Molecular di¡erentiation of Bi¢dobacterium species with ampli¢edribosomal DNA restriction analysis and alignment of short regions

of the ldh gene

Denis Roy *, Stephane SiroisFood Research and Development Centre, Agriculture and Agri-Food Canada, 3600 Casavant Boulevard West, St. Hyacinthe, Que., Canada J2S 8E3

Received 23 May 2000; received in revised form 27 July 2000; accepted 28 July 2000

Abstract

The differentiation of Bifidobacterium species was performed with specific primers using the PCR technique, the amplified ribosomalDNA restriction analysis (ARDRA) technique based on reports on the sequence of the 16S rRNA gene and speciation based on a shortregion of the ldh gene. Four specific primer sets were developed for each of the Bifidobacterium species, B. animalis, B. infantis andB. longum. The use of the ARDRA method made it possible to discriminate between B. infantis, B. longum and B. animalis with thecombination of BamHI, TaqI and Sau3AI restriction enzymes. The ldh gene sequences of 309^312 bp were determined for 19Bifidobacterium strains. Alignment of these short regions of the ldh gene confirmed that it is possible to distinguish between B. longum andB. infantis but not between B. lactis and B. animalis. ß 2000 Published by Elsevier Science B.V. on behalf of the Federation of EuropeanMicrobiological Societies.

Keywords: Bi¢dobacterium species ; ldh ; Speci¢c 16S rDNA primer; Ampli¢ed ribosomal DNA restriction analysis

1. Introduction

The characterization of bi¢dobacteria is important inthe food industry as manufacturing of some products re-quires a particular species. Accurate taxonomic identi¢ca-tion of bi¢dobacteria can be di¤cult when conventionalmethods are used. Some information exists on the DNAanalysis of bi¢dobacteria such as DNA^DNA hybridiza-tion, pulsed ¢eld gel electrophoresis (PFGE) and the ran-domly ampli¢ed polymorphic DNA pro¢les (RAPD) [1^4]. The 16S rRNA gene was also used for the systematicidenti¢cation of bi¢dobacteria [5]. Some papers demon-strated that distinguishing between Bi¢dobacterium longumand Bi¢dobacterium infantis and also between Bi¢dobacte-rium animalis and Bi¢dobacterium lactis is still confusedusing phenotypic characterization [1,2]. This di¡erentia-tion is more di¤cult because the DNA encoding the 16Sof the former human bi¢dobacteria strains is similar at90^98% [4] to B. animalis according to the 16S rRNAgene sequence data. In addition, DNA^DNA hybridiza-

tion showed low similarity between B. lactis and the typestrain of B. animalis [2]. These results suggest that thetaxonomic status of some species of bi¢dobacteria (B. lon-gum/B. infantis and B. animalis/B. lactis) should be clari-¢ed.

The development of new approaches and techniques ofmolecular biology would make it possible to clarify inwhich species strains of bi¢dobacteria belong. Ampli¢edribosomal DNA restriction analysis (ARDRA) has an ex-cellent potential for discrimination of organisms at thespecies level [6,7]. This technique is based on the ampli¢-cation of the DNA sequence of a 16S rDNA region, fol-lowed by the digestion of PCR products with restrictionenzymes [6,7]. A few authors used conserved sequencesother than the 16S rRNA gene for the characterizationof species such as the conserved gene encoding for theL-lactate dehydrogenase (ldh) studied in B. longum or therecA gene in human bi¢dobacteria [8^10]. Like the 16SrRNA, the recA gene is considered to be universallypresent in bacteria. A phylogenetic analysis of the shortsequence recA products was used to accurately classifystrains of bi¢dobacteria [9]. Fructose-1,6-bisphosphate-de-pendent L-lactate dehydrogenase (LDH) is a key enzymein lactic acid fermentation by most lactic acid bacteria. An

0378-1097 / 00 / $20.00 ß 2000 Published by Elsevier Science B.V. on behalf of the Federation of European Microbiological Societies.PII: S 0 3 7 8 - 1 0 9 7 ( 0 0 ) 0 0 3 6 4 - 5

* Corresponding author. Tel. : +1 (450) 773-1105;Fax: +1 (450) 773-8461; E-mail : royd@em.agr.ca

FEMSLE 9586 15-9-00

FEMS Microbiology Letters 191 (2000) 17^24

www.fems-microbiology.org

evolutionary study based on LDH sequences separates theprokaryotic from eukaryotic enzymes except for the B.longum LDH which falls in a group with the eukaryoticenzymes and the conserved ldh gene, suggesting a commonancestor for bacterial and vertebrate genes [8].

The objective of this study was to distinguish betweenB. infantis and B. longum as well as B. animalis andB. lactis using a combination of molecular biological tech-niques based on reports of the sequence of the 16S rRNAand the ldh genes. Speci¢c primers for identi¢cation ofbi¢dobacteria by PCR and the ARDRA technique basedon the 16S rRNA gene followed by the analysis of a shortsequence region of the ldh gene were used for the specia-tion of bi¢dobacteria.

2. Materials and methods

2.1. Bacterial strains and cultivation

Strains of bi¢dobacteria were isolated from commercialpreparations (dairy products and freeze-dried cultures) bythe Food Research and Development Centre, Agricultureand Agri-Food Canada (FRDC, Table 1). Other bi¢do-

bacteria were obtained from the American Type CultureCollection (ATCC, Manassas, VA, USA) and the Deut-sche Sammlung von Mikroorganismen (DSM, Germany).Strains (SRW-001, SRW-002, SRW-003, SRW-004) wereisolated from commercial preparations by FRDC andused as unknown strains to control the alignment of shortregions of the ldh gene as a method for di¡erentiation andidenti¢cation of bi¢dobacteria. Stock cultures were pre-pared in brain heart infusion supplemented with 10% glyc-erol and frozen at 340³C. Lactobacillus MRS broth (Dif-co Laboratories) supplemented with 0.05% L-cysteine^HClwas used to cultivate the frozen microorganisms and re-covered strains were subcultured once. Active cultureswere incubated for 18^24 h at 37³C in an anaerobic cham-ber (Anaerobic system, Forma Scienti¢c) with a gas at-mosphere of 5% CO2, 10% H2 and 85% N2.

2.2. DNA extraction

Genomic DNA was prepared according to Vincent et al.[11] from stationary-phase cultures in MRS broth contain-ing L-cysteine^HCl (0.05%). The concentration of puri¢edDNA was determined using mini-£uorometer TKO 100(Hoefer Scienti¢c) and capillary tubes.

Table 1List of bi¢dobacteria and non-bi¢dobacterium strains and the results of PCR tests using speci¢c primer sets

Species Strain Speci¢c primer set

Pbi F1/PbiR2

Bil F3/InfR5

Pbi F1/LonR4

Ban F2/PbiR1

B. adolescentis ATCC 15703T, ATCC, 15704, ATCC 15705, ATCC 15706,DSM 20087

+ 3 3 3

B. animalis ATCC 25527T, ATCC 27536, ATCC 27672, ATCC 27673,ATCC 27674, DSM 20104

+ 3 3 +

B. animalis RW-003, RW-004, RW-005, RW-006, RW-011, RW-013,RW-014, RW-015, RW-016, RW-017, RW-018, RW-029,RW-053, RW-054, RW-055, RW-058

+ 3 3 +

B. bi¢dum ATCC 11863, ATCC 15696, ATCC 29521T, DSM 20082,DSM 20215, DSM 20456

+ 3 3 3

B. bi¢dum RW-012, S28a + 3 3 3B. breve ATCC 15698, ATCC 15700T, ATCC 15701, DSM 20091 + 3 3 3B. breve RW-010, S17c, S46 + 3 3 3B. infantis ATCC 15697T, ATCC 15702, ATCC 17930, ATCC 25962,

RW- 27920+ + 3 3

B. lactis DSM 10140 + 3 3 +B. longum ATCC 15707T, ATCC 15708, DSM 20219, DSM 20097 + 3 + 3B. longum RW-001, RW-002, RW-008, RW-009, RW-019, RW-020,

RW-021, RW-022, RW-023, RW-024, RW-025, RW-026,RW-027, RW-028, RW-031, RW-033, RW-034, RW-035,RW-036, RW-037, RW-038, RW-039, RW-040, RW-041,RW-042, RW-043, RW-044, RW-045, RW-046, RW-047,RW-048, RW-050, RW-051, RW-057

+ 3 + 3

Lactobacillushelveticus

ATCC 15009T 3 3 3 3

Lactobacillusparacasei

ATCC 29599T 3 3 3 3

Lactobacillusacidophilus

ATCC 4356T 3 3 3 3

Escherichia coli ATCC 25922 3 3 3 3

TType strain.

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^2418

2.3. Identi¢cation by PCR with speci¢c primers

The speci¢c primers were chosen from highly conservednucleotide sequences in the 16S rDNA region (Table 2)and reaction conditions varied for the di¡erent primers.The reaction volume used was 50 Wl which contained10 mM dNTP, 1.5 mM MgCl2 (Pharmacia LKB Biotech-nology bu¡er), 5 U Taq DNA polymerase (PharmaciaLKB Biotechnology), 20 pmol Wl31 of each primer and25 ng of DNA. PCR ampli¢cations were performed witha Peltier Thermal Cycle (PTC-200, MJ Research) using thefollowing cycle parameters: denaturation at 92³C for 30 s,primer annealing for 30 s and primer extension at 72³C for1 min followed by a ¢nal extension at 72³C for 10 min.The program included a preincubation at 92³C for 5 minprior to the ¢rst cycle and the ¢nal extension step wasfollowed by cooling at 4³C. The temperature of annealingwas 50³C and the number of cycles was 35 for the primerset Pbi F1/Pbi R2. The temperatures of annealing for theprimer sets Ban F2/Pbi R1, Bil F3/Inf R5 and Pbi F1/LonR4 were 58, 55 and 56³C and the number of cycles was 30.The PCR products were run on 1% agarose gel (w/v)(Boehringer Mannheim Canada) in 1UTAE for 1 h at250 V and made visible by ethidium bromide stainingand UV transillumination.

2.4. Ampli¢cation and ARDRA

The optimization of each combination of primers wasdetermined by PCR with a 50 Wl total volume. Primerswere Pbi F1 and Pbi R2 (Table 2). After cycling, bi¢do-bacteria were di¡erentiated by a restriction fragmentlength polymorphism analysis using the enzymes BamHI,Sau3AI and TaqI (Boehringer Mannheim Canada). Re-striction digestion was carried out for 2 h at 37³C forBamHI and Sau3AI, and at 65³C for TaqI in 20 Wl ofincubation bu¡er (Boehringer Mannheim Canada) con-taining 5 U of restriction enzyme and 10 Wl of PCR prod-uct. Reaction products (10 Wl) were fractionated on 2.5%agarose gel in 0.5UTBE bu¡er for 1.5 h at 200 V. Gelswere stained with ethidium bromide, made visible by UVtransillumination and digitalized with the gel print 2000isystem (Bio/Can Scienti¢c Inc.). The images were analyzed

with the software GelCompar (Molecular Analyst Soft-ware Fingerprinting Plus, Bio-Rad Laboratories). Thebackground was subtracted by the rolling disk methodand the normalized patterns as obtained with the respec-tive enzyme were combined to generate a single patternfor each strain. The patterns were used to construct adendrogram using the UPGMA (unweighted pair groupmethod using arithmetic averages) clustering algorithm[12].

2.5. Sequence analysis of the ldh gene from bi¢dobacteria

Primers used for the detection of ldh gene were based onthe regions of the gene encoding LDH (EC 1.1.1.27) ofB. longum which was cloned in Escherichia coli and se-quenced by Minowa et al. [10] (between positions 914and 1283; GenBank accession number M33585). Theprimers were synthesized by General Synthesis and Diag-nostics (Canada). The optimization of the combination ofprimers was determined by PCR with a 50 Wl total volume.The PCR reactions contained 10 mM dNTP, 1.5 mMMgCl2, 50 mM KCl, 10 mM Tris^HCl pH 8.3, 5 U TaqDNA polymerase (Pharmacia LKB Biotechnology),20 pmol Wl31 of each primer and 25 ng of DNA. Primersequences were as follows: forward primers (LDH F1 5P-TACATGCTCATCACCAACCCGGTCGAC-3P) and thereverse primer (LDH R1 5P-CATGCCGATGGCGTAG-TTGGTGGCACCCTT-3P). Ampli¢cation of DNA wasperformed in a GeneAmp PCR system 2400 (Perkin El-mer) programmed for 9 min at 94³C for initial denatura-tion and 35 cycles of 30 s at 94³C for denaturation, 30 s at62³C for annealing, 30 s at 72³C for extension, followed by10 min at 72³C for a ¢nal extension. 10 Wl of each PCRreaction mixture was run on 2% agarose gel (w/v) in1UTAE for 1 h at 250 V and made visible by ethidiumbromide staining and UV transillumination. The length ofthe PCR product was 370 bp, puri¢ed by QIAquick GelExtraction Kit (Qiagen Inc.) and sequenced by AutomaticDNA sequencer 373 XL Stretch option XL (Applied Bio-systems, Perkin-Elmer). Multiple sequences were alignedusing the CLUSTAL W program [13].

The GenBank accession numbers for Bi¢dobacteriumnucleotide sequences reported in this paper are as follows:

Table 2Bi¢dobacterium species and speci¢c primer sets based on 16S rDNA sequences

Target group Primer Sequence (5P to 3P) Length (bp) Target sitea Product size (bp)

Bi¢dobacterium spp. Pbi F1 CCGGAATAGCTCC 13 144^156 914Pbi R2 GACCATGCACCACCTGTGAA 20 1058^1040

B. animalis Ban F2 AACCTGCCCTGTG 13 128^141 925Pbi R1 GCACCACCTGTGAACCG 17 1053^1037

B. infantis Bil F3 AGTTGATCGCATGGTCTTCT 20 182^209 837Inf R5 CCATCTCTGGGATC 14 1019^1004

B. longum Pbi F1 CCGGAATAGCTCC 13 144^156 875Lon R4 CGTATCTCTACGACC 15 1019^1004

aThe numbers correspond to numbers in the structure model of E. coli 16S rRNA (GenBank accession number J01859).

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^24 19

AF261669 (B. longum ATCC 15707T); AF261670 (B. lon-gum ATCC 15708); AF261671 (B. bi¢dum ATCC29521T); AF261672 (B. bi¢dum ATCC 11863);AF261673 (B. animalis ATCC 25527T); AF261674 (B. an-imalis ATCC 27536); AF261675 (B. lactis DSM 10140);AF261676 (B. adolescentis ATCC 15703T); AF261677 (B.adolescentis ATCC 15705); AF261678 (B. breve ATCC

15700T); AF261679 (B. infantis ATCC 15697T);AF261680 (B. infantis ATCC 15702); AF261681 (B. infan-tis ATCC 25962); AF261682 (B. infantis RW-27920);AF261683 (B. breve ATCC 15698); AF261684 (Bi¢dobac-terium spp. SRW001); AF261685 (Bi¢dobacterium spp.SRW002); AF261686 (Bi¢dobacterium spp. SRW003);AF261687 (Bi¢dobacterium spp. SRW004).

Fig. 1. Dendrogram obtained by ARDRA pro¢les for 69 Bi¢dobacterium strains generated from three di¡erent restriction enzymes. Patterns were com-bined using the Molecular Analysis Software Fingerprinting Plus and grouped with UPGMA.

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^2420

3. Results

3.1. Identi¢cation of Bi¢dobacterium spp. usinggenus-speci¢c and species-speci¢c primers

The four primer sets selected within the 16S rRNA gene(Table 2) were tested with genomic DNA of the pure cul-tures of 86 strains of bi¢dobacteria belonging to B. ado-lescentis, B. animalis, B. bi¢dum, B. breve, B. infantis, B.lactis and B. longum and four non-bi¢dobacterium species(Table 1). Speci¢c ampli¢cation of Bi¢dobacterium DNAwas achieved with primer Pbi F1 combined with primerPbi R2 for all of the strains tested. The primer sets Bil F3/Inf R5, Pbi F1/Lon R4 and Ban F2/Pbi R1 were able toidentify strains of B. infantis, B. longum and B. animalis,respectively. However, the species-speci¢c primer set forB. animalis showed a positive PCR result for DNA ofB. lactis. Finally, 50 commercial strains were identi¢edas B. animalis (16) and B. longum (34) using the Ban F2/Pbi R1 and Pbi F1/Lon R4 primer sets, respectively.

3.2. Identi¢cation by ARDRA

For 69 strains of bi¢dobacteria belonging to B. adoles-centis, B. animalis, B. bi¢dum, B. breve, B. infantis, B. lactisand B. longum, the 16S rDNA was ampli¢ed using thegenus-speci¢c primer set (Pbi F1/Pbi R2) and restrictedwith the enzymes BamHI, TaqI and Sau3AI (Fig. 1).Cleavage by the restriction endonucleases revealed a vari-ety of di¡erent DNA fragment patterns for six species ofbi¢dobacteria. The clustering from these patterns consis-tently grouped restriction fragment patterns into two dis-tinct subsets. The ARDRA patterns of known members ofB. animalis/B. lactis, B. longum and B. infantis were typicalfor each group and distinct from those of B. breve,B. adolescentis and B. bi¢dum. The restriction patternfrom the B. lactis strains was identical to that of the B.animalis strains. The ARDRA method con¢rmed the factthat B. longum was closely related to B. infantis but di¡er-entiation between these two species was obtained with theSau3AI restriction enzyme. The B. infantis strains exhib-ited a lower band than the B. longum strains. The BamHIand Sau3AI restriction enzymes showed that B. longumRW-009, RW-019, RW-023, RW-024, RW-025 and RW-045 were very di¡erent from the other B. longum strains.This result is in agreement with the PFGE results pub-lished by Roy et al. [3]. These six strains have the samebands as the B. animalis when we used the BamHI enzymebut they have a longer band than the other B. longumstrains when analyzed with the Sau3AI enzyme. Hence,the correlation between ARDRA and the species-speci¢cprimer sets was very good.

3.3. Speciation based on the ldh gene sequence

The ldh gene sequences of 370 bp were determined for

19 Bi¢dobacterium strains including four isolates of com-mercial origin. Comparison of the short region of the ldhgene was based on the sequences comprised between thetwo primers LDH F1 and LDH R1 which gave a sequenceof 309^312 bp (Fig. 2). A sequence identity of 100% wasfound between the short region of the ldh gene of B. lon-gum sequenced by Minowa et al. [9] and B. longum ATCC15707T determined in the present study. Only one nucleo-tide was di¡erent for the ldh sequence of B. longum ATCC15708 as compared with the other strains of B. longum.One isolate of commercial origin (SRW-003) exhibited anidentical nucleotide sequence to B. longum ATCC 15707T,indicating that this strain belonged to B. longum.

Bi¢dobacterial strains of B. animalis, B. bi¢dum,B. breve, B. adolescentis and B. infantis possessed speci¢csequences of the ldh gene as compared to B. longum. In acomparison of the sequences of all of the strains tested, wefound that B. lactis DSM 10140 (GenBank accession num-ber AF261675) and the sequence of B. animalis ATCC27536 (AF261674) were the same. The number of basedi¡erences between B. lactis and B. animalis ATCC25527T (AF261673) was six and the number of base di¡er-ences between B. lactis and B. longum was 55. The com-mercial isolate SRW-004 (AF261687) of B. animalis hadan identical nucleotide sequence to B. lactis DSM 10140and B. animalis ATCC 27536. Alignment of the ldh se-quence of SRW-001 (AF261684) and SRW-002(AF261685) showed very high identity with the referencestrains of B. breve and B. bi¢dum, respectively.

The ldh sequences of strains of B. infantis were divergentfrom those of B. longum. In addition, strains of B. infantisfell into two groups. B. infantis ATCC 15702 (AF261680)and RW-27920 (AF261682) exhibited small di¡erenceswith B. longum because the number of base di¡erenceswas 15^18 whereas B. infantis ATCC 15697T (AF261679)and ATCC 25962 (AF261681) were very di¡erent. ThePCR products of these two strains possessed speci¢c se-quences of the ldh gene highly divergent from those ofB. longum and all of the other strains tested.

Fig. 2 shows that the proportion of the nucleotide var-iation in the third position for B. animalis ATCC 25527T

as compared to that of B. longum ATCC 15707T was 42versus seven and nine for positions 1 and 2, respectively.In comparison, the proportion of nucleotide variation inthe third position for B. bi¢dum ATCC 29521T was 17whereas it was four and six in positions 1 and 2, respec-tively. However, B. animalis ATCC 25527T and B. bi¢dumATCC 29521T exhibited 34 and 14 silent mutations, re-spectively. The di¡erences in the number of amino acidsbetween B. longum ATCC 15707T and B. breve ATCC15700T, B. adolescentis ATCC 15703T, B. animalisATCC 25527T and B. bi¢dum ATCC 29521T were ¢ve,eight, 14 and nine, respectively. B. infantis ATCC 15702and RW-27920 exhibited a low number of mutations inthe ldh sequence whereas B. infantis ATCC 15697T andATCC 25962 possessed 151 nucleotides that were di¡erent

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^24 21

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^2422

from those of B. longum ATCC 15707T. These di¡erencesresulted in 71 amino acids which were di¡erent from thoseof B. longum ATCC 15707T.

4. Discussion

In the present study, we demonstrated that species-spe-ci¢c primers are useful for the di¡erentiation of strainsbelonging to B. infantis, B. longum and B. animalis. It iswell-known that B. infantis and B. longum are di¤cult todistinguish using phenotypic characterization and DNA^DNA hybridization [1] although their L-galactosidase elec-trophoretic patterns and genomic ¢ngerprints are di¡erent[3,14]. Phylogenetic data obtained from both 16S rRNAsequence analysis and 16S^23S internal transcribed spacersequence analysis demonstrated that B. longum ATCC15707T and B. infantis ATCC 15697T are closely related[5].

Vincent et al. [11] reported that the RAPD pro¢les in-dicate that the 20 human strains isolated by Bahaka et al.[1] fell into the B. longum cluster which also included thereference strains of B. infantis. On the other hand, se-quence information from a short fragment of the recAgene provided greater sensitivity than sequence informa-tion from the 16S rRNA gene for the di¡erentiation ofB. infantis [9]. In addition, Matsuki et al. [15] noted thattheir newly developed primers based on the 16S rRNAgene distinguished B. longum and B. infantis, even thoughthese taxa are closely related species. In the present study,the ARDRA method based on the 16S rRNA gene con-¢rmed the fact that B. longum was closely related to B.infantis but di¡erentiation between these two species wasobtained with the Sau3AI restriction enzyme. In addition,the analysis of a short region of the ldh gene showed thatit was possible to easily distinguish between B. infantis andB. longum.

The results of the ARDRA method indicate that thesubcluster containing reference and commercial strains ofB. animalis also included the new species B. lactis. It wasfound that commercially available industrial strains ofB. animalis isolated from fermented milks were identicalto the reference strain ATCC 27536 based on their ge-nomic ¢ngerprints using PFGE [3]. Vincent et al. [11]also noted that isolates from commercial products wereclassi¢ed as belonging to the B. animalis group. However,

according to their RAPD pro¢les, these isolates were moresimilar to the reference strains ATCC 27536, 27674 and27673 than the ATCC type strain 25527. Recently, Meileet al. [2] described an isolate of Bi¢dobacterium sp. as anew species which was named B. lactis. These authorsnoted that B. animalis is closely related (98.6% similarity)to B. lactis according to the 16S rRNA sequence data.However, DNA^DNA hybridization showed only weakhomology between B. lactis and the type strain of B. ani-malis (DSM 20104 = ATCC 25527T). In the present study,the analysis of a short region of the ldh gene showed thatstrains of B. lactis and B. animalis ATCC 27536 wereidentical although it was possible to distinguish betweenB. lactis and B. animalis ATCC 25527T.

The combination of speci¢c primers (PCR), ARDRAand analysis based on conserved genes such as ldh pro-vided a distinction between bi¢dobacterial species. Indeed,the ARDRA method made it possible to characterizeB. infantis, B. longum and B. animalis with the combina-tion of BamHI, TaqI and Sau3AI restriction enzymes.Alignment of short regions of the ldh gene also con¢rmedthat it is possible to distinguish between B. longum andB. infantis but not between B. lactis and B. animalis. Thisnew approach showed that the ldh gene for the genusBi¢dobacterium is well conserved and it is possible to useit for the identi¢cation and speciation of strains. Furtherwork will be performed on the analysis of PCR-ampli¢edldh gene by denaturing gradient gel electrophoresis toidentify isolates from probiotic products.

Acknowledgements

The authors wish to thank the Natural Sciences andEngineering Research Council of Canada (Ottawa, Ont.,Canada) (Research Partnerships Program ^ Research Net-work on Lactic Acid Bacteria), Agriculture and Agri-FoodCanada (Ottawa, Ont., Canada), Novalait Inc. (Quebec,Que., Canada), Dairy Farmers of Canada (Ottawa, Ont.,Canada), and Institut Rosell Inc. (Montreal, Que., Cana-da) for ¢nancial support.

References

[1] Bahaka, D., Neut, C., Khattabi, A., Monget, D. and Gavini, F.

Fig. 2. Multiple alignment of 20 strains of bi¢dobacteria. The alignment was generated from the ClustalW alignment with the partial protein sequencesof the ldh gene. The sequence was aligned with the corresponding codons. The ¢rst aligned sequence corresponds to the nucleotide numbers 941^1253of the ldh sequence of B. longum (GenBank accession number M33585). The asterisks indicate homology with the nucleotide reference strains. Fourcommercial strains are indicated by Bi¢dobacterium spp., 3 (AF261686), 8 (AF261684), 14 (AF261687) and 16 (AF261685). The other bacteria were ob-tained from ATCC. 1 B. longum ATCC 15707T (AF261669), 2 B. longum ATCC 15708 (AF261670), 4 B. infantis ATCC 15702 (AF261680), 5 B. infan-tis RW-27920 (AF261682), 6 B. breve ATCC 15700T (AF261678), 7 B. breve ATCC 15698 (AF261683), 9 B. adolescentis ATCC 15703T (AF261676), 10B. adolescentis ATCC 15705 (AF261677), 11 B. animalis ATCC 25527T (AF261673), 12 B. animalis ATCC 27536 (AF261674), 13 B. lactis DSM 10140(AF261675), 15 B. bi¢dum ATCC 29521T (AF261671), 17 B. bi¢dum ATCC 11863 (AF261672), 18 B. infantis ATCC 15697T (AF261679), and 19 B. in-fantis ATCC 25962 (AF261681).6

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^24 23

(1993) Phenotypic and genomic analyses of human strains belongingor related to Bi¢dobacterium longum, Bi¢dobacterium infantis, andBi¢dobacterium breve. Int. J. Syst. Bacteriol. 43, 565^573.

[2] Meile, L., Ludwig, W., Rueger, U., Gut, C., Kaufmann, P., Dasen,G., Wenger, S. and Teuber, M. (1997) Bi¢dobacterium lactis sp. nov.,a moderately oxygen tolerant species isolated from fermented milk.Syst. Appl. Microbiol. 20, 57^64.

[3] Roy, D., Ward, P. and Champagne, G. (1996) Di¡erentiation ofbi¢dobacteria by use of pulsed-¢eld gel electrophoresis and polymer-ase chain reaction. Int. J. Food Microbiol. 29, 11^29.

[4] McCartney, A.L., Wenzhi, W. and Tannock, G.W. (1996) Molecularanalysis of the composition of the bi¢dobacterial and Lactobacillusmicro£ora of humans. Appl. Environ. Microbiol. 62, 4608^4613.

[5] Leblond-Bourget, N., Philippe, H., Mangin, I. and Decaris, B. (1996)16S RNA and 16S to 23S internal transcribed spacer sequence anal-yses reveal inter- and intraspeci¢c Bi¢dobacterium phylogeny. Int. J.Syst. Bacteriol. 46, 102^111.

[6] Vaneechoutte, M., Rosseau, R., De Vos, P., Gillis, M., Janssens, D.,Paepe, N., De Rouck, A., Fiers, T., Claeys, G. and Kersters, K.(1992) Rapid identi¢cation of bacteria of the Comamonadaceaewith ampli¢ed ribosomal DNA-restriction analysis (ARDRA).FEMS Microbiol. Lett. 93, 227^234.

[7] Heyndrickx, M., Vauterin, L., Vandamme, P., Kersters, K. and DeVos, P. (1996) Applicability of combined ampli¢ed ribosomal DNArestriction analysis (ARDRA) patterns in bacterial phylogeny andtaxonomy. J. Microbiol. Methods 26, 247^259.

[8] Gri¤n, H.G., Swindell, S.R. and Gasson, M.J. (1992) Cloning and

sequence analysis of the gene encoding L-lactate dehydrogenase fromLactococcus lactis : evolutionary relationships between 21 di¡erentLDH enzymes. Gene 122, 193^197.

[9] Kullen, M.J., Brady, L.J. and O'Sullivan, D.J. (1997) Evaluation ofusing a short region of recA gene for rapid and sensitive speciation ofdominant bi¢dobacteria in the human large intestine. FEMS Micro-biol. Lett. 154, 377^383.

[10] Minowa, T., Iwata, S., Sakai, H., Masaki, H. and Ohta, T. (1989)Sequence and characteristics of the Bi¢dobacterium longum gene en-coding L-lactate dehydrogenase and the primary structure of the en-zyme: a new feature of the allosteric site. Gene 85, 161^168.

[11] Vincent, D., Roy, D., Mondou, F. and Dery, C. (1998) Character-ization of bi¢dobacteria by random DNA ampli¢cation. Int. J. FoodMicrobiol. 43, 185^193.

[12] Sneath, P.H.A. and Sokal, R.R. (1973) Numerical Taxonomy. W.H.Freeman, San Francisco, CA.

[13] Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence align-ment through sequence weighting, positions-speci¢c gap penalties andweight matrix choice. Nucleic Acids Res. 22, 4673^4680.

[14] Roy, D., Berger, J.-L. and Reuter, G. (1994) Characterization ofdairy-related bi¢dobacterial based on their L-galactosidase electro-phoretic patterns. Int. J. Food Microbiol. 23, 55^70.

[15] Matsuki, T., Watanabe, T., Tanaka, R. and Oyaizu, H. (1999) Dis-tribution of bi¢dobacterial species in human intestinal micro£oraexamined with 16S rRNA-gene-targeted species-speci¢c primers.Appl. Environ. Microbiol. 65, 4506^4512.

FEMSLE 9586 15-9-00

D. Roy, S. Sirois / FEMS Microbiology Letters 191 (2000) 17^2424