- 1.5
CD24 4035833 0.0432393 1.991LMNB1 2827185 0.0433302 1.547UBE2D4 2999640 0.0434227 -1.818C10orf104 3251353 0.0434236 -1.798APCDD1L 3911485 0.0434479 1.986SNRPD1 3781082 0.0436992 -1.558NPAL3 2325410 0.0437863 2.230EDN1 2895244 0.0439678 1.508C1orf123 2413153 0.0440587 -1.496NPBWR2 3914346 0.0442308 1.586SECTM1 3774906 0.0443955 -2.717SNX2 2826295 0.0444744 -2.059HSPA2 3540136 0.0445114 3.065LOC130576 2509988 0.0445644 1.617MAP3K8 3240987 0.0447617 -1.909C1GALT1 2989435 0.0450315 -2.074SDCBP 3099750 0.04508 -1.985CCDC109B 2739160 0.0452107 -2.508COL12A1 2961177 0.0452237 1.596TBC1D2 3217194 0.0452842 1.804TRAF3IP2 2969810 0.0457029 -1.877C2orf12 2583602 0.0457606 -1.775ARL4C 2604390 0.0463122 -2.440SAR1A 3293244 0.046431 -1.651C13orf33 3484117 0.0464358 -2.726ASPM 2449559 0.0472672 1.532PTTG1 2838201 0.0473813 2.131DDX3X 3974838 0.0474239 -1.665KIAA0746 2764192 0.0482268 2.316DAPK2 3628832 0.0487678 -1.814CCDC23 2409069 0.0488538 -1.641MYO1E 3626826 0.0491481 -2.058RPS27L 3628469 0.0493446 -1.645RIMS1 2913123 0.049545 1.503TMEM98 3717870 0.0495608 -1.574OXTR 2661992 0.0496543 8.289PRKY 4029152 0.0498144 1.566GABPA 3916576 0.0498245 -1.773
Appendix Table C4
Gene Symbol P-value Fold change P-value Fold changeABCA6 0.0072 -2.80 0.0274 -2.67ABCA9 0.0079 -1.51 0.0181 -1.75ADH1A 0.0165 -5.30 0.0394 -6.07ADH1B 0.0074 -4.17 0.0428 -4.51AKR1C2 0.0103 -6.19 0.0402 -4.72AKR1C3 0.0088 -5.47 0.0023 -4.53ALDH3A2 0.0184 -1.53 0.0428 -1.78ANK2 0.0395 -1.51 0.0379 -1.95APOD 0.0019 -11.38 0.0194 -8.67ASPA 0.0390 -1.75 0.0220 -2.03ASPM 0.0187 1.81 0.0473 1.53BCAT1 0.0101 2.60 0.0363 2.01BNC1 0.0245 1.74 0.0206 2.13BOC 0.0286 -1.79 0.0072 -1.68C10orf104 0.0224 -1.54 0.0434 -1.80C10orf72 0.0187 -1.71 0.0085 -1.80C13orf33 0.0215 -2.50 0.0464 -2.73C15orf41 0.0391 1.70 0.0076 1.57C18orf17 0.0457 -1.74 0.0185 -2.09C1R 0.0064 -3.21 0.0017 -3.02C1RL 0.0045 -1.83 0.0128 -1.79C1S 0.0274 -2.56 0.0045 -2.67C2orf33 0.0427 -1.73 0.0077 -2.54CBLN3 0.0013 -1.76 0.0359 -1.55CCDC23 0.0179 -1.73 0.0489 -1.64CCND1 0.0284 1.54 0.0339 1.84CDC20 0.0374 3.28 0.0274 4.29CDC42EP3 0.0073 1.74 0.0194 2.25CDON 0.0035 -5.46 0.0058 -5.46CFB 0.0001 -2.08 0.0077 -2.16COL12A1 0.0117 1.73 0.0452 1.60CPXM2 0.0150 3.40 0.0181 3.70CSPG4 0.0167 2.42 0.0302 1.90CXCL12 0.0189 -3.08 0.0432 -2.26CXCR7 0.0020 -2.49 0.0034 -2.56CYB5A 0.0243 -2.19 0.0061 -1.64DAPK2 0.0032 -2.52 0.0488 -1.81DAZAP2 0.0150 -1.73 0.0052 -1.78DLG7 0.0003 2.35 0.0293 1.91DNM1 0.0397 -2.33 0.0395 -2.11DOCK10 0.0286 2.47 0.0193 1.96EFNA5 0.0002 -2.91 0.0092 -2.49ENPP1 0.0008 9.90 0.0026 6.59EPHA2 0.0353 1.50 0.0001 1.71FBLN1 0.0365 -3.27 0.0091 -3.50FEZ1 0.0146 -1.58 0.0212 -1.57FLJ14213 0.0333 1.89 0.0243 1.83GALNT6 0.0020 1.99 0.0116 2.39GAS7 0.0004 -1.95 0.0232 -1.54GJC1 0.0240 2.22 0.0365 2.05
EFMR/Control females Male controls/female controlsGenes identified in EFMR/control female and male control/female control P<0.05
Appendix Table C5
Gene Symbol P-value Fold change P-value Fold changeEFMR/Control females Male controls/female controls
Genes identified in EFMR/control female and male control/female control P<0.05
GLIPR1 0.0148 1.96 0.0253 2.14GPR133 0.0002 -12.12 0.0402 -5.26GRK5 0.0105 -1.83 0.0227 -1.63HDAC9 0.0012 1.79 0.0024 1.55HIST1H3J 0.0319 1.90 0.0029 1.95HNMT 0.0118 -1.92 0.0292 -2.04HRSP12 0.0019 -4.17 0.0271 -3.98IL7R 0.0472 2.78 0.0400 2.87IQGAP3 0.0426 1.55 0.0179 1.56ITGA1 0.0262 2.51 0.0337 2.35ITGA3 0.0042 4.15 0.0048 3.67ITGA6 0.0030 6.75 0.0097 6.30ITPR2 0.0406 1.64 0.0009 1.54KIAA1305 0.0226 -1.82 0.0310 -2.11KIF18A 0.0102 1.69 0.0298 1.84KLF4 0.0048 -3.92 0.0002 -4.47KREMEN1 0.0007 -1.64 0.0088 -1.56LAMB1 0.0009 2.19 0.0027 1.80LMCD1 0.0013 -2.21 0.0071 -2.35LMNB1 0.0076 1.77 0.0433 1.55LNX2 0.0190 1.50 0.0111 1.56LOH3CR2A 0.0030 -2.75 0.0093 -3.35LPCAT2 0.0040 2.57 0.0341 1.83MAP3K8 0.0031 -2.32 0.0448 -1.91MASP1 0.0478 -3.36 0.0351 -2.19MCM5 0.0082 1.75 0.0231 1.74MET 0.0003 3.90 0.0076 3.15MITF 0.0138 -1.54 0.0328 -1.58MMP16 0.0078 1.96 0.0070 2.02NFIL3 0.0336 -2.53 0.0303 -2.71NFKBIA 0.0484 -2.27 0.0339 -1.60NPAL3 0.0043 2.24 0.0438 2.23NTF3 0.0014 1.92 0.0088 2.17NXN 0.0020 1.89 0.0179 1.73OSR2 0.0417 -4.14 0.0005 -10.28OXTR 0.0058 7.50 0.0497 8.29PAPPA 0.0387 -2.31 0.0095 -2.84PMP22 0.0469 -2.99 0.0014 -3.42PPARG 0.0110 -1.68 0.0225 -1.57PPFIBP1 0.0093 1.88 0.0178 1.51PRDX6 0.0250 1.74 0.0303 1.54PTTG1 0.0462 2.08 0.0474 2.13RAB9A 0.0353 -1.80 0.0035 -2.44RACGAP1 0.0101 1.97 0.0098 -1.63RGS4 0.0121 13.97 0.0027 3.16RRM2 0.0097 3.71 0.0017 3.24SECTM1 0.0030 -2.79 0.0444 -2.72SERPING1 0.0121 -4.05 0.0428 -2.88SLC7A1 0.0058 1.85 0.0287 2.24SLC9A3R2 0.0466 1.65 0.0287 2.24
Appendix Table C5
Gene Symbol P-value Fold change P-value Fold changeEFMR/Control females Male controls/female controls
Genes identified in EFMR/control female and male control/female control P<0.05
SOD2 0.0063 -2.18 0.0345 -2.40SPATA13 0.0257 -1.60 0.0369 -1.59STAT3 0.0110 -1.69 0.0054 -1.58TACC3 0.0036 1.69 0.0417 1.79TBC1D16 0.0124 -1.84 0.0109 -1.99TGFBR3 0.0307 -2.28 0.0130 -2.61TMTC1 0.0007 -11.62 0.0010 -11.80TNFAIP8 0.0003 -1.97 0.0006 -2.02TP53I11 0.0092 -2.20 0.0065 -2.10TWIST1 0.0309 -1.72 0.0315 -1.57UACA 0.0232 2.89 0.0078 2.21ZFP36L1 0.0352 -2.10 0.0191 -1.73ZFP36L2 0.0205 -2.00 0.0173 -1.99ZNF436 0.0176 -2.17 0.0091 -2.53
Appendix Table C5