molecular genetic analysis of selected neurological

MOLECULAR GENETIC ANALYSIS

OF SELECTED NEUROLOGICAL INHERITED DISEASES

BIBI SHAMIM SALEHA

(BT420081002)

DEPARTMENT OF BIOTECHNOLOGY & GENETIC

ENGINEERING

FACULTY OF BIOLOGICAL SCIENCES

KOHAT UNIVERSITY OF SCIENCE & TECHNOLOGY

KOHAT

2012

Molecular Genetic Analysis of Selected Neurological Inherited Diseases

MOLECULAR GENETIC ANALYSIS OF SELECTED NEUROLOGICAL INHERITED DISEASES

by

BIBI SHAMIM SALEHA

(BT420081002)

A thesis submitted in partial fulfillment of the

requirements for the degree of

Doctor of Philosophy

in

Biotechnology and Genetic Engineering

DEPARTMENT OF BIOTECHNOLOGY & GENETIC

ENGINEERING

FACULTY OF BIOLOGICAL SCIENCES

KOHAT UNIVERSITY OF SCIENCE & TECHNOLOGY,

KOHAT

2012


CERTIFICATION

It is certified that the contents and format of the thesis entitled “Molecular

Genetic Analysis of Selected Neurological Inherited Diseases” submitted by Miss.

Bibi Shamim Saleha (Registration # BT420081002) have been found satisfactory for

the requirement for degree of Doctor of Philosophy in Biotechnology & Genetic

Engineering.

Supervisor: _____________________________

Dr. Muhammad Jamil Chairman/Assistant Professor, Department of Biotechnology and Genetic Engineering, KUST

Co-Supervisor: _____________________________

Dr. Abdul Hameed Principal Scientific Officer, Institute of Biomedical and Genetic Engineering, KRL Islamabad

External Examiner: _____________________________

Prof. Dr. Inayat Ali Shahjehan Chairman, Department of Zoology, University of Peshawar

Date: _____________

Chairman: Dean:

Department of Biotechnology Faculty of Biological Sciences & Genetic Engineering, KUST KUST


DEDICATED TO

My Parents, whose blessings, guidance and encouragement, helped me

succeed in my goal.


ACKNOWLEDGEMENTS

“We bow before almighty for his might blessings”

I feel utmost obligate to offer my best thanks to the ALMIGHTY ALLAH, the

greatest compassionate and beneficent to all the human beings. I also bow before Allah,

Who blessed me with the health, talented and passionate teachers, good friends and

expression of thought. I do greatly acknowledge hereby the Holy Prophet

MUHAMMAD (P.B.U.H.), whose life and principles serve as a lighthouse of

knowledge for whole mankind.

I feel great pleasure in expressing thanks to Dr. Shafiq ur Rehman, Dean of

Biological Sciences, Kohat University of Science and Technology, for guidance,

encouragement and cooperation during my study.

I wish to pay my sincere regard to my supervisor Dr. Muhammad Jamil,

Chairman of Department of Biotechnology and Genetic Engineering, Kohat University

of Science and Technology, for his supervision, valuable suggestions and enthusiastic

encouragement throughout my research work.

I am extremely grateful from the core of my heart to my co-supervisor Dr.

Abdul Hameed, Principal Scientific Officer, Institute of Biomedical and Genetic

Engineering, for his keen interest, sincere guidance, continuous encouragement and

sympathetic attitude that enable me to complete my research work.

I present my deepest regards to Mr. Ajmal, Scientific Officer, IBGE, KRL

Islamabad, for his cooperation and help during my research work.

My special thanks to Dr. Arif, Ophthalmologist, from KUST Institute of

Medical Sciences and to Lft.Col. Dr. Usman, ENT Specialist, from Combined Military

Hospital Kohat, for their extremely useful input.

I am happy to acknowledge the assistance of my student Muhammad Asif in

collection of blood samples.

I hereby acknowledge to all my teachers who taught me each word in my

student life and research career.


I would be failing in my duty if I do not express my profound thanks to all my

friends whom I will ever remember for their continue encouragement, moral support,

affection, company and cooperation during the critical moments.

I m also thankful to my family members for their company, guidance and

constructive discussions in every field of life.

In last but not the least, to my parents who are constant source of inspiration and

their trust and confidence are treasures nothing can replace.

“I do appreciate all those who remembered me in their prayers and encouraged

me through out my life and education career”

Bibi Shamim Saleha


CONTENTS

List of Tables……….…………………….....……………………....………..…...........i

List of Figures…….…………………….....……………………....………..….............ii

List of Abbreviations…………………….....……………………....………..….........vi

Abstract………..….…………………….....……………………....………..…........... x

CHAPTER # 1

Introduction..………...……..……………………………………….……………….1

1.1 Inherited diseases 2

1.2 Neurological inherited diseases 4

1.3 Oculocutaneous Albinism 7

1.3.1 Genetics Of OCA 7

1.3.2 Epidemiology 8

1.3.3 Clinical Description 9

1.3.4 Melanin Production and Role of Melanocortin-1 Receptor 9

1.3.5 The Human MC1R Gene 10

1.3.6 Animal Models 11

1.4 Ushers syndrome 12

1.4.1 Frequency In Different Population 12


1.4.3 Clinical subtypes of USH 13

1.4.4 Genetics Of USHI 13

1.4.4.1 MYO7A gene 14

1.4.4.2 CDH23 gene 15

1.4.4.3 USH1C gene 17

1.4.4.4 PCDH15 gene 19

1.4.4.5 USHIG gene 21


1.5 Autosomal recessive primary microcephaly 22

1.5.1 Clinical description 22

1.5.2 Incidence of MCPH 22

1.5.3 Genetics of MCPH 23

1.5.3.1 MCPH1 locus 23







1.6 Isolated Clinical Anophthalmia 31

1.6.1 Clinical description 31

1.6.2 Inheritance patterns 32


1.6.4 Genetics of clinical Anophthalmia 33

1.6.4.1 Linkage to 14q32 locus 33

1.6.4.2 CEH10 gene 33

1.6.4.3 RAX gene 34

1.6.4.4 OTX2 gene 35

1.6.4.5 SOX2 gene 36

CHAPTER # 2

Materials and Methods………………………………………………………………39

2.1. Ascertainment of families 40

2.2. Pedigree drawing 40

2.3. Blood samples collection 40

2.4. Genomic DNA isolation 41

2.5. Genotyping and linkage analysis 42

2.6. PCR amplification and mutation screening 43

2.7. DNA digestion with restriction enzyme 44


CHAPTER # 3

Oculocutaneous Albinism …………………………..……………….……………….59

3.1. Results 60

3.1.1. Pedigree analysis 60

3.1.2. Clinical findings 62

3.1.3. Genotyping and linkage analysis 62

3.1.4. MC1R gene mutation screening 66

3.1.5. MC1R DNA Digestion With AciI Restriction Enzyme 66

3.2. Discussion 71

CHAPTER # 4

Usher Syndrome …………………….………..………………………………………76

4.1. Results 77


4.1.2. Clinical description 78

4.1.3. Microsatellite and linkage analysis 78

4.1.4. The PCDH15 gene mutation screening 78 4.2. Discussion 84

CHAPTER # 5

Primary Microcephaly …………………………………………………...….…….....89

5.1. Results 90


5.1.1.1. Family C 90

5.1.1.2. Family D 90

5.1.2. Clinical description of families C and D 91


5.1.4. ASPM gene mutation screening 100 5.2. Discussion 102


CHAPTER # 6

Isolated Clinical Anophthalmia……………..………………………………..…....106

6.1. Results 107


6.1.2. Clinical description 109


6.1.4. SOX2 gene mutation screening 110 6.2. Discussion 115

CHAPTER # 7

Conclusion and Future Recommendations………………………………………...119

7.1 Conclusion 120

7.2 Future Recommendations 121

REFERENCES

References………………………………….....……………………....………..….....123

List of Tables

Molecular Genetic Analysis of Selected Neurological Inherited Diseases i

LIST OF TABLES

Table No. Title Page No.

2.1 Oculocutaneous Albinism loci and genetic markers used

in linkage study

45

2.2 Primers set used for amplification of MC1R gene’s single

exon

46

2.3 Known USHR loci and genetic markers used in linkage

study 47

2.4 Primers set used for amplification of PCDH15 gene exons.

48

2.5 Known loci and list of STR markers used for

genotyping in Pakistani families with primary

microcephaly.

51

2.6 Primers used for amplification of ASPM gene exons. 53

2.7 Known loci and list of STR markers used for genotyping

in clinical bilateral anophthalmia. 56

2.8 Primers set used for amplification of SOX2 gene’s single

exon

57

2.9 Primers set used for amplification of SOX2 gene

promoter sequences 58

3.1 Clinical signs and symptoms of the affected OCA2 family

members

63

5.1 A summary of clinical findings of affected members of

MCPH families.

93

List of Figures

Molecular Genetic Analysis of Selected Neurological Inherited Diseases ii

LIST OF FIGURES

Figure Title

No.

Page No.

3.1 Pedigree of a family with Oculocutaneous Albinism type 2 61

3.2 Non-denaturing 8% polyacrylamide gel electropherogram for STR

marker D16S2621, demonstrating homozygosity among the family

A affected members (6ALB004, 6ALB006 and 6ALB008).

64



A affected members (6ALB004, 6ALB006 and 6ALB008).

64

3.4 OCA2 pedigree with genotyping data for a locus mapped on

chromosome 16q24.3.

65

3.5 Pedigree and mutation screening of MC1R gene in OCA2 family. 68

3.6 Theoretical digests showing the effects of the AciI restriction site

present in the DNA sequence of MC1R gene of normal and

affected individuals by using online available NEB cutter, version

2.0, software.

69

3.7 PCR – RFLP analysis of MC1R gene c.917G>A mutation. 70



B affected members (USHR506, USHR507, USHR508, and

USHR512).

80



B affected members (USHR506, USHR507, USHR508, and

80

List of Figures

Molecular Genetic Analysis of Selected Neurological Inherited Diseases iii

USHR512).


marker GATA121A08, demonstrating homozygosity among the

family B affected members (USHR506, USHR507, USHR508,

and USHR512).

81

4.4 Pedigree of USH1F and Genotyping data. A consanguineous

family from Khyber Pakhtunkhwa, Pakistan segregating autosomal

recessive usher syndrome mapped to locus on chromosome

10q21.1.

82

4.5 Sequence Analysis of the PCDH15 Gene Mutation c.1304 A>C in

the Family.

83

5.1 Photographs of few primary microcephaly patients of MCPH

Pakistani families.

93



C affected members (1MIC003, 1MIC006, 1MIC009 and

1MIC010).

94




1MIC010).

94




1MIC010).

95




95

List of Figures

Molecular Genetic Analysis of Selected Neurological Inherited Diseases iv

1MIC010).


marker D1S549, demonstrating homozygosity among the family C

affected members (1MIC003, 1MIC006, 1MIC009 and 1MIC010).

96


marker D1S518, demonstrating homozygosity for a patient

(2MIC004), and heterozygosity(due a crossover) for a patient

(2MIC006) of family D.

96



D affected members (2MIC004 and 2MIC006)

97


marker D1S1678, demonstrating heterozygosity (due to crossover)

among the family D affected members (2MIC004 and 2MIC006).

97

5.10 Pedigrees of 1MIC, a nonconsanguineous Pakistani family with

STR genotyping data for MCPH5 locus on chromosome 1q31.3

98

5.11 Pedigrees of 2MIC, a consanguineous Pakistani family with STR

genotyping data for MCPH5 locus on chromosome 1q31.3.

99

5.12 DNA sequence analysis of the ASPM gene in 2 families (1 and

2MIC) with microcephaly.

101

6.1 Pedigree of a family with bilateral isolated clinical anophthalmia 108

6.2 Photograph of eye of an anophthalmic patient of a Pakistani family 111


marker D3S2427, demonstrating hoeterozygosity (due to a

crossover) among the family E affected members (2MOP003, and

2MOP006).

112

List of Figures

Molecular Genetic Analysis of Selected Neurological Inherited Diseases v



E affected members (2MOP003, and 2MOP006).

112




113




113

6.7 Pedigree of 2MOP, a consanguineous Pakistani family with STR

genotyping data mapped to a locus on chromosome 3q26.3-q27.

114

List of Abbreviations

Molecular Genetic Analysis of Selected Neurological Inherited Diseases vi

LIST OF ABBREVIATIONS

STR Short tandem repeats

KPK Khyber Pakhtunkhwa

EDTA Ethylene Diamine Tetra Acetate

ACD Acid Citrate Dextrose

oC Degree Centigrade

STE Sodium-Tris-EDTA

SDS Sodium Dodecyl Sulfate

TE Tris – EDTA

OD Optical Density

MgCl2 Magnesium Chloride

Micro

M Micro molar

mM Milli molar

dNTPs Deoxy nucleotide triphosphates

Taq Thermophilus aquaticus

U Unit

DNA Deoxyribo nucleic acid

Tris-HCI Tris/ Hydrochloric acid

min Minute

sec Second

(NH4) 2SO4 Ammonium Sulphate

% Percentage

LOD Logarithm (base 10) of odds

ng Nanogram

µl Microliter

nM Nanomolar

ml Millilitre


Molecular Genetic Analysis of Selected Neurological Inherited Diseases vii

UV Ultraviolet

NEB New England Biolabs

AciI Arthrobacter citreus I

cM Centi-Morgan

bp Base pair

p Short arm of chromosome

q Long arm of chromosome

pH Negative logarithm of H+ ions conc.

rpm Revolutions per minute

WHO World Health Organization

RNIB Royal national institute of blind people

NCBI National Center for Biotechnology Information

OCA Oculocutaneous albinism

ROCA Rufous oculocutaneous albinism

MC1R Melanocortin- 1 receptor

P gene Pink-eyed dilution gene

MSHR melanocyte-stimulating hormone receptor

SHEP2 Skin/hair/eye pigmentation, variation in, 2

MSH Melanocyte-stimulating hormone

RFLP Restriction Fragment Length Polymorphism

TYR Tyrosinase

TYRP1 Tyrosinase-related protein 1

MATP Membrane-associated transporter protein

USH Usher Syndrome

PCDH15 Protocadherin-related 15

USH1F Usher syndrome type 1F

USHIC Usher syndrome type 1C

USHIG Usher syndrome type 1G


Molecular Genetic Analysis of Selected Neurological Inherited Diseases viii

RP Retinitis Pigmentosa

DFNB Deafness, Neurosensory, Autosomal Recessive

MYO7A Myosin VIIA

CDH23 Cadherin-related 23

AHL Age-related hearing loss

VLGR1 Very large G protein-coupled receptor-1

NBC3 Na, HCO3 Cotransporter 3

VNTRs Variable number of tandem repeats

dfcr Deaf circler

dfcr-2J Deaf circler-2 Jackson

av Ames waltzer

Pcdh15kci Pcdh15 mutant allele, Kyoto circling

CAMKG calcium/calmodulin-dependent protein kinase type II

NDST2 N-deacetylase/N-sulfotransferase 2

PLAU plasminogen-activator, urokinase

SAM sterile alpha motif

ASPM Abnormal spindle-like, microcephaly associated

MCPH Primary microcephaly

CDK5RAP2 CDK5 regulatory subunit associated protein 2

CENPJ Centromere protein J

STIL SCL/TAL1 interrupting locus

BRCT BRCA1 C-terminal domains

WDR62 WD repeat domain 62

ASNP ASPM N-proximal repeats regions

CPAP Centrosomal P4.1-Associated Protein

HOX10 Homeodomain

PAX4 Paired box 4

VSX1 Visual system homeobox 1


Molecular Genetic Analysis of Selected Neurological Inherited Diseases ix

USP9Y Ubiquitin specific peptidase 9, Y-linked

NXNL1 Nucleoredoxin-like protein 1

RDCVF Rod-derived cone viability factor

SOX2 SRY - (sex determining region Y)-box 2

A/M Anophthalmia/ Microphthalmia

CAT Computerized axial tomography

CHX10 CEH10 Homeodomain-Containing Homolog

RAX Retina and anterior neural fold homeobox

OTX2 Orthodenticle, Drosophila, Homolog of, 2

HMG High-mobility-group (HMG)

Abstract

Molecular Genetic Analysis of Selected Neurological Inherited Diseases x

ABSTRACT

Abstract

Molecular Genetic Analysis of Selected Neurological Inherited Diseases xi

This study was conducted to identify the loci and genes responsible to cause

congenital neurological inherited diseases in selective Pashtoon families of Khyber

Pakhtunkhwa region of Pakistan. For this purpose, five consanguineous/tribal

endogamy families (A-E) suffering from oculocutaneous albinism, usher syndrome,

primary microcephaly, and isolated clinical anophthalmia were selected and pedigrees

were drawn. Blood samples were collected with informed consent from affected, as

well as normal members of these families, and screened for disease associated

mutations. These families were analyzed for linkage to all the known loci of

oculocutaneous albinism, usher syndrome, primary microcephaly, and isolated

clinical anophthalmia, using microsatellite STR markers. Direct sequencing was

performed to find out disease associated mutations in the candidate genes.

Molecular genetic analysis of family A with oculocutaneous albinism and

golden red hair at birth was mapped to MC1R locus on chromosome 16q24.1. A novel

mutation c.917G>A of MC1R gene was found to be consisting with OCA2 phenotype

in family A. The identification of c.917G>A mutation in Pakistani family and its

direct association with OCA2 phenotype is the first demonstration of a mutation of

MC1R gene responsible for causing OCA2 phenotype in humans.

By genetic linkage analysis, family B with diseased phenotype of Usher

syndrome was mapped to USH1F locus on chromosome 10q21.22 (USH1F), which

harbors PCDH15 gene. On sequencing of the PCDH15 gene, a novel homozygous

c.1304 A>C transversion mutation was identified to be associated with the usher

phenotype in the USH1F mapped family. This c.1304 A>C mutation predicts an

amino-acid substitution of aspartic acid with an alanine at codon 435 (p.D435A) of

PCDH15 protein product.

Abstract

Molecular Genetic Analysis of Selected Neurological Inherited Diseases xii

Two families C and D with primary microcephaly were mapped to ASPM gene

locus. On mutation screening of ASPM gene by PCR amplification and direct DNA

sequencing, a common c.3978G>A transition, was identified in exon 17 of ASPM

gene to be responsible for diseased phenotype in both the families. The identified

mutation results into the substitution of an amino acid residue at position 1326 from

tryptophan to a stop codon (i.e., p.Trp1326Stop).

The family E with isolated clinical anophthalmia was mapped to SOX2 gene,

which is located at chromosome 3q26.3-q27. On exonic and regulatory regions

mutation screening of SOX2 gene, no disease-associated mutation was identified. It

shows that another gene responsible for the development of eye might be present at

chromosome 3q26.3-q27 and need to be identified and screened for disease-

associated mutation in this family.

It was concluded that the disease phenotypes of families with oculocutaneous

albinism, usher syndrome, primary microcephaly, and isolated clinical anophthalmia

were mapped by genetic linkage analysis. The candidate genes (MC1R, PCDH15,

ASPM and SOX2) in the mapped regions were screened for disease associated

mutations by PCR amplification and direct DNA sequencing. The novel disease-

associated mutations were identified in MC1R and PCDH15. The disease associated

mutation identified in ASPM gene was also reported in several other families of

Pakistani origin with primary microcephaly. However, no disease associated mutation

was identified in SOX2 gene, which indicates that possibly another gene might be

present in the mapped region for disease phenotype.

Introduction Chapter # 1

1

Molecular Genetic Analysis Of Selected Neurological Inherited Diseases

Chapter # 1

INTRODUCTION


2


1.1. INHERITED DISEASES:

Inherited diseases are caused due to mutation in genes. There are approximately

6000 human inherited diseases caused by single mutated gene (Ballabio, 2009).

Different types of mutations in only 2310 genes have been identified that cause

monogenic inherited diseases (Chial, 2008). The genetic mutation can be passed from

one or both parents to a child. However, it depends on pattern of inheritance that the

child will develop genetic disease due to inheritance of mutated gene. These inheritance

patterns are very important for understanding the inheritance of genetic diseases (Alan

et al., 2002: Rimoin, 2002). Most of the inherited diseases follow the Mendelian

patterns of inheritance: X-linked and autosomal modes of inheritance (Antonarakis and

Beckmann, 2006). Pedigree analyses of large families with several affected members

are very helpful for determining patterns of inheritance of single gene disorders (Chial,

2008).

Mutations in genes present on the X chromosome, cause X-linked diseases. Men

posses one copy of each X and Y chromosome and are more frequently affected than

women in case of X-linked diseases. However, the chance of inheritance of X-linked

diseases varies between men and women (Jorde et al., 2000; Badano and Katsanis,

2002). In case of autosomal diseases both males and females equally inherit mutated

genes on autosomes. In an autosomal dominant disease each affected person will get

only one mutated copy of the gene usually from affected mother or father and the

chance of inheritance of mutated gene for an affected person will be 50%. The

autosomal dominant diseases often show little penetrance (Pasternak and Bethesda,

2000; Lewis, 2001).

In case of autosomal recessive disease, mutations in both copies of the gene

cause the disease in an affected person. Usually parents of such an affected person are


3


unaffected but are carriers for the disease genes. All humans are believed to be carrier

for a number of such mutated genes (Pasternak and Bethesda, 2000). Close relatives if

do marry they are believed to share a proportion of their genes, certainly these related

parents carry recessive genes and as a result they are more likely to give birth to

children with autosomal recessive genetic diseases. The risk of autosomal recessive

genetic diseases depends on the degree of genetic relationship between the mated

parents (Lyons et al., 2009). The genetic disorders found to be strongly associated with

consanguinity, exhibit autosomal recessive pattern of inheritance (Hamamy et al.,

2007).

In a country like Pakistan, where cousin marriages are more commonly

practiced, diseases with recessive inheritance pattern are frequently found (Zaman,

2010; Borhany et al., 2010). It was noticed that approximately 60% of marriages in

Pakistan are between cousins and frequency of first cousin marriages rises more than

80% (Hussain and Bittles, 1998). According to a research report in Pakistan,

approximately 82.5% parents are first cousins, 6.8 % have blood relation, 6.3 % are of a

same caste and family, and only 4.4 % are not married to their blood relatives (Zaman,

2010). It has been reported that various inherited diseases, congenital defects and

reproductive wastage are more common in children of consanguineous couples in

Pakistan (Bittles, 2001). Consequently, rates are much higher of infant mortality and

childhood morbidity in Pakistan. Because children of consanguineous parents might

inherit autosomal recessive conditions or congenital abnormalities that often appear at

time of birth or later in childhood (Shaw et al., 2005). The large multigenerational

consanguineous families of Pakistan are powerful resources for genetic linkage studies

of recessively inherited diseases (Jaber et al., 1998).


4


The occurrence of congenital abnormalities inherited in an autosomal recessive

pattern was significantly higher in offsprings of consanguineous couples. The

probability to give birth to a baby with a serious type of congenital defects like mental

retardation is 3 - 4 % in unrelated mating, but in case of consanguineous marriage this

figure becomes doubles (Mehndiratta et al., 2007). In a study, the incidence of

congenital defects reported was 0.7 to 7.5% higher in children of consanguineous

couples as compared to non-consanguineous couples (Zlotogora, 2002), and these

figures suggested the role of hereditary in the occurrence of some congenital disorders

(Bittles, 2001).

1.2. NEUROLOGICAL INHERITED DISEASES:

Many neurological disorders are hereditary and are caused due to the inapt

functioning of the nervous system, when inappropriate nerve impulses all over the

nervous system may lead to diverse symptoms in various systems involved in these

pathologic processes (Faghihi et al., 2004). Neurological inherited diseases mostly

affect the brain, spinal cord, muscles, and nerves (Lieb and Selim, 2008; NIH, 2011).

Today, more than 600 different types of neurologic diseases are known. Some

of these have been reported throughout the world, commonly found among all the

genders and age-groups, while some are rare and are still being investigated (Admin,

2011). In the world, burden of neurological diseases weighs as 6.5%. The under

developed countries are accounted to have these as 4-5% in comparison to 10-11% in

developed countries of the world (WHO, 2006). Among children of developing

countries, these neurological diseases cause considerable mortality and continuing

morbidity (Vestergaard et al., 2008; Newton and Neville, 2010).

The high statistics of neurological diseases in developed countries owes to the

growth of life expectancy, urbanization of population and introduction of compatible


5


diagnostic facilities. Although the epidemiological data of neurological diseases is

available from some developing countries like Sri Lanka, India and China but the

frequency and pattern of these diseases are affected by geographical, cultural, social,

religious, and ethnic factors. Therefore, there is great need to conduct epidemiological

studies in each country (WHO, 2006). In India a population based study was conducted

by Gourie-Devi et al. (2004), and found 3355 individuals with neurological disease per

100,000 population. Similarly, in another study that was conducted in Saudi Arabia

screened a total of 23,227 Saudis. Overall burden of neurological diseases was 131 per

1000 population (al- Rajeh, 1993). The epidemiological data available on the frequency

and pattern of common neurological disorders in Pakistan is insufficient as mainly

based on the cases reported to the hospitals which do not reflect the whole of the

community (WHO, 2006). The incidence of 5 % representing only the 8 million people

suffering from neurological diseases in Pakistan (Wasay, 2003).

Rare congenital neurological diseases like sensorineural impairment,

neurodegenerative, neurodevelopment and defective axon guidance, show clinically

heterogeneity and genetic basis of some of them is known ( Ragge et al., 2007; Ahmed

et al., 2009; Guernsey et al., 2010; Kaindl et al., 2010; Engle, 2010; Millan et al.,

2011). Genes mutated in these disorders cause clear phenotypes including dual sensory

destruction of the audio vestibular and visual system (Yan and Liu ,2010: Millan et al.,

2011), abnormal development of the primary optic vesicle (Ragge et al., 2007;White et

al., 2008), reduced brain size than normal and mental retardation (Nicholas et al., 2009;

Kousar et al., 2010) and abnormality in melanin biosynthesis, resulting in incomplete

development of the retina of eyes (Zahed et al., 2005; Karaman, 2008) respectively.

These rare neurological diseases have been documented in the different populations of


6


world and have a significant impact on health (Jaijo et al., 2005; Chin et al., 2006; Gul,

2006 ; Lund et al., 2007; Sadarangani et al., 2008; Newton and Neville, 2010).

Neurology now needs attention of both clinical neurologists and geneticists

regarding diagnosis of rare neurological diseases to provide curative treatment. Many

neurological congenital diseases were first described in children of one race or a

population and Mendelian inheritance patterns have also been well documented (Jaijo

et al., 2005; Chin et al., 2006; Gul, 2006 ; Lund et al., 2007; Sadarangani et al., 2008;

Newton and Neville, 2010). Moreover, only community-based genetic studies have

provided the estimated burden of congenital neurological disorders in a particular

community (Knottnerus, 2003; Druley et al., 2009; Zaghloul and Katsanis, 2010).

Many studies have rapidly utilized advances in science to provide novel insights into

neurological disorders and their treatment. Many clinical trials have improved the

outcome of severe neurological conditions (Choi et al., 2009; Manolio et al., 2009;

Tsuji, 2010; Newton and Neville, 2010). Furthermore, the availability of the human

genome sequence information has enormously accelerated the identification of

causative genes of hereditary disorders including rare neurological diseases

(International Human Genome Sequencing Consortium, 2004; Bentley et al., 2008).

In spite of this progress, however, the mutations causing a considerable number

of hereditary diseases remain to be identified. The clinical presentations and

neuropathological findings of hereditary forms of rare neurological diseases are often

indistinguishable, therefore it is now evident that until the mutated genes that cause rare

neurological diseases are characterized, clinicians cannot properly define inherited

disorders (Tsuji, 2010). However it is very difficult to find genetic risk factors of

complex neurological disorders (Risch, 2000; Valente et al., 2004), because both

genetic and environmental factors are involved in them and do not obey standard


7


Mendelian pattern of inheritance e.g. schizophrenia, parkinson’s disease, epilepsy,

mental retardation, seizures, Alzheimer’s disease etc. (Hunter, 2005; Craig, 2008).

1.3. OCULOCUTANEOUS ALBINISM:

Oculocutaneous albinism (OCA) is a congenital genetic disorder caused by

decreased or complete deficiency of pigmentation in the skin, hair and eyes (Gronskov

et al., 2007). Complete or partial deficiency of pigmentation is due to irregular function

of an enzyme that abnormally produces, metabolizes, and distributes melanin (Oetting

and King, 1999). Reduced melanin production in the eyes results in the incomplete

development of eyes that produce neurological signs and symptoms. The symptoms

may include nystagmatism and low visual acuity in early age in individuals affected

with OCA. However, the nystagmatism in children with OCA may also be caused by

problem in visual pathway from the eye to the brain that produces an uncontrolled

movement of the eyes (Gronskov et al., 2007; RNIB, 2010). Moreover, foveal

hypoplasia results in reduced visual acuity in affected individuals and is an aspect of

oculocutanous albinism (Gronskov et al., 2007). Similarly, Engle (2010) labeled OCA

as axon defective guidance disease at the level of optic chiasma and thus the

neurological component of the oculocutaneous albinism cannot be ignored.

1.3.1. GENETICS OF OCA:

Pathogenic mutations in approximately 14 genes result in oculocutaneous,

ocular and syndromic albinism, and are clinically distinguishable (Zuhlke et al., 2007).

Most common type is oculocutaneous albinism (OCA), which is further subdivided into

four different forms, OCA1, OCA2, OCA3 and OCA4. Type 1 is the most severe type

(OCA1A and OCA1B), and is caused by mutations in the tyrosinase gene on

chromosome 11q14.3 and affected individuals have white hair and the skin very pale in

most of cases (Beaumont et al., 2005), while type 2 (OCA2) is most common type that


8


is caused by mutations in the Pink- eyed dilution (P) gene on chromosome 15q11.2-q12

and affected individuals have fair skin, freckles or moles on face, pale blonde to golden

or reddish-blonde hair, and blue eye (Peracha, 2007). Type 3 (OCA3) has been

described as rufous oculocutaneous albinism (ROCA or xanthism) or red OCA because

affected individuals typically have red hair, reddish-brown skin and blue or gray eyes

(Peracha, 2007), and is caused by mutations in the TYRP1 gene on chromosome 9p23

(Manga et al., 1997). OCA3 has only reported in Africa and New Guinea and is milder

type of Oculocutaneous albinism. Type 4 (OCA4) is rare and milder type (Raymond et

al., 2005; Grønskov et al., 2007), and is caused by mutation in the membrane-

associated transporter protein (MATP) gene on chromosome 5p13.3, (Newton et al.,

2001). All types of oculocutaneous albinism follow autosomal recessive mode of

inheritance (Gronskov et al., 2007).

1.3.2. EPIDEMIOLOGY:

Oculocutanous albinism has been extensively studied in different populations of

the world. It has been estimated that about 1 in 17,000 people have one of the types of

oculocutanous albinism (Witkop, 1979). OCA1 is not common in African American

population and has an overall prevalence of approximately 1 per 14,000 in remaining

populations of world (Lee et al., 1994). Although, OCA2 is known as African Black

OCA2 but its estimated prevalence is 1 in 66,000 in America (Oetting and King, 1999).

Prevalence of OCA3 has been reported as 1 in 8500 people in Africa, but it is very rare

in Asian populations (Rooryck et al., 2006). Similarly, prevalence of OCA4 has been

reported 8% in German people (Rundshagen et al., 2004), and 18% in Japanese people

(Inagaki et al., 2004).


9


1.3.3. CLINICAL DESCRIPTION :

All types of oculocutanous albinism have similar neurological and ocular

findings, including variable degrees of congenital nystagmus, myopia, reduced visual

acuity, astigmatism, hypopigmentation of iris and retinal epithelium, foveal hypoplasia,

and color vision impairment (King and Summers, 1988; Witkop, 1979; Lee et al., 1994;

King et al., 1995; Oetting and King, 1999; Inagaki et al., 2004; Rundshagen et al.,

2004; Rooryck et al., 2006). Photophobia in some types is very prominent. A

characteristic feature is strabismus (Creel et al., 1978). Affected individuals have

increased contra lateral and reduced ipsilateral projecting axons at the optic chiasma

(Petros et al., 2008; Engle, 2010).The degree of hypopigmentation of skin and hair

varies with type of oculocutanous albinism (King and Summers, 1988). Clinical

features of all types vary but always cannot be distinguished between them (Grønskov

et al., 2007). Some OCA types can only be distinguished on the basis of genetic testing

or molecular genetic analysis (Raymond et al., 2005).

1.3.4. MELANIN PRODUCTION AND ROLE OF MELANOCORTIN-1 RECEPTOR:

The genetic abnormalities affect the synthesis of melanin and lead to albinism.

The defect in melanin production is due to the dysfunction of melanin producing cells

called melanocyte. In melanin synthesis, tyrosinase is the key enzyme and due to loss

of activity of this important enzyme, no melanin is produced (Oetting and King, 1999).

It has been reported that additional enzymes have an important role in synthesis of

melanin, but their necessary functions in melanin formation have not yet been identified

(Hearing, 2000).

Generally two types of melanin, brown/black eumelanin and yellow/red

pheomelanin are produced by cutaneous and ocular melanocytes (Prota, 1992), and

mostly the melanocortin-1 receptor (MC1R) on the melanocyte regulates and controls


10


synthesis of both types of melanin (Sturm et al., 2001). Normally, when MC1R is

stimulated by the melanocyte-stimulating hormone (MSH), eumelanin is produced

while mutations in MC1R produce reduced amount of melanin or pheomelanin that

result in Oculocutaneous albinism (OCA). People who produce mostly pheomelanin

tend to have red or blond hair, freckles, and light-colored skin that tans poorly and

those people have high risk to develop skin damages because pheomelanin does not

protect skin from UV radiation (Nakayama et al., 2006). The role of the MC1R is

therefore seems to be very important in hypopigmentry disorders in humans.

1.3.5. THE HUMAN MC1R GENE:

The MC1R gene was mapped to the 16q24.3 by Gantz et al. (1994), and

Magenis et al. (1994), verified the association of MSHR to 16q24 by fluorescence in

situ hybridization (FISH). Most of the studies identified a number of common

mutations or variants in the MC1R gene that are associated with red hair and light skin

that tans poorly in different population of world (Nakayama et al., 2006; Sulem et al.,

2007, and Gao et al., 2009). Bastiaens et al. (2001), in a study investigated the MC1R

gene and identified mutations that caused nonmelanoma skin cancer. The mutations in

MC1R gene cause melanoma and skin cancer have also been reported by Beaumont et

al. (2005). van der Velden et al. (2001) reported the R151C mutation in the MC1R gene

that modified melanoma risk in Dutch families with fair skin. They concluded that the

R151C mutation affects in a dual manner, as it is a determinant of fair skin and also

increase melanoma risk in affected individuals.

Gao et al. (2009) conducted a case-control study on Parkinson disease (PD)

patients in U.S., and found a cys151 SNP in the MC1R gene that increased risk of this

disease in patients due to loss of neuromelanin-containing neurons in the substantia

nigra. King and his colleagues (2003) reported for the first time that MC1R gene


11


mutations modify the appearance of people with OCA2 phenotype. They described that

mutations in both the OCA2 and MC1R genes produced unusual feature red hair instead

of the usual yellow, blond, or light brown hair in OCA2. They concluded that the

MC1R doesnot cause OCA2, but modifies its presentation. However, a single study has

not been reported until now that oculocutaneous albinism type 2 could be solely by

mutations in the MC1R gene.

1.3.6. ANIMAL MODELS:

Studies on animal models also revealed that the Mc1r gene mutations determine

coat color in animals. In some breeds of dog such as golden retrievers, Irish setters,

and yellow Labrador retrievers, complete yellow or red coat color is due to an arg306-

to-ter (R306X) mutation in the Mc1r gene (Newton et al., 2000; Everts et al., 2000).

Nachman et al. (2003) studied variation in coat color of rock pocket mice population.

They concluded that the coat color of mice was either light or dark (melanic), and

mutated Mc1r gene causes variation in coat color in rock pocket mice. An inbred

laboratory strain of Japanese mice that has white belly, yellowish brown color on the

dorsal side, and black eyes referred as “Tawny” coat color, Wada et al. (2005)

identified six mutations in the Mc1r gene in tawny mice, resulted in 3 amino acid

substitutions, but only one substitutions trp252 to cys, was found to be responsible for

the tawny coat color in Japanese mice that is recessively inherited. Jackson et al.

(2007), studied expression of human MC1R gene in wildtype mice and transgenic mice

and found that expression is identical in both types of mice to determine pigmentation

pattern. However, human MC1R was found to be more sensitive to the ligand alpha-

melanocyte-stimulating hormone than mouse Mc1r.


12


1.4. USHERS SYNDROME:

Usher syndrome (USH) is characterized by a loss of vision due to retinitis

pigmentosa (RP) and bilateral sensorineural deafness (Smith et al., 1994). In 1858, it

was first described by Von Graefel (Von Graefel, 1858), and its hereditary nature was

first time reported in 41 families by Usher in 1914 (Usher,1914). In the literature

Hallgren syndrome, Usher-Hallgren syndrome, RP-dysacusis syndrome, and dystrophia

retinae dysacusis syndrome, all synonymous to usher syndrome (Mets et al., 2000).

1.4.1. FREQUENCY IN DIFFERENT POPULATION:

The frequency of Usher syndrome estimated is variable for different population.

It accounts ~10% for the pediatric deaf and hard of hearing (D/HOH) population

(Kimberling, 2007), 3%–6% for the congenitally deaf population (Vernon, 1969),

150% for the deaf-blind population (Boughman et al. 1983), 8 to 33% for isolated

retinitis pigmentosa population (Brownstein et al., 2004). Overall it affects the North

America and European populations about 1 in 2,000 (Morton, 1991), Scandinavia

population 1 in 29,000 and German population 1 in 12,500 (Otterstedde et al., 2001).


Epidemiological studies have reported the variable prevalence rate of usher

syndrome in population of different countries, it has been estimated to be 3.5/100,000

in Sweden and Finland (Nuutila, 1970; Grondhal, 1987), 3.2/100,000 in Colombia

(Tamayo, et al., 1991), 4.4/100,000 in the United States (Boughman et al., 1983), and

4.2/100,000 (Espinos, et al., 1998) in Spain. The prevalence of USH is between

1/16,000 and 1/50,000 in Scandinavia, Colombia, United Kingdom and the United

States (Petit, 2001). However, prevalence of usher syndrome has not been reported in

Pakistani population.


13


1.4.3. CLINICAL SUBTYPES OF USH:

USH is classified into three clinical subtypes, designated as types I, II, and III.

These clinical subtypes are distinguished on the basis of their severity and progression

of the hearing loss, the age at onset of RP, and the presence or absence of vestibular

impairment (Smith et al., 1994; Ahmed et al., 2003). Type I USH (USHI) is the most

severe form of Usher syndrome. The clinical symptoms of USHI include congenital

sensorineural hearing impairment, vestibular dysfunction, delayed motor development,

and early childhood retinitis pigmentosa. RP occurs due to photoreceptor degeneration

from the peripheral position of the retina to the macula and after narrowing of the visual

field, the first symptom of RP, night blindness arises in patients of USHI (Ayuso and

Millan 2010).

1.4.4. GENETICS OF USHI:

USHI is an autosomal recessive and the most genetically heterogeneous

inherited sensorineural disorder. To date, seven different loci USHIB (11q13.5),

USHIC (11p15.1), USHID (10q21-q22), USHIE (21q21), USHIF (10q21-q22), USHIG

(17q24-q25), and USHIH (15q22-q23) have been reported to cause usher syndrome

type I (Kaplan et al., 1992; Kimberling et al., 1992; Smith et al., 1992; Wayne et al.,

1996, 1997; Chaib et al., 1997; Ahmed et al., 2009). Genes at five of these loci, MYO7A

(USHIB), USHIC, CDH23 (USHID), PCDH15 (USHIF), and USHIG have been

identified (Ahmed et al., 2009; Petit, 2001; Weil et al., 2003). Mutations of four USHI

genes MYO7A, USH1C, CDH23, and PCDH15 are also reported to cause nonsydromic

deafness, DFNB2, DFNB18, DFNB12 and DFNB23, respectively (Bork et al., 2001;

Ahmed et al., 2002, 2003; Riazuddin et al., 2008).

USH1 genetic subtypes cannot be differentiated on the basis of clinical signs

and symptoms, only investigations of linkage analysis in linkage informative


14


consanguineous families (Ahmed et al., 2009) or mutational analysis of the genes

involve, have been considered useful. Roux et al. (2006) investigated a cohort of

patients in France and reported that mutations inUSHI genes cause usher syndrome in

more than 90% of patients. However in some ethnic groups, a few mutations have a

significant carrier frequency. As an example, a mutation c.216G>A in USHIC gene was

reported in French Canadians of Acadian origin that accounted for almost all USHI

cases in Acadian population (Ebermann et al.,2007), but this mutation has not been

found in any other population. In another example, the mutation c.733C>T in the

PCDH15 gene was identified by Ben-Yosef et al. (2003), that accounted for 58% of

families of Ashkenazi with USHI. In some USH genes mutations were not found in

some sporadic and familial cases of Usher syndrome from Pakistan, France and Spain,

suggested the search for additional novel USH genes (Roux et al., 2006; Jaijo et al.,

2006; Riazuddin et al., 2008).

1.4.4.1. MYO7A gene:

Myosin VIIA (MYO7A) gene was identified by Weil et al. (1995), on

chromosome 11q13.5 by positional cloning. The MYO7A gene expresses an

unconventional myosin motor molecule that help in transport of different

macromolecular structures that move relative to actin filaments of cell transport cargo

(Weil et al., 1995). The MYO7A gene consists of total 49 exons, spans 120 kb region in

genomic DNA (Kelley et al., 1997), and mutations in this gene are main cause for

USHI in patients (Millan et al., 2011).

The MYO7A gene has been investigated in many studies and reported various

mutations. Levy et al. (1997) carried out direct sequence analysis of 48 exons and

flanking splice sites of MYO7A gene and four novel mutations were identified in seven


15


patients of USHIB. Liu et al. (1997) investigated eight families of China with

autosomal recessive nonsyndromic deafness DFNB2 and three affected sibs were found

homozygous for R244P mutation in the MYO7A gene. Similarly, Luijendijk et al.

(2004) reported a Dutch family with autosomal dominant nonsyndromic DFNB2

deafness, and identified a heterozygous mutation in the MYO7A gene in affected

members of this family. Ouyang et al. (2005) conducted mutation screening of the all

known genes that cause USHI in patients from the United States and United Kingdom.

They identified approximately 35 to 39% of mutations in MYO7A and CDH23 genes

cause USHI. Riazuddin et al. (2008) reported fourteen homozygous novel mutations in

the MYO7A gene of affected individuals of consanguineous Pakistani families with

USHIB.

Gibson et al. (1995) generated a mouse to study shaker-1 (sh1) phenotype. In

the diseased mouse hyperactivity, vestibular dysfunction, and neuroepithelial-type

cochlear defects were observed due to mutations in the Myo7a gene. Moreover, in the

sh1 phenotype retinal degeneration was not observed, that is one of phenotypes of

Usher syndrome in humans. To investigate the function of MYO7A in the retina and to

know the basis of retinal degeneration in USH1B patients, Gibbs et al. (2003) studied

Myo7a-null shaker-1 mice. They found retinal degeneration in Myo7a-null mice and

suggested this defect accounts for the progressive blindness in USH1B patients.

1.4.4.2. CDH23 gene:

The Cadherin 23 (CDH 23) gene was first identified by DiPalma et al. (2001),

in waltzer mice. The human CDH23 gene consists of 69 exons (Wagatsuma et al.,

2007), and expresses a single transmembrane domain protein that contains cadherin

repeats (Bolz et al., 2001). Siemens et al. (2002) suggested that the CDH23 along with


16


harmonin as a transmembrane complex is expressed in hair cells stereocilia in the ear,

and in the photoreceptor cell layer of retina. This complex connects stereocilia into a

bundle in ear. In USHI patients, this transmembrane complex does not form and

consequently stereocilia bundles may disrupt and causes deafness (Kazmierczak et al.,

2007).

The CDH23 is considered the second common mutated gene responsible to

cause USHI. Bolz et al. (2001) reported a Cuban family with USHI and affected

individuals had autosomal recessive inherited congenital deafness and retinal

degeneration of variable degree. They identified homozygous truncating splice-site and

missense mutations and combination of both mutations cause variable retinal

phenotypes in patients. von Brederlow et al. (2002) studied a group of 52 patients

with USHI and mutation screening revealed CDH23 mutations accounted for about

10% of all disease alleles. Astuto et al. (2002) screened the entire coding region of

CDH23 in probands with USHI and nonsyndromic deafness. They identified different

types of mutations including missense, nonsense, splicing defects, microdeletions, and

insertions in the CDH23 gene. Similar types of mutations were also identified in the

CDH23 gene in patients with either recessive nonsyndromic deafness or USHI (Astuto

et al., 2002).

In children of consanguineous parents, with autosomal recessive deafness

DFNB12, Schultz et al. (2005) identified a homozygous phe1888-to-ser substitution in

the CDH23 gene. Wagatsuma et al. (2007) investigated five patients of Japanese

families with autosomal recessive nonsyndromic hearing loss and identified

homozygous or heterozygous missense mutations in the CDH23 gene. These mutations

account for about 5% of deafness in the Japanese population.


17


DiPalma et al. (2001) reported loss-of-function mutations in the Cdh23 gene of

waltzer mice, and abnormal stereocilia organization was observed in mice homozygous

for these mutations. They demonstrated that the Cdh23 is a main component in

stereocilia bundle formation, and similarity in mutations with human CDH23 gene

established waltzer as the mouse model for USHID. Noben-Trauth et al. (2003)

investigated inbred mouse strains with age-related hearing loss (AHL) and found a SNP

in exon 7 of the Cdh23 that produced reduced stability of Cdh23 protein, consequently

resulted in increased susceptibility to AHL. Zheng et al. (2005) generated mice with

significant levels of hearing loss due to mutations in both Cdh23 (v-2J) and Pcdh15

(av-3J) genes. They concluded that both CDH23 and PCDH15 play an important role in

formation of the stereocilia bundle. Schwander et al. (2009) reported salsa mice with

progressive deafness due an E737V mutation in the Cdh23 that was predicted to affect

binding of Ca2+ by the extracellular domain. Similar mutations found in the human

CDH23 gene cause nonsyndromic hearing loss DFNB12.

1.4.4.3. USH1C gene:

The USHIC gene is alternatively named harmonin and expresses a PDZ

domain-containing harmonin protein (Verpy et al., 2000). Siemens et al. (2002)

demonstrated that PDZ domains of harmonin interact with cytoplasmic domains of the

CDH23 to form a transmembrane complex that connects stereocilia into a bundle in the

ear. Mutations in both the USH1C and CDH23 genes cause deafness in individuals with

USH type I. Boeda et al. (2002) investigated the MYO7A, CDH23, and USH1C genes

expression in both human and mouse cells. They proposed that the interaction of

products of MYO7A, CDH23, and USH1C, is necessary for the cohesion of the

stereocilia. Similarly, Reiners et al. (2005) demonstrated that PDZ domain of harmonin


18


interacts with the PDZ-binding motifs of the USH2 proteins including very large G

protein-coupled receptor-1 (VLGR1), and Na, HCO3 Cotransporter 3 (NBC3). These

USH proteins and NBC3 are coexpressed in the retinal photoreceptors synaptic

terminals and hair cells of inner ear.

Verpy et al. (2000) identified frameshift, splice site mutations in coding regions

and variable number of tandem repeats (VNTRs) in intronic region of the USH1C gene

that cause both autosomal recessive syndromic and nonsyndromic deafness DFNB18 in

patients. Ouyang et al. (2002) reported a family with affected individuals had intense

deafness without retinitis pigmentosa due to a mutation in the USH1C gene. Ahmed et

al. (2002) identified a splice site mutation in intronic region of the USH1C gene in a

family with nonsyndromic deafness DFNB18. Ouyang et al. (2003) studied 128

probands with USHIC, in both Acadian and non-Acadian populations. All Acadian

probands were homozygous for a 216G-A mutation and the 9-repeat VNTR, named as

the Acadian alleles and, yielded evidence for a founder effect by haplotype analysis.

However, among non-Acadian probands, one from Pakistan was found to be

homozygous for a 238-239insC mutation and one from Canada, was found to be

homozygous for the Acadian alleles. They concluded that USHIC is a rare type of

Usher syndrome type I in non-Acadian populations. Blaydon et al. (2003) also found

the same homozygous 238-239insC mutation in the USH1C gene in a patient of Greek

origin in the U.K. However, they identified a heterozygous a val130-to-ile mutation

within the PDZ domain of the harmonin. Chen et al. (2005) reported a 36-bp insertion

mutation in the USH1C gene located on mitochondrial chromosome.

Johnson et al. (2003) identified two recessive murine mutations caused deafness

and circling behavior due to abnormal organization of stereocilia of cochlear hair cells.


19


A 12.8-kb intragenic deletion mutation referred as “deaf circler” (dfcr) in the Ush1c

gene that eliminated a total of 8 exons. A one base pair deletion mutation referred

as“deaf circler-2 Jackson”(dfcr-2J) in Ush1c gene that resulted in frameshift of 38

amino acid codons and then introduction of a premature stop codon in the harmonin

protein.

1.4.4.4. PCDH15 gene:

The human Protocadherin 15 (PCDH15) gene was mapped to chromosome

10q21-q22 by Alagramam et al. (2001), and contains an open reading frame (ORF) that

encodes 1,955 amino acids. The PCDH15 gene expresses in human fetal and adult

brain, lung, and kidney (Alagramam et al., 2001). By using immunocytochemistry,

Ahmed et al. (2003) investigated PCDH15 gene expression in hair cell stereocilia of

inner ear and photoreceptor cell of retina, and found it necessary for stereocilia bundles

cohesion and for function of retinal photoreceptor cell. Alagramam et al. (2007) used

technique of RT-PCR and identified twosplice variants of Pcdh15 in mouse. The

PCSH15 gene expresses various isoforms with three to eleven ectodomains, cadherin

repeats, a cytoplasmic domain (CD), and a transmembrane domain.

Ahmed et al. (2001) identified 33 exons in the PCDH15 gene and spans about

1.6 Mb of human genomic DNA. Ahmed et al. (2008) identified four additional exons

in the PCDH15 gene, which encode two other cytoplasmic domains. In a Pakistani

family, the first 2 exons of the PCDH15 gene were found critical defined regions to

cause Usher syndrome type IF. In the introns of PCDH15 gene, three additional genes:

calcium/calmodulin-dependent protein kinase type II (CAMKG), N-deacetylase/N-

sulfotransferase 2 (NDST2), and plasminogen-activator urokinase (PLAU) were mapped


20


(Ahmed et al., 2001). Alagramam et al. (2007) further added that the promoter region

of the PCDH15 gene contains CpG islands, suppressor and enhancer elements.

Northern blot analysis revealed that the PCDH15 gene is expressed in the retina,

and the pathogenic truncating mutations in this gene are associated with retinitis

pigmentosa in affected individuals with USH1F(Ahmed et al.,2001). In cell culture

studies, Ahmed et al. (2008) in a study linked consanguineous Pakistani families with

USH1F and identified both pathogenic and nonpathogenic mutations in the PCDH15

gene in affected individuals of these families. Autosomal recessive nonsyndromic

deafness DFNB23 is also caused by severe mutation in the PCDH15 gene (Ahmed et

al., 2003). Zheng et al. (2005) reported a digenic model for some affected members

with USHI, in which mutations in both CDH23 and PCDH15 in affected individuals

cause syndromic phenotypes. Kazmierczak et al. (2007) identified pathogenic

mutations in PCDH15 and CDH23 that are linked to inheritance of various forms of

hearing loss in humans.

In mouse, lots of mutations of Pcdh15 gene have been described, known as

Ames waltzer mutations, and are only model for USH1F and DFNB23 nonsyndromic

deafness (Ahmed et al. 2003). Ames waltzer (av) is a recessive mutation of Pcdh15 of

mouse (Alagramam et al., 2001), and subsequently results in degeneration of inner ear

neuroepithelia that causes deafness and vestibular dysfunction but no sign of RP. The

Pcdh15 mutant allele, Kyoto circling, (Pcdh15kci) in the rat causes severe defects in

cochlear hair cell stereocilia and there is also reduction in ganglion cells (Naoi et al.,

2009). Alagramam et al. (2007) have reported that both mouse and human

protocadherin 15 genes have complex genomic structures and transcription control

mechanisms.


21


1.4.4.5. USHIG gene:

The USHIG gene was first mapped by Kikkawa et al. (2003), on chromosome

11, using technique of positional cloning in mouse. The product of the USHIG gene

expresses a scaffold protein that contains ankyrin repeats and a SAM (sterile alpha

motif) domain known as SANS (Kikkawa et al., 2003). The human USH1G gene was

cloned by Weil et al. (2003), using database mining approach. The USHIG gene

product is a 460-amino acid protein that contains a SAM domain, three ankyrin-like

domains, a central region, and a PDZ domain. The human SANS protein shows 96%

sequence homology with the mouse Sans gene. The SANS protein interacts with other

USHI proteins including harmonin, cadherin, myosin VIIA to control and regulate

cohesion and proper development the stereocilia (Weil et al., 2003; Adato et al.,

2005). The interaction of PDZ domain of SANS with whirlin (WHRN) is important in

the ciliary transport system of photoreceptors cell layer in retina (Maerker et al., 2008).

The human USHIG gene consists of 3 exons and spans about 7.2 kb region in

genomic DNA on chromosome 17, however only 2 exons are coding (Weil et al.,

2003). In affected individuals of German Tunisian and Jordanian families with USHIG,

Weil et al. (2003) identified insertion transition and deletion mutations in first two

exons of the USHIG gene to cause disease phenotypes. Ouyang et al. (2005)

investigated probands from the U.S and found to be homozygous for a 113G-A

transition in the USHIG gene, resulted a truncated SANS protein. Kitamura et al.

(1992) developed the Jackson shaker mouse as an animal model that had phenotypes of

deafness, and degenerated neuroepithelia in the inner ear due to recessive mutations in

USHIG gene. Kikkawa et al. (2003) identified js and jsseal alleles in mouse. They

found insertion mutations in mutant js and jsseal alleles, that resulted in a truncated


22


Sans protein with no SAM domain at C-terminal and produced disorganized stereocilia

bundles in both inner and outer ear.

1.5. AUTOSOMAL RECESSIVE PRIMARY MICROCEPHALY:

1.5.1. CLINICAL DESCRIPTION:

Autosomal recessive primary microcephaly (MCPH) is clinically defined as a

congenital neurodevelopmental disease in which the affected individuals have head

circumference at least three standard deviations (SDs) below the expected mean for age

and sex and mild-to-severe mental retardation without any other neurological findings

(Kumar et al.,2004;Woods et al., 2005).

Microcephaly is known as disease of fetal brain development; affected

individuals have small brains and always mental retardation. It has been hypothesized

that the small size of the brain is due to asymmetric divisions of neuronal precursor

cells in the neuroepithelium that produce limited number of neurons during fetal life

(Bond et al., 2002; Kumar et al., 2009). Mild microcephaly (-3 SD) with normal

intelligence in rare individuals have been reported. In some individuals with short

stature or mild seizures and clumsiness have also been observed (Woods et al., 2005).

1.5.2. INCIDENCE OF MCPH:

The incidence of MCPH is approximately 1 in 10,000 individuals in Pakistan

and 1 in 1,000,000 in the Caucasian population (Woods et al., 2005). Epidemiological

data reported rare cases of MCPH in Whites as compared to Asian and Arab population

although consanguineous marriage is practiced (Woods et al., 2005). MCPH is more

common in populations like Pakistan, where consanguineous marriages are practiced

more frequently (Nicholas et al., 2009; Kousar et al., 2010; Darvish et al., 2010).


23


1.5.3. GENETICS OF MCPH:

MCPH shows genetically heterogeneity due identification of large number of

MCPH loci and genes. Total seven loci (MCPH1–MCPH7) have been identified up till

now. Among them five loci (MCPH1 to MCPH3, MCPH5 and MCPH6), have been

reported in Pakistani families of northern region (Woods et al., 2005). Moreover, two

loci, MCPH4 and MCPH7 were identified in the Moroccan and Indian populations

respectively (Jamieson et al., 1999; Kumar et al., 2009). To date mutations in five genes

have been identified including Microcephalin, CDK5RAP2, ASPM, CENPJ, and STIL

that cause MCPH (Woods et al., 2005; Kumar et al., 2009; Yu et al., 2010).

1.5.3.1. MCPH1 locus:

MCPH1 locus for primary microcephaly was mapped by Jackson et al. (1998) to

chromosome 8p23 in two consanguineous Pakistani families. A homozygous mutation

S25X was identified by Jackson et al. (2002), in the microcephalin gene in all affected

individuals of both families with MCPH1. The microcephalin gene consists of 14

exons, encodes an 835-amino acid protein that contains three conserved BRCA1 C-

terminal (BRCT) domains, and it shows 57% identity with its mouse ortholog Mcph1.

BRCT domain is a phosphor-protein domain in those proteins that participate in DNA

damage checkpoint control, when cell enters in M phase from G2 during the cell cycle

(Yu et al., 2003). Moreover, RT-PCR and in situ hybridization experiments of fetal

tissues confirmed expression of the microcephalin gene in fetal brain during

neurogenesis (Jackson et al., 2002). As the length of the cell cycle and duration of

neurogenesis are critical in production of total cortical cell number, therefore, mutation

in the microcephalin gene cause MCPH1 by disturbing normal cell cycle regulation in


24


neural precursors cells (Kornack, 2000). Xu et al. (2004) used western blot analysis,

and detected a 100-kD microcephalin protein in human embryonic cell lines.

Trimborn et al. (2004) reported one base pair insertion mutation 427insAin the

microcephalin gene of two sibs of consanguineous parents. The 427insA mutation was

present in homozygous state in affected individuals and in heterozygous state in the

unaffected parents. In a consanguineous Iranian family, Garshasbi et al. (2006)

investigated affected individuals that have mild microcephaly, short stature mental

retardation, and premature chromosome condensation of cells. They identified a

homozygous deletion mutation in the microcephalin gene of affected individuals.

Similarly, Darvish et al. (2010) also studied 112 Iranian families with primary

microcephaly, mental retardation, and premature chromosome condensation. They

reported eight different homozygous mutations in the microcephalin gene that resulted

in a truncated microcephalin protein. In a Danish female with MCPH1, affected

individuals had unusual phenotypes including ptosis, craniosynostosis, and bird-like

facies with micrognathia. Farooq et al. (2010) performed sequence analysis of the

microcephalin gene in this family and identified a homozygous 302C-G transversion

mutation that resulting a truncated microcephalin protein, in which the two C-terminal

BRCT domains were absent.


The second locus for primary microcephaly was mapped by Roberts et al.

(1999), on chromosome 19q13.1-q13.2 in two multiaffected consanguineous families.

Recently by homozygosity mapping Darvish et al. (2010) reported linkage of three

consanguineous Iranian families to the MPCH2 locus. MCPH2 with or without variable


25


types of cortical malformations is caused by mutations in the WDR62 gene located on

chromosome 19q13.12 (Yu et al., 2010).

Primary microcephaly-2 (MCPH2) shows variable phenotypes due to different

types of pathogenic mutations in affected individuals that were reported by various

studies. Roberts et al. (1999) mapped two consanguineous Pakistani families to

MCPH2 locus and the affected individuals had head circumference (4 to -7 SD) below

normal, mild to moderate mental retardation. Yu et al. (2010) reported affected children

of consanguineous families that have head circumferences (-9.8 SD) from low-normal

to severe, cortical malformations, lack of speech development, spastic quadriparesis

and variable seizures caused by homozygous pathogenic mutations in the WD repeat

domain 62 (WDR62) gene.

In a consanguineous Iranian family with primary microcephaly that was linked

to the MPCH2 locus by Darvish et al. (2010), the affected individuals showed facial

dysmorphism and intrauterine growth retardation. Nicholas et al. (2010) reported seven

consanguineous families showed linkage to MCPH2 and affected sibs had head

circumferences (-4 to -7 SD) below normal, mild to moderate mental retardation and

delayed speech acquisition due to two different homozygous mutations (R438Hand

4241dupT) in the WDR62 gene.

Bilguvar et al. (2010) investigated patients of Turkish consanguineous families

with MCPH2 and affected individuals had cortical malformations, moderate to severe

mental retardation, and seizures caused by missense, frameshift, and nonsense

mutations in the WDR62 gene. Bhat et al. (2011) reported MCPH2 patients in unrelated

consanguineous Indian families with cortical malformations, head circumferences (-4

and -9 SD), variable degrees of mental retardation due to homozygous truncating


26


mutations in the WDR62 gene. Murdock et al. (2011) investigated two brothers from

northern Europe, with variable severity of MCHP2 with polymicrogyria and identified

truncating mutations in the WDR62 gene. The first sib had a more severe bilateral

polymicrogyria, spastic quadriparesis, global developmental delay, abnormal corpus

callosum, and intractable seizures. The second sib had extensive polymicrogyria, no

seizures, and mild unilateral hemiparesis. However, both sibs had head circumferences

(-5 SD) below normal.


By using autozygosity mapping strategy, Moynihan et al. (2000) identified a

third locus for primary microcephaly, at chromosome 9q34 in a multiaffected

consanguineous Pakistani family. The critical region that contains MCPH3 locus, was

defined by a polymorphic STR marker D9S290, spanning a region of approximately 12

cM. Positional cloning strategy was used by Bond et al. (2005), to identify genes in

region of MCPH3 locus and further reduced the region to 2.2 Mb with help of

polymorphic STR microsatellite markers. They also performed bioinformatics analysis

to identify genes responsible for primary microcephaly-3 in same region and mapped

the cyclin dependent kinase 5 regulatory subunit-associated protein 2 (CDK5RAP2)

gene at chromosome 9q33.3.

The CDK5RAP2 gene was cloned by Nagase et al. (2000), which they referred

as KIAA1633. The CDK5RAP2 gene consists of a total 38 exons, and spans 190 kb

human genomic DNA. The predicted CDK5RAP2 protein contains 1,561 amino acids

and has two domains for structural maintenance of chromosomes (Evans et al., 2006).

Using RT-PCR ELISA, moderate to high level of expression of CDK5RAP2 was

detected in tissues of fetal liver, skeletal muscle, ovary, and kidney and in specific brain


27


regions (Nagase et al., 2000). Expression of CDK5RAP2 was found highest in

neuroepithelium of the frontal cortex of brain during early neurogenesis, which

contains neuron precursor cells and the expression patterns confirm CDK5RAP2 role in

regulation of neurogenesis mitosis (Bond et al., 2005). In affected offsprings of a

Pakistani family with MCPH3, Bond et al. (2005) identified a homozygous 243T-A

transversion mutation in the CDK5RAP2 gene, resulting in amino acid substitution

(S81X) in CDK5RAP2 protein.


By using homozygosity mapping strategy, the fourth locus MCPH4 for primary

microcephaly was identified by Jamieson et al. (1999), at 15q15-q21 in a

consanguineous Moroccan family. The minimal critical region that contains MCPH4,

observed was 19 cM between polymorphic STR markers ACTC and D15S98 in all

affected offsprings. They suggested that that due to non-informativeness of parental

polymorphic STR markers for its boundaries, the minimal critical region might be as

small as 5.3 cM, encompassing markers D15S222 and D15S962.

Recently Guernsey et al. (2010) investigated three unrelated patients from

Canada with MCPH by using genome wide linkage mapping and gene sequencing

approaches and identified pathogenic mutations in the CEP152 gene on chromosome

15q21 that caused autosomal recessive primary microcephaly-4 (MCPH4). They

reported that all patients had head circumferences (5 and 7 SD) below the mean. But in

infancy, fast jerky movements, mild psychomotor delay, reduced brain size and

behavioral disorders like impulsivity, tantrums, and aggression were noticed in these

patients.


28



Using homozygosity mapping Jamieson et al. (2000) identified fifth locus for

primary microcephaly, MCPH5, to chromosome 1q25-q32, in a Turkish family. The

minimal critical region that contains MCPH5 observed was 11.4 cM, between

polymorphic STR markers D1S384 and D1S2655. Pattison et al. (2000) refined

minimal critical region for MCPH5 on chromosome 1q31 to 8 cM in a consanguineous

Pakistani family. MCPH5 has been identified as the most common locus in Khyber

Pakhtunkhwa Pakistani population that accounted for linkage of 43 % of families

(Roberts et al., 2002). Bond et al. (2002) used positional cloning strategy and identified

the Abnormal Spindle-like, Microcephaly-Associated (ASPM) gene within the MCPH5

critical region on chromosome 1q31 in a Pakistani family. The ASPM gene consists of

28 exons, spanning 62 kb of genomic DNA and contains 10,434-bp open reading frame

(Bond et al., 2002).

The ASPM gene encodes a 3,477 amino acids protein of molecular weight 410 k

D and contains two conserved ASPM N-proximal (ASNP) repeats regions, and 81

calmodulin-binding isoleucine-glutamine (IQ) domains of variable length at C-terminal.

The ASPM is highly expressed in fetal tissues and at lower levels in adult tissues

(Kouprina et al., 2005). The ASPM is concentrated in the progenitor cells of the human

brain, and is critical for correct orientation of cell cleavage that allows proliferative,

symmetric division of neuroepithelial cells during brain growth (Fish et al., 2006). The

ASPM gene is over expressed in glioblastoma and breast cancer with other mitosis, cell

cycle genes (Horvath et al., 2006).

Molecular genetic analysis of ASPM gene in offsprings of consanguineous

families with MCPH5, identified different types of pathogenic mutations, resulting in a


29


truncated protein (Bond et al., 2003; Kumar et al., 2004; Gul et al. , 2006; Nicholas et

al., 2009; Darvish et al., 2010). Approximately seventy one distinct MCPH associated

ASPM mutations are reported to date (Nicholas et al., 2009; Kousar et al., 2010).

Moreover, mutations in the ASPM gene are the most common cause of MCPH in

Pakistan. The identification of a large number of homozygous recessive ASPM gene

mutations in Pakistani families with MCPH probably reflects the effects of

consanguinity (Gul et al., 2006).


The sixth locus for autosomal recessive primary microcephaly, MCPH6, was

mapped by Leal et al. (2003), to a region of 6 Mb of chromosome 13q12.2, in a

Brazilian family. Bond et al. (2005) refined this region to 3.1 Mb with the help of

polymorphic microsatellite markers in one Brazilian and two Pakistan families.

Darvish et al. (2010), by homozygosity mapping, found linkage of consanguineous

Iranian families with primary microcephaly to the MCPH6 locus. The affected

individuals had severe mental retardation and head circumference (-4 to -6 SD) below

normal. Additional clinical features, including small ears, notched nasal tip, strabismus,

joint stiffness, hypertelorism, seizures, and wheelchair requirement were also noticed in

patients.

Bond et al. (2005) used bioinformatics analysis and identified the Centromeric

Protein J (CENPJ) gene, and designated it Centrosomal P4.1-Associated Protein

(CPAP). Recently, Darvish et al. (2010) also reported mapping of the CENPJ gene to

chromosome 13q12.2. The CENPJ gene consists of 17 exons (Bond et al., 2005) and

encodes a 1,338-amino acid protein of 153 kD molecular weight (Hung et al., 2000).

The CENPJ contains 5 coiled-coil domains, multiples protein phosphorylation sites and


30


at C-terminal domain, a leucine zipper motif and 21 nonamer G-box repeats are present.

The CENPJ gene expresses a centrosomal protein; this shows its regulatory role in

microtubule assembly and nucleation (Hung et al., 2000). The CENPJ along with other

gene products including SAS6, PLK4, TUBG1, CEP135, CP110, and TUBG1 are

required for formation of procentriole and for different centriolar structures at different

stages of cell division (Kleylein-Sohn et al., 2007). Bond et al. (2005) identified a

homozygous pathogenic mutation in the CENPJ gene in three Pakistani

consanguineous families with MCPH6. Similarly, Gul et al. (2006) identified

homozygous deletion mutation in the CENPJ gene of all affected individuals of a

consanguineous Pakistani family with primary microcephaly. Darvish et al. (2010)

investigated the CENPJ gene in patients of consanguineous Iranian families with

primary microcephaly and identified a homozygous mutation in the CENPJ gene. In

patients of these Iranian families, additional features, like seizures and mild facial

dysmorphism were also recorded.


The seventh locus for autosomal recessive primary microcephaly, MCPH7 was

mapped by Kumar et al. (2009) on chromosome 1p33-p32.3 in five Indian families with

primary microcephaly. The critical region that contains MCPH7 locus, was defined by

two polymorphic STR markers D1S2797 and D1S417, spanning a region of

approximately 8.39 Mb. Recently by using homozygosity mapping strategy, Darvish et

al. (2010) linked consanguineous Iranian families with primary microcephaly to the

MCPH7 region. They also observed clinical features like short stature, ataxia,

strabismus and seizures in affected individuals of a consanguineous Iranian family.


31


Kumar et al. (2009) reported that primary microcephaly-7 (MCPH7) is caused

due to homozygous mutation in the SCL/TAL1 interrupting locus (STIL) gene. The

STIL gene consists of 20 exons including four alternatively spliced exons, referred

as13A, 13B, 18A and 18B (Karkera et al., 2002). The coding region starts from exon 3

that contain a potential E2F site, three functional SP1 sites and three consensus

CCAAT boxes. The upstream regulatory region of the STIL gene contains two

functional GATA1 sites and the transcription initiation site of this gene is highly rich

with the CpG dinucleotides. The mouse and human STIL genes show sequence

conservation of high degree in the promoter region (Colaizzo-Anas and Aplan, 2003).

The human STIL gene encodes a 1,287-amino acid protein (Collazo-Garcia et

al., 1995) that contains a cysteine-terminal domain and a nuclear localization signal

(Karkera et al., 2002). Kumar et al. (2009) by using RT-PCR technique detected the

STIL gene expression in human fetal brain that suggested it role to be involved in

neuronal cell production.

1.6. CLINICAL ANOPHTHALMIA:


Clinical anophthalmia is a rare genetic disease of eye and phenotype refers to

absence of ocular tissue in the orbit of eye (Pearce et al., 1974; McLean et al., 2003;

Bernardino, 2010). Congenital clinical anophthalmia commonly is bilateral (Verma and

FitzPatrick, 2007), but it may be unilateral (Reis et al., 2010). Often the anophthalmia is

part of a syndrome and is accompanied by other brain anomalies (Schneider et al.,

2008; Shah et al., 2011). Clinically in the absence of apparent ocular tissue congenital

Anophthalmia and extreme microphthalmia (A/M) i.e., presence of small eye are


32


considered same, because computerized axial tomography (CAT) scans investigations

indicated residual neuroectoderm in the orbit of eye in some cases (Dukc-Elder, 1964).

1.6.2. INHERITANCE PATTERNS:

Clinical anophthalmia exhibits different patterns of genetic inheritance i.e.,

autosomal dominant, autosomal recessive and X-linked recessive (Verma and

FitzPatrick, 2007; Zhou et al., 2008). Studies on autosomal recessive mode of

inheritance of anophthalmia were rarely reported (Pearce et al., 1974; Joseph, 1957).

Similarly, previous research studies have also provided rare evidences about

consanguinity association with congenital anophthalmia (Dukc-Elder, 1964, da Silva

and de Sousa, 1981).


Anophthalmia/microphthalmia (A/M) cause a considerable percentage of

congenital visually impairments in children (Gonzalez-Rodriguez et al., 2010).

Epidemiological data reported the prevalence of congenital anophthalmia is 3 per

100,000 populations. However, other evidences estimated the combined prevalence of

congenital anophthalmia and microphthalmia up to 30 per 100,000 populations

(Morrison et al., 2002; Campbell et al., 2002). In developed countries a prevalence of

0.2–0.4 per 10,000 births has been reported (Shaw et al., 2005; Kallen and Tornqvist,

2005; Lowry et al., 2005). Epidemiological studies have also investigated some risk

factors for anophthalmia including late maternal age, multiple births (Shaw et al., 2005;

Kallen and Tornqvist, 2005), low birth weight and less gestation period of infants

(Forrester and Merz, 2006). Epidemiological studies have reported that both genetic

and environmental factors cause anophthalmia and microphthalmia, however,

environmental factors accounts for less number of cases (Verma and FitzPatrick, 2007).


33


1.6.4. GENETICS OF CLINICAL ANOPHTHALMIA:

Genetic linkage analysis studies have identified same loci and mutations in

same genes for both isolated clinical anophthalmia and extreme microphthalmia

(Verma and FitzPatrick, 2007). It is considered that congenital A/M show genetic

heterogeneity due to linkage of large number of loci with them. Similarly mutations in

several well- defined human genes such as CHX10, RAX, SOX2 and OTX2 are also

associated with heritable forms of isolated bilateral clinical anophthalmia and severe

microphthalmia (Zhou et al., 2008).

1.6.4.1. Linkage to 14q32 locus:

Using whole-genome linkage analysis strategy, Bessant et al. (1998) mapped a

consanguineous multi-generations Pakistani family with isolated congenital bilateral

clinical anophthalmia, at chromosome 14q32. The minimal critical region at this locus

observed was 7.3 c M between polymorphic STR markers D14S987 and D14S267 in

all affected members. On human chromosome 14q and mousechromosome 12, several

eye-specific transcription factors genes are located (Bessant et al., 1998; Breitman et

al., 1987; Palmiter et al., 1987), but so far disease causing gene at this locus has not

been identified.

1.6.4.2. CEH10 gene:

Mutations in the CEH10 Homeodomain-Containing Homolog (CHX10) or

Homeodomain (HOX10) gene cause isolated clinical anophthalmia. De Chen et al.

(1989) studied somatic cell hybrids, and mapped the HOX10 gene, referred as RET1, at

chromosome 14. De Chen et al. (1990) used technique of in situ hybridization and sub

localized the COX10 gene to 14q24.3. Similarly, they also mapped the Chx10 gene at

mouse chromosome 12 by linkage analysis. The human CHX10 gene consists of 5

exons and encodes a 361-amino acid homeodomain protein that shares 97% identity to


34


mouse Chx10. Human CHX10 is expressed in progenitor cells and inner layer cells in

developing and mature retina respectively (Percin et al., 2000). The homeodomain

proteins CHX10 along with other proteins including paired box 4 (PAX4), visual

system homeobox 1 (VSX1) and ubiquitin specific peptidase 9, Y-linked (USP9Y),

bind with promoter of both the mouse and human nucleoredoxin-like protein1(NXNL1)

gene, stimulating to encode a Rod-derived cone viability factor (RDCVF). The RDCVF

protein is a retinal trophic factor that expresses in both inner and outer retina

(Reichman et al., 2010).

In consanguineous Arab and Jewish Syrian families with clinical anophthalmia,

Bar-Yosef et al. (2004) reported homozygosity for three different mutations: a splice

site G-to-A transition in intron 1, a 4-kb deletion in exon 3 and a R227W substitution in

exon 4 of the CHX10 gene. Similarly, Faiyaz-Ul-Haque et al. (2007) also identified a

homozygous R200P mutation in the CHX10 gene in patients of consanguineous

families from Qatar with cloudy corneas and clinical anophthalmia.

1.6.4.3. RAX gene:

Genetic analysis studies have revealed mutations in the Retina and Anterior

Neural Fold Homeobox (RAX) gene located on chromosome 18q21.3, causes isolated

clinical anophthalmia (Voronina et al., 2004; Lequeux et al., 2008). Mathers et al.

(1997) identified the RAX gene in human, zebra fish, Drosophila, and mouse. They

demonstrated that the RAX gene expression is necessary for normal development of eye

in vertebrates. Danno et al. (2008) reported a conserved noncoding sequence (CNS1),

that is located roughly 2 kb upstream of the RAX promoter, where specifically bind

OTX2 and SOX2 proteins. They concluded that the interaction of OTX2 and SOX2

proteins with CNS1 is necessary for the RAX expression in development of eye.

Voronina et al. (2004) in a study screened a total 75 individuals with clinical


35


anophthalmia and identified a compound heterozygous truncated Q147X and

substitution R192Q mutations in the homeodomain of the RAX gene. Lequeux et al.

(2008) also reported a compound heterozygosity for a deletion and nonsense mutation

in exon 3 of the RAX gene in an Algerian girl with bilateral clinical anophthalmia of

nonconsanguineous parents.

1.6.4.4. OTX2 gene:

Pathogenic mutations in Orthodenticle, Drosophila, Homolog of, 2 (OTX2)

cause syndromic clinical anophthalmia. The OTX2 is also a homeodomain family gene

and its homologs have been identified in rodent, zebra fish, chicken, and Xenopus

(Simeone et al., 1992). The human OTX2 gene was first mapped by Kastury et al.

(1994), at chromosome 14q21-q22 by using fluorescence in situ hybridization

approach. Later, Wyatt et al. (2008) mapped the OTX2 gene at chromosome 14q22.3.

The OTX2 gene consists of 5 exons and only last three exons are coding (Dateki et al.,

2010). The human OTX2 gene encodes a 297 amino acids protein. An isoform of the

OTX2 proteins that contains 289 amino acids is produced due to alternative splicing at

the border of intron 3 and exon 4. This shorter isoform of the OTX2 is expressed in

pituitary gland, thalamus, hypothalamus, and whole brain (Dateki et al., 2010). Hever

et al. (2006) explained that the expression and interactions of SOX2, OTX2, and PAX6

are important in the development of the eye. Similarly, Danno et al. (2008)

demonstrated that interaction between SOX2 and OTX2 proteins direct the RAX gene

expression in development of the eye.

Wyatt et al. (2008) investigated a total of 165 patients with clinical

anophthalmia, ocular malformations, and coloboma, and reported heterozygosity for

deletion mutations in the OTX2 gene. A de novo heterozygous frameshift mutation in

the OTX2 gene was identified in Japanese children with bilateral clinical anophthalmia,


36


short stature, and growth hormone deficiency (Dateki et al., 2008; Tajima et al., 2009).

Dateki et al. (2010) reported three truncation mutations and a microdeletion in the

OTX2 gene in patients with ocular malformations, short stature, and pituitary

dysfunction. Ashkenazi-Hoffnung et al. (2010) identified heterozygosity for a missense

mutation in DNA-binding domain of the OTX2 in a patient with unilateral clinical

anophthalmia, short stature, and growth hormone deficiency.

1.6.4.5. SOX2 gene:

Molecular genetic analysis research has proved that the most commonly

mutated gene is SRY - (sex determining region Y)-box 2 (SOX2) in isolated clinical

anophthalmia (Gonzalez-Rodriguez et al., 2010). In a genetic analysis study, it was

reported that the SOX2 is single exon gene (Fantes et al., 2003), and located at

chromosome 3q26.3-q27 (Stevanovic et al., 1994). Moreover, SOX2 gene encodes 317

amino acids protein that is member of the high-mobility-group (HMG) DNA-binding

protein family (Zhou et al., 2008). Kelberman et al. (2008) reported that the SOX2 gene

is expressed throughout the human brain particularly in the development of

hypothalamus, as well as the anterior pituitary, and the eye. Therefore, the SOX2 gene

expression is necessary in early development of eye and is critical for the formation of

different ocular tissues of eye (Masui et al., 2007; Reis et al., 2010).

It has been proved by research that 10%-20% of bilateral clinical anophthalmia

is due to mutations in SOX2 gene and mutations in SOX2 gene do not cause ocular

defects other than clinical anophthalmia (Reis et al., 2010). Mutation analysis

identified de novo heterozygous loss-of-function mutations in coding sequence of

SOX2 as cause of severe bilateral clinical anophthalmia (Ragge et al., 2005; Hagstrom

et al., 2005; Zenteno et al., 2005; Zhou et al., 2008).


37


Many research studies have investigated neurological inherited diseases due to

practice of consanguinity in different ethnic groups of Khyber Pakhtunkhwa region of

Pakistan (Bessant et al., 1998; Bond et al., 2002; Roberts et al., 2002; Gul et al., 2006;

Riazuddin et al., 2008; Ahmed et al., 2009). In Khyber Pakhtunkhwa, different tribes of

pathans are prominent ethnic groups and they are very intimate about their marriages.

They practice consanguineous marriage to strengthen family ties and to maintain the

family structure and property (Hussain and Bittler, 1998). In Khyber Pakhtunkhwa,

maternal illiteracy, mother age at birth of first child less than 20 years, a birth interval

of less than 18 months (Bittles, 2001), and a social trend to have more children

particularly sons until menopause, may also be the cause of congenital neurological

inherited diseases. The lack of public awareness towards prenatal diagnosis and

prevention of inherited disease and health risks associated with consanguineous unions

are limited. Many people do not agree with medical explanations of a genetic mode of

disease inheritance, even in case where there is an affected child. Due to these reasons

the neurological diseases are frequently observed in Khyber Pakhtunkhwa that follow

Mendelian patterns of inheritance, and for these molecular bases are not known.

Therefore, it was of great necessity to fully elucidate the genetic basis of neurological

inherited diseases in Khyber Pakhtunkhwa.

Due to high consanguineous marriages in Khyber Pakhtunkhwa, this population

was selected for study of neurological inherited disorders. In present study

consanguineous/tribal endogamy Pashtoon ethnic groups, Pakistani families in Khyber

Pakhtunkhwa, suffering from congenital inherited neurological diseases including

oculocutaneous albinism, usher syndrome, primary microcephaly, and isolated clinical

anophthalmia were ascertained and studied.


38


The aim of the present study was to identify the genetic cause of inherited

neurological disorders and establish molecular diagnostic techniques to provide genetic

counseling to the affected families.

The following were objectives of this study:

1. To trace genetic illnesses in those affected families that possesses a pedigree

of neurological diseases and determines phenotype by clinical assessments.

2. To map and identify disease causing gene(s) by genetic linkage analysis for

selected neurological inherited disorders.

3. To find the genetic complexity or heterogeneity of neurological inherited

disorder(s) by mutation screening of diseased gene(s).

Materials and Methods Chapter # 2

39


Chapter # 2

MATERIALS AND METHODS


40


2.1. ASCERTAINMENT OF FAMILIES:

Five Pashtoon ethnic group consanguineous/tribal endogamy families, suffering

from oculocutanous albinism (family A), usher syndrome (family B), primary

microcephaly (family C and D), and isolated clinical anophthalmia (family E), residing

in districts Kohat and Karak of Khyber Paktunkhwa region of Pakistan, were selected

for present study. These families were selected on personal contact basis. Disease

history, detailed pedigree drawing and pattern of inheritance were ascertained by

visiting these families, at their places of residence. From participating families

informed consent was obtained. After review of medical records of affected members,

documentation of relevant findings was accomplished. A thorough medical

examination of affected as well as normal members of these families, was conducted by

expert clinician and disease associated features were recorded.

2.2. PEDIGREE DRAWING:

Pedigrees of families (A-E) were drawn from the information provided by the

family by using Cyrillic (v2.10) program (http://www.cherwell.com). For illustrations

purposes, Cyrillic program develops graphical output. It further produces data files that

are appropriate for input into linkage analysis software programs like MLINK.

2.3. BLOOD SAMPLES COLLECTION:

Blood samples were collected with informed consent from affected as well as

normal members of families (A-E), in 10 ml vacutainer tubes (Becton Dickinson,

Mountain View, CA.), containing acid citrate dextrose (ACD) or Ethylene Diamine

Tetra Acetate (EDTA). Blood samples were also collected from 100 ethnically matched

unrelated normal Pakistani individuals and were used as controls for allelic frequencies


41


calculation and confirmation of disease associated mutation(s). The blood samples were

stored at 4oC before DNA extraction.

2.4. GENOMIC DNA ISOLATION:

Genomic DNA was extracted from peripheral blood by the standard phenol

chloroform extraction procedure (Maniatis et al., 1982), with the slight modification of

this standard organic method. The stored blood samples at 4oC in EDTA or ACD

vacutainers tubes were transferred to 50 ml falcon tubes for DNA extraction. To 10 ml

blood sample, 30 ml of cell lysis buffer was added and mixed by inverting tubes several

time and left on ice for 30 min. After 30 minute of incubation on ice, samples were

centrifuged at 3200 rpm for 40 min at 4oC. The red cell lysate (supernatant) was then

discarded and pellet was resuspended in 10 ml cell lysis buffer (0.32 M sucrose, 10 mM

Tris-HCl, 5 mM MgCl2 and 1 % v/v Triton X 100), and second centrifugation at 3200

rpm for 40 min at 4oC was carried out to remove remaining red cell debris and

hemoglobin. The fine pellet was then obtained by discarding the supernatant and each

pellet was resuspended in 6 ml of 1 X STE (Sodium-Tris-EDTA) buffer (0.1 M

NaCl2,10 mM tris-HCl and 1 mM EDTA), pH 8.0. After adding, 250 l of 10% SDS

(Sodium Dodecyl Sulfate) drop wise while vortexing and 10 l of proteinase K (20

mg/ml) to each sample, they were incubated overnight at 55oC in a shaking water bath.

After overnight incubation at 55oC, the samples were taken out of the water bath

and 5 ml (equal volume) of equilibrated phenol, pH 8.0 was added to each sample,

mixed by gently shaking and left on ice for 10 minutes. The samples then centrifuged at

3200 rpm for 40 minutes at 4oC. After centrifugation, the aqueous layer was carefully

collected with cut tip in new, appropriately labeled, 50 ml falcon tubes. To the collected

aqueous layer, 5ml (equal volume) of chilled chloroform: isoamylalchohol (24:1v/v)

was added, mixed thoroughly by inverting tubes several times and left on ice for 10


42


minutes. This mixture was centrifuged at 3200 rpm for 40 minutes at 4oC, the aqueous

layer was collected with cut tip into new, appropriately labeled, tubes. The DNA was

precipitated by adding 1/10 volume (500 l) of 10 M ammonium acetate and equal

volume (5 ml) of pre-chilled isopropanol or two volumes of pre-chilled absolute

ethanol. The samples were gently mixed and left overnight at –20oC.

The precipitated DNA was pelleted by centrifuged at 3200 rpm for 60 minutes

at 4oC. The supernatant was discarded and each pellet was washed with 5 ml of chilled

70% ethanol and centrifuged at 3200 rpm for 40 min at 4oC. The supernatant was

discarded again and the pellet was air or vacuum dried. The DNA pellets were

resuspended in TE buffer, pH 8.0 (10mM Tris; 1mM EDTA). The DNA samples were

transferred to labeled 1.5 ml Eppendorf tubes and stored at 4oC. The DNA

concentration was determined by spectrophotometerically by taking absorbance at 260

nm and DNA concentration was calculated by using formula:

DNA Conc. = Abs.260nm x dilution factor x correction factor = µg DNA/ml

2.5. GENOTYPING AND LINKAGE ANALYSIS:

To identify the locus responsible for diseases in the families (A-E), genomic

DNA from each individual was genotyped using microsatellite markers for the known

loci. The cytogenetic locations of these markers and size of amplified products were

obtained from genome database web site (www.gdb.org). Tables 2.1, 2.3, 2.5, and 2.7

show microsatellite STR markers used for mapping of known loci for the

oculocutanous albinism, usher syndrome, primary microcephaly and clinical

anophthalmia. The microsatellite markers for each locus were amplified by polymerase

chain reaction (PCR). PCR reactions were performed in a 10 l volume, each

containing 1.5 mM MgCl2, 0.6 M of each primer, 0.2 mM dNTPs, 1U Taq DNA

polymerase and PCR buffer [16 mM (NH4)2SO4, 67 mM Tris-HCI (pH 8.8), and


43


0.01% of the nonionic detergent Tween-20], (Bio-line, London, UK). Amplification

was performed with an initial denaturation for 4 min at 94oC, followed by 35 cycles of

denaturation at 94oC for 45 sec, annealing at 55-60 oC for 45 sec, extension at 72oC for

45 sec and a final extension at 72oC for 5 min. The PCR products were separated on 8

% non-denaturing polyacrylamide gels (40% Bis-acrylamide, 10 X TBE buffer, 25%

persulphate and TEMED), (Protogel; National Diagnostics, Edinburgh, Scotland, UK).

The gel was stained with ethidium bromide and photographed under UV illumination.

Alleles were assigned to individuals and genotypic data was used to find genotypes of

all individuals of these families. If desired, the LOD scores were calculated by using

the Cyrillic and MLINK software programme (Version 5.2,

ftp://linkage.rockefeller.edu/software/linkage/).

2.6. PCR AMPLIFICATION AND MUTATION SCREENING:

The MC1R, PCHD15, ASPM, and SOX2 genes were screened for mutation by

PCR amplification and direct DNA sequencing. The PCR amplification of the MC1R,

PCHD15, ASPM, and SOX2 gene was performed with pairs of overlapping primers

spanning the whole exonic region and splice junction sites (Table 2.2, 2.4, 2.6. and 2.8).

The pairs of primers used in this study for sequencing of PCHD15 and ASPM genes

were previously reported by Ahmed et al. (2001) and Nicholas et al. (2009)

respectively. However, for sequencing of MC1R and SOX2 genes, sets of overlapping

primers were designed by using online available Primer 3 tool

(http://simgene.com/Primer3). To screen mutation in SOX2 gene, promoter region was

PCR amplified from genomic DNA using primer sets shown in Table 2.9. PCR

amplification was performed in 50 µl reaction volume containing 250 ng of genomic

DNA, amplification buffer containing 600 nM of each primer, 1.5 mM MgCl2, 200 mM

of dNTPs and 2.5 U of Taq DNA polymerase (Applied Biosystems, Warrington, U.K.)


44


in an PxE thermal cycler (Hybaid, Basingstoke, U.K.). The amplification conditions

were 95oC for 5 min, followed by 35 cycles of 95oC for 45 sec, primer specific

annealing temperature (55-65oC) for 45 sec, 72 oC for 45 sec. Aliquots (5 µl) of the

PCR products were analyzed by 2.5% agarose gel electrophoresis. PCR products were

then purified by using QIA quick PCR Purification Kit (Qiagen, Crawley, U.K.). The

purified PCR products were sequenced directly using Big Dye® Terminator v 3.1 cycle

sequencing kit on an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, CA,

USA). Chromatograms from normal and affected individuals were compared with

corresponding reference gene sequences from NCBI (National Center for

Biotechnology Information) database to identify aberrant nucleotide base-pair change

(http://www.ncbi.nlm.nih.gov/). Potential disease-associated mutations were confirmed

by bi-directional sequencing, analyzed by using CLC viewer software

(www.clcbio.com) and then assessed in 100 ethnically matched control samples.

2.7. DNA DIGESTION WITH RESTRICTION ENZYME:

The presence of significant DNA nucleotide changes, identified during mutation

screening was confirmed by digestion of PCR products with an appropriate restriction

enzyme. The restriction enzyme map of the mutated DNA fragment was generated by

using online available NEB cutter, version 2.0, software

(http://tools.neb.com/NEBcutter2/). Reactions were carried out in the PCR buffer and

a reaction mixture was composed of a 1X concentration buffer with 1U of restriction

enzyme per mg of template DNA for digestion. Digestion was performed following the

manufacturers recommendations at incubation temperature and time specified for the

enzyme. Usually, 20 µl standard reaction volumes were used. Products were visualized

under UV transillumination following agrose gel electrophoresis and photographed.


45


Table 2.1: Oculocutaneous Albinism loci and genetic markers used in linkage study

Known

loci

Gene Disease I.D. STR Markers Distance

(cM)*

Amplified

length(bp)*

11q14.3 TYR OCA (OCA1A

&

OCA1B;YELL

OW

ALBINISM)

D11S237 88.4 193-213

D11S2002 102 220-260

D11S2000 111.7 199-235

15q11.2-

q12

OCA2 OCA2 D15S822 20.9 246-306

D15S165 36.3 184-208

9p23 TYRP1 OCA3 (Rufous

OCA)

D9S921 9.3 175-232

GATA124D09 16 165-197

D9S1121 20.4 184-216

5p13.3 MATP OCA4 GATA134B03 18.9 147-163

GATA145D09 21.1 217-237

D5S1470 46.1 161-213

16q24.3 MC1R SHEP2 D16S539 97.6 148-172

D16S520 97.6 181-197

D16S3063 97.7 246-260

D16S2621 97.7 239-263

D16S486 97.7 397-450

D16S3026 97.9 204-210

*cM: Centi Morgan *Bp: Base pairs


46


Table 2.2: Primers set used for amplification of MC1R gene’s single exon

Primer I.D. Sequence 5’-3’ PCR fragment

Size (bp)

MC1R_1aF TGGAGGGGAAGAACTGTG 293

MC1R_1aR AAGCAGTACATGGGTGAG

MC1R_1bF CATCGCCAAGAACCGGAA 403

MC1R_1bR GAAGAAGACCACGAGGCA

MC1R_1cF CATCGCCTACTACGACCA 252

MC1R_1cR GTGCTTAGATGCAGGAAGAAG

MC1R_1dF TGTCACCCTCACCATCCT 391

MC1R_1dR CGCGCTTCAACACTTTCA


47


Table 2.3: Known USHR loci and genetic markers used in linkage study

Locus

I.D.

Chromoso-

mal region

Gene STR Markers

used for exclusion

studies

Location

(cM*)

Amplified

length(bp*)

USH1A 1q41 Usherin D1S2141 233.5 232-272

D1S549 239.5 159-199

USH1F 10q21-q22

PCDH15 D10S1208 41.7 179-200

D10S1220 49 236-245

D10S1221 54 125-149

D10S1225 66.8 181-193

GATA121A08 76.7 184-200

USH1B 11q13.5 Myosin

1B

D11S2371 88.4 193-213

D11S2002 102 220-260

D11S2000 111.7 199-235

USH1C 11p15.1 Harmonin D11S1981 15.4 134-178

ATA34E08 31.3 156-171

USH1G 17q24-q25 Scaffold

Protein

D17S949 67.2 207-221

GATA43A10 74.9 275-299

D17S784 87.1 226-238



48


Table 2.4: Primers set used for amplification of PCDH15 gene exons

Primer I.D Forward Primer Reverse Primer Product Length(b)

PCDH15_1 TTGTCTTTTGGGCTGTAGCA

TCATGACAGAGATCATTGTACTGAAA

612

PCDH15_2 CCAGTGCATTAAACCAGTGTGT

GGACATCTGATTTCACTTTTCTAAGC

452

PCDH15_3 ATTAATTAGATTGCAAGATTTTCCTT

TCCATGGATTTGGGTTGAAA

300

PCDH15_4 GCAGATACTTTGGCCTTTTGG

GAAATTGACAAGCTTCCAGGAT

563

PCDH15_5 TGATTGTCTTCTCTTGTCCTTAAAA

TTTTCCCATAGTTAAATGAATTCCTAA

518

PCDH15_6 CACTTCAGTTTGTGGTTGTGG

CCATCAAAAATTAGCTTCTAGCAATA

446

PCDH15_7 TCATTCTATTTTCAGATGATAAGCA

GGTCAAAGAATACAGTGAATAAAAACA

437

PCDH15_8 TGCCTAATTTCTATAAACTACCTGTTG

CCCTGAAAATAATTTCGGACA

367

PCDH15_9 TGCTCCCCCTTAACATTCAA

TTGAATTGCTTTGCTTCTTCC

520

PCDH15_10 GTCTGCTTTCCCTGAACTGC

TGGGCTTCGCTTATTTTCTT

418

PCDH15_11 GCCTCACTGGATTTTCATTTC

CTTTTTAAAATATCCTTGTTTTGGA

551

PCDH15_12 TTCCACGATATAGGTCACCATC

TTCTTCTGTGAGGAAGAATGTTAAT

557

PCDH15_13 TGCTTCTTACCATATTAGAACACTTTT

TGCTTTTATTTGAAAAGTAACAGAAAT

515

PCDH15_14 TTGTGATTGCTTTAGTATTGTAACGG

TGCCTCTGATATTGTCCTTTTC

587


49



PCDH15_15 TCCTGTAAACCCAACAACTGAATA

ATCCATATTACCCTTGCTTTCCTT

371

PCDH15_16 TTTCCACATCAGGTAGGATTACA

AAAATGTTAAAAATAAACAGTCTCCTG

487

PCDH15_17 GCCTTAAAAGCTGTTTTCAATTTT

AAGGTTGCAGCACAATAGCA

471

PCDH15_18 CAGATAGACAAATGCCAGAATGA

AAATGTAAATCTGTATCCTTGAAAGTT

408

PCDH15_19 TCCTCCTTAGAGGGCCAAAT

CACAAACCCTAATAGCAAATCTCC

495

PCDH15_20 GCACTAACGCATGACTTCCA

TGTTATGGGTCTGGTACCACTG

437

PCDH15_21 TGAGGTGCCAGTCTGAAATG

TGCATTCTAGAAAAACAAAAAGCA

500

PCDH15_22 TGATCTGGCTACATTTCAGCTC

TCCAAGATGTGAGATACCAAGTG

488

PCDH15_23 CCTTCTGGAACCAGGCAAT

CGCCTAAACCAAAATTGGAA

337

PCDH15_24 CCTGCAGACCTCCTCCAGTA

TCACTTTAGCTAACATCACTGGATTT

302

PCDH15_25 CAAAAGCCAGCATTTTGTCA

ATCACTCCCTGCCTTGTCAT

465

PCDH15_26 GGCATGGCATCTAGAAATGG

AAAATGAAACTCAAGAAGTTGCT

463

PCDH15_27 CAGACATTTAGGAGGGCTTT

AGTGACTAACAATCTGAGTGAAAA

520

PCDH15_28 GAATTTGAAAATCAGAAACCACTG

CAGTTAAAAATCATGGTCATATAAAAA

267

PCDH15_29 TGGGAGCTAAATGCTGAAAAA

CCTGAAAACTTTAAGGCATGAGA

532


50



PCDH15_30 TGAATTCTACCCCTTATTCAAGAGA

TCAGAGTTCCTGAACGGTCTACTTA

417

PCDH15_31 CAAGCCATCCTTACTTTATCCAA

TGCAATTGTCTCCTGAAGTTG

428

PCDH15_32 TGTCATTAACTCTGTCATTATGAATTT

AAACTATTACAAACGCAAAACAAGG

270

PCDH15_33a CATTTCTCATTCTTCTCACAACTC

CCTCCTGGGTAAGCTGACTG

595

PCDH15_33b TTCAGACATTTCACAGAGAACAGA

GAGAGTGAAGAATGTAAAACACAAGG

522

PCDH15_33c CAAGAACTGTGGAACTCAAATCAG

CCTGTTATACAGACACACTCTGTGG

502

PCDH15_33d CTACCTCCATTTCCAACTCCTCT

ATTTCATTGAATTTGGGGTAAAAT

553

PCDH15_33e GCAAACCTCTTGTTGATCATAGTC

CCAAATACATAGGCTTCAAGAAAAA

444

PCDH15_33f TGTGGATGCAGTAACATTTACATT

AAATGCCTTACAAAAGTCAACGAC

446


51


Table 2.5: Known loci and list of STR markers used for genotyping in Pakistani

families with primary microcephaly

Locus

Name Chromosome Gene

STR

Markers

Distance

(cM)*

Amplified

Length(bp)*

MCPH1 8p22-pter Microcephalin D8S264 1.3 121-145

D8S1099 2.4 249-270

D8S277 4.1 148-180

D8S1130 9.9 132-156

MCPH2 19q13.1-13.2 Unknown D19S433 37.8 187-227

D19S178 48.5 141-193

D19S246 57.8 185-229

D19S589 59.6 153-193

D19S254 63.7 106-158

MCPH3 9q34 CDK5RAP2 D9S934 123.7 206-230

D9S282 131.3 231-242

D9S915 137.9 196-220

MCPH4 15q15-q21 Unknown ACTC 49.6 68- 92

D15S659 54.5 166-210

D15S643 59.6 195-223

MCPH5 1q31 ASPM D1S518 194.8 188-228

D1S1660 204.6 218-250

D1S1678 211.8 289-321

D1S1663 223.9 409-425

D1S2141 233.5 232-272

D1S549 239.5 159-199


52


Locus

Name Chromosome Gene

STR

Markers

Distance

(cM)*

Amplified

Length(bp)*

MCPH6 13q12.2 CENPG D13S787 19.4 231-271

D13S1493 30.5 223-243

MCPH7 1p32.3-p33 STIL D1S2134 59.5 249-301

D1S1661 60.1 89-101

D1S2652 63.9 94-106

*cM: Centi-Morgan *Bp: Base pairs


53


Table 2.6: Primers used for amplification of ASPM gene exons

Primer ID Forward Primers

Sequence Reverse Primers

Sequence Product

length(bp)

ASPM_1 ACTCCCACGACCTCTACAGC

CCAAGAGCCACCCACAGTTA

579

ASPM_2 AATTAAGCAGATAGGGTAGGAGAAA

TCCCAAAGACTCCTCTGCAA

471

ASPM_3a GGAAATGCAGAAGAGCAGAAA

CGTACAGAGAGTGGCAAGCA

460

ASPM_3b CAAGCTTGTGAAAACTTGGCTA

AATTCTAGTTCATTATTAGCTCCATGA

426

ASPM_3c CCCAACTGTTCTTCAACT

CTCTGGTACAGGTGGCCTTC

622

ASPM_3d TCCTAAATTTTCTGCAGTTCAGG

GCTCTGAGGGAGAAAAATGG

419

ASPM_3e GCTTCAGTTGCTCGGAAAAG

CAGCAAAAGCAAAGAAAAATCA

405

ASPM_4 AGTGCGTGGAGTACAG

TTCTTCCAGGCTGTTA 358

ASPM_5 CCCAAAATGCTTTCAGCTCT

CATTTAGGCTAATGAACAGGGAAT

434

ASPM_6 GAGCTAACAGGTTGCGATGA

CACCACACATACACACAAGAAGG

633

ASPM_7F GCTGCCAAAAATCCCACATA

TGTCATTACGTGCAACACCA

526

ASPM_8F TCCTGAGCTTTGTCTTTTTGC

GGGTGGAGGAAGGGAGAGTA

508

ASPM_9F TCCCATAGAGATATTGGGAGGA

GGACTCACCAGACAGGCATT

475

ASPM_10 CAGAATGATTTGGAGGATTTGTT

TTTCCAGAAAATGTTAGTCTATTCCA

316


54




Sequence Product

length(bp)

ASPM_11 TACTTGCCGACTATGGAGCA

CGCTATTTTCCAAAGCAACC

479

ASPM_12 GATTCCGGCAATAAGTCGTC

TCACAGTTACTGGGGCAAAA

404

ASPM_13 GTTTGCCTTTGGGGAAAAA

TCATTTGAGGGAAAGTTTGCT

557

ASPM_14 TGTGCCATGCTCTCACATAA

GCAGGTATTCCACCAAGGTC

599

ASPM_15 CGCAAACTGGTTCAGTGGTA

ATCCAAAAGCCTTGCACAAA

473

ASPM_16 GACCTTGGTGGAATACCTGCT

ACCTCCCCAACCCAAAATAC

461

ASPM_17 CGACATGCCTGGAATTATCA

AGCCTTCTGCTGAACACCAT

535

ASPM_18a TTGGATGGATTTCTGAATTGG

GCTTGAAAGCACCGAAATCT

650

ASPM_18b TGCAAAGAGCTTTTAGAGAATGG

AAAATCGAACTCTGTCTTGTCTCA

393

ASPM_18c GCTGCAGCCATTCAATTACA

GCAGCTGCTCTTAAATGCAAA

500

ASPM_18d GATGCAAGCCAGGAAAATG

TTCTTCCTCTGATTGACCTGTG

456

ASPM_18e ACCTTGTCCGAAAGCAGATG

GCAGCTTGATGTTCCCTTCT

478

ASPM_18f GATGGTACAGGGCGTACAAGA

TTTTGAATCAGAAGAGCAGCTT

439

ASPM_18g CAAAGGCAACATAAATGTGCTA

CACGCTGCATTTTACCTTGA

580

ASPM_18h GAAGACATATTCAACACATGCACA

GCAGTTTTCTTGAGAGAGAGGAA

538


55




Sequence Product

length(bp)

ASPM_18i GCAAAGATACTGGGCAATGAA

TAAGGGTTGCAGAGGAATGC

581

ASPM_18j CCAAGCAAATAGAGCTGCAA

GCCCACTGAAGCTTTTGGTA

633

ASPM_18k GACAATGGCATTCTGCTGTG

GCCTCTAAAAGCAGCCTGAA

668

ASPM_18l CAGGGCCAAAGTTGATTATGA

TGATAGCAGCTCTTTTCTGCTG

488

ASPM_18m TGGTCACAAGAAAACTGGAAA

TGGAAGATAAATGGTCACCTCA

468

ASPM_19 CACCACTGTTCTCAGAAGACTCA

GAAAATATCAACAAAACCAACCA

486

ASPM_20 CTTCTTTCGTGTGCGTGTGT

TTGACTGAAATAGATGTGTGTGAAA

452

ASPM_21 ACCCTTGGCTTACACCTTCA

TGACAGTCAGTGCTCTTGTCAC

583

ASPM_22 TGCTTTCTACACTCTGAGTTATGAGTT

GGTGAAAGGCTAAATGTTGTACG

488

ASPM_23 AATGCCTCTGTGGAAAGCTG

TGAGTTATTCTACCGGCTAATGC

453

ASPM_24 TGGTCGATAAATGCTGTCCA

ACTCTGGGCCATGTTCTCAC

574

ASPM_25 CCTTTCTGCCATTCTTGAGG

TTTCATCCTAAGACTCTTGCACA

436

ASPM_26 AAAGTCCTTTGCACTTGCTG

GCAAAAAGCAGGTTTGAACA

447

ASPM_27 GCGACAGAGCAAGAGAGACC

ACCAAACATTCCATTCTTATTCA

451

ASPM_28 TGAAGTTCTCCCACCTCTTTG

TGATAAAAATGAAGAATGTAATGAACA

400


56


Table 2.7: Known loci and list of STR markers used for genotyping in clinical

anophthalmia

Locus Name Chromosome Gene STR Markers Distance

(cM*)

Amplified

length(bp*)

MCOP1

14q32

D14S617 91.0 141-173

GATA168F06 92.6 212-232

GATA136B01 97.0 133-157

MCOP2

14q24.3

CHX10

D14S588 71.0 117-141

D14S53 82.7 151-155

D14S606 85.9 254-286

MCOP3

18q21.3

RAX

D18S858 54.9 193-208

ATA7D07 64.7 126-147

D18S64 60.1 188-208

14q21-22

OTX2

GATA168F06 92.6 212-232

GATA136B01 97.0 133-157

3q26.3-q27

SOX2

D3S1565 190.3 239-245

D3S2427 192.1 203-245

D3S1262 205.2 100-132

D3S2436 208.5 164-180

D3S1580 208.7 139-155

D3S1311 213.1 128-160



57


Table 2.8: Primers set used for amplification of SOX2 gene’s single exon

Primer

I.D. Sequence 5’-3’

PCR fragment

Size (bp)

Sox2_1aF CCTCTCTCTTTTTTTCCCC 431

Sox2_1aR TCTCCGACAAAAGTTTCC

Sox2_1bF GCGGCAACCAGAAAAACA 291

Sox2_1bR GCAGCGTGTACTTATCCTT

Sox2_1cF GCTCATGAAGAAGGATAAGT283

Sox2_1cR GCTGGTCATGGAGTTGTA

Sox2_1dF CATGAACGGCTGGAGCAA 407

Sox2_1dR AGTGCTGGGACATGTGAA

Sox2_1eF TTACCTCTTCCTCCCACTC 286

Sox2_1eR CTCCATGCTGTTTCTTACT


58


Table 2.9: Primers set used for amplification of SOX2 gene promoter sequences

Primer

I.D. Sequence 5’-3’

PCR

fragment Size

(bp)

5’F2 AGTCCCGGCCGGGCCGAG

602 5’R3 GGTAGC CCAGCTGGTCCTG

3’F GGCGTGAACCAGCGCATGG

612 3’R GGAGCG TACCGGGTT TTCTC

5’UTR F CGCTGATTGGTCGCTAGAA

518 5’UTR R CTTCAGCTCCGTCTCCATCAT

3’UTR.1F GGGGTGCAAAAGAGGAGAGTA

490 3’UTR.1R GAAAAATATTGGCAAATTCTCGC

3’UTR.2F AACATGGCAATCAAAATGTCC

514 3’UTR.2R ATTCTCGGCAGACTGATT CAA

3’UTR.3F CCCCCTTTATTTTCCGTAGTT

353 3’UTR.3R ATCATCCAGCCGTTTCTTTTT

Oculocutaneous Albinism Chapter # 3

59


Chapter # 3

OCULOCUTANEOUS ALBINISM


60


3.1. RESULTS:

3.1.1. PEDIGREES ANALYSIS:

A consanguineous family referred as “A” with oculocutanous albinism

phenotype and golden red hair at birth, lives in district Karak of Khyber Pakhtunkhwa

region of Pakistan. They are the descendents of the famous Khattak tribe. This family

has upper middle class socioeconomic status and educated backgrounds. They practice

consanguineous marriage to maintain the family structure and follow the combined

family system, they acknowledge the most.

The family A, traced back to four generations which consists of sixteen

individuals, among them ten were alive and six were dead at the time of data collection

(Figure 3.1). Three members were affected including one female and two male.

Individual 6ALB008 was first identified with oculocutanous albinism, therefore,

referred as proband and he helped in tracing this disease in the family A. The affected

persons are present in generation IV of the pedigree. The parents 6ALB001 and

6ALB002 are both normal phenotypically and resulted in three affected children

(6ALB004, 6ALB006 and 6ALB008). Oculocutaneous albinism is present by birth in

three affected children of this family, and the ages of these affected children lie

between 19-26 years. Pedigree analysis strongly suggests autosomal recessive pattern

of inheritance, as due to consanguineous marriage, affected members could be

homozygous for the disease allele.

Blood samples from eight individuals were collected including five normal

(6ALB001, 6ALB002, 6ALB003, 6ALB005, and 6ALB007), and three affected

(6ALB004, 6ALB006, and 6ALB008) individuals of family A.


61


Figure 3.1: Pedigree of family A with Oculocutaneous Albinism type 2. Squares

symbolize males and circles symbolize females. All filled circles and squares

symbolize affected members. Between symbols, double line represents consanguineous

marriage.


62


3.1.2. CLINICAL FINDINGS:

The affected family members were thoroughly examined by ophthalmologist for

the ocular and neurological signs and by dermatologist for the dermatological signs. It

revealed that affected members of the family have dermatological signs of unusual

reddish blonde hairs, fair skin and freckles; ocular signs of myopia, astigmatism, and

photophobia as well as neurological signs of nystagmus and decreased visual acuity

(Table 3.1).

3.1.3. GENOTYPING AND LINKAGE ANALYSIS:

In the present study, first DNA samples of normal and affected individuals of

family A with oculocutanous albinism were screened for linkage to the known loci of

OCA2. Table 2.1 summarizes the polymorphic STR markers that were used for linkage

analysis, in regions of known loci for OCA2. No evidence of linkage was observed

with any of the markers for 11q14.3 (OCA1A & 1B), 15q11.2-q12 (OCA2), 9p23

(OCA3) and 5p13.3 (OCA4) loci and therefore were excluded. From results obtained

(Figure 3.2 and 3.3), a strong evidence of linkage was observed at MC1R (SHEP2)

locus on chromosome 16q24.3, as all affected individuals of family A were found to be

homozygous for markers D16S2621 and D16S486 by linkage analysis. Parents of

affected individuals were first cousin and found to carry same disease chromosome in a

heterozygous state (Figure 3.4). The phenotype was analyzed as an autosomal recessive

trait, with complete penetrance, and a disease gene frequency of 0.0001 for the affected

allele. Maximum LOD scores of 3.05 were obtained at a theta value of zero for the fully

informative markers D16S2621 and D16S486, located 97.7 cM on chromosome

16q24.3, in family A by using the MLINK software programme.


63


Table 3.1: Clinical signs and symptoms of the affected OCA2 family members

6ALB004 6ALB006 6ALB008

Hair Color Reddish blonde Reddish blonde Reddish blonde

Skin Color Fair Fair Fair

Skin Freckles Freckles Freckles Freckles

Skin cancer Nil Nil Nil

Cancer history negative negative Negative

Eye sight Decreased visual

acuity

Decreased visual

acuity

Decreased visual

acuity

Astigmatic Astigmatic Astigmatic

Photophobic Photophobic Photophobic

Nystagmus Nystagmus Nystagmus

Eye color Light brownish Light brownish Light brownish


64


Figure: 3.2: Non-denaturing 8% polyacrylamide gel electropherogram for STR marker

D16S2621, demonstrating homozygosity among the family A affected members

(6ALB004, 6ALB006 and 6ALB008).


D16S486, demonstrating homozygosity among the family A affected members

(6ALB004, 6ALB006 and 6ALB008).


65


Figure 3.4: OCA2 pedigree with genotyping data for a locus mapped on chromosome

16q24.3. Both parents are carrier of defective (boxed) chromosome. The affected

individuals (filled square and circles) are homozygous for the defective chromosome.


66


3.1.4. MC1R GENE MUTATION SCREENING:

The Family A, normal and affected members were screened for mutations of the

MC1R gene. Polymerase chain reaction (PCR) amplification of single exonic region of

MC1R gene from DNA of both normal and affected individuals of family A, was

performed by using primers sets (Table 2.2). On mutation screening of the MC1R gene,

a novel mutation c.917G>A was found to be associated with OCA2 phenotype in

consanguineous family of Pakistani origin (Figure 3.5). This mutation results in the

substitution of codon for amino acid, arginine to histidine (p.Arg306His). This change

was identified in homozygous condition only in the patients and the normal parents

were carrier for the change. Moreover, this mutation was not found in 100 ethnically

matched control samples.

3.1.5. MC1R DNA DIGESTION WITH AciI RESTRICTION ENZYME:

On sequencing, a homozygous c.917G>A change was observed in patients.

PCR-Restriction fragment length polymorphism (RFLP) analysis was carried out for

confirmation of the mutation and its disease-association. By using online available

NEB cutter, version 2.0, software (http://tools.neb.com/NEBcutter2/), and the

restriction enzyme map of the mutated DNA fragment was generated. The restriction

mapping showed that the c.917G>A mutation abolishes the digestion site of AciI

restriction enzyme (Figure 3.6). AciI was therefore used to determine the presence of

the mutation identified in MC1R and confirm its disease-association. Restriction

digestion with I U of AciI per mg of template DNA was performed at incubation

temperature 37oC for 3-4 hrs. The 388 base pairs (bp) region of MC1R gene from DNA

of a normal individual (6ALB003) used as control, heterozygous carrier (6ALB001)

and homozygote patient (6ALB004) containing mutation, was amplified by PCR. The

PCR products were digested with the restriction enzyme AciI.DNA fragments


67


generated were resolved on 2.0% agarose gel, visualized under UV transillumination

(Figure 3.7). The sample of 6ALB003 gave a band for an original 388 base pairs (bp)

fragment, whereas the sample of 6ALB001 gave original 388bp bands as well as bands

of 141 bp, 139 bp, and 99bp. In addition, sample of patient 6ALB004, did not

produced original band of DNA 388 bp due to homozygous mutation, however bands

of 141bp, 139bp, and 99bp were visualized on gel. These results indicated presence

and absence of c.917G>A mutation in the MC1R gene in normal, carrier and affected

individuals.


68


Figure 3.5: Pedigree and mutation screening of MC1R gene in OCA2 family. The

c.917G>A (Arg306His) mutation is homozygous (CAC/CAC) in all three affected

(6ALB004, 6ALB006 and 6ALB008) individuals. Both parents (6ALB001 and

6ALB002) are career (CGC/CAC) for the mutation and normal individuals (6ALB003,

005 and 007) are either career (CGC/CAC) or homozygous (CGC/CGC) for the normal

allele. The affected individuals have freckles on their face and the color of their hair is

reddish to golden brown (arrow with electropherogram indicates MC1R nucleotide

mutated).


69


Figure 3.6: Theoretical digests showing the effects of the AciI restriction site present in

the DNA sequence of MC1R gene of normal and affected individuals by using online

available NEB cutter, version 2.0, software. The restriction mapping showed that the

c.917G>A mutation abolishes the digestion site of AciI restriction enzyme.


70


Figure 3.7: PCR – RFLP analysis of MC1R gene c.917G>A mutation. M is a 100bp

DNA ladder; lane 1, undigested control 388bp fragment; lane 2, AciI digested

heterozygous carrier; lane 3, AciI digested homozygote patient.


71


3.2. DISCUSSION:

Type 2 Oculocutaneous albinism (OCA2) is an autosomal recessive disease caused

by reduced melanin biosynthesis in skin, hair, and eyes (SHEP1). The melanin pigment

is considered necessary for the complete development of the retina of eyes. Reduced

melanin production in the eyes results in neurological signs and symptoms including

nystagmus and low visual acuity (Grønskov et al., 2007). Thus nystagmatism may be

caused by incomplete development of eye or problem in visual pathway from the eye to

the brain that produces an uncontrolled movement of the eyes in children in early age

with OCA. It has been reported that almost every individual with oculocutanous

albinism has nystagmus (Gronskov et al., 2007; RNIB, 2010). Similarly decreased

visual acuity in affected individuals is caused by foveal hypoplasia and misrouting of

the optic nerve fibers and is the most important feature of oculocutanous albinism

(Gronskov et al., 2007). Moreover, Engle, (2011), referred OCA as a defective axon

guidance disease at the level of optic chiasma.

In the present study, a consanguineous Pakistani family A, demonstrating autosomal

recessive oculocutanous albinism has been ascertained from Pashtoon ethnic group

living in district Karak of Khyber Pakhtunkhwa. The affected individuals of the family

A have unusual reddish blonde hairs, fair skin and freckles on faces. The ocular and

neurological features including astigmatism, photophobia, nystagmatism and decreased

visual acuity were also observed in all patients of this family (Table 3.1). The presence

of neurological signs in affected individuals, implying that oculocutanous albinism has

neurological components that cannot be ignored. Our results are in agreement with

findings of King et al. (2001), who also found almost similar ocular and neurological

anomalies as well as cutanous features in patients of OCA2. However, in all types of

OCA, similar ocular and neurological anomalies including nystagmus, photophobia,


72


reduced visual acuity, strabismus, astigmatism and foveal hypoplasia along with

different degree of skin and hair hypopigmentation, in affected individuals have been

observed (Grønskov et al., 2007). O'Donnell et al. (1978) reported congenital

nystagmus, impaired vision, translucent irides, and photophobia, strabismus and

albinotic fundi with hyperplasia of the fovea, in affected individuals of Caucasian

kindreds with ocular albinism.

In present study, linkage analysis was performed with STR markers

corresponding to the candidate genes involved in autosomal recessive oculocutanous

albinism phenotypes. Linkage was established in this Pakistani family to a locus at

chromosome 16q24.3, which harbors the MC1R gene. All affected individuals of this

family were found to be homozygous for markers D16S2621 and D16S486 at 97.7 cM

on chromosome 16 (Figure 3.2 and 3.3). All the affected individuals inherited the

disease chromosomes from both parents as they were carrier for disease chromosome.

Subsequently affected individuals were homozygous for disease chromosomes. By

sequencing analysis of the MC1R gene, a novel mutation c.917G>A was identified in

homozygous condition only in the patients with OCA2 phenotype and the normal

parents were found carrier for this mutation (Figure 3.5).

OCA2 is caused due to mutations in the Pink- eyed dilution (P) gene. Sulem et al.

(2007) reported that mutations in P gene cause variations in skin, hair, and eye

pigmentation in OCA2 affected individuals. The P gene product has an important

function in regulation of the pH of melanosomes (Yuasa et al., 2007). However,

synthesis of melanin in humans is controlled, to a greater extent, by the melanocortin-1

receptor (MC1R) on the melanocytes (Sturm et al., 2001). Akey et al. (2001)

investigated role of the P and MC1R genes in skin pigmentation variations among

Tibetan population. When data was analyzed, a significant gene-gene interaction was


73


found between the MC1R and P genes due to polymorphism in both genes that is

responsible for variable skin pigmentation in Tibetan population. King et al. (2003)

reported eight probands, who had unusual red hair at birth rather than yellow/blond that

are characteristic features of OCA2. It was found that mutations in the P gene caused

OCA2 phenotypes in all probands and mutations in the MC1R gene produced

phenotype of red hairs in only those probands, who had red hairs at birth. However,

Chiang et al. (2008) reported a Hispanic girl, who had unusual OCA2 phenotype i.e.,

reddish-blonde hair. She had blue irides, pale skin, horizontal nystagmus, absence of

foveal reflexes, albinotic fundi, irides that transilluminated light and decreased visual

acuity. Genetic analysis revealed that both parents were heterozygous for a P gene

mutation but a heterozygous mutation was also found in the TYRP1 gene in the girl and

her father. Due to haploinsufficiency at the P and TYRP1 loci together, the father, did

not develop a noticeable OCA2 phenotype. However, in this study association of

mutations in the MC1R gene with red hairs was not identified.

Smith et al. (1998) investigated general Irish population in which individuals

had fair skin and red hair and identified variations in the MC1R gene responsible for

these phenotypes. Flanagan et al. (2000) studied individuals with red hair in large

mutigenerational pedigrees. They concluded that variations in MC1R gene produce red

hair and are inherited as a recessive character. However, Healy et al. (2000) identified

variants in the MC1R gene in general population of Ireland and the U.K. They

concluded that that the MC1R gene variations are associated with sun sensitivity in

individuals without red hair. Sulem et al. (2007) carried out an extensive large study on

individuals of Icelands and Dutch. One Mb region containing a total 38 of SNPs and

the mutated MC1R gene, were found to be associated with phenotypes of fair skin

sensitivity to sun, freckles on face and red hair.


74


The MC1R is introns free gene and expresses a protein that acts as a receptor for

melanocyte-stimulating hormone (MSH). The MSH receptor (MSHR) is a seven pass

transmembrane G protein coupled receptor and controls melanogenesis. Usually,

melanin is of two types: pheomelanin (yellow/red) and eumelanin (brown/black).

Mutations in the MC1R gene results in impaired function of MSHR and consequently

produce increase amount of pheomelanin which leads to fair skin and light color hair

(Sturm et al., 2001). Increased production of pheomelanin causes damage to skin

induced by ultra violet light, whereas eumelanin gives protection against such damage.

Synthesis of eumelanin is stimulated, when MSHR is activated by binding of

melanocyte-stimulating hormone. This receptor is a major determining factor in sun

sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer

(Nakayama et al., 2006). More than 30 different alleles of MC1R for skin and hair color

have been reported and thus provided evidence that the MC1R gene is a major

determining component for variation in normal human pigmentation (Kennedy et al.,

2001; Debniak et al., 2001). To date, no evidence of ocular and neurological findings

due to mutations in MC1R gene in patients with oculocutanous albinism has been

reported. In present study, the identified MC1R pathogenic mutation in family A

(Figure 3.5), possibly produces ocular and neurological features along with cutanous

phenotype is showing the first evidence of neurological involvement of MC1R gene.

King and his colleagues in year 2003 (King et al., 2003) provided the first

demonstration of a MC1R modifying the OCA2 phenotype in humans. In present study

the identification of a novel mutation c.917G>A and its OCA2 phenotype association in

Pakistani family is first evidence of sole involvement of MC1R gene in oculocutaneous

albinism in humans. The identification of novel mutation and its direct association with

OCA2 phenotype may enable us to further understand the function of MC1R gene,


75


establishing genotype phenotype association and classification of the OCA. Clinical

differentiation of OCA types has been difficult due to the observed range of phenotypic

variation. Thus, genetic analysis may be helpful with respect to a precise diagnosis.

Usher Syndrome Chapter # 4

Molecular Genetic Analysis of Selected Neurological Inherited Diseases 76

Chapter # 4

USHER SYNDROME



4.1. RESULTS:

4.1.1. PEDIGREE ANALYSIS:

A consanguineous family “B”, suffering from Usher Syndrome dwells in Kohat

district of Khyber Pakhtunkhwa region of Pakistan. The surname of family B is Khattak

and in most of the cases the income based on the business in the local market. Most of

the members of this family have primary level of education. They preferred to have

cousin marriages under the influence of different social, cultural and financial aspects

of the society.

The three generations pedigree of family B indicates presence of 17 individuals,

in which 16 were alive at the time of data collection including equal number of females

and males (Figure 3.1). Four members are affected including two female and two male.

Individual USHR512 was first identified with usher syndrome, therefore, referred as

proband and she helped in tracing this disease in the family B. The affected persons are

present in generation III of the pedigree. The parents USHR503, USHR504, USHR510

and USHR511 are all normal phenotypically and resulted in four affected children

(USHR506, USHR507, USHR508 and USHR508). Usher syndrome is present by birth

in all affected individuals and the ages of affected children lie between 04-11 years.

Pedigree analysis strongly suggests autosomal recessive pattern of inheritance, as due

to two consanguineous marriages in second generation, affected members could be

homozygous for the disease allele.

Blood samples from 16 individuals were collected including 12 clinically

normal (USHR501, USHR502, USHR503, USHR504, USHR505, USHR509,

USHR510, USHR511, USHR513, USHR514, USHR515, and USHR516), and four

affected (USHR506, USHR507, USHR508, and USHR512) members of family B.




On the basis of clinical history and the results of ophthalmologic, audiometric,

and vestibular tests of affected children of family B, disease was diagnosed as Usher

syndrome. Affected members of this family with USH1 are profoundly deaf and blind

at birth. Moreover, clinically normal individuals of normal also have reduced vision.

4.1.3. MICROSATELLITE AND LINKAGE ANALYSIS:

In the present study, to identify the locus responsible for the USHI in family B,

genomic DNA from each individual was genotyped using microsatellite STR markers

for the known Usher syndrome loci. Table 2.3 summarizes the polymorphic STR

markers that were used for linkage analysis, in regions of known loci for USHI. Each

microsatellite marker was amplified by polymerase chain reaction (PCR). No evidence

of linkage was observed with the markers for 1q41 (USHIA), 11q13.5 (USHIB),

11q15.1 (USHIC), and 17q24-q25 (USHIG) and therefore were excluded. According to

results obtained (Figure 4.1, 4.2 and 4.3), we observed strong evidence of linkage and

the region of homozygosity for STR markers D10S1221, D10S1225 and GATA121A08

at USH1F locus on chromosome 10q21-q22, in a consanguineous Pakistani family “B”

with USH phenotypes (Figure 4.4). The USH1F locus on chromosome 10q21-q22

harbors PCDH15 gene.

4.1.4. THE PCDH15 GENE MUTATION SCREENING:

The PCDH15 gene was screened for mutation by PCR amplification and direct

DNA sequencing of 33 exons of PCDH15 gene from DNA of both normal and affected

individuals of family B, by using primers sets (Table 2.4), (Ahmed et al., 2001). The

mutation screening of PCDH15 in affected and unaffected members in this

consanguineous Pakistani family B revealed a transversion mutation (c.1304A>C) in

exon 11, resulting in a substitution of aspartic acid at position 435 of its protein



product. We identified homozygous mutant alleles of PCDH15 in four affected

individuals from this family (Figure.4.5).Whereas parents and some normal offspring of

consanguineous marriage were found heterozygous for the mutant alleles of PCDH15

so they were confirmed carriers. Moreover, the identified mutation was not found in

100 control samples of ethnically matched individuals.



Figure: 4.1 Non-denaturing 8% polyacrylamide gel electropherogram for STR marker

D10S1221, demonstrating homozygosity among the family B affected members

(USHR506, USHR507, USHR508, and USHR512).


D10S1225, demonstrating homozygosity among the family B affected members





GATA121A08, demonstrating homozygosity among the family B affected members




USHR5021 34 22 2

USHR5011 22 31 2

D10S1221D10S1225

GATA121A08

USHR5031 12 41 2

D10S1221D10S1225

GATA121A08

USHR50102 13 42 2

USHR5152 13 42 2

USHR5162 13 22 2

USHR5043 14 42 2

USHR5141 13 42 2

USHR5113 11 41 2

USHR5051 14 22 1

D10S1221D10S1225

GATA121A08

USHR5061 14 42 2

USHR5071 14 42 2

USHR5081 14 42 2

USHR5093 14 22 1

USHR5121 14 42 2

USHR5131 13 42 1

Figure 4.4: Pedigree of USH1F and Genotyping data. A consanguineous family from

Khyber Pakhtunkhwa, Pakistan segregating autosomal recessive usher syndrome

mapped to locus on chromosome 10q21.1. The genotyping results for STR marker,

D10S1221, D10S1225 and GATA121A08 are homozygous in all the affected

individuals, indicative of recessive mode of disease segregation in this family. Between

symbols, double lines represent consanguineous marriages. All filled circles and

squares symbolize affected members, whereas clear circles and squares symbolize

unaffected members. Solid bars indicating disease chromosome and clear bars showing

normal chromosome.



Figure: 4.5. Sequence Analysis of the PCDH15 Gene Mutation c.1304 A>C in the

Family B. Partial DNA sequence of the PCDH15 gene from (A) a heterozygous carrier

A/C and (B) a homozygous (affected) individual, showing a transversion (A>C).

Arrows indicate position of the mutation.



4.2. DISCUSSION:

Usher Syndrome type 1 (USH1) is a sensorineural disorder and is the most

severe form of Usher syndrome. Clinical signs and symptoms associated with USH

type 1 (USH1) are congenital sensorineural hearing impairment, delayed motor

development, vestibular dysfunction, and retinitis pigmentosa starts in early childhood.

The inheritance pattern of USHI is autosomal recessive. USHI is a genetically

heterogeneous disorder and to date, seven different loci USHIB, USHIC, USHID,

USHIE, USHIF, USHIG, and USHIH have been mapped (Kaplan et al., 1992;

Kimberling et al., 1992; Smith et al., 1992; Wayne et al., 1997, 1996; Chaib et al.,

1997; Ahmed et al., 2009). Mutations in five genes MYO7A, USHIC, CDH23,

PCDH15, and USHIG cause syndromic deafness (Ahmed et al., 2009; Petit, 2001; Weil

et al., 2003). Usher type 1 subtypes cannot be differentiated on the basis of clinical

signs and symptoms. Only investigations of large multi-generations consanguineous

families by linkage analysis or mutation screening of the genes involve have been

considered useful in research studies.

In affected individuals from an unreported Pakistani family with USH1F, we

identified a novel transversion pathogenic mutation in PCDH15 gene (Figure 4.5),

demonstrating that PCDH15 function is necessary in the sensory tissues of the human

eye and ear. Affected members of this family with USH1F are profoundly deaf and

blind at birth. Novel transversion pathogenic mutations were also identified in PCDH15

gene by (Ahmed et al., 2003, 2009) in Pakistani consanguineous families with Usher

Syndrome type 1F. Recently, Doucette et al. (2009) in a consanguineous family from

the island of Newfoundland have also reported a novel transversion pathogenic

mutation for nonsyndromic deafness in the Usher syndrome type IF gene PCDH15.

Mutation analysis investigations in gene PCDH15 has already reported to cause both



nonsydromic hearing loss DFNB23 and Usher Syndrome Type1F (Alagramam et al.

2001:Ahmed et al., 2001, 2003; Zheng et al., 2005; Ouyang et al., 2005; Rebibo-

Sabbah et al., 2007; Doucette et al., 2009). In consanguineous marriages related

individuals share genes from a common ancestor, homozygosity is favored, and their

progeny are more likely to have genetic disorders. Primarily, offspring of

consanguineous parents are at a two fold greater risk than offspring of nonrelated

parents for autosomal recessive disorders.

Reporting a novel pathogenic mutation c.1304A>C in Pakistani consanguineous

family (Figure 4.5), further supported the results of (Ahmed et al., 2003, 2009)

emphasized the need to know the genetic basis of recessively rare neurological

inherited diseases of this population. As a consequence of the unique socio-cultural

practices in the population of Pakistan, approximately 60% of marriages are

consanguineous, of which more than 80% are between first cousins (Hussain and

Bittles, 1998). Congenital recessively inherited neurological diseases are more

prevalent in population of Pakistan as consanguineous marriages are commonly

practiced. These consanguineous families in Pakistan usually consist of many

generations and are important resources for study of recessively neurological inherited

diseases by linkage analysis.

In Khyber Pakhtunkhwa, it was elucidated that parents decide marriages of

their children in order to find ease in marriage arrangements (social and financial),

building stable marital relationships, greater compatibility with in-laws, to reduce

domestic violence, and divorce rates, and maintenance of family property especially

landholdings. Here is also general tradition for marriage within family and ethnic group

at younger age. Subsequently, low levels of mother education, early age at first birth of



a baby, shorter birth intervals and tradition of producing children to comparatively later

ages are cause of congenital neurological inherited diseases.

Rare neurological disorders like usher syndromes are present in the population

of Pakistan and particularly in Khyber Pakhtunkhwa due to common practice of

consanguineous marriages and molecular basis of some of them is known. These rare

neurological diseases have a substantial impact on health care, socio–economic level

and quality of life. Finding genetic risk factors involved in these diseases may boost

knowledge about the diseases and possible treatment as well as provide a strong

background to convince or change the Pakistani population views regarding cousin

marriages.

The PCDH15 gene has been mapped by Alagramam et al. (2001) to

chromosome 10q21-q22. Ahmed et al. (2001) have explained gene structure of the

human PCDH15 gene that contains 33 exons and the start codon is at 396 base pairs in

exon 2 and the stop codon is at 6, 263 base pairs in exon 33. Recently, Ahmed et al.

(2009) have reported 4 additional exons in the PCDH15 gene, and total number of

exons is now 39. The size of genomic DNA is approximately 1.6 Mb (Ahmed et al.,

2001) within the promoter region of the PCDH15 gene instead of TATAA or CAAT

sequences, a CpG island, suppressor and enhancer elements have been identified by

Alagramam et al. (2005). The intron sizes in PCDH15 are variable and three additional

genes have been reported by Ahmed et al. (2001), and Alagramam et al. (2001). Within

the PCDH15 gene, large genomic rearrangements have been found that are a significant

cause of USH1F syndrome (Sandie et al., 2007).

Mutation analysis studies have documented particular mutations in PCDH15,

cause Usher syndrome type 1F (USH1F). Ahmed et al. (2001) investigated gene

mutations in the PCDH15 gene in a consanguineous Pakistani families of Usher



syndrome type IF and identified an IVS27-2A-G splice site mutation and an arg3-to-ter

(R3X) missense mutation in the PCDH15 gene. Alagramam et al. (2001) found a 1-bp

deletion of T at nucleotide 1471 in exon 10 and at 419 in exon 11of the PCDH15 gene,

that result in a frameshift and premature stop codon respectively, in a Hutterite family

from Alberta of Usher syndrome type IF. Ben-Yosef et al. (2003) in Ashkenazi Jews

found a unique mutation an arg245-to-ter (R245X) mutation in the PCDH15 gene in

most of cases of type I Usher syndrome. Ahmed et al. (2003) investigated families for

mutation analysis of the PCDH15 gene, in one family affected individuals were found

homozygous for a 785G-A transition in exon 8 that resulted in a gly262-to-asp

(G262D) substitution and another family affected individuals were also homozygous

for a 400C-G transversion in exon 5 of the PCDH15 gene, resulted in an arg134-to-gly

substitution however both types of substitutions caused a new form of nonsyndromic

deafness DFNB23 due to mutation in same gene.

Ouyang et al. (2005) reported the heterozygosity for a mutation of 3-bp deletion

(5601-5603delAAC) in exon 33 of the PCDH15 gene as this resulted in subsequent

deletion of threonine at 1867 and this also caused a missense mutation in patient with

USH1F at the PCDH15 locus. Zheng et al. (2005) also reported patients of usher

syndrome type1 who carried mutations of a 1-bp deletion heterozygosity in PCDH15

gene in combination with another mutation in the CDH23 gene, and the identified

deletions (16delT) and (193delC) cause a frameshift leading to an altered amino acid

sequence from codon 6 or a premature termination at codon 11 in the predicted signal

peptide of the protein and the deletion. Rebibo-Sabbah et al. (2007) reported nonsense

mutations in patients with Usher syndrome type 1F subsequently in translation of a

variable length protein that resulted from partial read-through of the this nonsense

mutations. Ahmed et al. (2009) in a consanguineous Pakistani family with Usher



syndrome type IF, investigated the PCHD15 gene for mutations in affected members

and found a homozygous 1940C-G transversion that resulted in a ser647-to-ter (S647X)

substitution and predicted to truncate the protein in the EC6 domain. Doucette et al.

(2009) reported a novel c.1583 T>A transversion predicts an amino-acid substitution of

a valine with an aspartic acid at codon 528 (V528D) of PCDH15 in a consanguineous

family from the island of Newfoundland.

This identified novel mutation occurs in a highly conserved extracellular

cadherin (EC) domain of PCDH15 and is predicted to be more deleterious than the

previously identified missense mutations (R134G and G262D), (Le-Guedard et al.,

2007). Clinical history and the results of ophthalmologic, audiometric, and vestibular

tests of affected children of family B, ruled out nonsyndromic deafness because of

Usher syndrome. This study supports the hypothesis that missense mutations in

conserved motifs of PCDH15 cause usher syndrome in Pakstani family. The genotype-

phenotype correlation developed in USH1F is similar to that in several other USH1

genes and cautions against a prognosis of a dual sensory loss in deaf children found to

be homozygous for hypomorphic mutations at the USH1F locus.

Understanding clinical disease progression and molecular pathways is important

in the progress towards developing gene therapy to prevent blindness due to Usher

syndrome as well as delivering prognostic information to affected individuals.

Primary Microcephaly Chapter # 5


89

Chapter # 5

PRIMARY MICROCEPHALY



90

5.1. RESULTS:

5.1.1. PEDIGREES ANALYSIS:

5.1.1.1. Family C:

The family C belongs to the famous Khattak tribe of district Karak in

Khyber Pakhtunkhwa, region of Pakistan. The family members are highly educated

and are professionals. Profession of father of affected children is education. The

traditional system of marriage within Khattak tribe results in high rate of tribal

endogamy.

The pedigree of family C consists of ten individuals in two generations and

all were alive at the time of data collection (Figure 5.10). Four males were affected

and individual 1MIC010 was first identified with primary microcephaly, therefore,

referred as proband and he helped in tracing this disease in the family C. Pedigree

analysis strongly suggests autosomal recessive pattern of inheritance, as due to

marriage within tribe, affected members could be homozygous for the disease

allele. In pedigree of family C, all affected persons are present in second generation.

The phenotypically normal parents 1MIC001 and 1MIC002 produced four affected

children (1MIC003, 1MIC006, 1MIC009, and1MIC010). Primary Microcephaly is

present by birth in all affected individuals.

Blood samples from ten individuals were collected including six normal

(1MIC001, 1MIC002, 1MIC004, 1MIC005, 1MIC007, and1MIC008), and four

affected (1MIC003, 1MIC006, 1MIC009, and1MIC010) members of family C.

5.1.1.2. Family D:

The consanguineous family D also belongs to the khattak tribe of district

Karak of Khyber Pakhtunkhwa, region of Pakistan. The parents of affected children



91

are educated. Due to strict social customs the family members marry only within

family.

The kindred of family D spans on two generations and consists of ten

individuals, all were alive at the time of data collection (Figure 5.11). One male

and one female were affected and individual 2MIC006 first identified with primary

microcephaly, therefore, referred as proband and she helped in tracing this disease

in the family D. Pedigree analysis strongly suggests autosomal recessive pattern of

inheritance, as due to consanguineous marriage, affected members could be

homozygous for the disease allele. In pedigree of family D, all affected persons are

present in second generation. The phenotypically normal parents 2MIC001 and

2MIC002 produced two affected children (2MIC004, and 2MIC006). Primary

Microcephaly is present by birth in all affected individuals of this family.

Blood samples from ten individuals were collected including eight normal

(2MIC001, 2MIC002, 2MIC003, 2MIC005, 2MIC007, 2MIC008, 2MIC009 and

2MIC010), and two affected (2MIC004 and 2MIC006) individuals of family D.

5.1.2. CLINICAL DESCRIPTION OF FAMILIES C AND D:

Detailed clinical examination of affected individuals of families C and D

was performed and summarized as in Table 5.1. It was observed that microcephaly

is present at birth in all affected individuals (Figure 5.1).The head circumferences

of affected individuals in both families were given in Table 5.1. The ages of

patients in families C and D lie between 3 to 19 and 26 to 29 years respectively.

The facial features of affected individuals are normal except slopping or narrow

forehead. In individual 1MIC006 of family C, history of rare seizures was found.

Almost all affected individuals have mild to moderate degree of mental



92

retardation. However, no other neurological findings were observed in any of the

affected individual. The unaffected individuals in family were clinically normal.


In the present study, first DNA samples of normal and affected individuals of

families C and D with autosomal recessive primary microcephaly were screened for

linkage to the known loci of MCPH. Table 2.5 summarizes the polymorphic STR

markers that were used for linkage analysis, in regions of known loci for MCPH. No

evidence of linkage was observed with any of the STR markers for 8p22-pter

(MCPH1), 19q13.1-13.2 (MCPH2), 9q34 (MCPH3), 15q15-q21 (MCPH4), 13q12.2

(MCPH6) and 1p32.3-p33 (MCPH7) loci and therefore were excluded. On the basis of

results obtained (Figure 5.2-5.9), both Pakistani families with MCPH were mapped to

MCPH5 locus on chromosome 1q31, which harbors the ASPM gene. The affected

individuals of family C were found to be homozygous for STR markers D1S1660,

D1S1678, D1S1663, D1S2141 and D1S549 (Figure 5.10) by linkage mapping.

Similarly affected individuals 2MIC004 and 2MIC006 of family D were found

homozygous for STR marker D1S1660 (Figure 5.8). However, a crossover was

obtained for patient 2MIC006 with marker D1S518 and was found heterozygous for

disease allele (Figure 5.7). Moreover, another crossover for marker D1S1678 was

obtained in individuals 2MIC004 and 2MIC006 (Figure 5.9). These crossovers

localized the disease gene within approximately 204.6 cM on chromosome 1q31.

Individuals 2MIC001 and 2MIC002 of family D were first cousin and both carried

same disease chromosome in a heterozygous state (Figure 5.11).



93

Table 5.1: A summary of clinical findings of affected members of MCPH families

Pedigree

code

Age

(years)

Head

circumference

(cm)

Clinical findings

1MIC003 19 44 Sloping forehead, Mild mental

retardation

1MIC006 15 44.5 Sloping forehead, rare seizures,

Moderate mental retardation

1MIC008 08 42 Narrow forehead, Moderate mental

retardation

1MIC010 03 43.5 Sloping forehead, Mild mental

retardation

2MIC004 29 42.5 Sloping forehead, Moderate mental

retardation

2MIC006 26 46 Sloping forehead, Moderate mental

retardation

Figure 5.1: Photographs of few primary microcephaly patients of MCPH Pakistani

families



94

Figure: 5.2 Non-denaturing 8% polyacrylamide gel electropherogram for STR

marker D1S1660, demonstrating homozygosity among the family C affected

members (1MIC003, 1MIC006, 1MIC009 and 1MIC010).






95





D1S2141, demonstrating homozygosity among the family C affected members

(1MIC003, 1MIC006, 1MIC009 and 1MIC010).



96


marker D1S549, demonstrating homozygosity among the family C affected members

(1MIC003, 1MIC006, 1MIC009 and 1MIC010).


marker D1S518, demonstrating homozygosity for a patient (2MIC004), and

heterozygosity (due a crossover) for a patient (2MIC006) of family D.



97


marker D1S1660, demonstrating homozygosity among the family D affected

members (2MIC004 and 2MIC006).


marker D1S1678, demonstrating heterozygosity (due to crossover) among the family

D affected members (2MIC004 and 2MIC006).



98

1MIC0043 12 12 11 13 1

1MIC0011 31 21 21 12 3

D1S1660D1S1678D1S1663D1S2141

D1S549

1MIC0021 21 11 12 13 1

1MIC0031 11 11 11 22 3

D1S1660D1S1678D1S1663D1S2141

D1S549

1MIC0053 22 12 11 23 3

1MIC0061 11 11 11 22 3

1MIC0071 21 11 11 12 1

1MIC0083 22 12 11 13 1

1MIC0091 11 11 11 22 3

1MIC0101 11 11 11 22 3

Figure 5.10: Pedigree of 1MIC, a nonconsanguineous Pakistani family with STR

genotyping data for MCPH5 locus on chromosome 1q31.3. Squares symbolize males

and circles symbolize females. All filled circles and squares symbolize affected

members, whereas clear circles and squares symbolize unaffected members. Single line

between symbols is representing nonconsanguineous marriage.



99

Figure 5.11: Pedigree of 2MIC, a consanguineous Pakistani family with STR

genotyping data for MCPH5 locus on chromosome 1q31.3. Squares symbolize males

and circles symbolize females. All filled circles and squares symbolize affected

members, whereas clear circles and squares symbolize unaffected members. Between

symbols, double line represents consanguineous marriage.



100

5.1.4. ASPM GENE MUTATION SCREENING:

Families C and D were screened for mutations of the ASPM gene. Twenty

eight exons of ASPM were amplified from DNA of both normal and affected

individuals of families C and D by using primers sets (Table 2.6), (Nicholas et al.,

2009). A common homozygous G>A pathogenic mutation (c.3978G>A) in exon 17 of

the ASPM gene was found in all the affected individuals of the both families (Figure

5.12). The change was identified in homozygous condition only in the patients and the

normal parents were carrier for the change. The CLC sequence viewer software

predicted the substitution of amino acid residue at position 1326 of ASPM gene protein

product from tryptophan to a stop codon (p.Trp1326Stop). It resulted to a truncated

protein product of 1325 amino acids, instead of normal 3477 amino acid protein.



101

Figure 5.12: DNA sequence analysis of the ASPM gene in 2 families (1 and 2MIC) with

microcephaly. DNA sequencing analysis revealed a homozygous G>A pathogenic

mutation (c.3978G>A) in exon 17 of the ASPM gene in all the affected individuals of

the both families. The upper electropherogram represents the sequence in the carrier

individual, while the lower electropherogram represents the sequence in the affected

individual. Arrows indicate the site of mutation.



102

5.2. DISCUSSION:

The genetic disorders that are strongly associated with consanguinity are

inherited as an autosomal recessive trait (Hamamy et al., 2007). In Pakistan,

consanguineous marriages are common and 60% of marriages are reported to be

within families and approximately 80% of marriages are practiced between first

cousins (Hussain and Bittles, 1998). Autosomal recessive primary microcephaly

(MCPH) may emerge worldwide in a population as the prevalence of a deleterious

gene or when degree of consanguinity increases.

MCPH shows considerable locus heterogeneity and seven loci (MCPH1–

MCPH7) have been mapped to date. Five loci out of seven reported (MCPH1 to

MCPH3, MCPH5 and MCPH6) have been identified in families of northern Pakistani

origin (Woods et al., 2005) and two loci, MCPH4 and MCPH7 were reported to be

identified in the Moroccan and Indian populations respectively (Jamieson et al., 1999;

Kumar et al., 2009). Five genes for the seven known loci are reported to date and they

include Microcephalin at MCPH1, CDK5RAP2 at MCPH3, ASPM at MCPH5, CENPJ

at MCPH6, and STIL at MCPH7 (Woods et al., 2005; Kumar et al., 2009; Yu et al.,

2010). Bond et al. (2005) noted that the ASPM, CDK5RAP2, and CENPJ genes, each

of which is mutant in a form of MCPH, encode proteins that are centrosomal

components during mitosis, which emphasized the key role of the centrosome in each

major stage of the development and function of the nervous system. Molecular genetic

analysis of MCPH in consanguineous families has been instrumental for mapping

disease loci and for identification of causative genes and mutations.

In present study, we reported a consanguineous family C and a non-

consanguineous (tribal endogamy) family D from Karak district of KPK in Pakistan

with autosomal recessive primary microcephaly. In these families microcephaly



103

was present by birth in all affected individuals and they are born with significantly

smaller head circumferences (Table 5.1) and are mentally retarded. Moreover, all

affected individuals have slopping or narrow forehead. In affected individuals of

Pakistani consanguineous families with primary microcephaly, the same abnormal

phenotypes were also observed by Gul et al. (2005) and Kousar et al. (2010).

The families C and D belong to famous Khattak tribe and the traditional

system of marriage within family/tribe results in high rate of consanguineous

marriages. Consequently, early age at first birth of a baby and tradition of producing

children to comparatively later ages may be the cause of autosomal recessive

primary microcephaly in these families. Analysis of pedigree is strongly suggestive

of autosomal recessive mode of inheritance as a consequence of marriages within

family/tribe. The affected individuals of family C were homozygous for the markers

linked to MCPH5 locus on chromosome 1q31 (Figure 5.10). Similarly, affected

individuals of family D were homozygous for marker D1S1660 linked to MCPH5

locus (Figure 5.8). However, crossovers were obtained for markers D1S518 and

D1S1678 in most of affected members of family D and these crossovers localized

the disease gene within approximately 204.6 cM on chromosome 1q31 (Figure 5.7

and 5.9). A common homozygous missense G>A pathogenic mutation

(c.3978G>A) in exon 17 of the ASPM gene (Figure 5.12), previously reported by

Nicholas et al. (2009), has been identified in Pakistani families C and D and is also

indicative of an autosomal recessive inheritance of MCPH either due to deleterious

gene or consanguinity. Therefore present study strongly supports the fact that

consanguineous marriages or tribe endogamy contributes to congenital rare

neurological diseases like MCPH that are inherited in autosomal recessive manner.



104

MCPH5 was identified by Roberts et al. (2002), on chromosome 1q31 and

is considered as the most common MCPH locus. The frequency of MCPH5 is 43%

in Khyber Pakhtunkhwa population due to consanguineous marriages endogamy

(Woods et al., 2005). MCPH5 locus has been mapped in different populations of

Jordan, Saudi Arabia, Holland, Yemen, Turkey, India, Iran, and Pakistan (Jamieson

et al., 2000;Pattison et al.,2000; Kumar et al., 2004; Gul et al., 2006; Nicholas et al.,

2009; Darvish et al., 2010). Pathogenic mutations in the ASPM gene at MCPH5

locus cause autosomal recessive primary microcephaly. Nicholas et al. (2009)

suggested that mutations in the ASPM gene are the most common cause of MCPH.

The ASPM gene contains a total of 28 exon, spanning 62 kb of genomic DNA. Most

of coding region of the ASPM gene is present in exon 3 and 18 (Bond et al., 2002).

Study of Bond et al. (2002) has suggested that the ASPM gene regulate proliferation

and differentiation of neuronal progenitor cells during brain development possibly

by modulation of mitotic spindle activity in cell division.

Disease associated mutations in the ASPM gene have been reported by

different studies. Bond et al. (2003) in a cohort study that included 23

consanguineous families and performed a complete mutation screening of the

ASPM gene. They identified a total of 19 mutations throughout the 10.4-kb ASPM

gene and these mutations were all predicted to be protein truncating. Kumar et al.

(2004) investigated of nine consanguineous Indian families with autosomal

recessive primary microcephaly, and identified different types of truncating

mutations in the ASPM gene. Similarly, Shen et al. (2005) identified a disease

associated mutation in the ASPM gene in affected individuals of a family with

primary microcephaly and epilepsy. In affected members of nine unrelated

consanguineous Pakistani families with MCPH, 6 different mutations were



105

identified by Gul et al. (2006) in the ASPM gene. Desir et al. (2008) reported a

family of two affected children with MCPH5 and identified a homozygous mutation

in the ASPM gene. In a consanguineous Moroccan family with MCPH5, Desir et al.

(2008) identified a homozygous truncating mutation in the ASPM gene.

Nicholas et al. (2009) screened the ASPM gene for mutations in 3 cohorts of

microcephalic children and identified pathogenic mutations that accounted for 39%

of 99 consanguineous MCPH families. Overall, the 27 novel mutations in the ASPM

gene were identified (Nicholas et al., 2009), including the present study identified

homozygous G>A pathogenic mutation (c.3978G>A) in exon 17 of the ASPM gene

in all the affected individuals of the families C and D (Figure 5.10 and 5.11). The

novel mutations identified by Nicholas et al. (2009), which almost doubled the total

number of ASPM mutations. Muhammad et al. (2009) identified different mutations

in ASPM gene in 20 Pakistani families with autosomal recessive primary

microcephaly and thus increased the total number of reported ASPM mutations from

35 to 47. Homozygous or compound heterozygous mutations in the ASPM gene

were identified by Passemard et al. (2009) in probands with MCPH5, including 16

novel truncating or nonsense mutations. Darvish et al. (2010) mapped the MCPH5

locus among consanguineous Iranian families with autosomal recessive primary

microcephaly and identified homozygous truncating mutations in the ASPM gene.

The identification of common mutation in ASPM gene in families C and D

with primary microcephaly analyzed in this study and several other families of same

ethnic group, will not only help to educate people about the anticipated genetic

consequences and genetic counseling but will also help the patients in prenatal

diagnosis, postnatal diagnosis and carrier testing to reduce the prevalence of MCPH

in a particular ethnic group of Pakistan.

Isolated Clinical Anophthalmia Chapter # 6


106

Chapter # 6

ISOLATED CLINICAL ANOPHTHALMIA



107

6.1. RESULTS:

6.1.1. PEDIGREE ANALYSIS:

A consanguineous family “E” with two affected daughters of isolated clinical

anophthalmia resides in district Kohat of Khyber Pakhtunkhwa region of Pakistan. The

surname of family is Khattak. This family has middle class socioeconomic status.

Members of this family are educated and practice consanguineous marriages in to

follow the family tradition of cousin marriages.

The pedigree of family E comprising of three generations and indicates presence

of eleven individuals, among them eight were alive and three were dead at the time of

data collection (Figure 6.1). In this family only two daughters were affected. Individual

2MOP006 was first identified with isolated clinical anophthalmia, therefore, referred as

proband and she helped in tracing this disease in the family C. Pedigree analysis

strongly suggests autosomal recessive pattern of inheritance, as due to first cousin

marriage, affected daughter could be homozygous for the mutant allele. In pedigree of

family E, both affected daughters are present in third generation. The phenotypically

normal parents 2MOP001and 2MOP002, produced two affected daughters. Bilateral

isolated anophthalmia is present at birth in both affected daughters and the ages of these

affected daughters lie between 04-13 years.

Blood samples from six individuals were collected including four clinically

normal (2MOP001, 2MOP002, 2MOP004, and 2MOP005), and two affected

(2MOP003, and 2MOP006) daughters of family E.



108

Figure 6.1: Pedigree of family E with bilateral isolated clinical anophthalmia. Squares

symbolize males and circles symbolize females. All filled circles and squares

symbolize affected members, whereas clear circles and squares symbolize unaffected

members. Between symbols, double line represents consanguineous marriage.



109


Thorough clinical examination of affected daughters was performed by

ophthalmologist. It was observed that bilateral isolated clinical anophthalmia i.e.,

absence of ocular tissue in the orbit of eye by birth present in both of them (Figure 6.2).

However, no other physical abnormality or mental retardation could be appreciated in

either of the affected daughters. As per opinion of the ophthalmologist, the clinical

anophthalmia of the two affected daughters does not have syndromic presentation.


In the present study to identify the locus responsible for the isolated bilateral

anophthalmia phenotype in individuals of this family, genomic DNA from normal and

affected individuals was genotyped using microsatellite markers for the known loci.

Table 2.6 summarizes the polymorphic STR markers that were used for linkage

analysis, in regions of known loci for clinical anophthalmia. No evidence of linkage

was observed with any of the STR markers for 14q32, 14q24.3, 18q21.3, and 14q21-22,

loci and therefore were excluded. In the view of the results obtained (Figure 6.3-6.6),

family E with isolated bilateral anophthalmia was mapped to a locus on chromosome

3q26.3-q27, where the SOX2 gene resides. Although a crossover was obtained with

marker D1S2427 in affected daughters (Figure 6.3), the critical disease region was

flanked by markers D3S1565, and D3S1311 in both patients. The estimated genetic

distance between these two markers was approximately 23 cM. However, based on

recessive mode of inheritance, homozygosity in the disease region of approximately 3

cM was observed in affected daughters in this family with markers D3S1262, D1S

2436 and D3S1580 (Figure 6.4-6.6). In family E, parents 2MOP001 and 2MOP002 of



110

affected daughters were first cousin and both carried same disease chromosome in a

heterozygous state (Figure 6.7)

6.1.4. SOX2 GENE MUTATION SCREENING:

All individuals of family E were screened for mutations in the SOX2 gene.

Polymerase chain reaction (PCR) amplification of single exon and promoter region of

SOX2 gene from DNA of both normal and affected individuals of family E, was

performed with forward and reverse primers sets, spanning the whole exonic region and

promoter region of SOX2 gene (Table 2.8 and Table 2.9). However, mutations were not

identified in the single exonic sequence and regulatory element of SOX2 gene by

comprehensive mutational analysis of both normal and affected individuals. As the

numbers of affected individuals are two in numbers so genes load score cannot be

calculated to examine combined effects of genes.



111

Figure 6.2: Photograph of eye of an anophthalmic patient of a Pakistani family.



112


D3S2427, demonstrating heterozygosity (due to a crossover) among the family E

affected members (2MOP003, and 2MOP006).


D3S1262, demonstrating homozygosity among the family E affected members

(2MOP003, and 2MOP006).



113



(2MOP003, and 2MOP006).



(2MOP003, and 2MOP006).



114

Figure 6.7: Pedigree of 2MOP, a consanguineous Pakistani family with STR

genotyping data mapped to a locus on chromosome 3q26.3-q27. Both parents are

carrier of defective (boxed) chromosome. The affected individuals (filled square and

circles) are homozygous for the defective chromosome.



115

6.2 DISCUSSION:

The term clinical anophthalmia was first used by Duke-Elder (Dukc-Elder, 1964), and

is a rare disease that the reported average prevalence of congenital anophthalmia is 3

per 100,000 populations (Campbell et al., 2002). Clinical anophthalmia is the absence

of the eye and diagnosed without histological examination (O’Keefe et al., 1987). The

most common phenotype in affected individuals is bilateral anophthalmia (Verma and

FitzPatrick, 2007), and rarely unilateral anophthalmia may be seen (Reis et al., 2010).

In present study, we reported a consanguineous family with two affected

daughters of isolated clinical anophthalmia from district Kohat of Khyber Pakhtunkhwa

region of Pakistan. Affected daughters do not have any congenital malformations

except for isolated bilateral anophthalmia. In addition, the family history showed that

there was no other member with anophthalmia. In this family, the affected daughters

have unaffected parents, who were first cousins, thus inheritance is undoubtedly

autosomal recessive. Consanguinity in a family as a risk factor and consequently

autosomal recessive mode of inheritance for clinical anophhalmia, have rarely been

reported in studies (Dukc-Elder, 1964, da Silva and de Sousa, 1981; Pearce et al., 1974;

Joseph, 1957). However, X-linked inheritance has been described for isolated clinical

anophthalmia (Brunquell et al., 1984; Verma and FitzPatrick, 2007). Epidemiological

studies have also reported other risk factors including late maternal age, multiple births,

low birth weight, less gestation period of infants, mechanical abortion and severe

vitamin A deficiency (Shaw et al., 2005; Kallen and Tornqvist, 2005; Forrester and

Merz, 2006;Verma and FitzPatrick, 2007). These risk factors were not identified in

family E as a cause of isolated clinical anophthalmia.



116

Linkage analysis of family E was performed with STR markers corresponding

to the candidate genes involved in clinical anophthalmia phenotypes. This Pakistani

family was linked to a locus at chromosome 3q26.3-q27, which harbors the SOX2 gene.

The critical disease region was flanked by markers D3S1565, and D3S1311 in affected

daughters; therefore, it is probable that the disease gene lies between these two markers

within a region of approximately 23 cM on chromosome 3. A crossover was obtained

for a marker D3S2427 in affected daughters (Figure 6.3), but these affected daughters

of family E showed homozygosity in the disease region of approximately 3 cM for

markers D3S1262, D1S2436 and D3S1580 (Figure 6.4-6.6). The linkage data

presented in this study suggests that a gene for isolated clinical anophthalmia is present

within the region of homozygosity of 3 cM at chromosome 3 (Figure 6.7). However,

mutation screening did not revealed any mutation in the exonic sequence and regulatory

element of SOX2 gene in parents and offsprings of this family. This indicates that

possibly another gene might be present in the mapped region for disease phenotype and

need to be identified and screened for disease-associated mutation in this family.

The severity of clinical anophthalmia is variable due to mutations in various

human genes that are associated with anophthalmia (Zhou et al., 2008; Reis et al.,

2010). Among them, SOX2 has been reported as a major causative gene for clinical

anophthalmia (Verma and FitzPatrick, 2007). By genetic analysis, Fantes et al. (2003)

identified the single-exon SOX2 gene in an intron of a noncoding SOX2OT (SOX2

overlapping transcript) gene. By using fluorescence in situ hybridization approach,

Stevanovic et al. (1994) mapped the SOX2 gene to chromosome 3q26.3-q27. SOX2 is

expressed universally in neural stem and neural precursors cells throughout the central

nervous system including the neural retina (D’Amour and Gage 2003; Ellis et al. 2004;



117

Ferri et al. 2004), and mutations in this gene are common cause of retinal and ocular

malformations in humans.

By sequence analysis of the coding region of SOX2 a heterozygous loss-of-

function mutation has been identified in individuals with unilateral and bilateral

anophthalmia in various research studies. In a mutation analysis study a 600-kb

microdeletion deletion contained of entire SOX2 gene and a de novo t (3; 11)(q27;

p11.2) translocation were reported in a female patient with isolated bilateral clinical

anophthalmia (Driggers et al., 1999). Male et al. (2002) investigated 3 unrelated

affected individuals with clinical anophthalmia and identified constitutional deletions

involving 3q27 in them. Similarly in another investigation the same deletion was

identified that contained SOX2 at the 3q breakpoint in individuals with bilateral clinical

anophthalmia, but it was found that deletion was present in heterozygous state and the

parents of affected individual had normal SOX2 gene sequence (Fantes et al., 2003). De

novo missense mutation and frameshift mutations in heterozygous state in coding

region of SOX2 in patients with bilateral anophthalmia/microphthalmia were also

reported (Ragge et al., 2005).

In a girl of 12 years with congenital bilateral clinical anophthalmia, Hagstrom

et al. (2005) found heterozygosity for a nonsense mutation in the SOX2 gene. In a

Mexican female infant with developmental delay, mild facial dysmorphism, and

bilateral clinical anophthalmia, Zenteno et al. (2005) also found heterozygosity for a

deletion mutation in the SOX2 gene. Faivre et al. (2006) reported heterozygosity for a

missense mutation in the SOX2 gene in a girl with bilateral clinical anophthalmos. The

additional clinical features including very narrow palpebral fissures, psychomotor

retardation and microcephaly were also recorded in that girl. The clinically normal

mother was found to be heterozygous for this mutation. Chassaing et al. (2007)



118

analyzed the SOX2 gene in two female sibs with clinical bilateral anophthalmia and

found heterozygosity for a 17-bp deletion in this gene. They further concluded that

haplo insufficiency of the SOX2 gene can cause clinical anophthalmia. In two sibs with

congenital bilateral clinical anophthalmia and brain development abnormalities,

Schneider et al. (2008) reported heterozygosity for a deletion mutation in the SOX2

gene. Similarly, in an Italian male with clinical bilateral anophthalmia and micropenis,

Pedace et al. (2009) found heterozygosity for an insertion mutation in the SOX2 gene

responsible for such phenotypes. In a Japanese man with bilateral clinical

anophthalmia, intellectual disability, seizures, hypogonadotropic hypogonadism, and

spastic diplegia, Numakura et al. (2010) reported heterozygosity for a nonsense

mutation in the SOX2 gene that causes this syndromic anophthalmia in patient.

Present study strongly supports the fact on the basis of pedigree and linkage

analysis that consanguineous marriage contributes to congenital isolated clinical

anophthalmia that is inherited in autosomal recessive manner. But this study could not

reveal a molecular basis for congenital clinical anophthalmia in this family, as a

consequence of mutations in SOX2. If more samples of congenital clinical

anophthalmia subjects would be investigated in families of same ethnic group, a better

estimation of disease related genes other than SOX2 but not yet identified in congenital

isolated clinical anophthalmia could be made in future.

Conclusion and Future Recommendations Chapter # 7


Chapter # 7

CONCLUSION AND FUTURE RECOMMENDATIONS



7.1. CONCLUSION:

The present study analyzed the genetic basis of some selected neurological

inherited diseases including oculocutanous albinism, usher syndrome, primary

microcephaly and isolated clinical anophthalmia in Pashtoon consanguineous/tribal

endogamy families of Khyber Pakhtunkhwa region of Pakistan. These selected families

suffering from neurological inherited diseases were analyzed for linkage to all the

known loci by using microsatellite STR markers and then by direct sequencing disease

associated mutations in the candidate genes were identified. Identification of the

genetic cause of inherited neurological diseases and development of molecular

diagnostic techniques in present study will help us to provide genetic counseling to the

affected families.

In this study, the disease phenotypes of families (A- E) with oculocutaneous

albinism, usher syndrome, primary microcephaly, and isolated clinical anophthalmia

respectively were mapped by genetic linkage analysis. The candidate genes (MC1R,

PCDH15, ASPM and SOX2) in the mapped regions were screened for disease

associated mutations by PCR amplification and direct DNA sequencing. The novel

disease-associated mutations were identified in MC1R and PCDH15.The disease

associated mutation identified in ASPM gene was also reported in several other families

of Pakistani origin with primary microcephaly. However, no disease associated

mutation was identified in SOX2 gene, which indicates that possibly another gene

responsible for disease phenotype is present in the mapped region.



7.2. FUTURE RECOMENDATIONS:

There is urgent need for the integration of genetic screening and counseling into

the public health services in Pakistan and particularly in Khyber Pakhtunkhwa, by

establishing genetic screening tests and counseling clinics, to guide those who have

family history of a disease.

In order to make a strong assessment of the health impact of consanguinity at the

ethnic level, more community-based genetic studies should be conducted to enhance

opportunities for early diagnosis, reduction of disease burden and prevention of genetic

disease in the whole life period. Moreover educational programs should be started to

educate those families with segregating autosomal recessive diseases to limit further

intermarriages.

Molecular genetic testing is now available in medicine practice due to recent

advancement in genetic research and their quick translation into clinical practice. Close

communication of the community doctors and clinical genetic specialists is necessary to

ensure high-quality and clinical validity of genetic tests. The technology of molecular

genetic testing is complex and has limits of ethical, legal and social issues. Therefore

community doctors must understand these issues and through proper consultation with

clinical genetics experts, should mentally prepare families before ordering molecular

genetic testing.

There is also great need to make record of genetic diseases in form of database

in order to find an estimated burden of congenital genetic disorders in a particular

community and to provide facts and figures to the general public and policymakers

about genetic risk factors for health in order to improve health of an individual and

community.



Another area of concern is the great need of investment in public health services

sector to ease the use of advance genetic technologies and implementation of genetics

research findings that could benefit communities.

References


123

REFERENCES

References


124

Adato, A., V. Michel, Y. Kikkawa, J. Reiners, K. N. Alagramam, D. Weil, H.

Yonekawa, U. Wolfrum, A. El-Amraoui, and C. Petit. 2005. Interactions in the

network of Usher syndrome type 1 proteins. Hum. Mol. Genet.14: 347-356.

Admin. 2011. Archive for the Neurological Diseases Category: Neurological Disorders

Health Tips, Information and Resources. http://neurological-

disorders.org/category/neurological-diseases/. Retrieve on 10-07-2011 at 9:30

am.

Ahmed, Z. M., S. Riazuddin, J. Ahmad, S. L. Bernstein, Y. Guo, M. F. Sabar, P.

Sieving, S. Riazuddin, A. J. Griffith, T. B. Friedman, I. A. Belyantseva, and

E. R. Wilcox. 2003. PCDH15 is expressed in the neurosensory epithelium of the

eye and ear and mutant alleles are responsible for both USH1F and DFNB23.

Hum. Mol. Genet. 12: 3215–23.

Ahmed, Z. M., S. Riazuddin, S. Khan, P. Friedman, S. Riazuddin, and T. Friedman.

2009. USH1H, a novel locus for type I Usher syndrome, maps to chromosome

15q22-23. Clin. Genet. 75: 86-91.

Ahmed, Z. M., S. Riazuddin, S. Aye, R. A. Ali, H. Venselaar, S. Anwar, P. P.

Belyantseva, M. Qasim, S. Riazuddin, T. B. Friedman. 2008. Gene structure

and mutant alleles of PCDH15: nonsyndromic deafness DFNB23 and type 1

Usher syndrome. Hum. Genet. 124: 215-223.

Ahmed, Z. M., S. Riazuddin, S. L. Bernstein, Z. Ahmed, S. Khan, A. J. Griffith, R. J.

Morell, T. B. Friedman, S. Riazuddin, and E. R. Wilcox. 2001. Mutations of the

protocadherin gene PCDH15 cause Usher syndrome type 1F. Am. J. Hum.

Genet. 69: 25–34.

Ahmed, Z. M., T. N. Smith, S. Riazuddin, T. Makishima, M. Ghosh, S. Bokhari, P. S.

Menon, D. Deshmukh, A. J. Griffith, S. Riazuddin, T. B. Friedman, and E. R.

References


125

Wilcox. 2002. Nonsyndromic recessive deafness DFNB18 and Usher syndrome

type IC are allelic mutations of USHIC. Hum. Genet. 110: 527–31.

Akey, J. M., H. Wang, M. Xiong, H. Wu, W. Liu, M. D. Shriver, and L. Jin. 2001.

Interaction between the melanocortin-1 receptor and P genes contributes to

inter-individual variation in skin pigmentation phenotypes in a Tibetan

population. Hum. Genet. 108:516–520.

al-Rajeh, S., O. Bademosi, H. Ismail, A. Awada, A. Dawodu, and H. al-Freihi. 1993. A

community survey of neurological disorders in Saudi Arabia: the Thugbah

study. Neuroepidemiology, 12: 164-78.

Alagramam, K. N., N. D. Miller, N. D. Adappa, D. R. Pitts, J. C. Heaphy, H. Yuan,

and R. J. Smith. 2007. Promoter, alternative splice forms, and genomic structure

of protocadherin 15. Genomics 90: 482-492.

Alagramam, K. N., C. L., H. Y., Murcia, Kwon, K. S., Pawlowski, C. G. Wright, and R.

P. Woychik. 2001. The mouse Ames waltzer hearing-loss mutant is caused by

mutation of Pcdh15, a novel protocadherin gene. Nat. Genet. 27: 99–102.

Alagramam, K. N., N. D. Miller, N. D. Adappa, D. R. Pitts, J. C. Heaphy, H. Yuan, and

R. J. Smith. 2005. Promoter alternative splice forms, and genomic structure of

protocadherin 15. Genomics 90: 482–92.

Alan, E., M. D. Guttmacher, S. Francis, and M. Collins. 2002. Review Article;

Genomic Medicine: A primer. N. Engl. J. Med. 347: 1512-1520.

Antonarakis, S. E., and J. S. Beckmann. 2006. Mendelian disorders deserve more

attention. Nat. Rev. Genet.7: 277-282.

Ashkenazi-Hoffnung, L., Y. Lebenthal, A. W. Wyatt, N. K. Ragge, S. Dateki, M.

Fukami, T. Ogata, M. Phillip, and G. Gat-Yablonski. 2010. A novel loss-of-

References


126

function mutation in OTX2 in a patient with anophthalmia and isolated growth

hormone deficiency. Hum. Genet. 127: 721-729.

Astuto, L. M., J. M. Bork, M. D. Weston, J. W. Askew, R. R. Fields, D. J. Orten, S. J.

Ohliger, S. Riazuddin, R. J. Morell, S. Khan, S. Riazuddin, and H. Kremer.

2002. CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse

families with Usher syndrome and nonsyndromic deafness. Am. J. Hum. Genet.

71: 262-275.

Ayuso, C., and J. M. Millan. 2010. Retinitis pigmentosa and allied conditions today: a

paradigm of translational research. Genome Med. 2: 34.

Badano, J. L., and N. Katsanis. 2002. Beyond Mendel: An evolving view of human

disease transmission. Nat. Rev. Genet. 3: 779-789.

Bakrania, P., D. O. Robinson, D. J. Bunyan, A. Salt, A. Martin, J. A. Crolla, A. Wyatt,

Fielder, J. Ainsworth, A. Moore, S. Read, J. Uddin, D. Laws, D. Pascuel-

Salcedo, C. Ayuso, L. Allen, J. R .O. Collin, and N. K. Ragge. 2007. SOX2

anophthalmia syndrome: 12 new cases demonstrating broader phenotype and

high frequency of large gene deletions. Br. J. Ophthalmol. 91: 1471–1476.

Ballabio, A. 2009. Learning Biology from the Study of Genetic Diseases. Fifth World

Conference on the Future of Science “The DNA Revolution” – Venice.

Bar-Yosef, U., I. Abuelaish, T. Harel, N. Hendler, R. Ofir, and O. S. Birk. 2004.

CHX10 mutations cause non-syndromic microphthalmia/anophthalmia in Arab

and Jewish kindreds. Hum. Genet. 115: 302-309.

Bastiaens, M. T., J. A. C. ter Huurne, C. Kielich, N. A. Gruis, R. G. J. Westendorp, B.

J. Vermeer, and J. N. B. Bavinck. 2001. Leiden Skin Cancer Study Team:

Melanocortin-1 receptor gene variants determine the risk of nonmelanoma skin

cancer independently of fair skin and red hair. Am. J. Hum. Genet. 68: 884-894.

References


127

Beaumont, K. A., R. A. Newton, D. J. Smit, J. H. Leonard, J. L. Stow, and R. A. Sturm.

2005. Altered cell surface expression of human MC1R variant receptor alleles

associated with red hair and skin cancer risk. Hum. Mol. Genet. 14: 2145-2154.

Bentley D.R., S. Balasubramanian, H.P. Swerdlow, G.P. Smith, J. Milton, C.G. Brown,

K. P. Hall, D.J. Evers, C. L. Barnes, and H. R. Bignell. 2008. Accurate whole

human genome sequencing using reversible terminator chemistry.Nature

456:53–59.

Ben-Yosef, T., S. L. Ness, A. C. Madeo, A. Bar-Lev, J. H. Wolfman, Z. M. Ahmed, R.

J. Desnick, J. P. Willner, K. B. Avraham, H. Ostrer, C. Oddoux, A. J. Griffith,

and T. B. Friedman. 2003. A mutation of PCDH15 among Ashkenazi Jews with

the type 1 Usher syndrome. N. Engl. J. Med. 348: 1664–70.

Bernardino, C. R. 2010. Congenital Anophthalmia: A Review of Dealing with Volume.

Middle East Afr. J. Ophthalmol. 17:156–160.

Bessant, D. A. R., S. Khaliq, A. Hameed, K. Anwar, S. Q. Mehdi, A. M. Payne, and S.

S. Bhattacharya. 1998. A locus for autosomal recessive congenital

microphthalmia maps to chromosome 14q32. Am. J. Hum. Genet. 62: 1113-

1116.

Bhat, V., S. Girimaji, G. Mohan, H. Arvinda, P. Singhmar, M. Duvvari, and A. Kumar.

2011. Mutations in WDR62, encoding a centrosomal and nuclear protein, in

Indian primary microcephaly families with cortical malformations. Clin. Genet.

80: 532–540.

Bilguvar, K., A. K. Ozturk, A. Louvi, K. Y. Kwan, M. Choi, B. Tatli, D. Yalnizoglu,

B. Tuysuz, A. O. Caglayan, S. Gokben, H. Kaymakcalan, and T. Barak. 2010.

Whole-exome sequencing identifies recessive WDR62 mutations in severe brain

malformations. Nature 467: 207-210.

References


128

Bittles, A. H. 2001. Consanguinity and its relevance to clinical genetics. Clin. Genet.

60:89–98.

Blaydon, D. C., R. F. Mueller, T. P. Hutchin, B. P. Leroy, S. S. Bhattacharya, A. C.

Bird, S. Malcolm, and M. Bitner-Glindzicz. 2003. The contribution of USH1C

mutations to syndromic and non-syndromic deafness in the UK. Clin. Genet. 63:

303-307.

Boeda, B., A. El-Amraoui, A. Bahloul, R. Goodyear, L. Daviet, S. Blanchard, I.

Perfettini, K. R. Fath, S. Shorte, J. Reiners, A. Houdusse, P. Legrain, U.

Wolfrum, G. Richardson, and C. Petit. 2002. Myosin VIIa, harmonin and

cadherin 23, three Usher I gene products that cooperate to shape the sensory

hair cell bundle. EMBO J. 21: 6689-6699.

Bolz, H., B. von-Brederlow, A. Ramirez, E. C. Bryda, K. Kutsche, H. G. Nothwang,

M. Seeliger, M. C. S. Cabrera, M. C. Vila, O. P. Molina, A. Gal, and C.

Kubisch. 2001. Mutation of CDH23, encoding a new member of the cadherin

gene family, causes Usher syndrome type 1D. Nat. Genet. 27: 108-112.

Bond, J., E. Roberts, G. H. Mochida, D. J. Hampshire, S. Scott, J. M. Askham, K.

Springell, M. Mahadevan, Y. J. Crow, A. F. Markham, C. A. Walsh, and C. G.

Woods. 2002. ASPM is a major determinant of cerebral cortical size. Nature

Genet. 32: 316-320.

Bond, J., E. Roberts, K. Springell, S. Lizarraga, S. Scott, J. Higgins, D. J. Hampshire,

E. E. Morrison, G. F. Leal, E. O. Silva, S. M. R. Costa, D. Baralle, M. Raponi,

G. Karbani, Y. Rashid, H. Jafri, C. Bennett, P. Corry, C. A. Walsh, and C. G.

Woods. 2005. Centrosomal mechanism involving CDK5RAP2 and CENPJ

controls brain size. Nat. Genet. 37: 353-355.

References


129

Bond, J., S. Scott, D. J. Hampshire, K. Springell, P. Corry, M. J. Abramowicz, G. H.

Mochida, R. C. M. Hennekam, E. R. Maher, J. P. Fryns, A. Alswaid, H. Jafri,

Y. Rashid, A. Mubaidin, C. A. Walsh, E. Roberts, and C.G. Woods. 2003.

Protein-truncating mutations in ASPM cause variable reduction in brain size.

Am. J. Hum. Genet. 73: 1170-1177.

Borhany, M., Z. Pahore, Z. Qadri, M. Rehan, A. Naz, A. Khan, S. Ansari, T. Farzana,

M. Nadeem, S. A. Raza, and T. Shamsi. 2010. Bleeding disorders in the tribe:

result of consanguineous in breeding. Orphanet J. Rare Dis. 5:23.

Bork, J. M., L. M. Peters, S. Riazuddin, S. L. Bernstein, Z. M. Ahmed, S. L. Ness, R.

Polomeno, A. Ramesh, M. Schloss, C. R. Srisailpathy, S. Wayne, S. Bellman,

D. Desmukh, Z. Ahmed, S. N. Khan, V. M. Kaloustian, X. C. Li, A. Lalwani, S.

Riazuddin, M. Bitner-Glindzicz, W. E. Nance, X. Z. Liu, G. Wistow, R. J.

Smith, A. J. Griffith, E. R. Wilcox, T. B. Friedman, and R. J. Morell. 2001.

Usher syndrome 1D and nonsyndromic autosomal recessive deafness: DFNB12

are caused by allelic mutations of the novel cadherin-like gene CDH23. Am. J.

Hum. Genet. 68: 26–37.

Boughman, J. A., M. Vernon, and K. A. Shaver. 1983. Usher syndrome: definition and

estimate of prevalence from two high-risk populations. J. Chronic Dis. 36: 595-

603.

Breitman, M. L., S. Clapoff, J. Rossant, L. C. Tsui, L. M. Glode, I. H. Maxwell, and A.

Bernstein. 1987. Genetic ablation: targeted expression of a toxin gene causes

microphthalmia in transgenic mice. Science 238: 1563-1565.

Brownstein, Z., T. Ben-Yosef, O. Dagan, M. Frydman, D. Abeliovich, M. Sagi, F. A.

Abraham, R. Taitelbaum-Swead, M. Shohat, M. Hildesheimer, T. B. Friedman,

K. B. Avraham. 2004. The R245X mutation of PCDH15 in Ashkenazi Jewish

References


130

children diagnosed with nonsyndromic hearing loss foreshadows retinitis

pigmentosa. Pediatr. Res. 55: 995–1000.

Brunquell, P. J., J. H. Papale, J. C. Horton, R. S. Williams, M. J. Zgrabik, D.M. Albert,

and E.T. Headley-White.1984. Sex-linked hereditary bilateral anophthalmos.

Arch. Ophthalmol. 102:108–113.

Bundey, S., and H. Alam. 1993. A 5-year prospective study of the health of children

indifferent ethnic groups, with particular reference to the effect on inbreeding.

Eur. J. Hum. Genet. 1: 206–219.

Campbell, H., E. Holmes, S. MacDonald, D. Morrison, and I. Jones. 2002. A capture-

recapture model to estimate prevalence of children born in Scotland with

developmental eye defects. J. Cancer Epidemiol. Prev. 7: 21-28.

Chaib, H., J. Kaplan, S. Gerber, C. Vincent, H. Ayadi, R. Slim, A. Munnich, J.

Weissenbach, and C. Petit. 1997. A newly identified locus for Usher syndrome

type I, USH1E, maps to chromosome 21q21. Hum. Mol. Genet. 6: 27–31.

Chassaing, N., B. Gilbert-Dussardier, F. Nicot, V. Fermeaux, F. Encha-Razavi, M.

Fiorenza, A. Toutain, and P. Calvas. 2007. Germinal mosaicism and familial

recurrence of a SOX2 mutation with highly variable phenotypic expression

extending from AEG syndrome to absence of ocular involvement. Am. J. Med.

Genet. 143A: 289-291.

Chen, J. M., N. Chuzhanova, P. D. Stenson, C. Ferec, and D. N. Cooper. 2005. Meta-

analysis of gross insertions causing human genetic disease: novel mutational

mechanisms and the role of replication slippage. Hum. Mutat. 25: 207-221.

Chial, H. 2008. Rare Genetic disorders: Learning about genetic disease through gene

mapping, SNPs and Microarray data. Nature education. 1:1.

References


131

Chiang, P. W., E. Spector, and A. C. H. Tsai. 2008. Evidence suggesting the inheritance

mode of the human P gene in skin complexion is not strictly recessive. Am. J.

Med. Genet. 146:1493-1496.

Chin, R. F., B. G. Neville, C. Peckham, H. Bedford, A. Wade, and R.C. Scott. 2006.

Incidence, cause, and short-term outcome of convulsive status epilepticus in

childhood: prospective population-based study. Lancet 368: 222–29.

Choi, M., U. I. Scholl, W. Ji, T. Liu, I. R. Tikhonova, P. Zumbo, A. Nayir, A.

Bakkaloglu. S. Ozen, S. Sanjad, C. Nelson-Williams, A. Farhi, S. Mane, and R.

P. Lifton. 2009. Genetic diagnosis by whole exome capture and massively

parallel DNA sequencing. Proc. Natl. Acad. Sci. 106: 19096–19101.

Colaizzo-Anas, T., and P. D. Aplan. 2003. Cloning and characterization of the SIL

promoter. Biochem. Biophys. Acta 1625: 207-213.

Collazo-Garcia, N., P. Scherer, and P. D. Aplan. 1995. Cloning and characterization of

a murine SIL gene. Genomics 30: 506-513.

Craig, J. 2008. Complex diseases: Research and applications. Nature Education 1:1.

Creel, D., F. E. O'Donnell, and C.J. Witkop.1978. Visual system anomalies in human

ocular albinos. Science 201: 931-933.

D’Amour, K. A., and F.H. Gage. 2003. Genetic and functional differences between

multipotent neural and pluripotent embryonic stem cells. Proc. Natl. Acad. Sci.

100: 11866–11872.

da Silva, E. O., and S. S. de Sousa.1981. Clinical Anophthalmia. Hum. Genet. 57:115-

116.

Danno, H., T. Michiue, K. Hitachi, A. Yukita, S. Ishiura, and M. Asashima. 2008.

Molecular links among the causative genes for ocular malformation: Otx2 and

Sox2 coregulate Rax expression. Proc. Natl. Acad. Sci. 105: 5408-5413.

References


132

Darvish, H., S. Esmaeeli-Nieh, G. B. Monajemi, M. Mohseni, S. Ghasemi-Firouzabadi,

S. S. Abedini, I. Bahman, P. Jamali, S. Azimi, F. Mojahedi, A. Dehghan, and Y

Shafeghati. 2010. A clinical and molecular genetic study of 112 Iranian families

with primary microcephaly. J. Med. Genet. 47: 823-828.

Dateki, S., K. Kosaka, K. Hasegawa, H. Tanaka, N. Azuma, S. Yokoya, K. Muroya,

M. Adachi, T. Tajima, K. Motomura, E. Kinoshita, H. Moriuchi, N. Sato, M.

Fukami, and T. Ogata. 2010. Heterozygous orthodenticle homeobox 2 mutations

are associated with variable pituitary phenotype. J. Clin. Endocr. Metab. 95:

756-764.

Dateki, S., M. Fukami, N. Sato, K. Muroya, M. Adachi, and T. Ogata. 2008. OTX2

mutation in a patient with anophthalmia, short stature, and partial growth

hormone deficiency: functional studies using the IRBP, HESX1, and POU1F1

promoters. J. Clin. Endocr. Metab. 93: 3697-3702.

De Chen, J., B. Bapat, R. Bascom, H. Willard, B. Gallie, and R. R. McInnes. 1989.

Identification of a developmentally regulated human retinal homeobox gene.

Am. J. Hum. Genet. 45: A111.

De Chen, J., L. Ploder, L. Collins, P. Thorner, V. Kalnins, Duncan, B. Taylor, and R.

R. McInnes. 1990. Chromosomal sublocalization and cellular expression of the

retinal homeobox gene HOX10. Am. J. Hum. Genet. 47: A102.

Debniak, T. R., Scott, B. Masojc, P. S. Andez, T. Huzarski, T. Byrski, B. De-bniak, G.

Orski, C. Cybulski, K. Me-drek, G. Kurzawski, T. V. Wetering, R. Maleszka, J.

O. Kładny, and J. Lubinsk. 2006. MC1R common variants, CDKN2A and their

association with melanoma and breast cancer risk. Int. J. Cancer. 119:2597–

2602.

References


133

Desir, J., M. Cassart, P. David, P. van-Bogaert, and M. Abramowicz. 2008. Primary

microcephaly with ASPM mutation shows simplified cortical gyration with

antero-posterior gradient pre- and post-natally. Am. J. Med. Genet. 146A: 1439-

1443.

Di Palma, F., R. H. Holme, E. C. Bryda, I. A. Belyantseva, R. Pellegrino, B. Kachar,

K. P. Steel, and K. Noben-Trauth. 2001. Mutations in Cdh23, encoding a new

type of cadherin, cause stereocilia disorganization in waltzer, the mouse model

for Usher syndrome type 1D. Nat. Genet. 27: 103-107.

Doucette, L., N. D. Merner, S. Cooke, E. Ives, D. Galutira, V. Walsh, T. Walsh, L.

MacLaren, T. Cater, B. Fernandez, J. S. Green, E. R. Wilcox, L. I. Shotland, X.

C. Li, M. Lee, M. C. King, and T. L. Young. 2009. Profound, prelingual

nonsyndromic deafness maps to chromosome 10q21 and is caused by a novel

missense mutation in the Usher syndrome type IF gene PCDH15. Eur. J. Hum.

Genet. 17: 554-64.

Driggers, R. W., C. J. Macri, J. Greenwald, D. Carpenter, J. Avallone, P. N. Howard-

Peebles, and S. W. Levin. 1999. Isolated bilateral anophthalmia in a girl with an

apparently balanced de novo translocation: 46, XX, t (3; 11) (q27; p11.2). Am.

J. Med. Genet. 87: 201-202.

Druley, T. E., F. L. Vallania, D. J. Wegner, K. E. Varley, O. L. Knowles, J. A. Bonds,

S. W. Robison, S. W. Doniger, A. Hamvas, and F. S. Cole. 2009. Quantification

of rare allelic variants from pooled genomic DNA. Nat. Methods 6: 263–265.

Dukc-Elder, S. 1964. Anophthalmos and extreme microphthalmos: System of

ophthalmology. St Louis: Mosby Year Book, Inc. Pp. 416-423.

Ebermann, I., H. P. Scholl, P. Charbel Issa, E. Becirovic, J. Lamprecht, B. Jurklies, J.

M. Millan, E. Aller, D. Mitter, and H. Bolz. 2007. A novel gene for Usher

References


134

syndrome type 2: mutations in the long isoform of whirlin are associated with

retinitis pigmentosa and sensorineural hearing loss. Hum. Genet. 121: 203-211.

Ellis, P., B. M. Fagan, S. T. Magness, S. Hutton, O. Taranova, S. Hayashi, A.

McMahon, M. Rao, and L. Pevny. 2004. SOX2, a persistent marker for

multipotential neural stem cells derived from embryonic stem cells, the embryo

or the adult. Dev. Neurosci. 26:148–165.

Engle, E. C. 2010. Human Genetic Disorders of Axon Guidance. Cold Spring Harb.

Perspect. Biol. 2: 1784-1787.

Espinos, C., J. M. Millan, M. Beneyto, and C. Najera. 1998. Epidemiology of Usher

syndrome in Valencia and Spain. Comm. Genet. 1: 223–228.

Evans, P. D., E. J. Vallender, and B. T. Lahn. 2006. Molecular evolution of the brain

size regulator genes CDK5RAP2 and CENPJ. Gene 375: 75-79.

Everts, R. E., J., Rothuizen, and B. A. van Oost. 2000. Identification of a premature

stop codon in the melanocyte-stimulating hormone receptor gene (MC1R) in

Labrador and golden retrievers with yellow coat colour. Animal Genet. 31: 194-

199.

Faghihi, A. M., S. Mottagui-Tabar, and C. Wahlestedt. 2004. Review Genetics of

neurological disorders. 2004. Expert Rev. Mol. Diagn. 4: 317-332

Faivre L, K. A. Williamson, V. Faber, N. Laurent, M. Grimaldi, C. Thauvin- Robinet,

C. Durand, F. Mugneret, J. B. Gouyon, A. Bron, F. Huet, C. Hayward, V.

Heyningen, and D. R. Fitzpatrick. 2006. Recurrence of SOX2 anophthalmia

syndrome with gonosomal mosaicism in a phenotypically normal mother. Am.

J. Med. Genet. 140: 636-639.

References


135

Faiyaz-Ul-Haque, M., S. H. E. Zaidi, M. S. Al-Mureikhi, I. Peltekova, L. C. Tsui, and

A. S. Teebi. 2007. Mutations in the CHX10 gene in nonsyndromic

microphthalmia/anophthalmia patients from Qatar. Clin. Genet. 72: 164-166,

Fantes, J. A., N. K. Ragge, S. A. Lynch, N. I. McGill, J. R. O. Collin, P. N. Howard-

Peebles, C. Hayward, A. J. Vivian, K. Williamson, V. van Heyningen, and D. R.

FitzPatrick. 2003. Mutations in SOX2 cause anophthalmia. Nat. Genet. 33:461-

463.

Farooq, M., S. Baig, N. Tommerup, and K. W. Kjaer. 2010. Craniosynostosis-

microcephaly with chromosomal breakage and other abnormalities is caused by

a truncating MCPH1 mutation and is allelic to premature chromosomal

condensation syndrome and primary autosomal recessive microcephaly type 1.

Am. J. Med. Genet. 152: 495-497.

Ferri, A. L. M., M. Cavallaro, D. Braida, A. Di Cristofano, A. Canta, A. Vezzani, S.

Ottolenghi, P. P. Pandolfi, M. Sala, S. DeBiasi, and S. K. Nicolis. 2004. Sox2

deficiency causes neurodegeneration and impaired neurogenesis in the adult

mouse brain. Development 131: 3805-3819.

Fish, J. L., Y. Kosodo, W. Enard, S. Paabo, and W. B. Huttner. 2006. Aspm

specifically maintains symmetric proliferative divisions of neuroepithelial cells.

Proc. Natl. Acad. Sci. 103: 10438-10443.

Flanagan, N., E. Healy, A. Ray, S. Philips, C. Todd, I. J. Jackson, M. A. Birch-Machin,

and J. L. Rees. 2000. Pleiotropic effects of the melanocortin 1 receptor (MC1R)

gene on human pigmentation. Hum. Mol. Genet. 9: 2531-2537.

Forrester, M. B and R. D. Merz. 2006. Descriptive epidemiology of anophthalmia and

microphthalmia in Hawaii, 1986–2001, Birth Defects. Res. A. Clin. Mol.

Teratol. 76:187-92.

References


136

Gantz, I., T. Yamada, T. Tashiro, Y. Konda, Y. Shimoto, H. Miwa, and J. M. Trent.

1994. Mapping of the gene encoding the melanocortin-1 (alpha-melanocyte

stimulating hormone) receptor (MC1R) to human chromosome 16q24.3 by

fluorescence in situ hybridization. Genomics 19: 394-395.

Gao, X., K. C. Simon, J. Han, M. A. Schwarzschild, and A. Ascherio. 2009. Genetic

determinants of hair color and Parkinson's disease risk. Ann. Neurol, 65, 76-82.

Garshasbi, M., M. M. Motazacker, K. Kahrizi, F. Behjati, S. S. Abedini, S. E. Nieh, S.

G. Firouzabadi, C. Becker, F. Ruschendorf, P. Nurnberg, A. Tzschach, R.

Vazifehmand, F. Erdogan, R. Ullmann, S. Lenzner, A. W. Kuss, H. H. Ropers,

and H. Najmabadi. 2006. SNP array-based homozygosity mapping reveals

MCPH1 deletion in family with autosomal recessive mental retardation and

mild microcephaly. Hum. Genet. 118: 708-715.

Gibbs, D., J. Kitamoto, and D. S. Williams. 2003. Abnormal phagocytosis by retinal

pigmented epithelium that lacks myosin VIIa, the Usher syndrome 1B protein.

Proc. Natl. Acad. Sci. 100: 6481-6486.

Gibson, F., J. Walsh, P. Mburu, A. Varela, K. A. Brown, M. Antonio, K. W. Beisel, K.

P. Steel, and S. D. M. Brown. 1995. A type VII myosin encoded by the mouse

deafness gene shaker-1. Nature 374: 62-64.

Gonzalez-Rodriguez, J., E. L. Pelcastre, J. L. Tovilla-Canales, J. E. Garcia-Ortiz, M.

Amato-Almanza, C. Villanueva-Mendoza, Z. Espinosa-Mattar, and J. C.

Zenteno. 2010. Mutational screening of CHX10, GDF6, OTX2, RAX and

SOX2 genes in 50 unrelated microphthalmia-anophthalmia-coloboma (MAC)

spectrum cases. Br. J. Ophthalmol. 94: 1100-4.

Gourie-Devi, M., G. Gururaj, P. Satishchandra, and D. K. Subbakrishna. 2004.

Prevalence of Neurological disorders in Banglore, India: A community based

References


137

study with a comparison between urban and rural areas. Neuroepidemiology 23:

261-8.

Grondahl, J. 1987. Estimation of prognosis and prevalence of retinitis pigmentosa and

Usher syndrome in Norway. Clin. Genet. 31: 255-264.

Gronskov, K., J. Ek, and K. Brondum-Nielsen. 2007. Oculocutaneous albinism.

Orphanet J. Rare Dis. 2: 2-43.

Guernsey, D. L., H. Jiang, J. Hussin, M. Arnold, K. Bouyakdan, S. Perry, T. Babineau-

Sturk, J. Beis, N. Dumas, S. C. Evans, M. Ferguson, M. Matsuoka, C.

Macgillivray, M. Nightingale, L. Patry, A. L. Rideout, A. Thomas, A. Orr, I.

Hoffmann, J. L. Michaud, P. Awadalla, D. C. Meek, M. Ludman, and M. E.

Samuels. 2010. Mutations in Centrosomal Protein CEP152 in Primary

Microcephaly Families Linked to MCPH4. Am. J. Hum. Genet. 87: 40–51.

Gul A., M. J. Hassan, S. Mahmood, W. Chen, S. Rahmani, M. I. Naseer, L. Dellefave,

N. Muhammad, M. A. Rafiq, M. Ansar, M. S. Chishti, G. Ali, T. Siddique,

and W. Ahmad. 2006. Genetic studies of autosomal recessive primary

microcephaly in 33 Pakistani families: Novel sequence variants in ASPM gene.

Neurogenetics 7:105–110.

Hagstrom, S. A., G. J. T. Pauer, J. Reid, E. Simpson, S. Crowe, I. H. Maumenee, E. I.

Traboulsi. 2005. SOX2 mutation causes anophthalmia, hearing loss, and brain

anomalies. Am. J. Med. Genet. 138a: 95-98.

Hamamy, H. A., A. T. Masri, A. M. Al-Hadidy, and K. M. Ajlouni. 2007.

Consanguinity and genetic disorders. A profile from Jordan. Saudi Med. J. 28:

1015- 1017.

References


138

Healy, E., N. Flannagan, A. Ray, C. Todd, I. J. Jackson, J. N. S. Matthews, M. A.

Birch-Machin, and J. K. Rees. 2000. Melanocortin-1-receptor gene and sun

sensitivity in individuals without red hair. Lancet 355: 1072-1073.

Hearing, V. J. 2000. The melanosome: the perfect model for cellular responses to the

environment. Pigment Cell Res.13: S23–S34.

Hever, A. M., K. A. Williamson, and V. van Heyningen. 2006. Developmental

malformations of the eye: the role of PAX6, SOX2 and OTX2. Clin. Genet. 69:

459-470.

Horvath, S., B. Zhang, M. Carlson, K. V. Lu, S. Zhu, R. M. Felciano, M. F. Laurance,

W. Zhao, S. Qi, Z. Chen, Y. Lee, A. C. Scheck, L. M. Liau, H. Wu, D. H.

Geschwind, P. G. Febbo, H. I. Kornblum, T. F. Cloughesy, S. F. Nelson, and P.

S. Mischel. 2006. Analysis of oncogenic signaling networks in glioblastoma

identifies ASPM as a molecular target. Proc. Natl. Acad. Sci. 103: 17402-

17407.

Hung, L. Y., C. J. C. Tang, and T. K. Tang. 2000. Protein 4.1 R-135 interacts with a

novel centrosomal protein (CPAP) which is associated with the gamma-tubulin

complex. Mol. Cell. Biol. 20: 7813-7825.

Hunter, D. J. 2005. Gene–environment interactions in human diseases. Nat. Rev. Genet.

6: 287–298.

Hussain, R., and A. H. Bittles. 1998. The prevalence and demographic characteristics of

consanguineous marriages in Pakistan. J. Biosoc. Sci. 30 : 261-75.

Hussain, R. 2005. The effect of religious, cultural and social identity on population

genetic structure among Muslims in Pakistan. Ann. Hum. Biol. 32 : 145- 53.

Inagaki, K., T. Suzuki, H. Shimizu, N. Ishii, Y. Umezawa, J. Tada, N. Kikuchi, M.

Takata, K. Takamori, M. Kishibe, M. Tanaka, Y. Miyamura, S. Ito, and Y.

References


139

Tomita. 2004. Oculocutaneous albinism type 4 is one of the most common types

of albinism in Japan. Am. J. Hum. Genet. 74: 466-471.

International Human Genome Sequencing Consortium. Finishing the euchromatic

sequence of the human genome. 2004. Nature 431: 931–945.

Jaber, L., G. L. Halpern, and M. Shohat. 1998. The impact of consanguinity worldwide.

Commu. Genet. 1: 12-17.

Jackson, A. P., D. P. McHale, D. A. Campbell, H. Jafri, Y. Rashid, J. Mannan, G.

Karbani, P. Corry, M. I. Levene, R. F. Mueller, A. F. Markham, N. J. Lench,

C. G. Woods. 1998. Primary autosomal recessive microcephaly (MCPH1) maps

to chromosome 8p22-pter. Am. J. Hum. Genet. 63: 541-546.

Jackson, A. P., H. Eastwood, S. M. Bell, J. Adu, C. Toomes, I. M. Carr, E. Roberts, D.

J. Hampshire, Y. J. Crow, A. J. Mighell, G. Karbani, H. Jafri, Y. Rashid, R. F.

Mueller, A. F. Markham, and C. G. Woods. 2002. Identification of

microcephalin, a protein implicated in determining the size of the human brain.

Am. J. Hum. Genet. 71: 136-142.

Jackson, I. J., P. S. Budd, M. Keighren, and L. McKie. 2007. Humanized MC1R

transgenic mice reveal human specific receptor function. Hum. Mol. Genet. 16:

2341-2348.

Jaijo, T., E. Aller, S. Oltra, M. Beneyto, C. Nájera, C. Ayuso, M. Baiget, M. Carballo,

G. Antiñolo, D. Valverde, F. Moreno, C. Vilela, H. Perez-Garrigues, A. Navea,

and J. M. Millán. 2006. Mutation profile of the MYO7A gene in Spanish

patients with Usher syndrome type I. Hum. Mutat. 27: 290–291.

Jaijo, T., E. Aller, M. Beneyto, C. Nájera, and J. M. Millan. 2005. Molecular genetics

study of Usher syndrome in Spain. Acta Otorrinolaringol. Esp. 56: 285-9.

References


140

Jamieson, C. R., C. Govaerts, and M. J. Abramowicz. 1999. Primary autosomal

recessive microcephaly: homozygosity mapping of MCPH4 to chromosome 15.

Am. J. Hum. Genet. 65: 1465-1469.

Jamieson, C. R., J. P. Fryns, J. Jacobs, G. Matthijs, and M. J. Abramowicz. 2000.

Primary autosomal recessive microcephaly: MCPH5 maps to 1q25-q32. Am. J.

Hum. Genet. 67: 1575-1577.

Johnson, K. R., L. H. Gagnon, L. S. Webb, L. L. Peters, N. L. Hawes, B. Chang, and Q.

Y. Zheng. 2003. Mouse models of USH1C and DFNB18: phenotypic and

molecular analyses of two new spontaneous mutations of the Ush1c gene. Hum.

Mol. Genet. 12: 3075–3086.

Jorde, L. B., J. C. Carey, M. J. Bamshad, and R. L. White. 2000. Medical Genetics.

2nd eds. St. Louis, Mosby Year Book, Inc.Pp.237-239.

Joseph, R. A. 1957. Pedigree of anophthalmos. Br. J. Ophthalmol. 41: 541-543.

Kaindl, A. M., S. Passemard, P. Kumar, N. Kraemer, L. Issa, A. Zwirner, B. Gerard,

Verloes, S. Mani, and P. Gressens. 2010. Many roads lead to primary

autosomal recessive microcephaly. Prog. Neurobiol. 90: 363-83.

Kallen, B., and K. Tornqvist. 2005. The epidemiology of anophthalmia and

microphthalmia in Sweden. Eur. J. Epidemiol. 20:345–50.

Kaplan, J., S. Gerber, D. Bonneau, J. M. Rozet, O. Delrieu, M. L. Briard, H. Dollfus, I.

Ghazi, J. L. Dufier, J. Frezal, and A. Munnich. 1992. A gene for Usher

syndrome type I (USH1A) maps to chromosome 14q. Genomics 14: 979– 987.

Karaman, A. 2008. Oculocutaneous albinism type 1A: A case report. Dermatol. Online

J. 14: 13.

References


141

Karkera, J. D., S. Izraeli, E. Roessler, A. Dutra, I. Kirsch, and M. Muenke. 2002. The

genomic structure, chromosomal localization, and analysis of SIL as a candidate

gene for holoprosencephaly. Cytogenet. Genome Res. 97: 62-67.

Kastury, K., T. Druck, K. Huebner, C. Barletta, D. Acampora, A. Simeone, A. Faiella,

and E. Boncinelli. 1994. Chromosome locations of human EMX and OTX

genes. Genomics 22: 41-45.

Kazmierczak, P. H., Sakaguchi, J. Tokita, E. Wilson-Kubalek, R. A. Milligan, U.

Muller, and B. Kachar. 2007. Cadherin 23 and protocadherin 15 interact to form

tip-link filaments in sensory hair cells. Nature 449: 87-91.

Kelberman, D., S. C. P. de Castro, S. Huang, J. A. Crolla, R. Palmer, J. W. Gregory,

D. Taylor, L. Cavallo, M. F. Faienza, R. Fischetto, J. C. Achermann, J. P.

Martinez-Barbera, K. Rizzoti, R. Lovell-Badge, I. C. A. F. Robinson, D.,

Gerrelli, and M. T. Dattani. 2008. SOX2 plays a critical role in the pituitary,

forebrain, and eye during human embryonic development. J. Clin. Endocr.

Metab. 93: 1865-1873.

Kelley, P. M., M. D. Weston, Z. Y. Chen, D. J. Orten, T. Hasson, L. D. Overbeck, J.

Pinnt, C. B. Talmadge, P. Ing, M. S. Mooseker, D. Corey, J. Sumegi, and W. J.

Kimberling. 1997. The genomic structure of the gene defective in Usher

syndrome type Ib (MYO7A). Genomics 40: 73-79.

Kennedy, C., J. ter-Huurne, M. Berkhout, N. Gruis, M. Bastiaens, W. Bergman, R.

EWillemze, and J. N. Bavinck. 2001. Melanocortin 1 receptor (MC1R) gene

variants are associated with an increased risk for cutaneous melanoma which is

largely independent of skin type and hair color. J. Invest. Dermatol. 117: 294–

300.

References


142

Kennedy, C., J. ter-Huurne, M. Berkhout, N. Gruis, M. Bastiaens, W. Bergman, R.

Willemze, B. Vavinck, and J. N. Bavnick. 2001. Melanocortin 1 receptor

(MC1R) gene variants are associated with an increased risk for cutaneous

melanoma which is largely independent of skin type and hair color. J. Invest.

Dermatol. 117: 294-300.

Kikkawa, Y., H. Shitara, S. Wakana, Y. Kohara, T. Takada, M. Okamoto, C. Taya,

K. Kamiya, Y. Yoshikawa, H. Tokano, K. Kitamura, K. Shimizu, Y.

Wakabayashi, T. Shiroishi, R. Kominami, and H. Yonekawa. 2003. Mutations

in a new scaffold protein Sans cause deafness in Jackson shaker mice. Hum.

Mol. Genet. 12: 453-461.

Kim, D. W., S. H. Nam, R. N. Kim, S. H. Choi, and H. S. Park. 2010. Whole human

exome capture for high-throughput sequencing. Genome 53:568-574.

Kimberling, W., and A. Lindenmuth. 2007. Genetics, hereditary hearing loss, and

ethics. Seminars in Hearing. 28: 216–225.

Kimberling, W. J., C. G. Moller, S. Davenport, I. A. Priluck, P. H. Beighton, J.

Greenberg, W. Reardon, M. D. Weston, J. B. Kenyon, J. A. Grunkemeyer, S. P.

Dahl, L. D. Overbeck, D. J. Blackwood, A. M. Brower, D. M. Hoover, P.

Rowlandand, and R. J. H. Smith. 1992. Linkage of Usher syndrome type I gene

(USH1B) to the long arm of chromosome 11. Genomics 14: 988–994.

King, R. A., and C. G. Summers. 1988. Albinism. Dermatol. Clin. 6:217-228.

King, R. A., R. K. Willaert, R. M. Schmidt, J. Pietsch, S. Savage, M. J. Brott, J. P.

Fryer, C. G. Summers, and W. S. Oetting. 2003. MC1R mutations modify the

Classic phenotype of oculocutaneous albinism type 2 (OCA2). Am. J. Hum.

Genet. 73: 638-645.

References


143

King, R. A., V. J. Hearing, D. J. Creel, and W. S. Oetting. 1995. Albinism. In: S. R.

Scriver, A. L. Beaudet, W. S. Sly, and D. Valle (eds.). The Metabolic and

Molecular bases of inherited Disease. 7th eds. McGraw-Hill, New York. Pp.

4353-4392.

Kitamura, K., H. Kakoi, Y. Yoshikawa, and F. Ochikubo. 1992. Ultrastructural findings

in the inner ear of Jackson shaker mice. Acta Otolaryng. 112: 622-627.

Kleylein-Sohn, J., J. Westendorf, M. Le Clech, R. Habedanck, Y. D. Stierhof, and E. A.

Nigg. 2007. Plk4-induced centriole biogenesis in human cells. Dev. Cell 13:

190-202.

Knottnerus, J. A. 2003.Community genetics and community medicine. Fam Pract.

20:601–6.

Kornack, D. R. 2000. Neurogenesis and the evolution of cortical diversity: mode,

tempo, and partitioning during development and persistence in adulthood. Brain

Behav. Evol. 55: 336–344.

Kouprina, N., A. Pavlicek, N. K. Collins, M. Nakano, V. N. Noskov, J. I. Ohzeki, G. H.

Mochida, J. I. Risinger, P. Goldsmith, M. Gunsior, G. Solomon, W. Gersch, J.

H. Kim, J. C. Barrett, C. A. Walsh, J. Jurka, H. Masumoto, and V. Larionov.

2005. The microcephaly ASPM gene is expressed in proliferating tissues and

encodes for a mitotic spindle protein. Hum. Mol. Genet. 14: 2155-2165.

Kousar, R., H. Nawaz, M. Khurshid, G. Ali, S. U. Khan, H. Mir, M. Ayub, A. Wali,

N. Ali, M. Jelani, S. Basit, W. Ahmad, and M. Ansar. 2010. Mutation Analysis

of the ASPM Gene in 18 Pakistani Families with Autosomal Recessive Primary

Microcephaly. J. Child Neurol. 25: 715-720.

References


144

Kumar, A., S. C. Girimaji, M. R. Duvvari, and S. H. Blanton. 2009. Mutations in STIL,

encoding a pericentriolar and centrosomal protein, cause primary microcephaly.

Am. J. Hum. Genet. 84: 286-290.

Kumar, A., S. H. Blanton, M. Babu, M. Markandaya, and S. C. Girimaji. 2004. Genetic

analysis of primary microcephaly in Indian families: novel ASPM mutations.

Clin. Genet. 66: 341-348.

Le -Guedard. S., V. Faugere, S. Malcolm, M. Claustres, and A. F. Roux. 2007. Large

genomic rearrangements within the PCDH15 gene are a significant cause of

USH1F syndrome. Mol. Vis. 13: 102–107.

Leal, G. F., E. Roberts, E.O. Silva, S. M. R. Costa, D. J. Hampshire, and C. G. A.

Woods. 2003. A novel locus for autosomal recessive primary microcephaly

(MCPH6) maps to 13q12.2. J. Med. Genet. 40: 540-542.

Lee, S.T., R. D. Nicholls, R. E. Schnur, L. C. Guida, J. Lu-Kuo, N. B. Spinner, E. H.

Zackai, and R. A. Spritz. 1994. Diverse mutations of the P gene among African-

Americans with type II (tyrosinase-positive) oculocutaneous albinism (OCA2).

Hum. Mol. Genet. 3: 2047-2051.

Lequeux, L., A. M. Rio, A. Vigouroux, M. Titeux, H. Etchevers, F. Malecaze, N.

Chassaing, and P. Calvas. 2008. Confirmation of RAX gene involvement in

human anophthalmia. Clin. Genet. 74: 392-395.

Levy, G., F. Levi-Acobas, S. Blanchard, S. Gerber, D. Larget-Piet, V. Chenal, X. Z.

Liu, V. Newton, K. P. Steel, S. D. Brown, A. Munnich, J. Kaplan, C. Petit, and

D. Weil. 1997. Myosin VIIA gene: heterogeneity of the mutations responsible

for Usher syndrome type IB. Hum. Mol. Genet. 6: 111-116.

Lewis, R. 2001. Human Genetics: Concepts and Applications, 4th eds. McGraw-Hill,

New York. Pp. 23-25.

References


145

Li, B., and S. M. Leal. 2009. Discovery of rare variants via sequencing: Implications

for the design of complex trait association studies. PLoS Genet. 5: 481-484.

Lieb, K., and M. H. Selim. 2008. Preoperative Evaluation of Patients with Neurological

Disease. Semin Neurol. 28:603-610.

Liu, X. Z., J. Walsh, Y. Tamagawa, K. Kitamura, M. Nishizawa, K. P. Steel, and S. D.

M. Brown. 1997. Autosomal dominant non-syndromic deafness caused by a

mutation in the myosin VIIA gene. Nat. Genet. 17: 268-269.

Lowry, R. B., R. Kohut, B. Sibbald, and J. Rouleau. 2005.Anophthalmia and

microphthalmia in the Alberta congenital anomalies surveillance system. Can. J.

Ophthalmol. 40: 38–44.

Luijendijk, M. W. J., E. van Wijk, A. M. L. C. Bischoff, E. Krieger, P. L. M. Huygen,

R. J. E. Pennings, H. G. Brunner, C. W. R. J. Cremers, F. P. M. Cremers, and

H. Kremer. 2004. Identification and molecular modelling of a mutation in the

motor head domain of myosin VIIA in a family with autosomal dominant

hearing impairment (DFNA11). Hum. Genet. 115: 149-156.

Lund, P. M., T. G. Maluleke, I. Gaigher, and M. J. Gaigher. 2007. Oculocutaneous

albinism in a rural community of South Africa: a population genetic study. Ann.

Hum. Biol. 34(4):493-7.

Lyons, E. J., A. J. Frodsham, L. Zhang, A. V. Hill, and W. Amos. 2009. Consanguinity

and susceptibility to infectious diseases in humans. Biol. Lett. 23. 5 : 574-6.

Maerker, T., E. van Wijk, N. Overlack, F. F. J. Kersten, J. McGee, T. Goldmann, E.

Sehn, R. Roepman, E. J. Walsh, H. Kremer, and U. Wolfrum. 2008. A novel

Usher protein network at the periciliary reloading point between molecular

transport machineries in vertebrate photoreceptor cells. Hum. Mol. Genet. 17:

71-86.

References


146

Magenis, R. E., L. Smith, J. H. Nadeau, K. R. Johnson, K. G. Mountjoy, and R. D.

Cone. 1994. Mapping of the ACTH, MSH, and neural (MC3 and MC4)

melanocortin receptors in the mouse and human. Mamm. Genome 5: 503-508.

Male, A., A. Davies, A. Bergbaum, J. Keeling, D. FitzPatrick, C. M. Ogilvie, and J.

Berg. 2002. Delineation of an estimated 6.7 MB candidate interval for an

anophthalmia gene at 3q26.33-q28 and description of the syndrome associated

with visible chromosome deletions of this region. Eur. J. Hum. Genet. 10: 807-

812.

Manga, P., J. G. R. Kromberg, N. F. Box, R. A. Sturm, T. Jenkins, and M. Ramsay.

1997. Rufous oculocutaneous albinism in southern African blacks is caused by

mutations in the TYRP1 gene. Am. J. Hum. Genet. 61: 1095–1101.

Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: A Laboratory

Manual. 2nd eds. Cold Spring Harbor Laboratory Press.

Manolio, T. A., F. S. Collins, N. J. Cox, D. B. Goldstein, L. A. Hindorff, D. J. Hunter,

M. I. McCarthy, E. M. Ramos, L. R. Cardon, and A. Chakravarti. 2009. Finding

the missing heritability of complex diseases. Nature.461:747–753.

Masui, S., Y. Nakatake, Y. Toyooka, D. Shimosato, R. Yagi, K. Takahashi, H. Okochi,

A. Okuda, R. Matoba, A. A. Sharov, M. S. Ko, and H. Niwa. 2007. Pluripotency

governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem

cells. Nat. Cell Biol. 9: 625-635.

Mathers, P. H., A. Grinberg, K. A. Mahon, and M. Jamrich. 1997. The Rx homeobox

gene is essential for vertebrate eye development. Nature 387: 603-607.

McLean, C. J., N. K. Ragge, R. B. Jones, and J. R. O. Collin. 2003. The management

of orbital cysts associated with congenital microphthalmos and anophthalmos.

Br. J. Ophthalmol. 87: 860–863.

References


147

Mehndiratta, M. M., B. Paul, and P. Mehndiratta. 2007. Arranged marriage,

consanguinity and epilepsy. Neurol. Asia. 12 : 15 – 17.

Mets, M. B., N. M. Young, A. Pass, and J. B. Lasky. 2000. Early diagnosis of Usher

syndrome in children. Trans. Am. Ophthalmol. Soc. 98: 237–242.

Millan, J. M., E. Aller, T. Jaijo, F. Blanco-Kelly, A. Gimenez-Pardo and C. Ayuso.

2011. Review Article; An Update on the Genetics of Usher Syndrome. J.

Ophthalmol. 1- 8.

Morrison, D., D. FitzPatrick, I. Hanson, K. Williamson, V. van Heyningen, B. Fleck

Jones, J. Chalmers, and H. Campbell. 2002. National study of microphthalmia,

anophthalmia, and coloboma (MAC) in Scotland: investigation of genetic

aetiology. J. Med. Genet. 39:16-22.

Morton, N. E. 1991. Genetic epidemiology of hearing impairment. Ann. N. Y. Acad.

Sci. 630: 16–31.

Moynihan, L., A. P. Jackson, E. Roberts, G. Karbani, I. Lewis, P. Corry, G. Turner, R.

F. Mueller, N. J. Lench, and C. G. Woods. 2000. A third novel locus for

primary autosomal recessive microcephaly maps to chromosome 9q34. Am. J.

Hum. Genet. 66: 724-727.

Muhammad, F., S. M. Baig, L. Hansen, M. S. Hussain, I. A. Inayat, M. Aslam, J. A.

Qureshi, M. Toilat, E. Kirst, M. Wajid, P. Nurnberg, H. Eiberg, N. Tommerup,

and K. W. Kjaer. 2009. Compound heterozygous ASPM mutations in Pakistani

MCPH families. Am. J. Med. Genet. 149: 926-930.

Murdock, D. R., G. D. Clark, M. N. Bainbridge, I. Newsham, Y. Q. Wu, D. M. Muzny,

S. W. Cheung, R. A. Gibbs, and M. B. Ramocki. 2011. Whole-exome

sequencing identifies compound heterozygous mutations in WDR62 in siblings

with recurrent polymicrogyria. Am. J. Med. Genet. 155: 2071-2077.

References


148

Nachman, M. W., H. E. Hoekstra, and S. L. D'Agostino. 2003. The genetic basis of

adaptive melanism in pocket mice. Proc. Natl. Acad. Sci. 100: 5268-5273.

Nagase, T., R. Kikuno, M. Nakayama, M. Hirosawa, and O. Ohara. 2000. Prediction of

the coding sequences of unidentified human genes. XVIII. The complete

sequences of 100 new cDNA clones from brain which code for large proteins in

vitro. DNA Res. 7: 273-281.

Nakayama, K., A. Soemantri, F. Jin, B. Dashnyam, R. Ohtsuka, P. Duanchang, M. N.

Isa, W. Settheetham-Ishida, S. Harihara, and T. Ishida. 2006. Identification of

novel functional variants of the melanocortin 1 receptor gene originated from

Asians. Hum. Genet. 119: 322-330.

Naoi, K., T. Kuramoto, Y. Kuwamura, H. Gohma, M. Kuwamura, and T. Serikawa.

2009. Characterization of the Kyoto Circling (KCI) Rat Carrying a Spontaneous

Nonsense Mutation in the Protocadherin 15 (Pcdh15). Gene. Exp Anim. 58: 1–

10.

National Institute of Health. 2011. Genes and Disease—Information and Chromosome

Maps from National Institutes of Health. http://www.ncbi.nlm.nih.gov/disease/.

Retrieve on 12-08-2011 at 8:30 am.

Newton, C. R., and B. G. Neville. 2010. Paediatric neurology: advances on many

fronts. Lancet Neurol. 8: 14–15.

Newton, J. M., A.L. Wilkie, L. He, S. A. Jordan, D.L. Metallinos, N.G. Holmes, I. J.

Jackson, and G. S. Barsh. 2000. Melanocortin 1 receptor variation in the

domestic dog. Mamm. Genome 11: 24-30.

Newton, J. M., O. Cohen-Barak, N. Hagiwara, J. M. Gardner, M. T. Davisson, R. A.

King, and M. H. Brilliant. 2001. Mutations in the human orthologue of the

References


149

mouse underwhite gene (uw) underlie a new form of oculocutaneous albinism,

OCA4. Am. J. Hum. Genet. 9: 981–988.

Nicholas, A. K., E. A. Swanson, J. J. Cox, G. Karbani, S. Malik, K. Springell, D.

Hampshire, M. Ahmed, J. Bond, D. D. Benedetto. M. Fichera, C. Romano, W.

B. Dobyns, and C. G. Woods. 2009. The molecular landscape of ASPM

mutations in primary Microcephaly. J. Med. Genet. 46: 249– 253.

Noben-Trauth, K., Q. Y. Zheng, and K. R. Johnson. 2003. Association of cadherin 23

with polygenic inheritance and genetic modification of sensorineural hearing

loss. Nat. Genet. 35: 21-23.

Numakura, C., S. Kitanaka, M. Kato, S. Ishikawa, Y. Hamamoto, Y. Katsushima, T.

Kimura, and K. Hayasaka. 2010. Supernumerary impacted teeth in a patient

with SOX2 anophthalmia syndrome. Am. J. Med. Genet. 152a: 2355-2359.

Nuutila, A. 1970. Dystrophia retinae pigmentosa-dysacusis syndrome (DRD): a study

of the Usher or Hallgren syndrome. J. Genet. Hum. 18: 57-88.

O'Donnell, F. E., R. A. King, W. R. Green, and C. J. Witkop. 1978. Autosomal

recessively inherited ocular albinism: a new form of ocular albinism affecting

females as severely as males. Arch. Ophthal. 96: 1621-1625.

Oetting, W. S. and R. A. King. 1999. Molecular basis of albinism: mutations and

polymorphisms of pigment genes associated with albinism. Hum Mutat.13: 99–

115.

O'Keefe, M., M .Webb, R. C. Pashby, and R. D. Wagman. 1987. Clinical

anophthalmos. Br. J. Ophthalmol. 71: 635-638

Otterstedde, C. R., U. Spandau, A. Blankenagel, W. J. Kimberling, and C. Reisser.

2001. A new clinical classification for Usher’s syndrome based on a new

subtype of Usher’s syndrome type I. Laryngoscope. 111: 84–86.

References


150

Ouyang, X. M., J. F. Hejtmancik, S. G. Jacobson, X. J. Xia, A. Li, L. L. Du, V.

Newton, M. Kaiser, T. Balkany, W. E. Nance, and X. Z. Liu. 2003. USH1C: a

rare cause of USH1 in a non-Acadian population and a founder effect of the

Acadian allele. Clin. Genet. 63: 150-153.

Ouyang, X. M., X. J. Xia, E. Verpy, L. L. Du, A. Pandya, C. Petit, T. Balkany, W. E.

Nance, and X. Z. Liu. 2002. Mutations in the alternatively spliced exons of

USH1C cause non-syndromic recessive deafness. Hum. Genet. 111: 26-30.

Ouyang, X. M., D. Yan, L. L. Du, J. F. Hejtmancik, S. G. Jacobson, W. E. Nance, A. R.

Li, S. Angeli, M. Kaiser, V. Newton, S. D. Brown, T. Balkany and X. Z. Liu.

2005. Characterization of Usher syndrome type I gene mutations in an Usher

syndrome patient population. Hum. Genet. 116: 292–9.

Palmiter, R. D., R. R. Behringer, C. J. Quaife, F. Maxwell, I. H. Maxwell, and R. L.

Brinster. 1987. Cell lineage ablation in transgenic mice by cell-specific

expression of a toxin gene. Cell 50: 435-443.

Passemard, S., L. Titomanlio, M. Elmaleh, A. Afenjar, J. L. Alessandri, G. Andria, T.

Billette de Villemeur, O. Boespflug-Tanguy, L. Burglen, E. Del-Giudice, F.

Guimiot, C. Hyon, B. Isidor, A. Megarbane, U. Moog, S. Odent, K. Hernandez,

N. Pouvreau, I. Scala, M. Schaer, P. Gressens, B. Gerard, and A.Verloes. 2009.

Expanding the clinical and neuroradiologic phenotype of primary microcephaly

due to ASPM mutations. Neurology 73: 962-969.

Pasternak, J. J., and M. D. Bethesda. 2000. An Introduction to Human Molecular

Genetics: Mechanisms of Inherited Diseases. Heredity 85: 1046-1365.

Pattison, L., Y. J. Crow, V. J. Deeble, A. P. Jackson, H. Jafri, Y. Rashid, E. Roberts,

and C.G. Woods. 2000. A fifth locus for primary autosomal recessive

microcephaly maps to chromosome 1q31. Am. J. Hum. Genet. 67: 1578-1580.

References


151

Pearce, W. G., S. Nigam, and J. Rootman. 1974. Primary anophthalmos. Histological

and genetic features. Canad. J. Ophthalmol. 9: 141-145.

Pedace, L., M. Castori, F. Binni, A. Pingi, B. Grammatico, S. Scommegna, S. Majore,

and P. Grammatico. 2009. A novel heterozygous SOX2 mutation causing

anophthalmia/microphthalmia with genital anomalies. Eur. J. Med. Genet. 52:

273-276.

Peracha, M. O., F. M. Cosgrove, E. Garcia-Valenzuela, and D. Eliott. 2007. Ocular

Manifestations of Albinism. http://emedicine.medscape.com/. Retrieve on 10-

09-2008 at 8:00 am.

Percin, E. F., L. A. Ploder, J. J. Yu, K. Arici, D. J. Horsford, A. Rutherford, B. Bapat,

D. W. Cox, A. M. V. Duncan, V. I. Kalnins, A. Kocak-Altintas, J. C. Sowden,

E. Traboulsi, M. Sarfarazi, and R. R. McInnes. 2000. Human microphthalmia

associated with mutations in the retinal homeobox gene CHX10. Nat. Genet. 25:

397-401.

Petit, C. 2001.Usher syndrome: From genetics to pathogenesis. Annu. Rev. Genomics

Hum. Genet. 2: 271–97.

Petros, T. J., A. Rebsam, and C. A. Mason. 2008. Retinal axon growth at the optic

chiasm: to cross or not to cross. Annu. Rev. Neurosci .31: 295–315.

Prota, G. 1992. Melanins and melanogenesis. Academic Press, New York. Pp. 1–290

Ragge, N. K., I. D. Subak-Sharpe, and J. R. O. Collin. 2007. A practical guide to the

management of anophthalmia and microphthalmia. Eye 21: 1290–1300.

Ragge, N. K., B. Lorenz, A. Schneider, K. Bushby, L. de Sanctis , U. de Sanctis, Salt,

J. R. Collin, A. J. Vivian, S. L. Free, P. Thompson, K. A. Williamson, S. M.

Sisodiya, V. van Heyningen, and D. R. Fitzpatrick. 2005. SOX2 anophthalmia

syndrome. Am. J. Med. Genet. 135 :1-8.

References


152

Raymond, E. B., J. J. Nordlund and J. P. Ortonne. 2005. Dermatologic Manifestations

of Albinism. http://emedicine.medscape.com/. Retrieve on 03-07-2009 at 8:00

am.

Rebibo-Sabbah, A., I. Nudelman, Z. M. Ahmed, T. Baasov, and T. Ben-Yosef. 2007.

In vitro and ex vivo suppression by aminoglycosides of PCDH15 nonsense

mutations underlying type 1 Usher syndrome. Hum. Genet. 122: 373-81.

Reichman, S., R. K. R. Kalathur, S. Lambard, N. Ait-Ali, Y. Yang, A. Lardenois, R.

Ripp, O. Poch, D.J. Zack, J.A. Sahel, and T. Leveillard. 2010. The homeobox

gene CHX10/VSX2 regulates RdCVF promoter activity in the inner retina.

Hum. Mol. Genet. 19: 250-261.

Reiners, J., E. van Wijk, T. Marker, U. Zimmermann, K. Jurgens, H. Brinke, N.

Overlack, R. Roepman, M. Knipper, H. Kremer, and U. Wolfrum. 2005.

Scaffold protein harmonin (USH1C) provides molecular links between Usher

syndrome type 1 and type 2. Hum. Mol. Genet. 14: 3933-3943.

Reis, L. M., R. C. Tyler, A. Schneider, T. Bardakjian and E.V. Semina. 2010.

Examination of SOX2 in variable ocular conditions identifies a recurrent

deletion in microphthalmia and lack of mutations in other phenotypes. Mol. Vis.

16: 768–773.

Riazuddin, S., S. Nazli, Z. M. Ahmed, Y. Yang, F. Zulfiqar, R. S. Shaikh, A. U. Zafar,

S. N. Khan, F. Sabar, F. T. Javid, E. R. Wilcox, E. Tsilou, E. T. Boger, J. R.

Sellers, I. A. Belyantseva, S. Riazuddin and T. B. Friedman. 2008. Mutation

spectrum of MYO7A and evaluation of a novel nonsyndromic deafness DFNB2

allele with residual function. Hum. Mutat. 29: 502–11.

Rimoin, D. L.2002. Emery and Rimoin's Principles and Practice of Medical Genetics.

Churchill Livingstone, New York. Pp. 2337–2354

References


153

Risch, N. J. 2000. Searching for genetic determinants in the new millennium. Nature.

15: 847-56.

Royal National Institute of Blind People. 2010. Nystigmatism.

http://www.rnib.org.uk/eyehealth/eyeconditions/eyeconditionsdn/Pages/nystag

mus.aspx. Retrieve on 13-05-2010 at 8:30 am.

Roberts, E., A. P. Jackson, A. C. Carradice, V. J. Deeble, J. Mannan,Y. Rashid, H.

Jafri, D. P. McHale, A. F. Markham, N. J. Lench, and C. G. Woods. 1999. The

second locus for autosomal recessive primary microcephaly (MCPH2) maps to

chromosome 19q13.1–13.2. Eur. J. Hum. Genet. 7: 815-8201.

Roberts, E., D. J. Hampshire, L. Pattison, K. Springell, H. Jafri, P. Corry, J. Mannon,

Y. Rashid, Y. Crow, J. Bond, and C. G. Woods. 2002. Autosomal recessive

primary microcephaly: An analysis of locus heterogeneity and phenotypic

variation. J. Med. Genet. 39: 718-721.

Rooryck, C., C. Roudaut, E. Robine, J. Müsebeck, and B. Arveiler. 2006.

Oculocutaneous albinism with TYRP1 gene mutations in a Caucasian patient.

Pigment Cell Res. 19: 239-242.

Roux F., V. Fougère, and V. Fougère. 2006. Survey of the frequency of USH1 gene

mutations in a cohort of Usher patients shows the importance of cadherin 23 and

protocadherin 15 genes and establishes a detection rate of above 90%. J. Med.

Genet. 43 : 763–768.

Rundshagen, U., C. Zuhlke, S. Optiz, F. Schwinger, and B. Kasman-Kellnew. 2004.

Mutations in the MATP gene in five German patients affected by

oculocutaneous albinism type 4. Hum. Mutat. 23: 106-110.

Sadarangani, M., C. Seaton, J. A. Scott, B. Ogutu, T. Edwards, A. Prins, H. Gatakaa,

R. Idro, J. A. Berkley, N. Peshu, B. G. Neville, and C. R. Newton. 2008.

References


154

Incidence and outcome of convulsive status epilepticus in Kenyan children: a

cohort study. Lancet Neurol. 7: 145–50.

Sandie, L. G., F. Valerie, M. Sue, C. Mireille, and R. Anne-Francoise. 2007. Large

genomic rearrangements within the PCDH15 gene are a significant cause of

USH1F syndrome. Mol. Vision. 13: 102-7.

Schneider, A., T. M. Bardakjian, J. Zhou, N. Hughes, R. Keep, D. Dorsainville, F.

Kherani, J. Katowitz, L. A. Schimmenti, M. Hummel, D. R. Fitzpatrick and T.

L. Young. 2008. Familial recurrence of SOX2 anophthalmia syndrome:

phenotypically normal mother with two affected daughters. Am. J. Med. Genet.

146 : 2794-8.

Schultz, J. M., Y. Yang, A. J. Caride, A. G. Filoteo, A. R. Penheiter, A. Lagziel, R. J.

Morell, S. A. Mohiddin, L. Fananapazir, A. C. Madeo, J. T. Penniston, and A. J.

Griffith. 2005. Modification of human hearing loss by plasma-membrane

calcium pump PMCA2. N. Engl. J. Med. 352: 1557-1564.

Schwander, M., W. Xiong, J. Tokita, A. Lelli, H. M. Elledge, P. Kazmierczak, A.

Sczaniecka, A. Kolatkar, T. Wiltshire, P. Kuhn, J. R. Holt, B. Kachar, L.

Tarantino, and U. Muller. 2009. A mouse model for nonsyndromic deafness

(DFNB12) links hearing loss to defects in tip links of mechanosensory hair

cells. Proc. Natl. Acad. Sci. 106: 5252-5257.

Shah, S. P., A. Taylor, J. C. Sowden, N. K. Ragge, I. Russell-Eggitt, J. S. Rahi, and C.

Gilbert. 2011. Anophthalmos, microphthalmos and typical coloboma in the UK:

a prospective study of incidence and risk. Invest. Ophthalmol. Vis. Sci. 52: 558-

64.

Shaw, G. M., S. L. Carmichael, W. Yang, J. A. Harris, R. H. Finnell, and E. J. Lammer.

2005. Epidemiologic characteristics of anophthalmia and bilateral

References


155

microphthalmia among 2.5 million births in California, 1989–1997. Am. J.

Med. Genet. 137: 36–40.

Shen, J., W. Eyaid, G. H. Mochida, F. Al-Moayyad, A. Bodell, C. G. Woods, and C.

A. Walsh. 2005. ASPM mutation identified in patients with primary

microcephaly and seizures. J. Med. Genet. 42: 725-729.

Siemens, J., P. Kazmierczak, A. Reynolds, M. Sticker, A. Littlewood-Evans, and U.

Muller. 2002. The Usher syndrome proteins cadherin 23 and harmonin form a

complex by means of PDZ-domain interactions. Proc. Natl. Acad. Sci. 99:

14946-14951.

Silvers, W. K. 1979. The coat colors of mice: a model for mammalian gene action and

interaction. Springer-Verlag, New York. Pp. 379.

Simeone, A., D. Acampora, M. Gulisano, A. Stornaiuolo, and E. Boncinelli. 1992.

Nested expression domains of four homeobox genes in developing rostral brain.

Nature 358: 687-690.

Smith, R. J., E. C. Lee, W. J. Kimberling, S. P. Daiger, M. Z. Pelias, B. J. Keats, M.

Jay, E. Bird, W. Reardon, M. Guest, R. Ayyagari, and J. F. Hejtmancik.1992.

Localization of two genes for Usher syndrome type I to chromosome 11.

Genomics 14: 995–1002.

Smith, R. J., C. I. Berlin, J. F. Hejtmancik, B. J. Keats, W. J. Kimberling, R. A. Lewis,

C. G. Moller, M. Z. Pelias, and L. Tranebjaerg. 1994. Clinical diagnosis of the

Usher syndromes. Usher Syndrome Consortium. Am. J. Med. Genet. 50: 32–38.

Stevanovic, M., O. Zuffardi, J. Collignon, R. Lovell-Badge, and P. Goodfellow. 1994.

The cDNA sequence and chromosomal location of the human SOX2 gene.

Mamm. Genome 5: 640-642.

References


156

Sturm, R. A., R. D. Teasdale, and N. F. Box. 2001. Human pigmentation genes:

identification, structure and consequences of polymorphic variation. Gene. 277:

49–62.

Sueyoshi, S., and R. Ohtsuka. 2003. Effects of polygyny and consanguinity on high

fertility in the rural Arab population in South Jordan. J. Biosoc. Sci. 35: 513–

526.

Sulem, P., D. F. Gudbjartsson, S. N. Stacey, A. Helgason, T. Rafnar, K. P. Magnusson,

A. Manolescu, A. Karason, A. Palsson, G. Thorleifsson, M. Jakobsdottir, and S.

Steinberg. 2007. Genetic determinants of hair, eye and skin pigmentation in

Europeans. Nat. Genet. 39: 1443-1452.

Tajima, T., A. Ohtake, M. Hoshino, S. Amemiya, N. Sasaki, K. Ishizu, and K. Fujieda.

2009. OTX2 loss of function mutation causes anophthalmia and combined

pituitary hormone deficiency with a small anterior and ectopic posterior

pituitary. J. Clin. Endocr. Metab. 94: 314-319.

Tamayo, M. L., J. E. Bernal, G. E. Tamayo, J. L. Frias, G. Alvira, O. Vergara, V.

Rodriguez, J. I. Uribe, and J. C. Silva. 1991. Usher syndrome: results of a

screening program in Colombia. Clin. Genet. 40: 304-311.

Trimborn, M., S. M. Bell, C. Felix, Y. Rashid, H. Jafri, P. D. Griffiths, L. M.

Neumann, A. Krebs, A. Reis, K. Sperling, H. Neitzel, and A. P. Jackson. 2004.

Mutations in microcephalin cause aberrant regulation of chromosome

condensation. Am. J. Hum. Genet. 75: 261-266.

Tsuji, S. 2010. Genetics of neurodegenerative diseases: insights from high-throughput

resequencing. Hum. Mol. Genet. 19: R65–R70.

Usher, C. H. 1914. On the inheritance of retinitis pigmentosa, with notes of cases. Roy.

Lond. Ophthal. Hosp. Rep. 19: 130-236.

References


157

Valente, E. M., S. Salvi, T. Ialongo, R. Marongiu, A. E. Elia, V. Caputo, L. Romito,

Albanese, B. Dallapiccola, and A. R. Bentivoglio. 2004. PINK1 mutations are

associated with sporadic early-onset Parkinsonism. Ann. Neurol. 56:336–341.

van der Velden, P. A., L. A. Sandkuijl, W. Bergman, S. Pavel, L. van Mourik, R. R.

Frants, and N. A. Gruis. 2001. Melanocortin-1 receptor variant R151C modifies

melanoma risk in Dutch families with melanoma. Am. J. Hum. Genet. 69: 774-

779.

Verma, A. S., and D. R. FitzPatrick. 2007. Anophthalmia and microphthalmia.

Orphanet J. Rare Dis. 2:47.

Vernon, M. 1969. Usher’s syndrome-deafness and progressive blindness. Clinical

cases, prevention, theory and literature survey. J. Chronic Dis. 22: 133-151.

Verpy, E., M. Leibovici, I. Zwaenepoel, X. Z. Liu, A. Gal, N. Salem and A. Mansour.S.

Blanchard, I. Kobayashi, B. J. B. Keats, R. Slim, and C. Petit. 2000. A defect in

harmonin, a PDZ domain-containing protein expressed in the inner ear sensory

hair cells, underlies Usher syndrome type 1C. Nat. Genet. 26: 51-55.

Vestergaard, M., M. G. Pedersen, J. R. Ostergaard, C. B. Pedersen, J. Olsen, and J.

Christensen. 2008. Death in children with febrile seizures: a population- based

cohort study. Lancet. 372:457–63.

von Brederlow, B., H. Bolz, A. Janecke, A. La O Cabrera, G. Rudolph, B. Lorenz, E.

Schwinger, and A. Gal. 2002. Identification and in vitro expression of novel

CDH23 mutations of patients with Usher syndrome type 1D. Hum. Mutat. 19:

268-273.

Von Graefe, A. 1858. Exceptionelles Verhalten des Gesichtsfeldes bei

Pigmententartung der Netzhaut. Graefes Arch. Ophthal. 4: 250-253.

References


158

Voronina, V. A., E. A. Kozhemyakina, C. M. O'Kernick, N. D. Kahn, S. L. Wenger, J.

V. Linberg, A. S. Schneider, and P. H. Mathers. 2004. Mutations in the human

RAX homeobox gene in a patient with anophthalmia and sclerocornea. Hum.

Mol. Genet. 13: 315-322.

Wada, A. T. Kuneida, M. Nishimura, Y. Kakizoe-Ishida, N. Watanabe, K. Ohkawa,

and M. Tsudzuki. 2005. Nucleotide substitution responsible for the tawny coat

color mutation carried by the MSKR inbred strain of mice. J. Hered. 96: 145-

149.

Wagatsuma, M., R. Kitoh, H. Suzuki, H. Fukuoka, Y. Takumi, and S. Usami. 2007.

Distribution and frequencies of CDH23 mutations in Japanese patients with

non-syndromic hearing loss. Clin. Genet. 72: 339-344.

Wang, W., S. G. Sullivan, S. Ahmed, D. Chandler, L. A. Zhivotovsky, and A. H.

Bittles. 2000. A genome-based study of consanguinity in three coresident

endogamous Pakistan communities. Ann. Hum. Genet. 64:41–49.

Wasay, M. 2003. Neurological care in Pakistan: actions are needed. J. Pak. Med. Assoc.

53: 576.

Wayne, S., R. B. Lowry, D. R. McLeod, R. Knaus, C. Farr, and R. J. H. Smith. 1997.

Localization of the Usher syndrome type IF (Ush1F) to chromosome 10. Am. J.

Hum. Genet. 61: 1752.

Wayne, S., V. M. Der-Kaloustian, M. Schloss, R. Polomeno, D. A. Scott, J. F.

Hejtmancik, V. C. Sheffield, and R. J. Smith. 1996. Localization of the Usher

syndrome type ID gene (Ush1D) to chromosome 10. Hum. Mol. Genet. 5:1689–

1692.

Weil, D., A. El-Amraoui, S. Masmoudi, M. Mustapha, Y. Kikkawa, S. Laine, S.

Delmaghani, A. Adato, S. Nadifi, Z. B. Zina, C. Hamel, A. Gal, H. Ayadi, H.

References


159

Yonekawa, and C. Petit. 2003. Usher syndrome type I G (USH1G) is caused by

mutations in the gene encoding SANS, a protein that associates with the USH1C

protein, harmonin. Hum. Mol. Genet. 12: 463–71.

Weil, D., S. Blanchard, J. Kaplan, P. Guilford, F. Gibson, J. Walsh, P. Mburu, A.

Varela, J. Levilliers, M. D. Weston, P. M. Kelley, W. J. Kimberling, M.

Wagenaar, F. Levi-Acobas, D. Larget-Piet, A. Munnich, K. P. Steel, S. D. M.

Brown, and C. Petit.1995. Defective myosin VIIA gene responsible for Usher

syndrome type 1B. Nature 374: 60-61.

White, T., T. Lu, R. Metlapally, J. Katowitz, F. Kherani, T. Wang, K. Tran-Viet, and T.

L. Young. 2008. Identification of STRA6 and SKI sequence variants in patients

with anophthalmia/microphthalmia. Mol. Vis.14: 2458-2465.

Witkop, C. J. 1979. Albinism: hematologic-storage disease, susceptibility to skin

cancer, and optic neuronal defects shared in all types of oculocutaneous and

ocular albinism. Ala. J. Med. Sci. 16:327-330.

Woods, C. G., J. Bond, and W. Enard. 2005. Autosomal recessive primary

microcephaly (MCPH): A review of clinical, molecular and evolutionary

findings. Am. J. Hum. Genet. 76: 717-728.

World Health Organization. 2006. Neurological disorders; public health challenges,

Geneva, Switzerland. Pp 27-35.

Wyatt, A., P. Bakrania, D. J. Bunyan, R. J. Osborne, J. A. Crolla, A. Salt, C. Ayuso, R.

Newbury-Ecob, Y. Abou-Rayyah, J. R. O. Collin, D. Robinson, and N. Ragge.

2008. Novel heterozygous OTX2 mutations and whole gene deletions in

anophthalmia, microphthalmia and coloboma. Hum. Mutat. 29: 278-283.

Xu, X., J. Lee, and D. F. Stern. 2004. Microcephalin is a DNA damage response protein

involved in regulation of CHK1 and BRCA1. J. Biol. Chem. 279: 34091-34094.

References


160

Yan, D., and X. Y. Liu. 2010. Genetics and pathological mechanisms of Usher

syndrome. J. Hum. Genet. 55:327-35.

Yu, T. W., G. H. Mochida, D. J. Tischfield, S. K. Sgaier, L. Flores-Sarnat, C. M. Sergi,

M. Topcu, M. T. McDonald, B. J. Barry, J. M. Felie, C. Sunu, W. B. Dobyns,

R. D. Folkerth, A. J. Barkovich, and C. A. Walsh. 2010. Mutations in WDR62,

encoding a centrosome-associated protein, cause microcephaly with simplified

gyri and abnormal cortical architecture. Nat. Genet. 42: 1015-1020.

Yuasa, I., K. Umetsu, S. Harihara, A. Kido, A. Miyoshi, N. Saitou, B. Dashnyam, F.

Jin, G. Lucotte, P. K. Chattopadhyay, and L. Henke. 2006. Distribution of the

F374 allele of the SCL45A2 (MATP) gene and founder-haplotype analysis.

Ann. Hum. Genet. 70:802–811.

Zaghloul, N. A., and N. Katsanis. 2010. Functional modules, mutational load and

human genetic disease. Trends Genet. 26:168–176.

Zahed, L., H. Zahreddine, B. Noureddine, N. Rebeiz, N. Shakar, P. Zalloua, and F.

Haddad. 2005. Molecular basis of oculocutaneous albinism type 1 in Lebanese

patients. J. Hum. Genet. 50: 317-9.

Zaman, M. 2010. Marriage of cousins: Congenital diseases and people's perceptions in

Pakistan, a public health challenge. J. Public Health Policy. 31: 381- 383.

Zenteno, J. C., G. Gascon-Guzman, and J. L. Tovilla-Canales. 2005. Bilateral

anophthalmia and brain malformations caused by a 20-bp deletion in the SOX2

gene. Clin. Genet. 68:564–566.

Zenteno, J. C., H. J. Perez-Cano, and M. Aguinaga, 2006. Anophthalmia-esophageal

atresia syndrome caused by an SOX2 gene deletion in monozygotic twin

brothers with markedly discordant phenotypes. Am. J. Med. Genet. 140a: 1899-

1903.

References


161

Zheng, Q. Y., D. Yan, X. M. Ouyang, L. L. Du, H. Yu, B. Chang, K. R. Johnson, and

X. Z. Liu. 2005. Digenic inheritance of deafness caused by mutations in genes

encoding cadherin 23 and protocadherin 15 in mice and humans. Hum. Mol.

Genet. 14: 103-111.

Zhou, J., F. Kherani, T. M. Bardakjian, J. Katowitz, N. Hughes, L. A. Schimmenti,

Schneider, and T. L. Young. 2008. Identification of novel mutations and

sequence variants in the SOX2 and CHX10 genes in patients with

anophthalmia/microphthalmia. Mol. Vis.14:583–592.

Zlotogora, J. 2002. What is the birth defect risk associated with consanguineous

marriage? Am. J. Med. Genet. 109: 70–1.

Zlotogora, J. 2007. Multiple mutations responsible for frequent genetic diseases in

isolated populations. Eur. J. Hum. Genet. 15:272–278.

Zlotogora, J., Y. Hujerat, S. Barges, S.A. Shalev, and A. Chakravarti. 2006. The fate of

12 recessive mutations in a single village. Ann. Hum. Genet. 71:202–208.

Zuhlke, C., A. Stell, and B. Käsmann-Kellner. 2007. Genetics of oculocutaneous

albinism. Ophthalmologe. 104: 674-80.

References


162

ELECTRONIC REFERENCES:

BioMed Central, http://www.biomedcentral.com/browse/journals/

Ensembl Genome Browser, http://www.ensembl.org/index.html

GeneCards, http://www.genecards.org/

Genetic Disease Information,

http://www.ornl.gov/sci/techresources/Human_Genome/medicine/assist.shtml

Genetics Forum, http://www.topix.com/forum/science/genetics

Genetics Home Reference, http://ghr.nlm.nih.gov/

National Center for Biotechnology Information, www.ncbi.nlm.nih.gov

National Institute of Health, http://health.nih.gov/

Online Mandelian Inheritance of Man, http://www.ncbi.nlm.nih.gov/omim

molecular genetic analysis of selected neurological

Documents