Invited review

Molecular complexity of sexual development and gene

regulation in Plasmodium falciparum

Nirbhay Kumar*, Gloria Cha, Fernando Pineda, Jorge Maciel,Diana Haddad, Mrinal Bhattacharyya, Eiji Nagayasu

Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins Malaria Research Institute,

Johns Hopkins University, 615 N. Wolfe Street, Baltimore, MD 21205, USA

Received 21 September 2004; received in revised form 19 October 2004; accepted 19 October 2004

Abstract

The malaria parasite, Plasmodium falciparum, has a complex life cycle which alternates between the vertebrate host and the

invertebrate vector. Various morphological changes as well as stage-specific transcripts and gene expression profiles that accompany

parasite’s asexual and sexual life cycle suggest that gene regulation is crucial for the parasite’s continual adaptations to survive the

changing environments as well as for pathogenesis. Development of sexual stages is crucial for malaria transmission and relatively

little is known about the role of specific gene products during asexual to sexual differentiation and further development. Therefore, in

order to have a full understanding of the biology of the malaria parasite, gene regulation on a genome-wide global level must be

understood, an area remaining to be elucidated in P. falciparum. Parasite features, such as A–T bias, difficulties in cloning, labor-

intensive culture and purification of specific stages of the parasite, all contribute to the difficulties to investigate many aspects of

parasite biology. However, despite these challenges, limited studies have revealed a number of parallelisms with eukaryotic

transcription. For example, the parasite’s genes are organised in a similar fashion, contain promoter elements and upstream activation

sequences, as shown by structural searches and functional assays, and some of the basal machinery and general transcription factors

have been found in Plasmodium. The completion of the full genome sequence of P. falciparum and other species of Plasmodium has

resulted in the search for specific transcription factors through genome mining. Although genome mining may identify some of the

factors, search for these factors solely by primary sequence homology would result in a non-comprehensive list for transcription factors

present in the genome. Here, we present further discussion on putative transcription factors like activities detected in the asexual and

sexual stages of P. falciparum.

q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Keywords: Plasmodium; Gametocytes; Transcription factors; Gene expression

1. Introduction

The worldwide incidence of symptomatic malaria cases

each year is 300–500 million and 1.5–2 million, mostly

children, die as a result of infection (Global Health Council,

2003). Infection occurs after the bite of the vector, the

female Anopheles mosquito. During the course of the bite,

the sporozoite form of the parasite is transmitted from the

salivary gland of the mosquito and the parasite then enters

0020-7519/$30.00 q 2004 Australian Society for Parasitology Inc. Published by

doi:10.1016/j.ijpara.2004.10.013

* Corresponding author. Tel.: C1 410 955 7177; fax: C1 410 955 0105.

E-mail address: nkumar@jhsph.edu (N. Kumar).

hepatocytes and multiplies by asexual schizogony.

The resulting merozoites then invade erythroctes and the

parasite goes through a series of morphological changes

either as asexual stages or as sexual forms upon differen-

tiation. The intermittent fevers, characteristic of infection

with malaria, are attributed to release of asexual parasites

from red blood cells. For completion of the host–vector

cycle a final cellular transformation of a subset of these

asexual stages to the sexual gametocyte stage must occur.

It is this form which in ingested by the vector during a blood

meal and sexual differentiation and development thus

represent a crucial link for continued malaria transmission

between the vertebrate host and invertebrate insect vector.

International Journal for Parasitology 34 (2004) 1451–1458

www.parasitology-online.com

Elsevier Ltd. All rights reserved.

Fig. 2. Unique gametocyte proteins using relational databases. Summary of

proteomic data on various stages of P. falciparum published (Florens et al.,

2002; Lasonder et al., 2002). Various stages of the parasite are sporozoite

(S), trophozoite (T), merozoite (M), gamete (G) and gametocytes.

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581452

2. Complexity of sexual development and parasite

gene expression

Mechanisms involved in sexual differentiation and

development largely remain unknown. Previous studies

had suggested that morphologically and biochemically

parasites commit to sexual pathway at the time of invasion

of erythrocyte by the merozoite, thus the progeny of a

developing schizont either continues, life cycle as asexual

parasite or are sexually differentiated into either all male or

all female gametocytes (Fig. 1, see Lobo and Kumar, 1998;

Kongkasuriyachai and Kumar, 2002 for reviews and other

references). What triggers the initial switch to sexual

development is still not known. Previous biochemical and

immunochemical approaches and, more recently, genome,

proteome and transcriptome analysis have demonstrated

that the sexual development is accompanied by stage-

specific expression of a large number of genes (more than

400, Fig. 2) (Florens et al., 2002; Lasonder et al., 2002).

Some of these gene products are likely to be important

mechanistically, while others might offer novel targets for

immune attack against the parasite (Kongkasuriyachai and

Kumar, 2002). Targeted gene disruption via homologous

recombination has been used to show different roles for a

handful of these gene products. For example, disruption of

Pfg27 leads to complete loss of sexual phenotype, on the

other hand disruption of Pfs48/45 rendered male gametes

infertile (reviewed in Kongkasuriyachai and Kumar, 2002;

Lobo et al., 1999; Van Dijk et al., 2001). Attempts to

employ gene silencing methods based on RNAi in our

laboratory have in general not been successful, in spite of

previous published reports (Malhotra et al., 2002; Kumar

et al., 2002). Various approaches tested in our studies

included electropoartion of dsRNA in the parasites,

incubation ‘soaking’ of parasites in culture with dsRNA or

SiRNA and pre-loading red blood cells with SiRNA prior to

infection with Plasmodium falciparum. Lack of RNAi in

Fig. 1. Model for intraerythrocytic sexual commitment, differentiation and

development. Various stages are indicated, ring (R), trophozoite (T),

schizont (S), male (M) and female (F) gametocytes.

P. falciparum is not surprising in view of the fact that the

parasite appears to lack Dicer and various other components

of the RISC complex, necessary for RNAi effects (Aravind

et al., 2003).

Stage specific gene expression in the parasite arises from

changes in the apparent levels and abundance of mRNA

levels for such genes in different stages of the parasite. Gene

expression appears to be largely controlled transcription-

ally, however, very little is known about how this

differential transcriptional regulation is achieved. Control

at the level of specific transcription factors present in

particular stage of the parasite may provide a logical

explanation. Although not much is known about transcrip-

tional regulation, this process is fundamental to the parasite

as is implied by the highly complex life cycle. Plasmodium

falciparum alternates between the vertebrate host and the

invertebrate vector, and is accompanied by the parasite

going through numerous morphological changes, as well as

changes at the molecular level revealed by developmentally

distinct patterns of protein and RNA synthesis.

Examination of individual gene expression illustrates the

complexity in the parasite system. Some proteins are

expressed constitutively, while others are expressed only

in certain stages. For example, the RNA coding merozoite

surface protein can be seen through Northern blot analysis

and nuclear run-on analysis to be present during the entire

erythrocytic cycle (Lanzer et al., 1992). On the other hand,

expression of multiple var genes is seen by RT-PCR

analysis in the early ring stage asexual parasites followed by

predominant expression of a single var gene product,

PfEMP1 in erythrocytic trophozoite and schizonts (Scherf

et al., 1998). Changes in the expression of genes encoding

cytoskeletal proteins, such as actin and tubulin, during

sexual development have been reported (Wesseling et al.,

1989; Delves et al., 1990; Rawlings et al., 1992). Patterns of

expression of other proteins expressed in the sexual stage

has been reviewed previously (Kongkasuriyachai and

Kumar, 2002; Moreira et al., 2004, this issue).

In addition to studying the complex expression patterns

of individual genes, recent microarray data has revealed

interesting characteristics of global gene regulation in the

malaria parasite. These studies suggested that several

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1453

mechanisms are likely to be operational in the parasites and

that there is a coordinated program of gene expression

during the intraerythocytic development of the parasite.

Although genes of related function are not necessarily

clustered on the chromosomes, there was a coordinated

program of gene expression which grouped genes coding

proteins of similar function at particular times. Microarray

data also shows a sequential expression of transcripts in that

mRNA’s involved in protein synthesis peaked first,

followed by metabolism related genes, then adhesion/inva-

sion genes, and lastly protein kinases were turned on

(Hayward et al., 2000; Mamoun et al., 2001; Le Roch et al.,

2003; Bozdech et al., 2004). The presence of a consensus

element in the promoter of genes expressed at the same time

which allows the orchestration of simultaneous gene

expression is worth investigating. Global proteome analysis

of sporozoites, merozoites, trophozoites, and gametocytes

using tandem mass spectrometry analysis has been used to

identify proteins in various stages of the parasite and such

studies have revealed that genes encoding many coex-

pressed proteins are clustered on certain chromosomes

(Florens et al., 2002; Lasonder et al., 2002).

A recent gene expression profile analysis in the

intraerythrocytic developmental cycle of highly synchro-

nised parasite has demonstrated that nearly 60% of the

genes are turned on all the time, and interestingly, nearly all

of these have a discrete maximum and minimum for

transcript level over a time course (Bozdech et al., 2004).

These studies also suggest that transcription of multiple

genes may be achieved by a single induction resulting in a

cascade of gene expression, further suggesting that only a

few specific transcription factors are required. Thus

transcription of genes in the parasites may not be governed

on a need or response basis but instead follow a program of

gene expression upon induction. There are, however,

several examples which argue against this hypothesis. For

example, induction of certain genes in the parasite is turned

on during heat shock demonstrating gene expression in

response to environmental fluctuations (Kumar et al., 1991).

Understanding of transcriptional control mechanisms and

transcription factors in specific gene regulation in the

parasites are thus, at best, only poorly understood.

3. Regulation of gene expression

Regulation of gene expression can occur at different

levels such as transcription, mRNA stability, translation and

post-translation control mechanisms. In eukaryotes, it is

well established that transcription rate is influenced by

‘trans-acting elements’ called transcription factors (see

Latchman, 2004). These transcription factors are proteins

which localise to the nucleus where subsequent binding to

the upstream activation sequences (‘cis-acting element’) of

DNA within the promoter region occurs, thus modulating

the rate of transcription of genes through a number of steps.

Binding of transcription factors to the DNA alters the

overall conformation of the DNA in that region, causing

the DNA to twist or bend. Twisting and bending may allow

the DNA to expose otherwise unseen or unreachable

binding sites for other transcription factors, or conversely,

prevent binding of other transcription factors. Lastly,

transcription factors also affect the transcriptionally active

euchromotin or transcriptionally inactive heterochromatin,

state of the chromosomes by modifying histones through

methylation or acetylation thus affecting gene regulation.

In order to be able to effect gene regulation, transcription

factors need to be present in the nucleus where the

transcription factor-DNA binding occurs. The abundance

and availability of transcription factors in the nucleus is

regulated by several mechanisms (see Latchman, 2004, for

individual references). In general, transcription factors tend

to have short half life (minutes) allowing for regulation to

occur at the level of transcription factor production. In

certain cases transcription factors may be localised in areas

outside of the nucleus, however, are translocated into the

nucleus upon activation. For example, NFkB is localised in

the cytoplasm and bound to the inhibitor partner, IkB

(Baeuerle and Baltimore, 1988). In order to allow genes to

be activated by NFkB, IkB must be phosphorylated,

allowing dissociation between NFkB and IkB to occur.

The phosphorylated IkB is targeted for degradation by the

proteasome, while NFkB is free to translocate into the

nucleus and exert action on genes. Transcription factor

levels can also be regulated by targeted degradation. For

example, b-catenin, involved in the Wnt signaling path-

ways, is regulated by phosphorylation, ubiquitinylation, and

degradation by the proteasome system (Cong et al., 2003).

Transcription factors can also be controlled by conversion

of inactive monomeric states to active oligomeric states

either independently or with the assistance of other

components. For example, prior to heat shock activation,

monomeric heat shock factor (HSF) is bound and seques-

tered by the stabilising hsp 90 (Knowlton and Sun, 2001).

After heat shock, the chaperone hsp 90 dissociates and freed

monomeric HSF undergoes trimerisation. In addition to the

structural requirement of HSF trimer formation, this

complex must also be phosphorylated in order to translocate

inside the nucleus and activate transcription. The regulation

of transcription factors is obviously crucial to the proper

control of gene expression which is influenced by the

presence or absence of these trans-acting regulatory

elements.

4. Gene structure and transcriptional machinery

in P. falciparum

In the last decade, it has been established that the

gene structure of P. falciparum is similar to that of other

eukaryotes (Lanzer et al., 1993; Horrocks et al., 1998). For

example, common features include the monocistronically

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581454

transcribed genes, protein coding genes between the 5 0 and

3 0untranslated regions, the presence of introns, capped

mRNA, poly-A tails, and the presence of promoter regions.

Also, a number of enzymes and factors involved in

transcription have also been found and the actions of these

have been shown to be similar with eukaryotes. These

include RNA polymerase I, II and III, TATA-binding

protein (McAndrew et al., 1993; Hirtzlin et al., 1994; Fox

et al., 1993; Li et al., 1991; 1989). Recently, Coulson et al.

(2004) have utilised bioinformatics searches based on 51

profile-hidden Markov Models (HMMs) and found 17 of the

HMMs (corresponding to 71 proteins) in the genome of the

malaria parasite. HMMs are probabilistic models that

describe the likelihood that an amino acid residue occurs

at each given position of an alignment. A profile HMM can

convert a multiple sequence alignment into a position-

specific scoring marix (see Pevsner, 2003 for more details).

Identification of many of the above proteins gives support to

the notion that some of the transcription regulators in

P. falciparum might be homologous to those in plants,

animals and fungi. Elucidation of mechanisms involved in

transcriptional regulation in P. falciparum have been

difficult due to the AT-rich genome sequence of the

parasite. Initial identification and mapping of promoter

elements were approached structurally. However, the ‘ACT’ richness resulted in challenges to identify promoters

based on TATAA boxes as well as presenting challenges in

cloning these regions. Much information about promoter

and gene structure was initially based on gene encoding

glycophorin binding protein, GBP130 (Lanzer et al., 1993;

Lanzer and Horrocks, 1999), and more recently on other

genes, including those expressed in the sexual stages

(Dechering et al., 1999; Alano et al., 1996). With the

advent of transfection for P. falciparum some attempts have

been made to validate these promoters by functional studies

using reporter genes (Horrocks and Kilbey, 1996). Through

these limited studies it has been suggested that promoters in

the parasite have a bipartite structure which is characteristic

of eukaryotic promoters, with basal promoter elements

regulated by upstream elements. This structure is overall

similar to that of a normal eukaryotic RNA polymerase

promoter (Buratowski, 1994; Tjian et al., 1994; Goodrich et

al., 1996).

Although the overall structure of promoters is similar to

that of eukaryotes, several factors are divergent as observed

in GBP 130 (Horrocks et al., 1998). First, the distance

between the cis-acting elements and the transcriptional start

site is much longer than the distance in other eukaryotes

(Levitt, 1993; Horrocks and Kilbey, 1996; Crabb and

Cowman, 1996). Secondly, comparison of the 37 bp cis-

acting sequence of GBP-130 in the parasite similar to

corresponding eukaryotic sequences, has revealed that cis-

acting elements in parasites do not share homology with

eukaryotic cis-acting elements, suggesting evolutionary

divergence of these regulatory elements in Plasmodium.

5. Search for cis-and trans-acting elements

in Plasmodium by genome mining

The recent searches for transcriptional machinery and

specific transcription factors through Plasmodium genome

mining has revealed that many components involved in

eukaryotic specific transcriptional regulation can not be

easily identified, suggesting that Plasmodium might

use different mechanisms for transcriptional regulation

(Aravind et al., 2003). Although a few general transcription

factors, like TBP and TFIID have been identified, the

genome mining and proteome analysis has indicated a

paucity of recognisable transcription factors in

P. falciparum, emphasising the importance of epigenetic

mechanisms of transcriptional regulation in these organisms

(see Aravind et al., 2003 for a review and other references).

Simply searching by overall sequence homology can be

limiting, however, because while the functional regions of

the proteins are conserved, the trend in Plasmodium has

been that the remaining parts of the proteins show much

variation, including in the few general transcription factors

successfully cloned in P. falciparum. In Plasmodium, the

regions of the TATA-binding protein which contact

the DNA have been shown to be extremely conserved, but

the overall structure and remainder of the protein is quite

different with much less conservation in amino acid

sequence (Hernandez, 1993; McAndrew et al., 1993).

Recently, amino acid sequence search has revealed the

presence of a specific transcription factor, c-Myb, although

it’s role needs to be confirmed in biological functional

studies (Briquet et al., 2003. Molecular analysis of two

annotated transcription factors in P. falciparum. The Journal

of Eukaryotic Microbiology. Abstract for 41st annual

meeting for Society of Protozoologist). Therefore, identifi-

cation of genes simply by sequence homology, while

possibly identifying the presence of some transcription

factors, will yield only a partial list and other methods must

be employed to determine and validate the presence or

absence of putative transcription factors. In addition to the

search for these trans-acting elements, efforts to elucidate

the presence of cis-acting DNA elements in the genome

have also been undertaken. Whether the elements have

biological relevance has not been confirmed yet (Briquet

et al., 2003. Molecular analysis of two annotated transcrip-

tion factors in P. falciparum. The Journal of Eukaryotic

Microbiology. Abstract for 41st annual meeting for Society

of Protozoologist)

Using bioinformatics search for cis-acting elements in

Plasmodium, Militello et al. (2004) concluded that regulat-

ory sequences in the parasite are not homologous to

standard eukaryotic regulatory sequences. This study

characterised a ‘G-box’ which is an unusually G-rich

sequence element upstream of HSP genes, while lacking

standard eukaryotic sequences like CCAAT boxes or Sp1

binding sites. However, the bioinformatics analysis did

confirm previous data on the preservation of other features

Table 1

Consensus binding sequencesa used in Panomics TranSignal Array

AP-1 CGCTTGATGACTCAGCCGGAA

AP-2 GATCGAACTGACCGCCCGCGGCCCGT

ARE CTACGATTTCTGCTTAGTCATTGTCTTCC

Brn3 CACAGCTCATTAACGCGC

CBF AGACCGTACGTGATTGGTTAATCTCTT

CDP ACCCAATGATTATTAGCCAATTTCTGA

C/EBP TGCAGATTGCGCAATCTGCA

ERE GTCCAAAGTCAGGTCACAGTGACCTGAT-

CAAAGTT

c-Myb TACAGGCATAACGGTTCCGTAGTGA

Ets GGAGGAGGGCTGCTTGAGGAAGTATAA-

GAAT

FAST-1 CGGATTGTGTATTGGCTGTAC

MEF2 GATCGCTCTAAAAATAACCCTGTCG

Myc-Max GGAAGCAGACCACGTGGTCTGCTTCC

Pit1 TGTCTTCCTGAATATGAATAAGAAATAA

CREB AGAGATTGCCTGACGTCAGAGAGCTAG

E2F-1 ATTTAAGTTTCGCGCCCTTTCTCAA

EGR GGATCCAGCGGGGGCGAGCGGGGGCCA

Ets-1/PEA3 GATCTCGAGCAGGAAGTTCGA

GAS/ISRE CGAAGTACTTTCAGTTTCATATTACTCTA

CAA

GATA CACTTGATAACAGAAAGTGATAACTCT

GRE GACCCTAGAGGATCTGTACAGGATGTTCTA-

GATCCAATTCG

HNF-4 (1) CTCAGCTTGTACTTTGGTACAACTA

IRF-1 GGAAGCGAAAATGAAATTGACT

MEF-1 GATCCCCCCAACACCTGCTGCCTGA

NF-1 TTTTGGATTGAAGCCAATATGATAA

NFATc ACGCCCAAAGAGGAAAATTTGTTTCAT

ACA

NF-E1 (YY1) CGCTCCGCGGCCATCTTGGCGGCTGGT

NF-E2 TGGGGAACCTGTGCTGAGTCACTGGAG

NFkB AGTTGAGGGGACTTTCCCAGGC

Oct-1 TGTCGAATGCAAATCACTAGAA

p53 TACAGAACATGTCTAAGCATGCTGGGG

Pax-5 GAATGGGGCACTGAGGCGTGACCACCG

Pbx1 CGAATTGATTGATGCACTAATTGGAG

PPAR CAAAACTAGGTCAAAGGTCA

PRE GATCCTGTACAGGATGTTCTAGCTACA

RAR(DR-5) TCGAGGGTAGGGTTCACCGAAAGTTCAC

TCG

RXR(DR-1) AGCTTCAGGTCAGAGGTCAGAGAGCT

SIE GTGCATTTCCCGTAAATCTTGTCTACA

Smad 3/4 TCGAGAGCCAGACAAAAAGCCAGACATT-

TAGCCAGACAC

Smad SBE AGTATGTCTAGACTGA

Sp1 ATTCGATCGGGGCGGGGCGAG

SRE GGATGTCCATATTAGGACATCT

Stat1 (p84/p91) CATGTTATGCATATTCCTGTAAGTG

Stat3 GATCCTTCTGGGAATTCCTAGATC

Stat5 AGATTTCTAGGAATTCAATCC

Stat6 GTATTTCCCAGAAAAGGAAC

Stat4 CTAGAGCCTGATTTCCCCGAAATGATGAGC-

TAG

TFIID GCAGAGCATATAAAATGAGGTAGGA

TR GATCGTAAGATTCAGGTCATGACCTGAG-

GAGA

TR(DR-4) AGCTTCAGGTCACAGGAGGTCAGAGAGCT

USF-1 CACCCGGTCACGTGGCCTACACC

VDR(DR-3) AGCTTCAGGTCAAGGAGGTCAGAGAGCT

HSE CTGGAATTTTCTAGA

MRE CTCTGCGCCCGGCCC

a Sequences obtained from Panomics, Inc. (www.panomics.com).

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1455

of eukaryotic transcription like upstream activation

sequences, 5 0 untranslated regions start sites, and

3 0untranslated regions.

6. Experimental search for putative transcription factors

in asexual and sexual stages of P. falciparum

In order to modulate gene expression, DNA-binding

transcription factors must be localised in the nucleus. In our

search for functional transcription factors nuclear extracts

prepared from P. falciparum were used to test for

protein/DNA binding in two independent experimental

schemes, by the high throughput TranSignal Protein/DNA

array hybridisation (Panomics, Inc. Redwood City, CA,

USA) and the traditional gel mobility shift assay. Specific

transcription factors have DNA binding domains which

interact with short stretches of sequences in the promoter

region called the upstream activating sequences, and it is

through this sequence specific interaction that specific

regulation occurs. Since the sequence recognition and

binding is crucial to the action of transcription factors, the

specificity of binding of proteins in the nuclear extract to

transcription factor-specific consensus sequences suggests

possible functional roles of such proteins.

In the TranSignal Protein/DNA array hybridisation

approach we searched for putative transcription factors

based on their ability to bind highly-conserved cis-acting

elements for eukaryotic transcription factors (Table 1).

Proteins in the nuclear extracts prepared from P. falciparum

enriched for asexual or sexual stages or from parasites

stressed by heat shock or serum starvation bound to a

number of highly conserved eukaryotic consensus DNA

binding sequences. However, a distinct differential profile

was not seen between the nuclear extracts prepared from

asexual and sexual parasites tested (Fig. 3 and Table 2).

Likewise, the binding patterns with stressed parasites were

also not different from those obtained with unstressed

parasites. Future experiments with more stringent purifi-

cation of various parasite stages may be necessary to detect

changes in profiles, in conjunction with a more quantitative

Fig. 3. High throughput screening for putative P. falciparum transcription

factors. Hybridisation patterns for putative transcription factor activities in

the nuclear extracts prepared from asexual and sexual-enriched parasites.

Membranes used were Panomic’s TranSignal Protein/DNA Array (www.

panomics.com).

Table 2

Summary of results from bioinformatics searches of consensus binding sequences within the 2 kb upstream of 5 0 untranslated region (5’utr) as compared to

positive spots from the TranSignal Protein/DNA array

Transcription factor Positive in TranSignal

array

cis-element identified

within 2 kb of 5 0utr

Transcription factor Positive in TranSignal

array

cis-element identified

within 2 kb of 5 0utr

AP-1 (1) X NF-E1

AP-2 (1) NF-E2 X

ARE NFkB X

Brn3 Oct-1 X

C/EBP P53 X

CBF Pax-5 X

CDP X X Pbx1

c-Myb X X Pit 1

CREB (1) X PPAR

E2F1 X PRE

EGR X RAR (DR5) X

ERE RXR (DR1) X

Ets SIE

Ets1/PEA3 Smad SBE X

FAST-1 Smad 3/4 X

GAS/ISRE Sp1 X

GATA X SRE X

GRE X Stat1 X

HNF-4 X Stat3

HSE X X Stat4 X X

IRF-1 Stat5

MEF-1 X X Stat6

MEF-2 TFIID X

MRE X TR

Myc-Max TR (DR-4) X

NF-1 X USF-1 X

NFATc VDR (DR3) X X

The ‘positives’ from the TranSignal are spots with the greatest intensity consistently in various asexual and sexual nuclear extracts.

Table 3

Summary of some putative transcription factor activities (revealed by array

hybridisation) and their roles as suggested in the literature (see Latchman,

2004 for individual references)

AP-1 Activator protein, regulate granulysin gene

expression

C-Myb Signal transduction, proliferation and differenti ation

CREB cAMP response element

E2F1 Regulates cyclin E, critical for the expression of

S phase-specific proteins

EGR Early grown response element

MEF-1 Myogenic cell fate specification and differentiation

MRE Metal response element

NF-E2 Erythroid transcription factor

NFkB Regulators of type 1 interferon system

Pax-5 Mutations result in mouse developmental mutants

Smad 3/4 Signalling

SP1 Serine protease 1

TR(DR-4) Thyroid hormone receptor

HSE Heat shock element

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581456

method for measurement, like real-time reverse transcrip-

tase polymerase chain reaction. Furthermore these types of

results need independent verification by traditional

approaches like gel mobility shift assay.

An initial attempt has shed further light on the

complexity of such analysis. Oligonucleotides corre-

sponding to eight of the most prominent positive hits

(c-Myb, CREB, EGR, MEF-1, NFkB, E2F1, Smad 3/4,

HSE), as well as two consistently negative by TranSignal

(Oct-1 and Stat-1), were tested in the gel mobility shift

assays. Interestingly, although band-shift was observed in

many of these positive samples the specificity of such

binding by competition was unclear. For two of the eight

examined C-Myb and MEF-1, high specific binding was

observed, but for others the specificity of DNA protein

interaction remains questionable. In some cases even

unrelated oligonucleotide sequences seem to compete for

binding of specific probes, suggesting significant random

interactions. A possible interpretation is that the recog-

nition between DNA sequences and binding proteins may

not be strictly specific to the consensus sequences tested

and may display broader binding specificity. Another

possible explanation is that binding revealed by

the TranSignal array is non-specific. While our results

suggest the presence of many putative transcription

factors, future studies are needed to directly validate

their presence and stage-specific functions. Table 3 gives

a summary of suggested role for few representative

transcription factor activities detected by array hybridis-

ation approach.

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–1458 1457

7. Bioinformatics search of Plasmodium genome

The consensus binding sequences used to identify

transcription factor activation in the TranSignal Pro-

tein/DNA array represent highly conserved eukaryotic

consensus binding sequences (Table 1). Since malaria

genome is A–T rich, it was questioned whether these

consensus binding sequences could be found in the

promoter regions of the parasite genome. We employed a

bioinformatics approach to search the consensus binding

sequences against regions of the parasite genome

expected to be involved in gene regulation. The

sequences were searched up to 2 kb upstream of the

translation initiation codons. Seventeen out of 54 hits of

100% sequence homology were revealed by BLAST

analysis. It was expected that the transcription factors

which were positive in our TranSignal array would also

be confirmed by the presence of corresponding cis-

binding sequences upstream of genes, especially since

those sequences were affinity-selected by the proteins in

the parasite nuclear extracts. Paradoxically, only six out

of 17 of our strongest positive signals were confirmed by

these searches. It is noteworthy that the program used

was developed to recognise sequences of 100% hom-

ology only. It is possible that in these organisms the

sequences involved are slightly modified, thus undetect-

able in searches requiring 100% sequence homology and

perhaps the parasite exploits variation in consensus

binding sequences as a mechanism of regulation. In our

search we also noted some discrepancy in terms of

certain consensus sequences found in promoter regions

by bioinformatics search but negative by TranSignal

array analysis. We do not know whether it is a reflection

of temporal differences in terms of expression of

transcription factors at different time points in asexually

and sexually developing erythrocytic parasites.

8. Conclusion

A clear analysis of gene expression patterns can provide

clues about how gene expression is regulated and knowl-

edge of how transcription is controlled at the molecular

level will improve our understanding of the malaria parasite.

Currently there is only scant evidence for post-transcrip-

tional control mechanisms in these organisms, emphasising

the importance of transcriptional control mechanism.

However, the fact that significant regions of the genome

have been found to be either transcriptionally active or

transcriptionally silent, suggests that parasites may also

employ translational control mechanisms. Relatively

little is known about how the parasite globally regulates

the production of proteins important for its pathogenesis and

sequential development. Only a few putative transcription

factors have been mapped to the genes that they regulate. A

clear understanding how gene expression is regulated in

malaria parasites undoubtedly will improve our ability to

unravel complexity of parasite biology, evaluate gene

function in the parasite and even identify key targets for

controlling infection caused by these parasites.

Acknowledgements

Research in the NK laboratory is supported by research

grants from the NIH and pilot grant award from the JHMRI.

References

Alano, P., Silverstrini, F., Roca, L., 1996. Structure and polymorphism of

the upstream region of the pfg27/25 gene, transcriptionally regulated in

gametocytogenesis of Plasmodium falciparum. Mol. Biochem. Para-

sitol. 79, 207–217.

Aravind, L., Iyer, L.M., Wellems, T.E., Miller, L.H., 2003. Plasmodium

biology: genomic gleanings. Cell 115, 771–785.

Baeuerle, P.A., Baltimore, D., 1988. IkB: a specific inhibitor of the NF-kB

transcription factor. Science 242, 540–546.

Bozdech, Z., Llinas, M., Pulliam, B., Wong, E., Zhu, J., DeRisi, J.L., 2004.

The transcriptome of the intraerythrocytic developmental cycle of

Plasmodium falciparum. PLOS Biol. 1, 85–100.

Buratowski, S., 1994. The basics of basal transcription by RNA polymerase

II. Cell 77, 1–3.

Cong, F., Schweizer, L., Chamorro, M., Varmus, H., 2003. Requirement for

a nuclear function of beta-catenin in Wnt signaling. Mol. Cell Biol. 23,

8462–8470.

Coulson, M.R., Hall, N., Ouzounis, C.A., 2004. Comparative genomics of

transcriptional control in the human malaria parasite Plasmodium

falciparum. Genome Res. 14, 1548–1554.

Crabb, B.S., Cowman, A.F., 1996. Characterization of promoters and stable

transfection by homologous and non homologous recombination in

Plasmodium falciparum. Proc. Natl Acad. Sci. USA 93, 7289–7294.

Dechering, K.J., Kaan, A.M., Mbacham, W., Wirth, D.F., Eling, W.,

Konings, R.N., Stunnenberg, H.G., 1999. Isolation and functional

characterization of two distinct sexual-stage-specific promoters of the

human malaria parasite Plasmodium falciparum. Mol. Cell. Biol. 19,

967–978.

Delves, C.J., Alano, P., Ridley, R.G., Goman, M., Holloway, S.P.,

Hyde, J.E., Scaife, J.G., 1990. Expression of alpha- and beta-tubulin

genes during the asexual and sexual blood stages of Plasmodium

falciparum. Mol. Biochem. Parasitol. 43, 271–278.

Florens, L., Washburn, M., Raine, D., Anthony, R., Grainger, M.,

Haynes, D., Moch, J., Muster, N., Sacci, J., Tabb, D., Witner, A.,

Wolters, D., Wu, Y., Garder, M., Holder, A., Sinden, R., Yates, J.,

Carucci, D., 2002. A proteomic view of the Plasmodium falciparum life

cycle. Nature 419, 520–526.

Fox, B.A., Li, W.B., Tanaka, M., Inselburg, J., Bzik, D.J., 1993. Molecular

characterization of the largest subunit of Plasmodium falciparum RNA

polymerase I. Mol. Biochem. Parasitol. 61, 37–38.

Goodrich, J.A., Cutler, G., Tjian, R., 1996. Contacts in context: Promoter

specificity and macromolecular interaction in transcription. Cell 84,

825–830.

Hayward, R.E., Derisi, J.L., Alfadhli, S., Kaslow, D.C., Brown, P.O.,

Rathod, P.K., 2000. Shotgun DNA microarray and stage-specific gene

expression in Plasmodium falciparum malaria. Mol. Microbiol. 35,

6–14.

Hernandez, N., 1993. TBP, a universal eukaryotic transcription factor?.

Genes Dev. 7, 1291–1308.

Hirtzlin, J., Farber, P.M., Franklin, R.M., 1994. Isolation of a novel

Plasmodium falciparum gene encoding a protein homologous to the

Tat-binding protein family. Eur, J. Biochem 226, 673–680.

N. Kumar et al. / International Journal for Parasitology 34 (2004) 1451–14581458

Horrocks, P., Kilbey, B.J., 1996. Physical and functional mapping of the

Plasmodium falciparum proliferating cell nuclear antigen genes

transcription start site. Mol. Biochem. Parasitol. 82, 207–215.

Horrocks, P., Dechering, K., Lanzer, M., 1998. Minireview—control of

gene expression in Plasmodium falciparum. Mol. Biochem. Parasitol.

95, 171–181.

Knowlton, A.A., Sun, L., 2001. Heat-shock factor-1, steroid hormones, and

regulation of heat shock protein expression in the heart. Am. J. Physiol.

Heart Circ. Physiol. 280, H455–H464.

Kongkasuriyachai, D., Kumar, N., 2002. Functional characterization of

sexual stage specific proteins in Plasmodium falciparum. Int.

J. Parasitol. 32, 1559–1566.

Kumar, N., Koski, G., Harada, M., Aikawa, M., Hong, Z., 1991. Induction

and localisation of Plasmodium falciparum stress proteins related to the

heat shock protein 70 family. Mol. Biochem. Parasitol. 48, 47–58.

Kumar, R., Adams, B., Oldenburg, A., Musiyenko, A., Barik, S., et al.,

2002. Characterisation and expression of a PP1 serine / threonine

protein phasphatase (PfPP1) from the malaria parasite, Plasmodium

falciparum: demonstration of its essential role using RNA interference.

Malar J. 2002;, 1–5.

Lanzer, M., Horrocks, P., 1999. Mutational analysis identifies a five

base pair cis-acting sequence essential for GBP 130 promoter

activity in Plasmodium falciparum. Mol. Biochem. Parasitol. 99,

77–87.

Lanzer, M., de Bruin, D., Ravetch, J.V., 1992. Transcription mapping of a

100 kb locus of Plasmodium falciparum identifies an intergenic region

in which transcription terminates and reinitiates. Eur. Mol. Biol. Org. J.

11, 1949–1955.

Lanzer, M., Wertheimer, S., De Bruin, D., Ravetch, J., 1993. Minireview—

Plasmodium: control of gene expression in malaria parasites. Exp.

Parasitol. 77, 121–128.

Lasonder, E., Ishihama, Y., Andersen, J.S., Vermunt, A.M.W., Pain, A.,

Sauerwein, R.W., Eling, W.M.C., Hall, N., Waters, A.,

Stunnenberg, H.G., Mann, M., 2002. Analysis of the Plasmodium

falciparum proteome by high-accuracy mass spectrometry. Nature 419,

537–542.

Latchman, D., 2004. Eukaryotic Transcription Factors. Academic Press,

New York.

Le Roch, K.G., Zhou, Y., Blair, P.L., Grainger, M., Moch, K., Haynes, D.,

De la Vega, P., Holder, A., Batalov, S., Carucci, D.J., Winzeler, E.A.,

2003. Discovery of gene function by expression profiling of the malaria

parasite life cycle. Science 301, 1503–1508.

Levitt, A., 1993. RNA processing in malaria parasites. Parasitol. Today. 9,

465–468.

Li, W.B., Bzik, D.J., Gu, H.M., Tanaka, M., Fox, B.A., Inselburg, J., 1989.

An enlarged largest subunit of Plasmodium falciparum RNA poly-

merase II defines conserved and variable RNA polymerase domains.

Nucl. Acids Res. 17, 9621–9636.

Li, W.B., Bzik, D.J., Tanaka, M., Gu, H.M., Fox, B.A., Inselburg, J., 1991.

Characterization of the gene encoding the largest subunit of

Plasmodium falciparum RNA polylmerase III. Mol. Biochem. Para-

sitol. 46, 229–239.

Lobo, C.A., Kumar, N., 1998. Sexual differentiation and development in

malaria parasites. Parasitol. Today 14, 146–150.

Lobo, C.A., Fujioka, H., Aikawa, M., Kumar, N., 1999. Disruption of Pfg27

locus by homologous recombination leads to loss of the sexual

phenotype in Plasmodium falciparum. Mol. Cell 3, 793–798.

Malhotra, P., Dasarathi, P.V., Kumar, A., Mohmmed, A., Agrawal, A.,

Bhatnagar, R.K., Chauhan, V.S., 2002. Double-stranded RNA-

mediated gene silencing of cysteine protease (falcipain-1 and -2) of

Plasmodium falciparum. Mol. Microbiol. 45, 1245–1254.

Mamoun, C., Gluzman, I., Hott, C., MacMillan, S., Amarakone, A.,

Anderson, D., Carlton, J., Dame, J., Chakrabarti, D., Martin, R.,

Brownstein, B., Goldberg, D., 2001. Co-ordinated programme of gene

expression during asexual intraerythrocytic development of the human

malaria parasite Plasmodium falciparum revealed by microarray

analysis. Mol. Microbiol. 39, 26–36.

McAndrew, M., Read, M., Sims, P., Hyde, J., 1993. Characterization of the

gene encoding an unusually divergent TATA-binding protein (TBP)

from the extremely ACT-rich human malaria parasite Plasmodium

falciparum. Gene 124, 165–171.

Militello, K.T., Dodge, M., Bethke, L., Wirth, D.F., 2004. Identification of

regulatory elements in Plasmodium falciparum genome. Mol. Biochem.

Parasitol. 134, 75–88.

Moreira, C.K., Marrelli, M.T., Jacobs-Lorena, M., 2004. Gene expression

in Plasmodium: from gametocytes to sporozoites. Int. J. Parasitol. 2004;

(this issue).

Pevsner, J., 2003. Bioinformatics and Functional Genomics. Wiley (p. 325).

Rawlings, D.J., Fujioka, H., Fried, M., Keister, D.B., Aikawa, M.,

Kaslow, D.C., 1992. Alpha-tubulin II is a male-specific protein in

Plasmodium falciparum. Mol. Biochem. Parasitol. 56, 239–250.

Scherf, A., Hernandez-Rivas, R., Buffet, P., Bottius, E., Benatar, C.,

Pouvelle, B., et al., 1988. Antigenic variation in malaria: in situ

switching, relaxed and mutually exclusive transcription of var genes

during intra-erythrocytic development in Plasmodium falciparum. Eur.

Mol. Biol. Org. J. J. 17, 5418–5426.

Tjian, R., Maniatis, T., 1994. Transcriptional activation: a complex puzzle

with a few easy pieces. Cell 77, 5–8.

Van Dijk, L.H.M., Janse, C.J., Thompson, J., Waters, A.P., Brake, J.A.M.,

Dodemont, H.J., Stunnenberg, H.G., van Gemert, G.L.,

Saurwein, R.W., Eling, W., 2001. A central role for P45/48 in malaria

parasite male gamete fertility. Cell 104, 153–164.

Wesseling, J.G., Snijders, P.J.F., Someren Van, P., Jansen, J.,

Smits, M.A., Schoenmakers, J.G.G., et al., 1989. Stage-specific

expression and genomic organization of the actin genes of the

malaria parasites Plasmodium falciparum. Mol. Biochem. Parasitol.

35, 167–176.