microsatellite markers screening for coffee berry disease (colletotrichum kahawae...

“UTAFITI NDIO UHAI WA WAKULIMA WA KAHAWA”

Improving Income Security and Livelihoods

MICROSATELLITE MARKERS

SCREENING FOR COFFEE BERRY

DISEASE (COLLETOTRICHUM

KAHAWAE) RESISTANCE

MTENGA, Damian J., KUSOLWA, Paul M., REUBEN,

Shazia. O.W.M and KILAMBO, Deusdedit L.



Introduction

❖Coffee accounts for about 20% of Tanzania's

foreign exchange earnings

❖ More than 450,000 families' farms (95%)

and 110 estates (5%) derive their

livelihoods from growing coffee

❖ Coffee production in Tanzania is mainly

constrained by the prevalence of pests and

diseases



Introduction cont...

❖Coffee berry disease (CBD), caused by

Colletotrichum kahawae, is a major constraint for

Arabica coffee cultivation in Africa

❖CBD preventive control by frequent fungicide

sprays accounts for 30–40 % of total production

costs

❖Can lead to 60% harvest loss on susceptible

varieties if not controlled (Bedimo et al, 2008).



Coffee berry disease damage

❖Direct loss occurs as a

result of flower and young

fruit infection

❖ Immature berries are most

susceptible at expansion

phase

❖Mummified berries are the

main sources of primary

inoculum



Introduction cont..

❖ In perennial crops traits of interest such as disease

resistance can be observed and screened only at

late stages of development and require

assessment over a number of years

❖ Use of marker assisted selection (MAS) in

perennial crops can greatly decrease the time

taken to select for resistance enabling rapid

identification genotypes containing disease

resistance genes (Collard and Mackill, 2008)



Objective of the study

The main objective:

To hasten the process of development and release of

Coffee berry disease resistant varieties

Specific objectives were:

i. To carry out hybridization between KP423 and

Ethiopian accessions to broaden the genetic base

for disease resistance

ii. To use gene specific microsatellite markers to

screen for CBD resistance genes to identify resistant

materials



Materials and Methods❖ The phenotypic screening was carried out at

TaCRI Lyamungu Pathology Laboratory

✓ Latitude 03º14’699’’S and Longitude 037º14’762’’E a

✓ Altitude 1268 masl

❖ Molecular work was carried out at Sokoine

University of Agriculture (SUA) Molecular

Laboratory

✓ Latitude 6° 49' 49'' S and 37° 40' 141’’ E

✓ Altitude 500 - 600 masl



Experimental design

❖ 11 genotypes and their F1 progenies including susceptible

KP423 were used in the experiment

❖ The experiment was laid out in a RCBD with 3 replications

❖ Each genotype had fifty seeds planted in germination box

per replication making total of 150 seeds

❖ At the hypocotyl stage; seedlings were subjected to

phenotypic screening

❖ Seeds of the susceptible KP423 were not subjected to

phenotypic screening



Phenotypic hypocotyl screening

Resistant

genotypeSusceptible

genotype



Materials and Methods cont…i) Phenotypic screening

Germinating seedlings from parents and F1s were

subjected to hypocotyl screening for CBD resistance

using the procedure by Van der Vossen et al, 1976.

Inoculated seedlings were individually scored and

average infection (G) on each genotype was

calculated as follows:

4

G = 1/N ∑ ini

i = 0



Materials and Methods cont…i) Phenotypic screening cont..

where, i is the disease class; ni is the number of seedlings in

class i; N is the total number of seedlings scored (Omondi et

al., 2001 ).

❖ The disease reaction was read using 0-4 scale by

Van der Graaf (1978); Where: 0 = absence of

symptoms and 4 = dead hypocotyls

❖ Mean score data were subjected to ANOVA using

GenStat V. 12.1 statistical software

❖ Mean separation was done by Fisher protected

HSD



Materials and Methods cont…i) Phenotypic screening

List of genotypes used for CBD diseases resistance genes screening

Genotypes Description Code

F45/64/2049 x KP423 F1 hybrid 101

F90/64/4660 x KP423 F1 hybrid 102

Rume Sudan VC298 x KP423 F1 hybrid 103

F45/64/2061 x KP423 F1 hybrid 104

F24/64/902 x KP423 F1 hybrid 105

F24/64/886 x KP423 F1 hybrid 106

Catimor PRO 127 x KP423 F1 hybrid 107

F89/64/4650 x KP423 F1 hybrid 108

KP 423 Commercial 109

F24/64/886 Ethiopian 110

Catimor PRO 127 Progenitor 111

F89/64/4650 Progenitor 112

Rume Sudan VC298 Progenitor 113

PNI 088 Progenitor 114

Sarchimor Progenitor 115

HdT VCE 1593 Progenitor 116







Materials and Methods cont…ii) Specific gene markers screening

❖Leaf samples were collected from

the seedlings that survived CBD pre

selection for DNA extraction for

resistance gene

❖Two gene specific markers

Sat235 and Sat207 sourced from

literature (Gichuru et al, 2008) were

used

❖ DNA extraction and PCR

amplification followed the procedure

by Diniz et al, 2005

DNA extraction at SUA molecular lab



Marker

namePrimer (5' - 3') Sequence Reference

Sat207 F GAAGCCGTTTCAAGCC

Gichuru et al.,

2008

R CAATCTC TTTCCGATGCTCT

Sat235 F TCGTTCTGTCATTAAATCGTCAA Gichuru et al., 2008

R GCAAATCATGAAAATAGTTGGTG

Materials and Methods cont…

ii) Specific gene markers screening

Gene specific markers used in the study



Results and DiscussionPhenotypic screening of parental genotypes (0-4) scale

Genotype MeanSARHIMOR 0.080a

VC 298 0.080a

F90/64/T4660 0.104a

PNI088 0.184a

HDT VCE 1593 0.340ab

F45/64/T2049 0.384ab

F89/64/T4650 0.384ab

PRO127 0.620bc

F24/64/902 0.912cd

F24/64/T886 0.930cd

F24/64/T2061 1.256d

KP423 3.680e

Mean values on the same column having the same letter(s) are not significantly

different at p≤0.05 according to Fisher HSD



Results and DiscussionPhenotypic screening of F1 hybrids scale (0-4)

Genotype MeanVC 298 x KP423 0.112a

F90/64/T4660 x KP423 0.136a

VCE1593 x KP423 0.240ab

F89/64/T4650 x KP423 0.336bc

PNI 088 x KP423 0.408cd

SARCHIMOR x KP423 0.416cd

F45/64/T2049 x KP423 0.432cde

PRO 127 x KP423 0.464cde

F24/64/T2061 x KP423 0.504def

F24/64/902 x KP423 0.560ef

F24/64/T886 x KP423 0.64of

KP423 3.680g

Mean values on the same column having the same letter(s) are not significantly

different at p≤0.05 according to Fisher HSD



Results and DiscussionPhenotypic screening

❖ All the genotypes except KP423 showed resistance to

CBD with significantly different p≤0.05 performance

among parental genotypes and F1 hybrids.

❖ The higher the value the more the susceptibility to

CBD. The lower the value the higher the resistance to

the disease.

❖ The control variety KP423 which is highly susceptible

to CBD had the highest mean score and had

significantly difference p≤0.05 performance



Results and DiscussionMarker Sat235 screening

Figure 1: A 2% gel photograph showing amplification of coffee parental genotypes, F1 hybrids and a commercial variety KP423 by SSR

marker Sat 235. Lanes 101–120 represent coffee genotypes. Lane M represents a 100-bp ladder and lane C+ represent a control

of a known amplification

1500bp

500bp

100bp

p



Results and DiscussionMarker Sat207 screening

Figure 2: A 2% gel photograph showing amplification of coffee parental genotypes, F1 hybrids and a commercial variety

KP423 by SSR marker Sat 207. Lanes 101–120 represent genotypes. Lane M represents a 100-bp ladder and lane C+ and C

represents controls of a known amplification

1500bp

100bp

500bp



Results and discussion

Marker screening for CBD resistance gene

❖ The genotypes containing the resistance gene were

expected to show phenotypic resistance to CBD

and also banding patterns similar to the resistance

donors when screened by markers.

❖ Genotypes lacking the resistance gene were

expected to show phenotypic susceptibility to CBD

and banding pattern similar to the susceptible

commercial variety KP423 when marker screened.



Results and discussion

❖ All the twenty genotypes were amplified by

markers Sat235 and Sat207 except genotypes

(103) a hybrid, (109) commercial and (110)

Ethiopian accession

❖ The genotypes showing good resistance when

phenotypically screened but not amplified by

markers Sat235 and Sat207 like genotypes (109,

(103) and (110) might have the gene but located at

different position or a different gene not Ck-1



Conclusion

❖ The presence of CBD resistance gene in the

genotypes amplified by SSR primer Sat 235 and

Sat207 was confirmed by production of bands

similar to the progenitors with the exception of

the genotypes (103), (110) and (109)

❖ This finding indicates that marker screening can

be used in CBD resistant genotypes selection at

early stages reducing the time of selection cycle



Some key References

1. Diniz, L. E. C., Ruas, C. F., Carvalho, V. P., Torres, F. M., Ruas, E. A., Santos,

M. O., Sera, T and Ruas, P. M. (2005). Genetic diversity among forty coffee

varieties assessed by RAPD markers associated with restriction digestion.

Brazil Archive Biology Technical 48(4): 511 – 521.

2. Gichuru, E. K., Agwanda, C. O., Combes, M. C., Mutitu, E. W., Ngugi, E. C. K.,

Bertrand, B. & Lashermes, P. (2008). Identification of molecular markers linked

to a gene conferring resistance to coffee berry disease (Colletotrichum

kahawae) in Coffea arabica. Plant Pathology 57(6): 1117 – 1124.

3. Van der Graaff, N. A. (1978). Selection for resistance to coffee berry disease in

arabica coffee in Ethiopia. Evaluation of selection methods. Netherlands Journal

of Plant Pathology, 84(6): 205 – 215.

4. Van der Vossen, H. A. M., Cook, R. T. A. and Murakaru, G. N. W. (1976).

Breeding for resistance to Coffee berry disease caused by Colletrotrichum

coffeanum Noack (sensu Hindorf) in Coffea arabica L. I. Methods of

preselection for resistance. Euphytica, 25: 733 – 745.



Acknowledgements

This work was supported by Tanzanian

Coffee Stakeholders, The Tanzanian

government and the European

commission

We are grateful to the IACO Organizing

committee for accepting our paper for

presentation and TaCRI management for

sponsoring my participation



Arabica Robusta

microsatellite markers screening for coffee berry disease (colletotrichum kahawae...

Documents