MicroRNA Expression during Chondrogenic Differentiation and

Inflammation of Equine Cells

by

Midori Elizabeth Buechli

A Thesis

presented to

The University of Guelph

In partial fulfilment of requirements

for the degree of

Master of Science

in

Biomedical Sciences

Guelph, Ontario, Canada

© Midori E. Buechli, January, 2013

ABSTRACT

MICRORNA EXPRESSION DURING CHONDROGENIC DIFFERENTIATION AND

INFLAMMATION OF EQUINE CELLS

Midori Elizabeth Buechli Advisors:

University of Guelph, 2012 Professor T.G. Koch

Professor J. LaMarre

Understanding the molecular networks that maintain articular cartilage and regulate

chondrogenic differentiation of mesenchymal stromal cells (MSCs) are important prerequisites

for the improvement of cartilage repair strategies. The first study within this thesis demonstrates

that equine cord blood-derived MSCs induced towards a chondrogenic phenotype showed

significantly increased miR-140 expression from day 0 to day 14, which was accompanied by

decreased expression of previously identified miR-140 targets; ADAMTS-5 and CXCL12. The

second study shows that in vitro chondrogenesis on fibronectin coated-PTFE inserts results in

more homogeneous hyaline-like cartilage with an increased number of differentiated cells

compared with pellet cultures. Finally, the expression of miR-140, miR-9, miR-155 and miR-

146a was investigated in an in vitro model of osteoarthritis and suggests a possible role for miR-

146a. These results suggest that microRNAs may be useful for directing or enhancing eCB-

MSC chondrogenic differentiation and for developing novel biomarker panels of in vivo joint

health.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS……………………………………….……………………………..i

DECLARATION OF WORK PERFORMED…………………………………………….......iii

LIST OF TABLES………………………………………………………………………….…...iv

LIST OF FIGURES…………………………………………………………………………...…v

LIST OF ABBREVIATIONS……………………………………………………………….…vii

INTRODUCTION……………………………………………………………………………….1

Natural Cartilage Development…………………………………………....……1

Synovial joint formation…………………………………………………..1

Endochondral ossification…………………………...…………………….3

Current Treatments for Cartilage Injury………………...…………………….5

Bone Marrow Stimulation……………………………...………………….5

Osteochondral Grafts…………………………………...…………………6

Autologous Chondrocyte Implantation……………………………………6

MSCs as a Cell Source for Chondrogenesis……………………………………7

Induction of in vitro Chondrogenesis………………………….………………..9

Role of MicroRNAs in Cartilage Development and Homeostasis…..……….12

MicroRNA Biogenesis…………………………………………...………13

Expression of microRNAs during chondrogenesis………………………15

MicroRNAs in articular cartilage…………………………………...……17

MicroRNAs in Osteoarthritis……………………………………….……18

RATIONALE...............................................................................................................................23

iv

CHAPTER 1 - MICRORNA-140 EXPRESSION DURING CHONDROGENIC

DIFFERENTIATION OF EQUINE CORD BLOOD DERIVED MESENCHYMAL

STROMAL CELLS……………………………………………………………………….……26

Introduction…………………………………………………..…………………………27

Materials and Methods…………………………………………………………………30

Study design…………………………………………………………………..….30

eCB-MSC isolation and culture….………………………………………………31

Chondrogenic differentiation………………………………………………….…31

Chondrocyte isolation………………………………………………………...….32

Histology and immunohistochemistry………………………………………...…32

RNA extraction, reverse transcription, qRT-PCR……………………………….33

Statistical analysis…………………………………………………………..……33

Results………………………………………………………………………………..….34

Chondrogenic differentiation of eCB-MSCs…………………………………….34

MicroRNA-140 expression in undifferentiated eCB-MSCs and equine articular

chondrocytes………………………………………………………………….….35

Expression of miR-140, Sox9 and miR-140 target genes during

chondrogenesis…………………………………………………………………...35

Discussion…………………………………………………………………………….…36

Tables…………………………………………………………………………………....42

Figures…………………………………………………………………………………...43

v

CHAPTER 2 - CHONDROGENIC DIFFERENTIATION OF EQUINE CORD BLOOD-

DERIVED MESENCHYMAL STROMAL CELLS IN MEMBRANE-BASED

CULTURES…………………………………………………………………………………..…47

Introduction…………………………………………………………………………..…48

Materials and Methods…………………………………………………………………50

Study design…………………………………………………………………..….50

eCB-MSC isolation and culture….…………………………………………..…..51

Chondrogenic differentiation………………………………………………...…..51

Histology and immunohistochemistry………………………………………..….52

Results ………………………………………………………………………...…...........52

Chondrogenic differentiation of pellets and membranes……………………...…52

Discussion……………………………………………………………………………….54

Figures………………………………………………………………………………..….58

CHAPTER 3 - THE EFFECT OF INFLAMMATORY STIMULI ON MICRORNA

EXPRESSION IN EQUINE CHONDROCYTES…………………………………………....61

Introduction………………………………………………………………………….….62

Materials and Methods…………………………………………………………………65

Study design………………………………………………………………...……65

Chondrocyte isolation, culture and treatment……………………………...…….65

RNA extraction, reverse transcription, qRT-PCR……………………………….66

Protein isolation and quantification………………………………………...……67

Statistical Analysis…………………………………………………………...…..67

vi

Results………………………………………………………………………………...…68

Decreased expression of cartilage markers………………………………………68

Increased expression of inflammatory markers……………………………….…68

MicroRNA expression…………………………………………………………...68

Expression of downstream targets……………………………………………….69

Discussion……………………………………………………………………………….69

Tables……………………………………………………………………………………75

Figures………………………………………………………………………………...…76

GENERAL DISCUSSION AND CONCLUSIONS…………………………………………..80

REFERENCES………………………………………………………………………………….89

APPENDICES……………………………………………………………………………..…..102

Screening of eCB-MSCs………………………………………………………………..102

Cell culture of equine cord-blood derived mesenchymal stromal cells…….………..…103

Cell Counting using Trypan Blue………………………………………………………107

Chondrogenic induction of MSCs – membrane and pellet protocols.……...….……….108

Tissue preparation for Histology and Immunohistochemistry.……………...………….111

Histology – Toluidine Blue and Hematoxylin and Eosin staining…………………….114

Immunostaining of cartilage/cartilage-like tissues…………………………………..…116

RNA isolation using mirVana miRNA isolation kit……………………………………120

RNA isolation using TRI Reagent ……………………………………………………..123

Reverse transcription using standard oligodT protocol…………………...……………125

Reverse transcription for microRNAs using TaqMan microRNA assays….…………..127

QPCR for messenger RNAs using SYBR Green……………………………………….129

vii

QPCR for microRNAs using TaqMan microRNA assays…………………………...…132

Chondrocyte isolation from articular cartilage…………………………………………135

Protein extraction from cells……………………………………………………………138

viii

ACKNOWLEDGEMENTS

I would like to express my immense gratitude to the many people who have contributed to my

graduate experience and without whom the completion of this program would not have been

possible.

I would like to thank my supervisors Drs. Thomas G. Koch and Jonathan LaMarre for taking me

under their wings when I first joined the Department of Biomedical Sciences. Their enthusiasm

and intellectual guidance have instilled in me a deeper appreciation for the sciences and a desire

for greater knowledge. I am grateful for their mentorship and unwavering support throughout

my master’s program. I am particularly indebted to Dr. Koch who encouraged me and facilitated

my transfer from the course-based MBS (Master of Biomedical Sciences) program to the thesis-

based M.Sc. program. Because of this choice, my first manuscript has been accepted for

publication in a peer-reviewed journal, I have had the amazing opportunity to spend three

months doing research in Copenhagen and present my research at the Nordic Orthopaedic

Federation (NOF) 56th

Congress in Estonia. Thank you for propelling me forward.

Many thanks to Dr. Lise C. Berg for welcoming me into the Department of Clinical Veterinary

and Animal Sciences at the University of Copenhagen and making me feel comfortable in the lab

during my stay in Denmark. It was a pleasure learning laboratory techniques, such as qRT-PCR

using the Lightcycler480, protein extraction and chondrocyte isolation under her tutelage. Her

ideas helped shape the third chapter of this thesis and I am grateful for her expertise, feedback

and support which have been instrumental in the completion of this thesis.

ix

Special thanks to Esther Semple, Erinne Barnett, Helen Coates, Ed Reyes, Michelle Ross and Dr.

Monica Antenos for teaching me many of the essential laboratory techniques and protocols

and/or for being excellent resources. Each one of you has been extremely helpful and supportive

during the past two years.

I would like to thank my fellow graduate students Carmon Co and Laurence Tessier for their

friendship and encouragement during trying times. It has been a pleasure procrastinating and

commiserating with you. Thank you for making my time in the lab (and out of the lab) even

more enjoyable!

None of this would have been possible without the love and support of my partner. I would like

to thank Rob for seeing me through highs and lows and always being there for me. Your

patience and understanding are deeply appreciated.

x

DECLARATION OF WORK PERFORMED

I declare that all work submitted for assessment of this thesis is my own work with the exception

of the items indicated below.

Equine cord blood-derived mesenchymal stromal cell isolation, cell line establishment and initial

cryopreservation were performed by Rajdeep Gill, Jacqueline Fountain and Dr. Thomas Koch.

Screening of adhesion proteins for the coating of the PTFE membranes was performed by Dr.

Koch. Primer pairs for equine Col II, Col X, CD-RAP, MMP-1, SAA and GAPDH were

designed and optimized by Dr. Lise Berg. Primer pairs for HDAC4 and Cxcl12 were designed

by Laurence Tessier, but optimized by me.

xi

LIST OF TABLES

Introduction

Table 1. MiRNAs involved in cartilage development and homeostasis…………………………22

Chapter 1

Table 1. Primer pairs used for qRT-PCR………………………………………………………...42

Chapter 3

Table 1. Primer pairs used for qRT-PCR……………………………………………………...…75

xii

LIST OF FIGURES

Introduction

Figure 1: Synovial joint morphogenesis: Interzone specification, formation and cavitation……..3

Figure 2: Schematic representation of the changes in morphology that occur during

chondrogenesis………………………………………………...…………………………………..4

Figure 3: MicroRNA biogenesis and mechanisms of miRNA-mediated repression……………14

Chapter 1

Figure 1: Study Design…………………………………………………………………………..30

Figure 2: Chondrogenic differentiation of eCB-MSCs…………………………………………..43

Figure 3: Gene expression of cartilage markers by eCB-MSC pellets cultured up to 21 days in

chondrogenic media……………………………………………………………………………...44

Figure 4: Expression of microRNA-140 (miR-140) in undifferentiated equine CB-MSCs and

articular chondrocytes……………………………………………………………………………45

Figure 5: Expression of miR-140, Sox9 and previously identified targets IGFBP5, CXCL12, and

ADAMTS5……………………………………………………………………………………….46

Chapter 2

Figure 1: Study design for in vitro chondrogenesis……..………………………………………50

Figure 2: Histology and immunostaining of chondrogenic differentiation in the membrane

culture system without 24 hour expansion step………………………………………………….58

Figure 3: Histological comparison of pellet cultures and membrane cultures with 24 hour

expansion step……………………………………………………………………………………59

Chapter 3

Figure 1: Study design for the isolation and treatment of equine articular chondrocytes……….65

xiii

Figure 2: Gene expression of cartilage markers…………………………………………………76

Figure 3: Gene expression of inflammatory markers……………………………………………77

Figure 4: Expression levels of microRNAs……………………………………………………...78

Figure 5: Gene expression of miR-140 and miR-146a downstream targets…………………......79

General Discussion and Conclusions

Figure 1: Schematic representation of biochemical reactions for RGD-coating on PTFE……....85

xiv

LIST OF ABBREVIATIONS

3-D Three dimensional

ABAM Anti-bacterial anti-mycotic

ACI Autologous chondrocyte implantation

ADAMTS A disintegrin and metalloproteinase with thrombospondin motifs

Ago-2 Argonaute-2

AIA Antigen induced arthritis

ALP Alkaline phosphatase

ANOVA Analysis of Variance

BM-MSC Bone marrow-derived multipotent mesenchymal stromal cell

BMP Bone morphogenic protein

BSA Bovine serum albumin

CB-MSC Cord blood-derived multipotent mesenchymal stromal cell

CD-RAP Cartilage-derived retinoic acid-sensitive protein

ChIP Chromatin immunoprecipitation

COL2A1 Collagen type IIA1

COMP Cartilage oligomeric matrix protein

CP Chondrogenic Potential

CTRL Control

CXCL12 Chemokine (C-X-C motif) ligand 12

DMEM Dulbecco’s modified eagle medium

ECM Extracellular matrix

FBS Fetal bovine serum

FGF Fibroblast growth factor

xv

FN Fibronectin

GAG Glycosaminoglycan

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

HDAC4 Histone deacetylase 4

HIF Hypoxia inducible factor

HRP Horseradish peroxidase

IGF Insulin growth factor

IGFBP Insulin growth factor binding protein

IL-1β Interleukin-1 beta

iNOS Inducible nitric oxide synthase

ITS Insulin transferrin selenium

LEF-1 Lymphoid enhancer binding factor-1

LPS Lipopolysaccharide

LRA Luciferase reporter assay

MACI Matrix-assisted autologous chondrocyte implantation

miR, miRNA MicroRNA

MMP Matrix metalloproteinase

MSC Multipotent mesenchymal stromal cell

mRNA Messenger RNA

NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells

NSAIDs Non-steroidal anti-inflammatory drugs

OA Osteoarthritis

PBS Phosphate buffered saline

Pri-miRNA Primary microRNA

PPARα Peroxisome proliferator-activated receptor α

xvi

PTFE Polytetrafluoroethylene

PTHrP Parathyroid hormone related protein

qPCR Quantitative real-time polymerase chain reaction

RISC RNA induced silencing complex

Runx2 Runt-related transcription factor 2

SAA Serum amyloid A

SBE Smad binding element

SCID Severe combined immunodeficiency

SEM Standard error of mean

Smad Mothers against decapentaplegic homolog

Sox Sex determining region Y box

Sp1 Specificity protein 1

TGFβ Transforming growth factor beta

TLR Toll-like receptor

TNFα Tumour necrosis factor alpha

TUNEL Terminal deoxynucleotidyl transferase dUTP nick end labeling

UTR Untranslated region

VEGF Vascular endothelial growth factor

WMISH Whole mount in situ hybridization

1

INTRODUCTION

Cartilage is a flexible connective tissue, consisting of extracellular matrix (ECM) interspersed

with chondrocytes. There are three types of cartilage; elastic, fibrous and hyaline, which differ

in their relative composition of collagen fibers, proteoglycans and elastin. Elastic cartilage is

found in the epiglottis and the outer ear and its many elastin networks allow for great flexibility.

Fibrocartilage has excellent tensile strength due to the thick, parallel bundles of collagens type I

and II and is normally found in the intervertebral discs, pubic symphysis and meniscus.

However, the focus of this thesis will be restricted to hyaline cartilage, more specifically, the

articular cartilage that is found on the surfaces of articulating bones and allows for near

frictionless movement. Resident articular chondrocytes produce and maintain an extensive ECM

consisting of collagens and proteoglycans. Collagen type II is the main component of articular

cartilage and provides support and tensile strength to the tissue (Basser et al., 1998).

Proteoglycans, such as aggrecan, are highly hydrated due to the high level of glycosylation of the

core protein. This hydration confers the cartilage with the capacity to withstand load bearing and

absorb shock (Hardingham & Fosang, 1992). Articular chondrocytes retain a stable phenotype

and resist hypertrophy, calcification, apoptosis and vascular invasion, however the mechanisms

by which they maintain their phenotype remain largely unknown.

Natural cartilage development

Synovial Joint Formation

Synovial joints, also known as diarthrosis, allow for movement at the point of contact of

articulating bones and the distribution of biomechanical loads through the structure. They are

2

characterized by the presence of articular cartilage on opposing bony surfaces and lubricating

synovial fluid. The synovial joints are formed concomitantly with the skeletal elements. During

embryonic development, the transient cartilage that provides a framework for endochondral bone

formation and the permanent cartilage that protects the surfaces of articulating bones, both arise

from the mesenchymal progenitor cells of the blastema. The process is initiated by the

aggregation and condensation of mesenchymal cells, which favours cell-cell and cell-matrix

interactions important for triggering signal transduction pathways leading to chondrogenic

differentiation (Fig. 1). The formation and growth of the condensations are regulated by many

factors including homeobox (Hox) transcription factors, bone morphogenic proteins (BMPs),

fibroblast growth factors (FGFs) and Sonic hedgehog (Shh; Chen et al., 2009). The first

indication of synovial joint development is the formation of the interzone, where mesenchymal

cells become flattened and form a region of high cell density within the condensation. Joint

formation is thought to be initiated by Wnt/β-catenin signalling, which leads to the induction of

growth/differentiation factor 5 (GDF5), BMP family member (Guo et al., 2004). The interzone

evolves into a three-layered interzone. The cells of the central zone eventually disappear,

forming the joint cavity and although the mechanisms responsible are not fully elucidated,

programmed cell death and physical changes in the ECM are thought to be involved (DeBari et

al., 2010). The remaining zones are thought to form the articular cartilage covering the adjacent

bones (Araldi & Schipani, 2010) as well as periarticular and intraarticular joint structures (Fig.1)

(Rountree et al., 2004; Koyama et al., 2008).

3

Figure 1: Synovial joint morphogenesis: Interzone specification, formation and cavitation.

Within the mesenchymal condensation, an interzone of flattened cells appears. This evolves into

a three-layered interzone; the central layer undergoes cavitation, resulting in the formation of the

joint cavity, while the outer layers develop to form the articular cartilage, peri- and intra-articular

structures (Khan et al., 2007).

Endochondral Ossification

Concomitantly with synovial joint formation, the adjacent mesenchymal cells undergo

morphological changes, losing their processes to take on a rounded morphology (Fig. 2). They

begin to express SRY-related high-mobility-group box 9 (Sox9), a key transcriptional regulator

in early chondrogenesis. Along with Sox5 and Sox6, Sox9 regulates cartilage development by

activating the expression of collagen type 2, aggrecan and cartilage oligomeric matrix protein

(COMP; Huang et al., 2001; Ng et al., 1997). The expression of these cartilage-specific genes

leads to chondrocyte maturation and extracellular matrix (ECM) production (Lefebvre & Smits,

2005). The proliferating and pre-hypertrophic chondrocytes elongate the cartilage template

before undergoing cell cycle arrest and becoming hypertrophic. Hypertrophic chondrocytes are

4

defined by an increase in size and the expression of collagen type X, alkaline phosphatase

(ALP), matrix metalloproteinase 13 (MMP-13) and runt-related transcription factor 2 (Runx2).

These changes are associated with matrix mineralization (Kim et al., 2010). The expression of

vascular endothelial growth factor (VEGF) then stimulates vascular invasion, which facilitates

the replacement of the mineralized cartilage by bone through the migration of osteoclasts and

osteoblasts (Carlevaro et al., 2000). The terminally differentiated chondrocytes either

transdifferentiate towards osteoblasts or undergo apoptosis (Adams & Shapiro, 2002).

Figure 2. Schematic representation of the changes in morphology that occur during

chondrogenesis. The red box indicates the crucial step wherein the chondrocytes either maintain

their phenotype (articular chondrocytes) or progress towards hypertrophy and terminal

differentiation (Modified from Gadjanski et al., 2012).

These ossification events begin at a site known as the primary ossification centre, located in the

centre of the diaphysis (shaft), and then spread along the diaphysis. Secondary ossification

centres later appear at either end (epiphysis) of the developing long bone. The cartilage between

the primary and secondary ossification centre is known as the epiphyseal plate or ‘growth’ plate,

since this site is responsible for post-natal interstitial bone growth. Eventually, the cartilage of

the epiphyseal plate is also replaced by bone, forming a line where the primary and secondary

5

ossification centres meet. The articular cartilage however, can normally resist ossification and

maintain a stable phenotype.

Current treatments for articular cartilage defects

Cartilage defects can arise as a result of trauma or inflammation and, left untreated, can continue

to deteriorate and lead to osteoarthritis (Wang et al., 2006). Articular cartilage has a limited

healing response due to the avascular nature of the tissue and the extensive ECM which prevents

cell migration to the injury site. There are several surgical techniques aimed at restoring the

articular surface, reducing pain and increasing mobility. Focal cartilage injuries in humans are

currently treated by debridement, bone marrow stimulation, autologous chondrocyte

implantation or osteochondral grafts depending on the size and severity of the defect (Williams

et al., 2010).

Bone Marrow Stimulation

During bone marrow stimulation, the damaged articular cartilage is debrided to expose the

subchondral bone which can then be penetrated by one of the following techniques; arthroscopic

abrasion, drilling or microfracture (Ahmed & Hincke, 2010). The penetration of the bone

releases blood and marrow into the defect to form a fibrin clot. The theory is that the marrow

contains chondroprogenitors that will differentiate and repair the lesion. Although these

techniques may offer some pain reduction (Nehrer & Minas, 2000), the long term results are

largely dependent on patient age and size of the defect. One of the major limitations of bone

marrow stimulation is that the repair tissue consists of fibrocartilage, a biomechanically inferior

tissue compared with articular cartilage, that can deteriorate over time. Additional drawbacks

6

include incomplete filling and bone formation in the defect site (Steinwachs et al., 2008). The

cause of this inadequate repair is not fully understood but speculations are that the number of

MSCs released may be insufficient to stimulate full repair or that the MSCs may require

additional growth factors to differentiate fully. Moreover, the inferior long-term results in older

patients could be attributed to the decreased proliferative capacity and differentiation potential of

adult stem cells (Stenderup et al., 2003).

Osteochondral Grafts

Cartilage transfer procedures involve the transplantation of healthy sections of bone and cartilage

to the damaged area. Cylindrical osteochondral plugs are harvested from low weight bearing

areas and inserted into recipient holes in the affected part of the joint. As the subchondral bone

is penetrated during this procedure, the spaces between the grafts are filled with fibrocartilage,

while the donor sites are filled by cancellous bone covered in fibrocartilage (Hangody et al.,

2008). Although this method can restore the articular surface, the limited availability of

autologous osteochondral plugs can limit the repair of large defects. Additional concerns include

donor site morbidity, risk of infection and lack of integration between the plugs and the

surrounding cartilage (Ahmed & Hincke, 2010).

Autologous Chondrocyte Implantation

The clinical procedure known as autologous chondrocyte implantation (ACI) or matrix-assisted

ACI (MACI) involves the introduction of in vitro expanded chondrocytes into the defect site and

has been used to treat cartilage defects with relative success (Brittberg et al., 1994; Knutsen et

al., 2004; Ebert et al., 2011). However, this repair strategy requires a preliminary surgery to

7

harvest chondrocytes from a low weight bearing area of the articular cartilage, which causes

donor site morbidity and may result in further degenerative changes (Lee et al., 2000). Due to

the limited amount of tissue available and the low proliferative capacity of chondrocytes,

prolonged expansion is required to obtain sufficient numbers of cells. Furthermore,

chondrocytes tend to lose their chondrocytic features during expansion in a process known as

dedifferentiation (von der Mark et al., 1977), which may be responsible for the formation of

fibrous rather than hyaline tissue in the joint following ACI/MACI (Saris et al., 2008).

Improvement of the MACI approach through the application of different biomaterials and

alternative cell sources may help overcome the limitations of current cartilage repair modalities.

Mesenchymal stromal cells as a cell source for chondrogenesis

Mesenchymal stromal cells are a promising cell source for the treatment of articular cartilage

defects because they eliminate the need to harvest healthy cartilage and they can be rapidly

expanded to generate large numbers of cells. They are multipotent and given the appropriate

culture conditions, can be differentiated into bone, cartilage, muscle or adipose tissue (Baksh et

al., 2004). MSCs can be isolated from many sources such as adipose tissue, bone marrow,

synovial membrane and umbilical cord blood (Zuk et al., 2002; Castro-Malaspina et al., 1980;

De Bari et al., 2001; Lee et al., 2004). Although many comparative studies have been

undertaken, no consensus has been reached on the optimal MSC source for cartilage tissue

engineering.

The therapeutic use of human MSCs is not widely practiced, however MSCs derived from

equine bone marrow (BM-MSC) are currently used to treat horses with musculoskeletal injuries.

8

These equine cell-based therapies are primarily used to treat tendon and ligament injuries at this

time (Guest et al., 2008; Pacini et al., 2007; Smith et al., 2003) but the use of MSC in equine

cartilage repair is gaining significant interest. Most studies are restricted to in vitro work,

however Wilke et al. (2007) provides an example of an in vivo study of the effect of MSC

implantation on cartilage healing in an equine model. They induced cartilage lesions in the

femoropatellar joints of six horses and treated them with an autologous fibrin vehicle containing

culture-expanded BM-MSCs or with autologous fibrin alone as a control. An arthroscopic

examination 30 days after treatment revealed that the BM-MSC treated defects were significantly

improved; the repair tissue was thicker and more homogeneous compared to the controls. These

results were not sustained 8 months after treatment, at which point no difference was observed

between groups. Whether the initial improvement in healing response was MSC-mediated is

uncertain, however, MSCs do not harbour unlimited proliferative capacities in vitro therefore

death or metabolic inactivation of the MSCs may account for the lack of sustained improvement

(Kern et al., 2006).

Although BM-MSCs are the best-characterized, cord blood-derived MSCs (CB-MSCs) may

offer several advantages. The collection of bone marrow is an invasive procedure and the

proliferative capacities and differentiation potential decline with increasing age (Stenderup et al.,

2003). In contrast, umbilical cord blood can be obtained by a non-invasive method (Rubinstein et

al., 1993; Koch et al., 2007) and studies on both human and equine CB-MSCs have revealed

higher replicative potential and broader potency compared to BM-MSCs (Kern et al., 2006;

Kogler et al., 2006; Koch et al., 2007). In particular, human and equine CB-MSCs are reported

to be more chondrogenic than bone marrow and adipose tissue derived-MSCs (Berg et al., 2009;

9

Zhang et al., 2011). Despite the apparent superiority of CB-MSCs, little data regarding their

performance in vivo is available. However, a phase III clinical trial using the recently approved

allogeneic-unrelated umbilical cord blood-derived mesenchymal stem cell product known as

CartiStem® was recently completed (ClinicalTrials.gov Identifier NCT01041001). This study

compared the safety and efficacy of CB-MSC administration to microfracture treatment in

patients with articular cartilage lesions of the knee. Although a peer-reviewed paper has not yet

been published, Nature Medicine reported that improvement in knee mobility was 26% percent

higher in the cell treated group (CartiStem®) compared to the control group treated by

microfracture alone (Wohn, 2012).

Induction of in vitro chondrogenesis

Chondrogenic differentiation of MSCs has traditionally been induced by applying three-

dimensional (3-D) culture conditions and including transforming growth factor-β (TGF-β) and

dexamethasone in the media, as described by Johnstone and colleagues in 1998. In the

micromass pellet culture system, MSCs are centrifuged into pellets in polypropylene tubes,

resulting in the formation of cell aggregates. The use of polypropylene is crucial because the

cells form aggregates in favor of cell-cell interactions rather than adhering to the substrate.

However, the micromass pellet culture system is primarily used to study in vitro chondrogenesis

rather than use the differentiated cells for biological repair. In fact, only 250 000 - 500 000 cells

are seeded to form the cell aggregates and increasing pellet size can result in cell necrosis in the

center of the aggregate (Ebisawa et al.., 2004). Although immunohistochemistry of the pellets in

several reports indicate successful differentiation through collagen type II and sulfated

glycosaminoglycan (GAG) staining, it is often heterogeneous and accompanied by expression of

10

collagen type I, which is characteristic of fibrous tissue, and collagen type X, which is typical of

terminal differentiation of hypertrophic chondrocytes (Steck et al., 2005; Nelea et al., 2005).

Lee and colleagues have recently developed a protocol in which ovine BM-MSCs are

differentiated towards a chondrogenic fate on collagen IV-coated polytetrafluoroethane

membrane inserts. They reported that GAG and collagen content was similar in pellet and

membrane-based cultures. Hypertrophic markers Runx2 and collagen X were expressed in both

culture types however, the expression level of collagen type I mRNA was significantly lower in

membrane cultured cells compared to pellet cultures (Lee et al., 2011).

A plethora of other differentiation protocols have been developed in an attempt to optimize in

vitro cartilage engineering. Different cocktails of exogenous anabolic factors have been applied

with variable results. For instance, TGF-β3 in combination with BMP-2, -4 or -6 improved

chondrogenesis of human BM-MSCs compared to TGF-β3 alone. BMP-2 induced the most

significant improvement, as evidenced by increased size and weight of pellets and positive

staining for collagen II and proteoglycans (Sekiya et al., 2005). In a similar study, the addition

of parathyroid hormone related protein (PTHrP) to TGF-β2 increased GAG content and

expression of collagen II mRNA and protein, while decreasing the expression of collagens I and

X and Runx2 (Kim et al., 2008). Monolayer expansion of MSCs in media containing fibroblast

growth factor 2 (FGF-2) is thought to extend the proliferative lifespan of MSCs and enhance

chondrogenesis once differentiation is induced (Solchaga et al., 2010).

Another important factor influencing chondrogenic differentiation is oxygen tension. In general

in vitro engineered cartilage tissues are cultured in a 20% oxygen environment even though the

11

physiological environment in which articular cartilage resides is hypoxic; approximately 1-7%

O2 (Silver et al., 1975; Kellner et al., 2002). Several studies have reported that hypoxic

conditions enhance chondrogenesis of bone marrow derived-MSCs (Khan et al., 2010; Markway

et al., 2010), an effect that is thought to be mediated by hypoxia inducible factor-1α (HIF-1α:

Kanichai et al., 2008). A study using chromatin immunoprecipitation (ChIP) demonstrated that

HIF-1α may promote chondrogenesis by binding to a hypoxia response element in the promoter

region of Sox9 (Amarilio et al., 2007).

Additional protocols include MSC co-culture with articular chondrocytes (Ahmed et al., 2007;

Chen et al., 2009), the use of biomaterials such as alginate and agarose (Vinatier et al., 2009),

chondrogenic growth factor delivery via gene transfer (Palmer et al., 2005; Steinert et al., 2008)

and mechanical stimulation using bioreactor systems (Grad et al., 2011). Chondrogenic

differentiation techniques aim to increase the expression and production of ECM components

and prevent the upregulation of hypertrophy-associated markers such as MMP-13, collagen X,

Runx2 and activity of ALP. A study by Pelttari et al. (2006) demonstrated that premature

induction of hypertrophy in vitro leads to matrix calcification and vascular invasion of BM-MSC

pellet cultures following ectopic transplantation into severe combined immunodeficiency (SCID)

mice. However, when articular chondrocytes were subjected to the same conditions, they formed

stable cartilage. This suggests that there are inherent differences between articular and MSC-

derived chondrocytes that need to be characterized in order to develop protocols that can

generate a stable differentiated phenotype in vitro and in vivo.

12

The role of microRNAs in cartilage development and homeostasis

MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs, approximately 20-25

nucleotides in length, which are potent regulators of gene expression. These molecules are

thought to be involved in regulating at least one third of all mammalian genes (Lewis et al.,

2005). MiRNAs function at the post-transcriptional level by binding to complementary

sequences in the 3’-untranslated region (3’-UTR) of target mRNAs and inhibiting their

expression, either by blocking translation or by inducing mRNA degradation. Thus, microRNAs

are directly involved in regulating cellular phenotype (Bartel, 2004).

The first microRNA was discovered in 1993, when two independent studies using

Caenorhabditis elegans found that the Lin-14 protein, which is essential for cell lineage

patterning during larval development, was negatively regulated by a short untranslated RNA

fragment within the lin-4 gene (Lee et al., 1993; Wightman et al., 1993). Upon closer

examination, researchers found that this RNA fragment was complementary to a sequence in the

3’UTR of lin-14 and suggested that an antisense RNA-RNA interaction inhibited the translation

of lin-14. This phenomenon was originally thought to be nematode specific and it was not until

2001 that the importance of these discoveries was revealed when a number of small RNAs with

similar regulatory potential was identified in both vertebrates and invertebrates, thus the term

‘microRNA’ was coined (Lagos-Quintana et al., 2001). Numerous studies have since shown that

they are important regulators of various biological processes such as differentiation, development

and tumorigenesis (Chen et al., 2003; Krichevsky et al., 2006; Nicoloso et al., 2009).

13

MicroRNA biogenesis

In order to generate mature single-stranded miRNAs, multiple processing steps are required (Fig.

3). Long primary transcripts known as pri-miRNAs, are generally transcribed by RNA

polymerase II and can originate from genes, polycistronic clusters or intronic regions (Winter et

al., 2009). The classical miRNA originates from a small gene within an intergenic region and

can be regulated through its promoter. However, a number of miRNAs can be found in

polycistronic units or ‘miRNA clusters’, where a single transcript contains multiple miRNA

precursors (Lagos-Quintana et al., 2001). MiRNA genes or clusters form stem-loop

conformations for each miRNA due to the sequence complementarity within the arm of the stem.

The RNAse III known as Drosha acts in concert with DGCR8 (DiGeorge Critical Region 8) to

cleave the pri-miRNAs and produce small hairpin structures termed pre-miRNAs. Additionally,

many miRNAs are derived from intronic regions of messenger RNAs, in which case they are

regulated and transcribed together with their host gene. The mechanism of intronic miRNA

processing is not clear but pre-miRNA cleavage is thought to involve a functional association

between Drosha and the spliceosome (Kataoka et al., 2009).

14

Figure 3. MicroRNA biogenesis and mechanisms of miRNA-mediated repression. (1) Primary

transcripts are transcribed by polymerase II from genes (2a), polycistronic clusters (2b), or

introns (2c). The pre-miRNA is cleaved from the pri-miRNA by Drosha (2a,b) or through a

spliceosome-Drosha interaction (2c). Pre-miRNA are transported to the cytoplasm by exportin-5

(3). The stem-region is cleaved by Dicer (4) forming a miRNA duplex (5). The guide strand

associates with the RISC (6) and anneals to the 3’UTR of target genes (7) to either repress

translation (8a) or induce mRNA degradation. (Araldi & Schipani, 2010).

Once released, the pre-miRNAs are recognized by Exportin5 and exported from the nucleus into

the cytoplasm through the nuclear pore complex. The cytoplasmic RNAse III, Dicer, cleaves the

15

loop region of the hairpin to generate a short RNA duplex which contains the miRNA guide

strand as well as the passenger strand, denoted by an asterisk (miRNA*). Although either strand

can act as a functional miRNA, it is normally the strand with the less thermodynamically stable

5’ end that becomes incorporated into the RNA-induced silencing complex (RISC; Du &

Zamore, 2005), while the other is degraded. Once the miRNA:RISC binds to a target mRNA,

gene silencing can occur either by blocking translation or by inducing transcript degradation.

The outcome is thought to depend on the degree of mismatch between the microRNA and the

target mRNA, with degradation being the result of best-matched targets.

Expression of microRNAs during chondrogenesis

The first indication that microRNAs may be involved in chondrogenesis was provided by

Wienholds et al. (2005). Using whole mount in situ hybridization reactions (WMISH), they

showed that most conserved vertebrate microRNAs are expressed in a tissue-specific manner in

zebrafish embryos and they revealed that miR-140 is only expressed in cartilaginous tissue. This

expression pattern of miR-140 was also shown in mouse embryos and histone deacetylase 4

(HDAC4) was identified as a target (Tuddenham et al., 2006). As HDAC4 is a known co-

repressor of Runx2, its suppression by miR-140 may promote chondrocyte hypertrophy and

osteoblast differentiation during skeletal development. Further evidence of the crucial role of

microRNAs during chondrogenesis was provided by a study in which Dicer, an

endoribonuclease required for microRNA processing, was knocked out in the cartilage of mice

(cKO). As a result, the proliferating pool of chondrocytes was reduced and hypertrophic

differentiation was accelerated, causing severe growth defects and premature death of the mice

(Kobayashi et al., 2008). Abundant expression of miR-140 was detected in the chondrocytes of

16

the control mice compared to the cKO mice, however the effect of its reduction on the phenotype

of the cKO mice is unclear since a global miRNA deficiency was induced.

In order to further characterize the role of miR-140 during chondrogenesis and skeletal

development, Kobayashi and colleagues generated miR-140 null mice. These mice reached

adulthood but exhibited growth retardation and skeletal defects, which were attributed to

accelerated hypertrophic differentiation, since no alteration in proliferation of chondrocytes was

detected. Using argonaute-2 immunoprecipitation (Ago2-IP), Ago-2 being the catalytic

component of the RISC that binds miRNAs and consequently their target genes, Dnpep (aspartyl

aminopeptidase) was identified as a miR-140 target because its mRNA levels were enriched in

wild type chondrocytes compared to miR-140 null chondrocytes. They found that Dnpep

overexpression had an antagonist effect on BMP signalling and proposed that the skeletal defects

of miR-140 null mice were due in part to reduced BMP signalling caused by Dnpep upregulation

(Nakamura et al., 2011).

Several reports have demonstrated that miR-140 expression increases during in vitro

chondrogenesis (Miyaki et al., 2009; Yang et al., 2011), therefore in vitro studies have been used

to elucidate microRNA targets during chondrogenic differentiation. A key transcription factor in

the TGF-β signalling pathway, Smad3, was identified as a direct target of miR-140.

Overexpression and knockdown of miR-140 in a murine MSC line showed that Smad3 mRNA

was unaffected by miR-140 manipulation but Smad3 protein levels were decreased in cells

treated with a miR-140 mimicking siRNA, while they were increased in response to antimiR-

140, revealing that Smad3 is regulated at the protein level. Direct binding of miR-140 to the

17

3’UTR of Smad3 was confirmed by luciferase reporter assay (LRA; Pais et al., 2010).

Specificity protein 1 (Sp1), which is a transcription factor that inhibits the cell cycle, was also

shown to be directly regulated by miR-140 through translational repression. Thus, miR-140 may

be implicated in the maintenance of chondrocyte proliferation by repressing Sp1 (Yang et al.,

2011). In the same study, miR-140 was found to be co-expressed with its host gene, Wwp2-C,

and directly induced by Sox9, the master transcriptional regulator of chondrogenesis (Yang et al.,

2011).

Another microRNA that has been associated with chondrogenesis is miR-145. While other

studies have identified a role for this microRNA in embryonic stem cell differentiation (Xu et al.,

2009) and vascular smooth muscle cell maintenance (Xin et al., 2009; Elia et al., 2009), recent

reports have demonstrated that miR-145 expression decreases during chondrogenic

differentiation of human and murine MSCs. Interestingly, both studies identified Sox9 as a

target of miR-145, albeit through different binding sites in the 3’UTR (Yang et al., 2011;

Martinez-Sanchez et al., 2012). Knocking down miR-145 was reported to increase the

expression of cartilage ECM genes COL2A1 and aggrecan and decrease the levels of

hypertrophic markers RUNX2 and MMP13 (Martinez-Sanchez et al., 2012), making miR-145 an

attractive target in cartilage tissue engineering. Many additional microRNAs have been

identified as having a role in chondrogenesis and can be found in Table I.

MicroRNAs in articular cartilage

The identification of abundantly expressed microRNAs in articular cartilage suggests an

important role for microRNAs in cartilage homeostasis. MicroRNA microarray revealed that the

18

largest difference in expression between human BM-MSCs and articular chondrocytes was

exhibited by miR-140 (Miyaki et al., 2009). In another study, genome-wide profiling comparing

healthy primary human chondrocytes and dedifferentiated chondrocytes showed that H19, a

primary miRNA transcript for miR-675 (Cai & Cullen, 2007), was highly abundant. Collagen

type II gene expression was found to be upregulated by miR-675, possibly through a de-

repression mechanism (Dudek et al., 2010). Mechanical stimulation is essential for chondrocyte

differentiation and cartilage homeostasis. In order to identify miRNAs that may be involved in

mechanical stress response, microRNA expression profiles were determined in the articular

cartilage of regions with differing mechanical loading conditions. MiR-221 and miR-222 were

up-regulated in the weight-bearing anterior medial condyle compared with the non-weight-

bearing posterior medial condyle, suggesting that these miRNA species may be regulators of an

articular cartilage mechanotransduction pathway (Dunn et al., 2009). Guan et al. (2011)

identified miR-365 as a mechanosensitive miRNA by screening primary chicken chondrocytes

before and after cyclic loading. Chondrocyte proliferation and differentiation towards a

hypertrophic phenotype was stimulated by miR-365, an effect that was proposed to be mediated

by direct repression of its target, HDAC4.

MicroRNAs in osteoarthritis

Osteoarthritis (OA) is a highly prevalent degenerative joint disease that affects both horses and

humans (Lacourt et al., 2012). Although the pathogenesis underlying the disease is poorly

understood, it is generally accepted that cartilage degradation stems from an imbalance between

anabolic and catabolic factors. The development and progression of OA are believed to be

mediated by secreted proinflammatory cytokines, particularly interleukin (IL)-1β and tumour

19

necrosis factor (TNF). They are elevated in OA synovial fluid, synovial membrane, subchondral

bone and cartilage and suppress the expression of cartilage ECM components, while stimulating

the release of matrix metalloproteinases (Kapoor et al., 2011). In a study by Asahara and

colleagues, the expression of miR-140 was significantly reduced in OA articular cartilage

compared to normal cartilage and in vitro treatment of normal chondrocytes with IL-1β

suppressed miR-140 expression. They reported that expression of the aggrecanase, Adamts5 (a

disintegrin and metalloproteinase with thrombospondin motifs 5), is regulated by miR-140 since

its IL-1β-induced upregulation was abrogated by the introduction of a double stranded miR-140

mimic (ds-miR-140; Miyaki et al., 2009). More recently, the same group generated miR-140

null mice. The miR-140-/-

mice exhibited a short stature and craniofacial deformities that were

attributed to a reduction in proliferating chondrocytes. Articular cartilage of these mice appeared

normal at 1 month, however they developed age-related OA changes such as proteoglycan loss

and fibrillation of articular cartilage by 12 months. Cartilage-specific transgenic mice

overexpressing miR-140 were also generated and were found to be resistant against the antigen

induced arthritis (AIA) model. Both Adamts5 mRNA and protein were upregulated in the

articular cartilage of miR-140-/-

mice compared to wild-type mice and Adamts5 gene expression

was repressed in miR-140 null chondrocytes treated with ds-miR-140, suggesting negative

regulation by miR-140. Luciferase reporter assay indicated that miR-140 directly targets

Adamts5 through a miR-140 binding site in its 3’UTR. Thus the protective role of miR-140 in

OA pathology was speculated to be mediated by Adamts5 repression (Miyaki et al., 2010).

Insulin growth factor binding protein 5 (IGFBP5) is another putative target of miR-140.

Transfection of human OA chondrocytes with pre-miR-140 caused decreased IGFBP5

20

expression, while anti-miR-140 cause increased expression. Since these results were observed

24 hours post-treatment, direct regulation of IGFBP5 by miR-140 was suggested although

3’UTR LRA was not performed (Tardif et al., 2009). The role of IGFBP5 in cartilage

homeostasis is unclear but is thought to regulate the availability of insulin growth factor 1 (IGF-

1). Treatment of human chondrocytes with IL-1β increased the expression of MMP-13 and miR-

140, an effect that was abrogated by inhibition of NF-κB. MMP-13 was identified as a direct

miR-140 target by LRA and anti-miR-140 transfection caused elevated MMP-13 expression in

the IL-1β stimulated cells (Liang et al., 2012). The increased expression of miR-140 in response

to IL-1β stimulation conflicts with a previous report where miR-140 was downregulated by IL-

1β (Miyaki et al., 2009). This inconsistency could be due to differences in passage number,

cytokine concentration and treatment duration. Whether decreased miR-140 expression in OA

chondrocytes (Miyaki et al., 2009; Tardif et al., 2009; Iliopoulos et al., 2008) is due to elevated

proinflammatory cytokines is yet to be determined.

Another miRNA that has recently emerged in OA pathology is miR-146a. A study by Yamasaki

and colleagues demonstrated that miR-146a is highly expressed in cartilage from patients with

mild OA and that expression decreases with severity. They also established that IL-1β induces

miR-146a in normal human articular chondrocytes (Yamasaki et al., 2009). In a subsequent

study miR-146a was overexpressed in IL-1β stimulated rat chondrocytes and in a surgical model

of OA. Its overexpression was accompanied by upregulation of VEGF and repression of Smad4,

an important mediator of the TGFβ signalling pathway. Smad4 was determined to be a direct

target of miR-146a that is regulated both by mRNA degradation and translational repression.

Transfection of miR-146a into chondrocytes induced apoptosis as indicated by an increase in

21

percentage of TUNEL positive cells. Thus, miR-146a may contribute to several hallmarks of

OA; impaired TGFβ signalling, pathological vascularization and reduced cellularity of articular

cartilage due to chondrocyte apoptosis (Li et al., 2012). Additional miRNAs have been

associated with OA and can be found in Table I.

Cartilage regeneration remains a clinical challenge because of its limited healing response. More

and more miRNAs with roles in cartilage development and homeostasis are being identified and

a better understanding of the molecular mechanisms at play will have profound implications for

cartilage repair and OA treatments. Despite the increasing interest in miRNA function in

cartilage biology, there appear to be no reports on microRNA expression in equine MSCs or

chondrocytes.

22

Table I. MiRNAs involved in cartilage development and homeostasis

miRNAs Targets Function of target Reference

miR-140 HDAC4 Inhibition of chondrocyte hypertrophy Tuddenham et al., 2006

CXCL12 Role in BMP-2 signalling Nicolas et al., 2008

IGFBP5 Regulates availability of IGF-1 Tardif et al., 2009

ADAMTS5 Aggrecan degradation Miyaki et al., 2010

SMAD3 TGFβ signalling Pais et al., 2010

DNPEP Inhibition of BMP signalling Nakamura et al., 2011

SP-1 Chondrocyte proliferation Yang et al., 2011

MMP-13 Collagen degradation Liang et al., 2012

miR-145 SOX9 Chondrogenic differentiation Yang et al., 2011

SOX9 Chondrogenic differentiation Martinez-Sanchez et al.,

2012

miR-199a* SMAD1 TGFβ signalling Lin et al., 2009

miR-221 MDM2 Chondrocyte proliferation Kim et al., 2010

miR-337 TGFBR2 TGFβ signalling Zhong et al., 2012

miR-449a LEF-1 Repression of chondrogenesis (↓ Sox9) Paik et al., 2012

miR-455-3p ACVR2B

SMAD2

Potential modulator TGFβ signalling

TGFβ signalling

Swingler et al., 2011

miR-18a CCN2 Role in stimulation of ECM production Ohgawara et al., 2009

miR-675 COL2A1 ECM component Dudek et al., 2010

miR-222 N.I. TBD (role in mechanosensitivity) Dunn et al., 2009

miR-365 HDAC4 Inhibition of chondrocyte hypertrophy Guan et al., 2011

miR-146a SMAD4 TGFβ signalling Li et al., 2012

miR-22 BMP7

PPARα

Regulation of IL-1β and MMP13

Regulation of IL-1β and MMP13

Iliopoulos et al., 2008

miR-27b MMP-13 Collagen degradation Akhtar et al., 2010

miR-34a COL2A1

iNOS

ECM component

Chondrocyte apoptosis

Abouheif et al., 2010

N.I. not identified

23

RATIONALE

Orthopaedic injuries involving the joint cartilage are some of the most common causes of

lameness in racehorses (Bailey et al., 1999). Articular cartilage repair remains a clinical

challenge due to the poor regenerative capacities of the tissue. Current procedures are primarily

palliative, none of which are capable of reversing injuries to this tissue. A number of different

stem cell-based therapies have considerable potential in the treatment of joint injuries. In

particular, mesenchymal stromal cells (MSCs) have been regarded as a promising cell source to

improve the quality of cartilage repair because of their ability to self-renew and differentiate into

various lineages. In fact, the use of bone marrow-derived MSCs (BM-MSCs) for the treatment

of equine orthopaedic injuries is increasing, but is primarily directed toward the repair of

ligaments and tendons at this time (Fortier & Smith, 2008). One key challenge of using stem

cells to repair damaged cartilage is the induction of a stable chondrocyte phenotype without

terminal differentiation. Current in vitro differentiation protocols have successfully induced cells

with chondrocyte-like morphology, production of extracellular matrix and expression of

cartilage-specific markers including collagen II, aggrecan and SOX9. However, these features

are often accompanied by markers of fibrous tissue such as collagen I, and/or markers of

hypertrophy such as collagen X (Johnstone et al., 1998).

One approach that may reduce the expression of fibrous and hypertrophic markers, and increase

the expression of cartilage-specific markers, is the use of a membrane culture system rather than

the traditional pellet culture system. On coated cell culture inserts 2 million cells can be seeded

for differentiation instead of 250 000 – 500 000. Additionally, this system may provide a more

24

homogeneous environment for the cultures by reducing the surface tension and nutrient gradients

compared to pellets.

Another parameter that could improve the outcome of in vitro chondrogenesis is the MSC

source. Although BM-MSCs are most commonly used, MSCs can be isolated from a number of

other sources including adipose tissue, synovial membrane and umbilical cord blood (Zuk et al.,

2001; De Bari et al., 2001; Lee et al., 2004). Cord blood is an attractive alternative MSC source

to bone marrow because of its superior multipotency, proliferative capacity and ease of

acquisition (Kern et al., 2006; Kogler et al., 2006; Koch et al., 2007). Additionally, human and

equine studies suggest that CB-MSCs are more chondrogenic than bone marrow and adipose

tissue derived-MSCs (Berg et al., 2009; Zhang et al., 2011). Therefore, equine CB-MSCs (eCB-

MSCs) were selected as the MSC source in this study.

In order to address the challenges posed by articular cartilage injury and degeneration, it is

important to elucidate the molecular mechanisms at play during chondrogenic differentiation and

pathological processes. Novel post-transcriptional regulators known as microRNAs have

recently emerged as important regulators and fine-tuners of gene expression. They are involved

in many biological processes including chondrogenic differentiation and pathogenesis of

arthropathies such as osteoarthritis (OA; Hong et al., 2012). Therefore, the involvement of

microRNAs in cartilage specific processes warrants further investigation.

Based on this rationale, hypotheses and objectives were proposed for each chapter:

25

Chapter 1

Hypothesis: Cartilage-specific microRNA miR-140 will be expressed in equine articular

chondrocytes and will be upregulated during chondrogenic induction of eCB-MSCs.

Objective: Characterise the expression of miR-140 and selected miR-140 targets in

chondrogenically differentiated eCB-MSCs and equine articular chondrocytes.

Chapter 2

Hypothesis: Chondrogenic differentiation of eCB-MSCs using membrane culture will allow

differentiation of high numbers of cells and yield more homogeneous, hyaline-like cartilage

compared to pellet culture.

Objective: Histologically evaluate pellet and membrane cultures following chondrogenic

differentiation.

Chapter 3

Hypothesis: Select microRNAs will be differentially expressed in response to inflammatory

stimuli in equine articular chondrocytes.

Objective: Characterise the expression of microRNAs previously associated with arthritis in

other species, in equine articular chondrocytes subjected to inflammatory stimuli.

26

CHAPTER 1

MicroRNA-140 Expression During Chondrogenic Differentiation of Equine Cord Blood-

Derived Mesenchymal Stromal Cells

(This chapter is a modified version of the manuscript SCD-2012-0411.R1 accepted for

publication by Stem Cells and Development on November 15th

, 2012)

27

Introduction

Orthopaedic injuries involving joint cartilage are some of the most common causes of lameness

in racehorses (Bailey et al., 1999). Mesenchymal stromal cells (MSCs) represent a promising

source of chondroprogenitors for cell-based cartilage repair therapies. Although bone marrow

derived MSCs (BM-MSCs) are the best-characterized, cord blood-derived MSCs (CB-MSCs)

may offer several advantages. In contrast to the invasive procedures necessary to collect bone

marrow and the rapid decline in the proliferative capacity of BM-MSCs (Stenderup et al., 2003),

umbilical cord blood can be obtained using a minimally invasive method (Rubenstein et al.,

1993; Koch et al., 2007) and studies on both human and equine CB-MSCs have revealed higher

replicative potential and broader potency compared to BM-MSCs (Kogler et al., 2006; Kern et

al., 2006). In particular, these CB-MSCs are reported to possess higher chondrogenic potential

compared to bone marrow and adipose tissue derived-MSCs (Berg et al., 2009; Zhang et al.,

2011).

MicroRNAs (miRNAs) are a class of endogenous non-coding RNAs, approximately 20-25

nucleotides in length. These potent regulators of gene expression are thought to be involved in

the regulation of one third of all mammalian genes (Lewis et al., 2005). They function at the

post-transcriptional level by binding to complementary sequences in the 3’-untranslated region

(3’-UTR) of target mRNAs and inhibiting their translation and/or facilitating their decay.

MicroRNAs have profound effects on cellular phenotype and biological function in many

different tissues and numerous studies have shown that they are important regulators of diverse

biological processes such as differentiation, development and tumorigenesis (Chen et al., 2004;

Krichevsky et al., 2006; Nicoloso et al., 2009).

28

During microRNA biogenesis, long primary transcripts (pri-miRNAs) are synthesized by RNA

polymerase II and then processed into small hairpin structures known as pre-miRNAs by the

enzymes Drosha and DGCR8. They are then exported to the cytoplasm where the RNAse III,

Dicer, cleaves the loop region of the hairpin to generate a short RNA duplex. One strand is

degraded leaving a mature single-stranded miRNA molecule that becomes incorporated into the

RNA-induced silencing complex (RISC) (Du & Zamore, 2005) and binds target mRNAs to

either block translation or induce transcript degradation.

Evidence for the crucial role of microRNAs in cartilage development was provided by a study in

which Dicer, an endoribonuclease required for the production of mature microRNA, was

knocked out in the cartilage of mice. This resulted in a smaller proliferating pool of

chondrocytes and accelerated hypertrophic differentiation, causing severe skeletal defects

(Kobayashi et al., 2008). Findings by Wienholds et al. demonstrating that most conserved

vertebrate microRNAs are expressed in a tissue-specific manner in zebrafish embryos and that

microRNA-140 (miR-140) is only expressed in cartilaginous tissue, suggested an important role

for this miRNA species in cartilage development (Wienholds et al., 2005). Subsequent studies

confirmed the cartilage specific nature of miR-140 in mice (Tuddenham et al., 2006) and humans

(Miyaki et al., 2009).

Several miR-140 targets have been identified; HDAC4 (Tuddenham et al., 2006), CXCL12

(Nicolas et al., 2008), IGFBP5 (Tardif et al., 2009), ADAMTS-5 (Miyaki et al., 2010), Smad3

(Pais et al., 2010), Dnpep (Nakamura et al., 2011) and Sp1 (Yang J et al., 2011). Additionally,

29

miR-140 was found to be directly induced by Sox9, the master transcriptional regulator of

chondrogenesis. Furthermore, it is co-expressed with the “host” gene from which it is

intronically transcribed, Wwp2-C an E3 ubiquitin protein ligase (Yang J et al., 2011).

Although miR-140 is the most frequently studied microRNA in cartilage biology and pathology,

studies have not been described in equine cells. In this study, we demonstrate that miR-140 is

highly expressed in normal equine cartilage and that expression increases after 14 days of

chondrogenic differentiation of equine CB-MSCs. Expression was directly correlated with the

transcriptional regulator Sox9 and previously identified targets ADAMTS-5 and CXCL12

showed expression patterns that suggest possible regulation by miR-140. These findings provide

further insight into the molecular mechanisms of chondrogenic differentiation in eCB-MSCs.

30

Materials and Methods

Figure 1: Study Design. All eCB-MSC cell lines were screened for chondrogenic potential prior

to the study by differentiating pellets for two weeks then staining with Toluidine Blue (Appendix

1.). Strongly stained pellets with hyaline-like morphology were grouped as high chondrogenic

potential (CP) eCB-MSCs, while weakly stained pellets were grouped as low CP eCB-MSCs.

High CP eCB MSCs were subjected to chondrogenic differentiation for 7, 14 or 21 days before

assessment of outcome parameters.

31

eCB-MSC Isolation and Culture

The isolation of equine MSCs from umbilical cord blood was performed as previously described

(Koch et al., 2009). Briefly, the nucleated cell fraction was isolated from 11 different cord blood

samples using PrepaCyte®-WBC medium (BioE Inc., St Paul, MN) according to the

manufacturer’s instructions. The cells were suspended in isolation medium [low-glucose

Dulbecco’s modified Eagle medium (DMEM; Lonza, Wakersville, MD), 30% FBS (Invitrogen,

Burlington, ON, Canada), dexamethasone (10-7

M; Sigma, Oakville, ON, Canada), penicillin

(100 IU/mL; Invitrogen), streptomycin (0.1 mg/mL; Invitrogen) and L-glutamine (2 mM;

Sigma)], seeded in polystyrene culture flasks and incubated at 38.5°C with 5% CO2 in a

humidified incubator. When cells reached 70-80% confluence, they were detached using 0.04%

trypsin/0.03% EDTA solution and re-seeded at 5000cells/cm2. For cryopreservation, trypsinized

cells were washed, resuspended in 10% dimethyl sulfoxide (Sigma), stored overnight at -80°C

and transferred to liquid nitrogen for long-term storage. Following preliminary screening, 5

eCB-MSC lines were selected, thawed and expanded; experiments were performed in passages

5-6.

Chondrogenic Differentiation

High density micromass pellet cultures were prepared by centrifuging 2.5x105 cells/pellet at 150

x g in 96-well V-bottom polypropylene plates (Phenix, Candler, NC). 20 pellets were prepared

for each cell line for each time point and cultured at 38.5°C in a hypoxic environment of 5% O2

for 7, 14 or 21 days in chondrogenic differentiation media containing DMEM-HG, 200mM

Glutamax-I, 100 mM Sodium pyruvate, 1x ABAM (Invitrogen), 0.1 mM dexamethasone, 100

μg/ml ascorbic acid-2 phosphate, 40 μg/ml proline (Sigma-Aldrich), 1x ITS (BD Biosciences,

32

Bedford, MA) and 10 ng/ml TGF-β3 (R&D Systems, Minneapolis, MN). Medium was changed

every 2-3 days.

Chondrocyte Isolation

Articular cartilage was collected from the fetlock joints of 3 horses without evidence of joint or

systemic disease immediately after euthanasia. Tissue was minced with a scalpel blade and

digested with 1.5 mg/ml collagenase type II (Sigma-Aldrich) overnight at 37˚C. Digested

samples were strained and isolated chondrocytes were snap frozen in mirVana lysis/binding

buffer (Ambion, Austin, TX) and stored at -80 °C until RNA isolation.

Histology and Immunohistochemistry

One representative pellet from each cell line was selected (N=5), fixed in 10% formalin and

embedded in paraffin. Five micrometer sections were prepared and stained with Hematoxylin

and Eosin or Toluidine Blue. For collagen type I and type II immunostaining, paraffin-

embedded sections were rehydrated and digested with 20 µg/ml proteinase K and 1600 U/ml

hyaluronidase, blocked with 3% bovine serum and incubated with an antibody reactive to

collagen type I (Calbiochem, Gibbstown, NJ) or collagen type II (Developmental Studies

Hybridoma Bank, Iowa City, IA) overnight at 4°C. Subsequently, samples were incubated with

HRP-conjugated anti-mouse secondary antibody (DAKO, Mississauga, ON, Canada) and

immunoreactivity was detected using diaminobenzidine chromagen (DAKO) with hematoxylin

counterstain. QCapture software was used for imaging.

33

RNA Extraction, Reverse Transcription, qRT-PCR

Total RNA, including small RNAs, was isolated from equine articular chondrocytes (N=3),

undifferentiated eCB-MSCs (N=5) and pellet cultures (N=5 with 5 pellets per cell line) using

mirVana microRNA isolation kit according to the manufacturer’s protocol (Ambion). RNA

concentration and purity were determined using the Nanodrop ND-1000 spectrophotometer. To

determine microRNA expression, 100 ng of RNA was reverse transcribed using the TaqMan

microRNA reverse transcription kit with the appropriate microRNA specific stem-loop primer;

mmu-miR-140. This primer, while designed for mouse, is identical to the homologous Equus

caballus sequence as confirmed by BLASTN sequence alignment of the probe on the equine

genome. qRT-PCR was then performed using the TaqMan PCR Master Mix and TaqMan

microRNA assay (Applied Biosystems, Foster City, CA). To assess mRNA expression,

complementary DNA was synthesized from total RNA using SuperScript II and oligo(dT)18

primers (Invitrogen) and qRT-PCR was performed using Roche LightCycler 480, Fast Start

DNA Master SYBR Green I (Roche Diagnostics) and the equine-specific primers found in Table

1. All reactions were run in triplicate. Crossing point (Cp) values for miR-140 were normalized

to U6 snRNA, while Cp values for mRNAs were normalized to GAPDH. Relative gene/miRNA

expression was determined using the delta-delta Ct method.

Statistical Analysis

GraphPad Prism 5 Software (San Diego, CA) was used to perform statistical analyses. One way

analysis of variance (ANOVA) with Bonferroni post-test was applied to determine the

differences between the gene expression levels and wet mass. Student’s unpaired t-test was used

to compare the expression of miR-140 between MSCs and chondrocytes. Gene expression data

34

are expressed as fold differences ± SEM compared with undifferentiated eCB-MSCs.

Significance was determined using raw data and assigned at p<0.05.

Results

Chondrogenic differentiation of eCB-MSCs

eCB-MSCs formed white, glistening pellets, an appearance consistent with hyaline cartilage

(Fig. 2A). They increased in size and weight over 21 days of differentiation (Fig. 2B), with the

average wet mass increasing from 0.56 mg on day 7 to 0.93 mg on day 21. Additionally, pellet

sections were stained with hematoxylin and eosin to assess their morphology and with toluidine

blue to determine the presence of proteoglycans (Fig. 2C). Histological examination clearly

showed cartilage tissue development; cells with round morphology inside lacunae were visible at

day 14 and became more defined at day 21. Toluidine blue staining was visible as early as day 7

and showed a progressive increase in proteoglycan content in the accumulated matrix at days 14

and 21. Immunostaining was also performed to assess the protein expression of collagens type I

and II (Fig. 2C). As expected, the staining intensity for collagen type II increased from day 7 to

day 21, while decreasing for collagen type I.

Chondrogenesis was also evaluated over the three week period through the assessment of gene

expression for collagens I, II and X and aggrecan using qRT-PCR (Fig. 3). Expression levels of

collagens I and II, and aggrecan increased significantly from day 0 to day 7, then began to

decrease. The expression of aggrecan at 7 days of chondrogenesis was similar to articular

chondrocytes, while expression levels of collagens I and II were similar to equine articular

chondrocytes at 21 days. Collagen X expression peaked at day 14 then decreased at day 21, at

35

which point the expression level was not significantly different from that of articular

chondrocytes.

MicroRNA-140 expression in undifferentiated eCB-MSCs and equine articular chondrocytes

qPCR analysis using TaqMan microRNA assays revealed that the expression of miR-140 is

almost 300-fold higher in equine chondrocytes compared to undifferentiated eCB-MSCs (Fig. 4).

Expression of miR-140, Sox9 and miR-140 target genes during chondrogenesis

During chondrogenic differentiation, miR-140 increased significantly from day 0-14, then

decreased slightly, though not significantly, at day 21 (Fig. 5A). The expression of Sox9, the

master transcriptional regulator of chondrogenesis, also followed this pattern (Fig. 5B).The

expression patterns for previously identified miR-140 targets IGFBP5, CXCL12, ADAMTS-5

and HDAC4 [19, 18, 20, 16] were also examined. IGFBP5 expression levels increased from day

0-14, then decreased at day 21 (Fig. 5C). In contrast, CXCL12 expression was highest at day 0,

decreasing significantly by day 7 and remaining repressed throughout the differentiation period.

CXCL12 expression appeared higher in the chondrocytes compared with the differentiating

MSCs, though statistical significance was not achieved as there was considerable variability (Fig.

5D). A similar pattern was observed for ADAMTS-5, its expression decreased significantly

from day 0-7 and remained low until day 21, however this repression was not significant at day

14 and day 21 compared to day 0, likely due to inter-donor variation Surprisingly, ADAMTS-5

mRNA expression appeared relatively high in normal articular chondrocytes, although

significant variability was present (Fig. 5E). Expression of histone deacetylase 4 (HDAC4), a

co-repressor of Runx2, was also examined but mRNA levels in most samples were below the

36

detection limit (data not shown). These results suggest that miR-140 may play an important role

in the chondrogenic differentiation of eCB-MSCs through selective targeting of specific mRNAs,

such as CXCL12 and ADAMTS-5.

Discussion

During vertebrate development, chondroprogenitor cells undergo morphological changes and

begin to express cartilage-specific genes, leading to chondrocyte maturation and ECM

production (Lefebvre & Smits, 2005). Chondrogenesis is initiated by the recruitment and

condensation of mesenchyme, a process which is regulated by cell-cell interactions. Similarly, in

vitro chondrogenesis involves the aggregation of mesenchymal cells into high density pellets

(Johnstone et al., 1998). Transforming growth factor-β (TGF-β) is one of the earliest genes

expressed in in vivo mesenchymal condensations, whereas TGF-β is applied exogenously in

vitro. Sox9 is a key transcriptional regulator in early chondrogenesis, with a crucial role in

regulating cartilage formation by activating the expression of cartilage-specific genes including

collagen type 2, aggrecan and cartilage oligomeric matrix protein (COMP) (Huang et al., 2001;

Ng et al., 1997). Sox9 is also expressed during chondrogenic differentiation of micromass

pellets. As previously reported, eCB-MSCs can be successfully differentiated towards a

chondrogenic fate, as indicated by a gradual increase in size and weight and by histological

evaluation of morphology, proteoglycan content and expression of chondrogenic markers (Koch

et al., 2007; Berg et al., 2009; Koch et al., 2009). Gene expression patterns for collagen II and

aggrecan in this study showed an initial increase after one week, then began to decrease. This

suggests that upon chondrogenic stimulation, the eCB-MSCs rapidly accumulate transcripts to

produce ECM. Collagen II mRNA levels did not correlate with the protein abundance seen in the

37

immunostaining. One possible explanation for this is that, as differentiation progresses and the

ECM is established, collagen II mRNA levels decrease to baseline expression as the

chondrocytes take on a maintenance role. However, the significantly lower expression of

aggrecan compared to chondrocytes and the increased expression of collagen X indicates that the

differentiation method does not perfectly recapitulate in vivo cartilage development.

Studies demonstrating the loss of the miRNA processing enzyme Dicer in the cartilage of mice

revealed an overall role for miRNAs in chondrogenesis and skeletogenesis. The absence of

mature miRNAs caused severe growth defects due to a decrease in proliferating chondrocytes

and accelerated hypertrophy (Kobayashi et al., 2008). Many miRNAs with roles in cartilage

specific processes have since been identified. For instance, miR-199a* was identified as an

inhibitor of early chondrogenic differentiation. While overexpression of miR-199a* in murine

MSCs decreased the expression of early chondrogenic markers during BMP2-induced

chondrogenesis, anti-miR-199a* increased their expression. This was mediated through Smad1

signalling, which was identified as a direct target of this microRNA through 3’UTR luciferase

reporter assay (Lin et al., 2009). In a similar study, miR-145 was reported to directly repress

Sox9 during TGF-β3 induced chondrogenic differentiation of murine MSCs (Yang B et al.,

2011). MiR-140 has been the focus of many cartilage studies due to its specificity in this tissue.

It is transcribed from an intron within the Wwp2-C gene and thought to be induced by Sox9

(Yang J et al., 2011). Identified targets include HDAC4, IGFBP5, ADAMTS-5, Cxcl12, Smad3,

Dnpep, Sp1 and MMP-13 (Tuddenham et al., 2006; Nicolas et al., 2008; Tardif et al., 2009;

Miyaki et al., 2010; Pais et al., 2010; Nakamura et al., 2011; Yang J et al., 2011; Liang et al.,

38

2012). The role of microRNAs in cartilage development and homeostasis has been reviewed

elsewhere (Hong & Reddi, 2012).

We demonstrate here that miR-140 is expressed in equine cells, specifically in chondrogenically

differentiating eCB-MSCs and articular chondrocytes. This observation is in agreement with

previous reports that miR-140 is cartilage specific (Wienholds et al., 2005) and highly expressed

in human articular chondrocytes (Miyaki et al., 2009). Significantly higher expression was

observed in eCB-MSCs following 2 weeks of in vitro differentiation stimuli, compared to

undifferentiated cells. The presence of miR-140 in undifferentiated eCB-MSCs suggests that

this miRNA could be involved in the maintenance of chondrogenic potential. This is consistent

with the detection of miR-140 in undifferentiated C3H10T1/2 cells that were subsequently

differentiated into chondrocytes (Nicolas et al., 2008). The expression pattern of miR-140

correlated with the expression of chondrogenic transcription factor Sox9. Yang and colleagues

reported that suppression of Sox9 reduced miR-140 expression in ATDC5 cells and they utilized

luciferase reporter assays to confirm the direct binding of Sox9 to the upstream region of miR-

140 (Yang J et al., 2011). Our data are consistent with the potential for Sox9 to regulate miR-

140 expression during eCB-MSC chondrogenic differentiation, however additional studies are

required to confirm this hypothesis.

MicroRNAs influence target gene expression by facilitating the decay of specific mRNA targets

or by inhibiting translation of target genes. In this study, we also evaluated the expression of

three previously identified miR-140 mRNA targets; IGFBP5, CXCL12 and ADAMTS-5. Insulin

growth factor binding protein 5 (IGFBP5) is a protein that regulates the availability of IGF-1, an

39

anabolic factor involved in matrix synthesis and chondrocyte survival (Jones et al., 1993).

IGFBP5 was reported to be directly targeted for mRNA degradation by miR-140 in human OA

chondrocytes. Pre-miR-140 treatment caused a significant decrease in IGFBP5 mRNA

expression while knockdown caused a significant increase. These changes occurred early (24

hours) and since a miR-140 seed sequence was predicted in the 3’UTR of IGFBP5, a direct

interaction between IGFBP5 and miR-140 was suggested, however, 3’UTR luciferase reporter

assays were not performed (Tardif et al., 2009). Chemokine (CXC motif) ligand 12 (CXCL12),

also known as stromal derived factor-1 (SDF-1), functions by activating the G-protein coupled

receptor CXC chemokine receptor 4 (CXCR4). CXCL12 is a potent chemoattractant for

CXCR4-expressing cells and may have a role in MSC migration (Kortesidis et al., 2005),

survival and initiation of differentiation (Son et al., 2006). Using an overexpression/knockdown

approach, CXCL12 was identified as one of 49 genes that were repressed by miR-140

overexpression and derepressed by miR-140 silencing. Northern blot analysis and 3’UTR

luciferase reporter assays validated CXCL12 as a miR-140 target (Nicolas et al., 2008). A

disintegrin and metalloproteinase with thrombosponin motifs (ADAMTS-5) is a proteolytic

enzyme that cleaves aggrecan and has been associated with the degeneration of osteoarthritic

cartilage (Stanton et al., 2005; Glasson et al., 2005). In a study by Miyaki et al., miR-140-/-

mice

and transgenic (TG) mice overexpressing miR-140 were generated. ADAMTS-5 expression was

increased in the chondrocytes of miR-140-/-

mice and reduced in the chondrocytes of miR-140

TG mice. Furthermore, ds-miR-140 decreased the expression of ADAMTS-5 in miR-140-/-

mice, providing additional evidence that miR-140 targets this gene for degradation. Direct

binding of miR-140 to ADAMTS-5 mRNA was demonstrated by luciferase reporter assay

(Miyaki et al., 2010).

40

Surprisingly, the expression pattern of IGFBP5 correlated directly with miR-140 levels rather

than an inversely, which would be expected if miR-140 facilitated its decay. This data suggests

that IGFBP5 mRNA may not be targeted for degradation by miR-140 during chondrogenic

differentiation. The possibility remains that the translation of this gene is inhibited by miR-140,

however, the small sample quantities and absence of reliably cross-reactive antibodies prohibits

the evaluation of these possibilities at this time. In contrast, ADAMTS-5 and CXCL12 mRNA

levels were high prior to differentiation but low throughout differentiation, suggesting that these

genes were targeted by miR-140. CXCL12 gene expression has been shown to decrease rapidly

upon osteogenic and chondrogenic induction (Zhu et al., 2007; Cristino et al., 2008). Blockade

of CXCL12 signalling prior to BMP-2 stimulated osteogenesis decreased the expression of

osteogenic markers and abrogated the accumulation of osteocalcin, suggesting that CXCL12 is

involved in initiation of BMP-2 induced osteogenesis (Zhu et al., 2007). Regulation of CXCL12

expression appears to be important for chondrogenic induction, but whether its expression

decreases because it would otherwise impede differentiation or whether its expression is required

for initiation of chondrogenesis is unknown.

The roles of ADAMTS-5 suppression in cartilage development are not entirely clear. One

hypothesis is that ADAMTS-5 is suppressed during cartilage differentiation and development to

facilitate the accumulation of aggrecan in the ECM, but that it is increased in established

articular cartilage to regulate baseline turnover of aggrecan (Tortorella et al., 2001). This would

help explain the seemingly high expression of ADAMTS-5 in our samples from articular

chondrocytes (Fig. 5E). However, considerable variability in both CXCL12 and ADAMTS-5

41

expression was evident in those samples. The possibility of clinically undetectable joint disease

remains a potential contributor to the variation, as it cannot be definitively excluded from the

samples. It will be important to study the effect of miR-140 overexpression and knockdown on

the expression of both previously identified and novel targets in eCB-MSCs to provide further

insight into the molecular pathways in these cells.

In conclusion, the results of this study show that miR-140 exhibits a dynamic expression pattern

during chondrogenesis of eCB-MSCs that correlates with the expression of the transcription

factor Sox9. Additionally, CXCL12 and ADAMTS-5 mRNA levels were suppressed during

chondrogenic differentiation while miR-140 expression was increased, suggesting that this

microRNA may target these genes for degradation. Further studies, including overexpression

and knockdown of miR-140, will clarify the role of miR-140 during chondrogenesis of MSCs

and determine the utility of this microRNA as an enhancer or inducer of chondrogenesis.

42

Tables

Table 1. Primer pairs used for qRT-PCR

Primers denoted with an asterisk (*) were designed by Dr Lise C. Berg.

Primers denoted with a dagger (†) were designed by Laurence Tessier.

Gene Forward (5’-3’) Reverse (5’-3’) Primer Source

CollagenIIα1 GACAACCTGGCTCCCAAA ACAGTCTTGCCCCACTTAC NM_001081764*

CollagenIα1 GAAAACATCCCAGCCAAGAA TGATGTTTTGAGAGGCATGG Berg et al., 2009 [7]

CollagenXα1 CCAAGAGGTGCCCCTGGAAT GTTGCCTGTTATACACAATC NM_174634.1*

Aggrecan CTTAGAGGACAGAAAGCGAC ACTTTGGGCGGAAGAAGG Trumble et al., 2001 [25]

Sox9 ATCTGAAGAAGGAGAGCGAG TCAGAAGTCTCCAGAGCTTG Zehentner et al., 1999 [26]

ADAMTS-5 AACTGGGGGTCCTGGGGGTCCTGG CATTTCTTGCCTCACACTGCTCAT Coyne et al., 2009 [27]

IGFBP5 GGAGGAGCCGAGAACACTG GCGAAGCCTCCATGTGTC McGivney et al., 2010 [28]

CXCL12 AGATGTCCTTGCCGGTTCTT CTTCAGTTTCGGGTCAATGC XM_001489644.2†

HDAC4 AGGAACTACCAGGCGTCCAT CTGTTAGTGTTCCCGCAGGT XM_003365703.1†

GAPDH GGGTGGAGCCAAAAGGGTCATCAT AGCTTTCTCCAGGCGGCAGGTCAG Iqbal et al., 2004 [29]

43

Figures

Figure 2: Chondrogenic differentiation of eCB-MSCs. (A) Pellets from eCB-MSC are spherical,

white and glistening after 7, 14 and 21 days in chondrogenic media. (B) Wet mass of pellets

revealed an increase in weight from day 7 to day 21. Data shown as mean ±SEM. (*) p<0.05,

(**) p<0.01. N=5, n=5. (C) Histological appearance of pellets at days 7, 14 and 21. Hematoxylin

and eosin staining shows the development of cells with round morphology inside lacunae (top

row), while Toluidine Blue staining confirms an increase in proteoglycan accumulation in the

extracellular matrix over the differentiation period. Immunostaining for collagens I and II (third

and fourth rows) further confirms chondrogenic differentiation as the staining for collagen I

decreases over time, while collagen II increases. All images are 100x magnification.

44

Figure 3: Gene expression of cartilage markers by eCB-MSC pellets cultured up to 21 days in

chondrogenic media. mRNA levels were assessed by qPCR with GAPDH as a reference gene.

(A, B, D) Collagen II, Aggrecan and Collagen I expression increased from day 0-7 then

decreased from day 7-21. (C) Collagen X expression increased from day 0-14 then decreased at

day 21. Data shown as mean ± SEM. (*) p<0.05, (**) p<0.01, (***) p<0.001, (****) p<0.0001.

N=5 eCB-MSCs from different foals and N=3 chondrocyte samples from different horses.

45

Figure 4: Expression of microRNA-140 (miR-140) in undifferentiated equine CB-MSCs and

articular chondrocytes. MiR-140 expression was significantly higher in chondrocytes (N=3

different horses) compared to eCB-MSCs (N=5 from cord blood of different foals). Data shown

as mean ± SEM. (**) p<0.01.

46

Figure 5: Expression of miR-140, Sox9 and previously identified targets IGFBP5, CXCL12, and

ADAMTS5. (A, B, C) miR-140, Sox9 and IGFBP5 expression increased from day 0-14 then

decreased at day 21. (D, E) CXCL12 and ADAMTS5 expression decreased from day 0-7 and

remained low until day 21. Data shown as mean ± SEM. (*) p<0.05, (**) p<0.01, (***) p<0.001,

(****) p<0.0001. N=5 eCB-MSCs from different foals and N=3 chondrocyte samples from

different horses.

47

CHAPTER 2

Chondrogenic Differentiation of Equine Cord Blood-Derived Mesenchymal Stromal Cells

in Membrane-Based Cultures

48

Introduction

Articular cartilage is a dense connective tissue that covers joint surfaces to protect underlying

bone and allow low-friction articulation. Cartilage damage can be sustained by trauma,

inflammation or disease and there are limited therapeutic options for repair due to the poor

regenerative capacity of the tissue (Mankin, 1982; Williams et al., 2010). The current cell-based

strategies often yield repair tissue consisting of mechanically inferior fibrocartilage, therefore

alternative cell sources are being investigated. Mesenchymal stromal cells (MSCs) proliferate

rapidly and are readily expanded to generate large numbers of cells. Furthermore, they are

multipotent and can be differentiated into multiple different cell lineages, including chondrocytes

(Baksh et al., 2004). In particular, human and equine CB-MSCs are reported to be more

chondrogenic than bone marrow and adipose tissue derived-MSCs (Berg et al., 2009; Zhang et

al., 2011).

In vitro chondrogenic differentiation of MSCs is normally induced by applying three-

dimensional (3-D) culture conditions and including transforming growth factor-β (TGF-β) in the

medium, as described by Johnstone et al. in 1998. However, this system is primarily used to

study molecular pathways involved in chondrogenesis, rather than provide differentiated cells for

biological repair. In fact, only 250 000 - 500 000 cells are seeded to form the cell aggregates, but

increasing pellet size can result in cell necrosis in the center of the aggregate (Ebisawa et al.,

2004). Although immunohistochemistry of the pellets in several reports indicate successful

differentiation through collagen type II staining, it is often heterogeneous and accompanied by

expression of collagen type I, which is characteristic of fibrous tissue, and collagen type X,

which is typical of terminal differentiation of hypertrophic chondrocytes (Steck et al., 2005;

49

Nelea et al., 2005). Interestingly, Lee and colleges have recently developed a protocol in which

2 million bone marrow derived-MSCs (BM-MSCs) are differentiated towards a chondrogenic

fate on collagen IV-coated polytetrafluoroethylene (PTFE) membrane inserts. They reported that

glycosaminoglycan (GAG) and collagen content was similar in pellet and membrane-based

cultures and that hypertrophic markers Runx2 and collagen X were expressed in both culture

types. However, the expression level of collagen I was significantly lower in membrane-

cultured cells compared to pellet (Lee et al., 2011).

The aim of this study was to determine whether the use of a 3-D membrane culture system would

provide a more homogeneous environment for chondrogenic differentiation of equine cord

blood-derived MSCs. We found that it was necessary to implement a 24 hour expansion step

prior to stimulating chondrogenic differentiation in the membrane culture system. Chondrogenic

differentiation of selected eCB-MSCs generated hyaline-like cartilage in both culture systems,

however the tissues were more homogeneous in the membrane system.

50

Materials and Methods

Figure 1: Study design for in vitro chondrogenesis. All eCB-MSC cell lines were screened for

chondrogenic potential prior to the study by differentiating pellets for two weeks then staining

with Toluidine Blue (Appendix 1.). Strongly stained pellets were grouped as high chondrogenic

potential (CP) eCB-MSCs, while weakly stained pellets were grouped as low CP eCB-MSCs.

Three high CP and one low CP eCB-MSCs were selected and differentiated as pellets or on

51

membranes (with or without 24 hour expansion). Chondrogenesis was assessed by histology and

immunostaining.

eCB-MSC Isolation and Culture

The isolation of equine MSCs from umbilical cord blood was performed as previously described

(Koch et al., 2009). Briefly, the nucleated cell fraction was isolated from 5 cord blood samples

using PrepaCyte®-EQ medium (BioE Inc., St Paul, MN) according to the manufacturer’s

instructions. The cells were suspended in isolation medium [low-glucose Dulbecco’s modified

Eagle medium (DMEM; Lonza, Wakersville, MD), 30% FBS (Invitrogen, Burlington, ON,

Canada), dexamethasone (10-7

M; Sigma, Oakville, ON, Canada), penicillin (100 IU/mL;

Invitrogen), streptomycin (0.1 mg/mL; Invitrogen) and L-glutamine (2 mM; Sigma)], seeded in

polystyrene culture flasks and incubated at 38.5°C with 5% CO2 in a humidified incubator.

Selected cryopreserved MSCs were thawed and expanded; experiments were performed in

passages 5-6.

Chondrogenic Differentiation

High density micromass pellet cultures were prepared by centrifuging 2.5x105 cells/pellet at 150

x g in 96-well V-bottom polypropylene plates (Phenix, Candler, NC). For membrane cultures,

PTFE cell culture inserts (0.2 mm pore size; Millipore, Billerica, MA) were coated with

fibronectin (Millipore) overnight then seeded with 2.0x106 cells/membrane, either directly into

chondrogenic media or in expansion media for 24 hours prior to chondrogenic induction. The

selection of fibronectin was based on preliminary studies screening fibronectin (FN) against

laminin and collagen type IV, which suggested that eCB-MSCs adhered more consistently to

52

PTFE membranes coated with FN than the other ECM molecules. The pellets and membranes

were cultured at 38.5°C with 5% O2 for 14 days in chondrogenic differentiation media

containing DMEM-HG, 200mM Glutamax-I, 100 mM Sodium pyruvate, 1x ABAM (Invitrogen),

0.1 mM dexamethasone, 100 μg/ml ascorbic acid-2 phosphate, 40 μg/ml proline (Sigma-

Aldrich), 1x Insulin-Transferrin-Selenium (ITS; BD Biosciences, Bedford, MA) and 10 ng/ml

TGF-β3 (R&D Systems, Minneapolis, MN). Medium was changed every 2-3 days.

Histology and Immunohistochemistry

Pellets and membranes were fixed in 10% formalin and embedded in paraffin. Five micrometer

sections were prepared and stained with Hematoxylin and Eosin or Toluidine Blue. For collagen

type I and type II immunostaining, paraffin-embedded sections were rehydrated and digested

with 20 µg/ml proteinase K and 1600 U/ml hyaluronidase, blocked with 3% bovine serum and

incubated with an antibody reactive to collagen type I (Calbiochem, Gibbstown, NJ) or collagen

type II (Developmental Studies Hybridoma Bank, Iowa City, IA) overnight at 4°C.

Subsequently, samples were incubated with HRP-conjugated anti-mouse secondary antibody

(DAKO, Mississauga, ON, Canada) and immunoreactivity was detected using diaminobenzidine

chromagen (DAKO) with hematoxylin counterstain. QCapture software was used for imaging.

Results

Chondrogenic differentiation of pellets and membranes

Due to known inter-donor variation, all eCB-MSC cell lines were screened for chondrogenic

potential prior to the study by differentiating pellets for two weeks then staining with Toluidine

Blue. Strongly stained pellets were grouped as high chondrogenic potential (CP) eCB-MSCs,

53

while weakly stained pellets were grouped as low CP eCB-MSCs (Appendix I). To examine the

difference between pellet and membrane culture systems, three high CP eCB-MSCs and one low

CP eCB-MSC were selected and differentiated.

Cultures were stained with hematoxylin and eosin to reveal their morphology and with toluidine

blue to determine the presence of proteoglycans. All eCB-MSCs that were seeded directly into

chondrogenic media in the membrane system did not adhere to the membrane and did not

develop a chondrogenic phenotype (Fig. 2), therefore further mention of the membrane system

will refer to the protocol including the 24 hour expansion step. Cells with round morphology

inside lacunae were visible in both culture systems for all cell lines with the exception of the low

CP eCB-MSC pellet. Additionally, cells with a flattened morphology were present in peripheral

areas of high CP eCB-MSC pellets.

High CP eCB-MSCs were strongly stained for toluidine blue as both pellets and membranes

(Fig. 3). However, the low CP eCB-MSC did not stain for toluidine blue in pellet culture, but

was weakly stained in the membrane system. Immunostaining was also performed to evaluate

the protein expression of collagens type I and II (Fig. 3). Collagen type II was highly expressed

in both culture systems for all cell lines with the exception of the low CP eCB-MSC pellet.

Collagen type I was also expressed, but this was primarily in peripheral regions of the pellets

while it was more homogeneously distributed in the membrane culture system.

54

Discussion

In this study, we have successfully induced chondrogenic differentiation of eCB-MSCs in a 3D

membrane culture system as evidenced by changes in cell morphology, strong toluidine blue and

collagen II staining. These characteristics were also observed in the pellet culture system but

were accompanied by peripheral inconsistencies. For instance, the morphology of the cells

within the pellet was consistent with hyaline-like cartilage, but the peripheral areas contained

cells with a flattened morphology, indicating a more fibrous phenotype. Additionally, these

areas were stained for collagen type I, which is a marker of fibrous tissue. Together these results

show that chondrogenic differentiation can be achieved through pellet culture, however, the

resulting tissue is heterogeneous and shows both cartilaginous and fibrous regions. This was

attributed to uneven diffusion of oxygen and nutrients throughout the tissue and the surface

tension caused by the spherical nature of the high density pellets. In contrast, even dispersion of

round cells within lacunae was shown in the membrane system, accompanied by homogeneous

toluidine blue, collagen II and collagen I staining. Therefore, with regard to uniformity of the

differentiated tissue, membrane culture appears to be superior. The increased number of cells in

this system (2 million instead of 250 000) is also advantageous for cartilage tissue engineering

strategies as sufficient numbers of differentiated cells are difficult to obtain from autologous

chondrocytes (Darling & Athanasiou, 2005).

Further evidence in support of the superiority of membrane culture for chondrogenic

differentiation is provided by the difference in chondrogenic induction of the low CP eCB-MSC

in pellet culture compared to membrane culture. While the low CP eCB-MSC pellet was not

55

positively stained for toluidine blue or collagen II, nor did it show any changes toward cartilage-

like morphology, the low eCB-MSC membrane culture stained positively for collagen II and

toluidine blue, albeit weakly. There were some lacunae, although poorly defined, and the overall

thickness of the tissue was lower compared to the high CP eCB-MSCs. However, this suggests

that the membrane system is a more effective method of inducing chondrogenesis since

differentiation was stimulated to some degree in a cell line that was originally thought to have no

chondrogenic potential.

Employing a 24 hour expansion step prior to the application of chondrogenic media appears to

be necessary, since membrane cultures that were immediately induced without the expansion

step did not adhere to the membrane, nor show any evidence of differentiation. Cell-matrix

interactions play an important role in mesenchymal cell condensation, an event required for

cartilage development both in vitro and in vivo. Fibronectin has been implicated in this process

and is thought to facilitate translocation of mesenchymal cells to pre-cartilage condensations

(Frenz et al., 1989). The absence of attachment to the membrane in the direct chondrogenesis

group likely prevented the formation of condensations, which subsequently inhibited

chondrogenic differentiation altogether. However, the molecular basis for the necessity of the 24

hour expansion step to promote adhesion is unclear. One hypothesis is that expansion media

contains serum, while the differentiation media does not, therefore certain factors may be present

in the serum that enhance MSC attachment to the fibronectin-coated substrate at a crucial point

early in chondrogenesis.

56

Further experiments will be conducted to determine additional differences between membrane

and pellet cultures. For instance, transcript levels of chondrogenic markers (Collagen II, Sox9

and Aggrecan), hypertrophic markers (Runx2 and Collagen X) and collagen I should be assessed

to evaluate whether the differentiation culture system has an effect on gene expression. Lee et al.

(2011) reported that both culture systems expressed similar levels of chondrogenic markers and

hypertrophic markers in ovine BM-MSCs, but that membrane cultured cells expressed less

collagen I mRNA. It will be interesting to determine whether the same results will be obtained

for eCB-MSCs or whether this MSC type will have additional beneficial effects on gene

expression during chondrogenic differentiation. In addition, it will be important to ascertain

whether in vitro differentiated cells undergo mineralization in vivo. Bone marrow derived-

MSCs have a tendency to undergo premature hypertrophy and studies have shown that

subcutaneous transplantation of in vitro differentiated pellets into severe combined

immunodeficient (SCID) mice leads to calcification and vascular invasion (Pelttari et al., 2006;

Dickhut et al., 2009). However, direct applications of undifferentiated BM-MSCs to chondral

defects have yielded variable results. For instance, in an equine model, full thickness cartilage

defects were induced in the femoropatellar regions and treated with either fibrin vehicle

containing MSCs or fibrin vehicle alone as a control. Arthroscopic assessment at 30 days

revealed that defects treated with the MSCs were significantly improved compared to the

controls, however these results were not sustained at 8 months (Wilke et al., 2007). In a case

report, two human patients with patella defects were treated with MSCs and after 2 years,

clinical symptoms had improved but the repair tissue consisted of fibrocartilage (Wakitani et al.,

2004). Our hypothesis is that some degree of in vitro induction of MSCs towards a

57

chondrogenic fate is required in order to optimize biological repair, however the optimal duration

and induction protocol has yet to be determined.

Although the overall goal in tissue engineering is usually to perfectly recapitulate the tissue of

interest in vitro, a study by Kandel et al. (2006) suggests that this may not be necessary.

Osteochondral plugs were prepared using calcium polyphosphate substrates seeded with

autologous chondrocytes and implanted into osteochondral defects in sheep. After 9 months in

vivo, proteoglycan content had not changed, collagen had increased slightly and mechanical

properties had improved significantly. Therefore, it is possible that engineered cartilage tissue

with properties inferior to native cartilage could be improved when exposed to an orthotopic in

vivo environment. It will be interesting to determine whether eCB-MSCs differentiated in

membrane or pellet culture systems will mineralize, form fibrocartilage or show improved

biochemical and mechanical properties when they are applied to cartilage defects.

In summary, a protocol for chondrogenic differentiation was developed using cell culture inserts

coated with fibronectin. According to histological evaluation it appears that the membrane

culture system is superior to pellet culture. Further studies are required to determine the effect of

membrane culture on the expression of chondrogenic, osteogenic and fibrous markers. However,

these results suggest that membrane culture is suitable for chondrogenic screening and mini

scale-up of eCB-MSC chondrogenic pre-differentiation.

58

Figures

Figure 2: Histology and immunostaining of chondrogenic differentiation in the membrane

culture system without 24 hour expansion step. All eCB-MSCs shown here were seeded onto

PTFE membranes directly in chondrogenic media. The brown lines are the membranes and two

appear in most images because the membranes were folded in half before embedding in paraffin.

There is little attachment to the membrane and no evidence of chondrogenesis as the cell layers

are thin, they are not stained for toluidine blue or collagen II and they are positively stained for

collagen I. All images are 100x magnification.

59

60

Figure 3: Histological comparison of pellet cultures and membrane cultures with 24 hour

expansion step. eCB-MSCs shown here were either cultured as pellets in V-well polypropylene

plates in chondrogenic media or on PTFE membranes in expansion media for 24 hours then

changed to chondrogenic media. The high chondrogenic potential (CP) pellets (eCB 1012, 1103

and 1108) are strongly stained for Toluidine blue and collagen II, while the low CP pellet (eCB

1101) shows no signs of differentiation. All membrane cultures, including the low CP culture,

were positively stained for Toluidine Blue and collagen II. Collagen type I staining was also

present in these cultures but was more homogeneously distributed compared to the pellets, where

strong peripheral staining is observed. All images are 100x magnification.

61

CHAPTER 3

The Effect of Inflammatory Stimuli on MicroRNA Expression in Equine Chondrocytes

62

Introduction

Osteoarthritis (OA) is a highly prevalent joint disease primarily characterized by the progressive

degradation of articular cartilage. Surveys have reported that approximately 60% of lameness

cases in the sport horse are related to osteoarthritis (Caron & Genovese, 2003). Although the

pathogenesis underlying this disease is unclear, it is generally accepted that the balance between

anabolic and catabolic factors is perturbed in OA, leading not only to articular cartilage damage,

but to synovial tissue inflammation and subchondral bone remodelling. In order to reduce pain

and slow disease progression, non-steroidal anti-inflammatory drugs (NSAIDs), intra-articular

steroids, viscosupplementation and chondroprotectants are commonly prescribed (Goodrich &

Nixon, 2006). However, these drugs cannot halt disease progression nor can they reverse any

damage. A better understanding of the molecular mechanisms involved in the development of

osteoarthritis will be important for the improvement of OA therapy.

Inflammatory cytokines are believed to be critical mediators of OA pathophysiology. In

particular, interleukin-1β (IL-1β) and tumor necrosis factor α (TNFα) are elevated in synovial

fluid, subchondral bone and cartilage of OA patients and associated with cartilage destruction

and the initiation and propagation of inflammatory signals (Kapoor et al., 2011). These

cytokines inhibit anabolic activities in the cartilage by down-regulating the expression of

extracellular matrix (ECM) components collagen type II and aggrecan (Chadjichristos et al.,

2003; Seguin & Bernier, 2003). They also stimulate the release of proteolytic enzymes; matrix

metalloproteinases (MMPs) -1, -3 and -13 (Lefebvre et al., 1990) and ADAMTS-4 (a disintegrin-

like and metalloproteinase with thrombospondin type 1 motifs; Tortorella et al., 2001), which

regulate the degradation of collagens and aggrecan, respectively.

63

Serum amyloid A (SAA) is synthesized by the liver during systemic acute phase response.

However, local expression of SAA mRNA has been reported in other cells in response to

inflammatory stimuli. Both mRNA and protein expression were strongly induced by

lipopolysaccharide (LPS) treatment in chick embryo chondrocytes (Zerega et al., 2004) and SAA

levels were elevated in OA cartilage and synovial fluid (Vallon et al., 2001; Sukenik et al.,

1988). Although the function of SAA is not fully understood, local production suggests a role

for this protein within the site of expression, rather than exclusively during systemic responses.

MicroRNAs (miRNAs) have emerged as important regulators of cartilage development and

homeostasis (Hong & Reddi, 2012). These small non-coding RNA species alter gene expression

by facilitating the decay of specific mRNA targets or by inhibiting translation of target genes.

Expression profiling studies using microarrays and qRT-PCR analysis have identified a number

of microRNA species that are up-regulated and down-regulated in OA cartilage compared to

healthy controls (Illiopoulos et al., 2008; Jones et al., 2009). In particular, several studies have

found the cartilage-specific microRNA miR-140 to be decreased in OA chondrocytes (Tardif et

al., 2009; Miyaki et al., 2009). Asahara and colleagues have shown that the treatment of

chondrocytes with IL-1β reduced miR-140 expression and subsequent studies by the same group

suggested that the regulation of ADAMTS5 by miR-140 contributes to its involvement in OA

pathogenesis (Miyaki et al., 2009; 2010). Another miRNA that has been associated with OA is

miR-146a, which was highly expressed in grade I OA cartilage but decreased with increasing

severity (Yamasaki et al., 2009). Experiments using rat chondrocytes revealed that miR-146a

was induced by IL-1β treatment and identified Smad4 as direct target. Vascular endothelial

64

growth factor (VEGF) was up-regulated by mir-146a expression and this effect was mediated by

Smad4 repression (Li et al., 2012). MicroRNA-9 was increased in human OA cartilage and bone

tissue and its overexpression in chondrocytes suppressed IL-1β-induced TNFα and MMP-13

secretion, suggesting a protective role for this miRNA in OA (Jones et al., 2009). TNFα, IL-1β

and LPS induced miR-155 expression in rheumatoid arthritis synovial fibroblasts (RASFs) and

OASFs, however the expression was higher in RASFs. MiR-155 overexpression in RASFs

repressed mRNA and protein expression of MMP-3 (Stanczyk et al., 2008).

In this study, we examined the effects of proinflammatory cytokines IL-1β and TNFα, and the

acute phase protein SAA on the expression of miR-140, miR-146a, miR-9 and miR-155 in

equine chondrocytes. Of the selected miRNAs, only miR-146a was significantly increased in

response to IL-1β and SAA compared to untreated controls. Although the functional role of

miR-146a in OA has yet to be determined, it appears to be involved in inflammatory pathways in

equine chondrocytes.

65

Materials and Methods

Figure 1: Study design for the isolation and treatment of equine articular chondrocytes.

Following euthanasia, cartilage was harvested and chondrocytes were released by enzymatic

digestion. The cells were treated with recombinant inflammatory proteins or left untreated for 24

or 48 hours at which point RNA was isolated and mRNA levels of cartilage markers,

inflammatory markers and microRNAs were determined.

Chondrocyte isolation, culture and treatment

Cartilage was collected from the articular surface of the third metacarpal bone (MCIII) of 5

horses without clinical evidence of joint or systemic disease, immediately after euthanasia. All

animals were euthanized according to Danish legislative guidelines using captive bolt followed

by exsanguination. Tissue was minced with a scalpel blade and digested with 1.5 mg/ml pronase

66

for 1 hour followed by a second digestion step with 1.5 mg/ml collagenase type II overnight at

37˚C. Digested samples were strained and isolated chondrocytes were seeded in 24-well plates

and maintained in chondrocyte culture medium [high glucose-Dulbecco’s modified eagle

medium (HG-DMEM) with Glutamax, 10% Fetal calf serum, 1% penicillin-streptomycin, 1%

gentamycin, ascorbic acid] at 37˚C with 5% CO2 for 2 days. Chondrocytes were treated with

recombinant equine IL-1β (10ng/mL; R&D Systems, Minneapolis, MN), recombinant equine

TNFα (50ng/mL; R&D Systems, Minneapolis, MN), recombinant human SAA (1μg/mL;

Peprotech, Rocky Hill, NJ) or left untreated for 24 and 48 hours.

RNA isolation, reverse transcription and qPCR

Total RNA, including small RNAs, was isolated using TRI Reagent (Molecular Research Centre,

Cincinnati, OH) according to the manufacturer’s protocol. Briefly, the samples were

homogenized in Tri Reagent and phase separation was achieved by the addition of chloroform.

The RNA in the aqueous phase was precipitated using isopropanol and the pellet was dissolved

in RNAse-free water. RNA concentration and purity were determined using a Nanodrop ND-

1000 spectrophotometer. To determine microRNA expression, 100 ng of RNA was reverse

transcribed using the TaqMan microRNA reverse transcription kit with the appropriate RT stem-

loop primer (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was then performed

using the TaqMan PCR Master Mix and TaqMan microRNA assay (Applied Biosystems, Foster

City, CA). To assess mRNA expression, complementary DNA was synthesized from total RNA

using SuperScript II, oligo(dT)18 and random hexamer primers and qRT-PCR was performed

using Roche LightCycler 480, Fast Start DNA Master SYBR Green I (Roche Diagnostics) and

the equine specific primers found in Table 1. All reactions were run in triplicate. Crossing point

67

(Cp) values for microRNAs were normalized to U6 snRNA, while Cp values for mRNAs were

normalized to GAPDH. Relative gene/miRNA expression was determined using the delta-delta

Ct method.

Protein isolation and quantification

Cells were harvested using Trypsin-EDTA and washed with phosphate buffered saline (PBS).

Once pelleted, cells were lysed using protein lysis buffer [50 mM HEPES (pH 7.6), 100 mM

NaCl, 10 mM EDTA, 1% Triton, 4 mM Na-pyrophosphate, 2 mM Na-orthovanadate, 10 mM

NaF and cOmplete protease inhibitor cocktail (Roche, Indianapolis, IN)] and incubated on ice.

Cell debris was pelleted by 40 000 x g centrifugation at 4°C for 10 minutes. Protein

concentration in the supernatant was quantified using the BioRad DCTM

protein assay according

to the manufacturer’s protocol.

Statistical Analysis

GraphPad Prism 5 Software (San Diego, CA) was used to perform statistical analyses. One way

analysis of variance (ANOVA) with Bonferroni post-test was applied to determine the

differences in gene expression between time points within each treatment group. Data are

expressed as fold differences ± SEM compared with untreated chondrocytes at 0h. Significance

was assigned at p<0.05.

68

Results

Decreased gene expression of cartilage markers

Messenger RNA levels for the ECM components, collagen type II and aggrecan, were decreased

following treatment with IL-1β, TNFα and SAA compared to the untreated controls (Fig. 2).

The expression of collagen type 2 was also reduced at 48h in the untreated controls, highlighting

the importance of avoiding prolonged culture of chondrocytes as this is known to induce

dedifferentiation. CD-RAP mRNA expression decreased in response to IL-1β and SAA and was

increased by TNFα. Similarly, Sox9 was unchanged by IL-1β and SAA but was significantly

increased by TNFα.

Increased gene expression of inflammatory markers

Gene expression of MMPs -1, -3 and -13 was increased by all three treatments, however, the

increase in MMP-1 expression in response to TNFα was not significant. Additionally, mRNA

levels of SAA were increased by all three treatments particularly TNFα which induced SAA

significantly at 48h (Fig. 3).

MicroRNA expression

MiR-140 expression increased at 24h and decreased at 48h in response to all treatments

including controls. A similar pattern was observed for miR-9. MiR-146a expression was

significantly induced by IL-1β and SAA. MiR-155 showed no changes in expression in response

to any of the treatments (Fig. 4).

69

Expression of putative downstream targets

ADAMTS5 showed an increase in expression after 24h which was sustained at 48h. It is not

inversely correlated with miR-140 expression, although neither was altered by inflammatory

stimuli compared to controls. HDAC4 expression was increased in response to all three

treatments, however this induction was only significant for IL-1β and SAA. This gene did not

inversely correlate with miR-140. VEGF expression was significantly increased at 48h in

response to TNFα, although it was expected to be directly correlated to miR-146a as a result of

Smad4 degradation/repression by miR-146a (Li et al., 2012)

Discussion

Osteoarthritis is a degenerative joint disease that affects the cartilage and subchondral bone of

articulating joints. Since proinflammatory cytokines are thought to be involved in OA

development and progression, we treated equine articular chondrocytes with IL-1β or TNFα to

model some of their effects in vitro. Although SAA is normally associated with systemic acute

phase response, this protein has been detected in osteoarthritic cartilage and synovial fluid

(Vallon et al., 2001; Sukenik et al., 1988), suggesting that it may be involved in local

inflammation of OA joints. Therefore SAA was also included as a treatment group. As

expected, the expression of ECM components collagen type II and aggrecan was suppressed by

the cytokines and by SAA. The concentration of CD-RAP is high in OA synovial fluid (Saito et

al., 2002), therefore the expectation was that the inflammatory treatments would increase CD-

RAP mRNA expression, however it was decreased by IL-1β and SAA and slightly increased by

TNFα. The function of CD-RAP in chondrocytes is not clear, but it is thought to inhibit

proliferation (Kondo et al., 2001), therefore the decreased viability of chondrocytes treated with

70

TNFα (Schuerwegh et al., 2003) could be mediated in part by induction of CD-RAP expression.

Sox9 expression levels decline in OA cartilage (Salminen et al., 2001; Brew et al., 2010) and are

suppressed in chondrocytes treated with IL-1β or TNFα (Murakami et al., 2000). Unexpectedly,

Sox9 expression remained relatively unchanged in response to IL-1β and SAA, but was

significantly increased by TNFα.

The expression of inflammatory genes was also determined to confirm the induction of an

inflammatory response by IL-1β, TNFα and SAA. Matrix metalloproteinases -1, -3 and -13 were

induced by all three treatments. SAA expression was induced by inflammatory cytokines as

previously reported in rabbit chondrocytes (Vallon et al., 2001). It was also increased by the

administration of SAA protein, suggesting positive feedback amplification of the inflammatory

signal.

Although the pathogenesis of OA is poorly understood, several studies have suggested that

microRNAs may contribute to the abnormal gene and protein expression characteristic of OA.

MicroRNA expression profiling has revealed that the expression of many miRNAs is altered in

OA cartilage compared to healthy controls (Illiopoulos et al., 2008; Jones et al., 2009). Further

studies have attempted to elucidate the functions of specific altered miRNAs in OA. For

instance, miR-140 has been identified as a cartilage-specific microRNA that is decreased in OA

chondrocytes (Illiopoulos et al., 2008, Miyaki et al., 2009; Tardif et al., 2009), therefore miR-140

was expected to decrease in response to IL-1β, TNFα and SAA treatments. Previous studies

have reported conflicting results, Miyaki et al. (2009) state that miR-140 is downregulated by IL-

71

1β treatment in normal human chondrocytes, while Liang et al. (2012) report that it is increased

by IL-1β stimulation in the human cartilage cell line C28/I2. However, in the present study we

observe an increase in miR-140 expression at 24h which returns to baseline at 48h. This pattern

was observed in all groups including untreated controls, suggesting that miR-140 may not be

involved in inflammatory pathways in equine chondrocytes.

The expression of previously described targets ADAMTS5 (Miyaki et al., 2010) and HDAC4

(Tuddenham et al., 2006) was evaluated to determine whether they were inversely correlated

with miR-140 expression. ADAMTS5 mRNA was increased in all treatment groups including

the controls and did not appear to be regulated by miR-140 under these conditions. This

aggrecanase is important for aggrecan turnover in healthy cartilage, but is also thought to be

involved in OA pathogenesis. Contradictory results have been reported regarding the importance

of ADAMTS5 versus its family member ADAMTS4 (Fosang et al., 2008). Knockout mouse

models indicate that the former is the major aggrecanase in OA (Glasson et al., 2004), however

in vitro studies using human chondrocytes demonstrated that ADAMTS5 expression is

unchanged by IL-1β and TNFα, whereas ADAMTS4 was strongly induced by both cytokines

(Moulharat et al., 2004). In a study using equine cartilage explants, ADAMTS5 expression was

induced by IL-1β but to a lesser extent than ADAMTS4 (Busschers et al., 2010). These

discrepancies could be due to differences in cell versus explant culture, duration of cytokine

treatment or species. Expression of HDAC4 was increased by all three treatments compared to

the controls and was not inversely correlated to miR-140 expression. However, the possibility of

HDAC4 regulation by miR-140 on the translational level still remains and protein levels must be

assessed to explore that possibility. HDAC1 and HDAC2 are elevated in human OA

72

chondrocytes and were reported to repress cartilage specific genes (Hong et al., 2009). Further

studies will be required to determine whether a similar role exists for HDAC4 in response to

inflammatory stimuli.

MiR-9 expression is elevated in human OA cartilage and subchondral bone (Jones et al., 2009),

therefore, its expression was expected to increase in response to the inflammatory treatments in

this study. However, miR-9 showed an expression pattern similar to miR-140 with an increase

occurring at 24h followed by a decrease at 48h. IL-1β, TNFα and LPS induced the expression of

miR-155 in OA synovial fibroblasts (Stanczyk et al., 2008), however the same effect was not

observed in equine chondrocytes; treatment with IL-1β, TNFα and SAA had no effect on the

expression of miR-155. Therefore it appears that these miRNAs are not important regulators of

inflammation in equine chondrocytes.

Asahara and colleagues were the first to associate miR-146a with arthritis. They reported that

miR-146a was highly expressed in the synovial tissues from RA patients compared to OA and

normal samples (Nakasa et al., 2008). Next, they determined its expression pattern in OA

cartilage and demonstrated that miR-146a is intensely expressed in low grade OA cartilage but

decreases with severity and that its expression can be induced by IL-1β stimulation (Yamasaki et

al., 2009). This finding is consistent with the IL-1β-induced upregulation of miR-146a that we

observed in equine chondrocytes. Additionally, we found that miR-146a was significantly

increased by SAA, whereas TNFα had no effect. A study using THP-1 cells has been described

in which LPS, IL-1β and TNFα induced miR-146 through NF-κB (Taganov et al., 2006).

Although IL-1β signals via IL-1 receptor type I (IL-1RI) while SAA appears to signal through

73

Toll-like receptors (TLRs; Sandri et al., 2008), it is possible that these pathways converge at NF-

κB to induce miR-146a. This hypothesis could easily be explored by preventing NF-κB

activation using an inhibitor such as pyrrolidine dithiocarbamate (PDTC), then determining

whether IL-1β and SAA-induced miR-146a expression is abrogated. Pathological

vascularization of cartilage can be observed in OA, and VEGF is thought to be a key regulator of

angiogenesis under inflammatory conditions in articular joints (Murata et al., 2008). In a recent

study, upregulation of VEGF expression by miR-146a through mRNA degradation and

translational repression of Smad4 was demonstrated in rat chondrocytes (Li et al., 2012).

Contrary to the findings of Dai and colleagues, we did not identify a correlation between VEGF

mRNA levels and miR-146a. VEGF expression was relatively unchanged in response to IL-1β

and SAA treatment, but increased by TNFα, suggesting that the role of this miRNA in OA may

not be related to VEGF.

Our findings demonstrate that SAA stimulation of equine articular chondrocytes can suppress the

expression of cartilage genes and induce the expression of catabolic enzymes to similar levels as

IL-1β and TNFα, suggesting a potential role for SAA in OA development. We show that

miRNAs -140, -155 and -9 which were previously identified as being differentially expressed in

response to proinflammatory cytokines, were not significantly altered by IL-1β, TNFα or SAA

treatments compared to the untreated controls. This suggests that these microRNAs are not key

regulators of OA pathogenesis in the horse or that this in vitro model does not appropriately

recapitulate in vivo processes. Additional experiments including determination of their

expression in equine OA tissues will be important before ruling them out as therapeutic targets

for the treatment of OA. MiR-146a expression was significantly induced by IL-1β and SAA,

74

suggesting that this microRNA is involved in equine OA pathogenesis. However, its role does

not appear to be mediated by VEGF as IL-1β and SAA-mediated induction of miR-146a had no

effect on its expression. Investigating other targets of miR-146a in chondrocytes may lead to a

better understanding of OA pathogenesis and consequently improve the therapeutic options for

the treatment of OA.

75

Tables

Table 1. Primer pairs used for qRT-PCR

Gene Forward (5’-3’) Reverse (5’-3’) Primer Source

CollagenIIα1 TCTGCAGAATGGGCAGAGGTATA GATAATGTCATCGCAGAGGACATTC Berg et al., 2009

Aggrecan CTTAGAGGACAGAAAGCGAC ACTTTGGGCGGAAGAAGG Trumble et al., 2001

Sox9 ATCTGAAGAAGGAGAGCGAG TCAGAAGTCTCCAGAGCTTG Zehentner et al., 1999

CD-RAP/MIA ATGCCCAAGCTGGCTGA CTTCGATTTTGCCAGGTTTC Berg et al., 2009

MMP-1 CAG TGC CTT CAG AAA CAC GA GCT TCC CAG TCA CTT TCA GC NM_001081847*

MMP-3 TGT GGA GGT GAT GCA CAA ATC GCA TGC CAG GAA ATG TAG TGA A Fehr et al., 2000

MMP-13 GCT GCC TAT GAG CAT CCT TC ACC TCC AGA CCT GGT TTC CT Nomura et al., 2007

SAA CCT GGG CTG CTA AAG TCA TC AGG CCA TGA GGT CTG AAG TG AY246757.1*

HDAC4 GGACATTTGGGTCGTTGTAG CATCGTGGACTGGGACGTGCACC Eivers et al., 2012

ADAMTS5 AACTGGGGGTCCTGGGGGTCCTGG CATTTCTTGCCTCACACTGCTCAT Coyne et al., 2009

VEGF AGG CCA TGA GGT CTG AAG TG CAT CTC TCC TAT GTG TGG CTT TG Desch et al., 2012

GAPDH GGGTGGAGCCAAAAGGGTCATCAT AGCTTTCTCCAGGCGGCAGGTCAG Iqbal et al., 2004

Primers denoted with * were designed by Dr. Lise C. Berg.

76

Figures

Figure 2: Gene expression of cartilage markers in equine articular chondrocytes treated with IL-

1β, TNFα, SAA or untreated after 0, 24 and 48 hours. Collagen II and aggrecan mRNA levels

decreased in response to all three treatments, though significance was only achieved with ACAN

expression in response to SAA. No significant changes were observed for CD-RAP. Sox9

expression was increased in response to TNFα. Data shown as mean ± SEM. (*) p<0.05, (**)

p<0.01, (****) p<0.0001. N=5 per time point.

77

Figure 3: Gene expression of inflammatory markers in equine articular chondrocytes treated with

IL-1β, TNFα, SAA or untreated after 0, 24 and 48 hours. MMPs -1, -3 and -13 increased

significantly in response to all treatments, with the exception of MMP-1 expression in response

to TNFα. SAA was also increased by all three treatments, however significance was only

reached in TNFα treated samples. Data shown as mean ± SEM. (*) p<0.05, (**) p<0.01, (****)

p<0.0001. N=5 per time point.

78

Figure 4: Expression levels of microRNAs in equine articular chondrocytes treated with IL-1β,

TNFα, SAA or untreated after 0, 24 and 48 hours. MiR-140 expression increased after 24h and

decreased at 48h in all groups, however significance was only achieved in the control group.

Mir-9 showed a similar pattern. No significant differences were observed for miR-155. MiR-

146a expression was significantly induced by IL-1β and SAA. Data shown as mean ± SEM. (*)

p<0.05, (**) p<0.01, (***) p<0.001, (****) p<0.0001. N=5 per time point.

79

Figure 5: Gene expression of miR-140 and miR-146a downstream targets in equine articular

chondrocytes treated with IL-1β, TNFα, SAA or untreated after 0, 24 and 48 hours. ADAMTS5

expression increased after 24 hours in all groups including the controls. HDAC4 was

significantly increased in response to IL-1β and SAA. VEGF was significantly increased by

TNFα. Data shown as mean ± SEM. (*) p<0.05, (**) p<0.01, (***) p<0.001, (****) p<0.0001.

N=5 per time point.

80

GENERAL DISCUSSION AND CONCLUSIONS

Orthopaedic injuries involving the joint cartilage are some of the most common causes of

lameness in racehorses (Bailey et al., 1999). Since the tissues resulting from repair generated by

current treatments often consist of mechanically inferior fibrocartilage, alternative methods are

being explored. The multi-lineage differentiation potential and high proliferative capacity of

mesenchymal stromal cells make them excellent candidates for tissue engineering strategies. In

a study by Wilke et al. (2007), equine cartilage defects that were filled with BM-MSCs were

significantly improved after 30 days compared to controls. However, no difference was

observed between groups after 8 months. This study emphasizes the need for a better

understanding of chondrogenic differentiation. MicroRNAs are potent regulators of gene

expression and have recently been associated with cartilage development and homeostasis (Hong

& Reddi, 2012), therefore the aim of the first study was to determine the expression of miR-140,

a cartilage-specific microRNA, during chondrogenesis of eCB-MSCs. The aim of the second

study was to improve the in vitro differentiation technique in order to generate higher numbers of

differentiated cells, as well as increase the homogeneity of the tissues. The membrane culture

system described in this thesis could be used to pre-differentiate eCB-MSCs prior to use in

cartilage tissue engineering approaches. Osteoarthritis is another challenge in articular cartilage

repair. Little is known about the pathogenesis of this disease, therefore the aim of the third study

was to determine the expression of select microRNAs in an in vitro model of OA. The

expression of microRNAs in equine CB-MSCs and chondrocytes as demonstrated in this thesis

suggests that microRNAs could potentially be used to direct or enhance eCB-MSC chondrogenic

differentiation as well as to develop novel biomarker panels of in vivo joint health.

81

In Chapter 1, I demonstrate both that miR-140 is highly expressed in normal equine articular

cartilage and that eCB-MSCs express significantly higher levels of this microRNA after 14 days

of chondrogenic differentiation. These findings reveal for the first time that miR-140 is

expressed in equine cells, even though miR-140 was not identified during an in silico analysis of

microRNAs in the Equus caballus genome (Zhou et al., 2009). Additionally, this work is

consistent with previous reports that miR-140 is cartilage specific (Tuddenham et al., 2006) and

increases during chondrogenesis of MSCs (Miyaki et al., 2009). MicroRNAs function by

repressing translation or inducing transcript degradation, however this study only examined the

potential of miR-140 to regulate the latter due to absence of reliably cross-reactive antibodies for

protein quantification. The expression of miR-140 target mRNAs encoding ADAMTS-5 and

CXCL12 (Miyaki et al., 2009; Nicolas et al., 2008) was supressed during chondrogenesis,

suggesting potential regulation by miR-140. IGFBP5, another miR-140 target (Tardif et al.,

2009), was also examined, but its expression was directly correlated with miR-140 expression.

Together these results indicate that, while some of our findings are consistent with previous

reports, the regulation of miR-140 target genes could vary between species.

The finding that miR-140 expression correlates with both cartilage differentiation and with the

suppression of CXCL12 and ADAMTS-5 mRNA levels suggests that miR-based manipulation

of gene expression might represent a useful component of therapeutic approaches aimed at

improving cartilage differentiation. It will be important to overexpress miR-140 during

chondrogenic differentiation and determine whether it could improve or even induce

chondrogenesis. Evidence for the potential of microRNAs to alter cell fate has been provided by

recent studies in which specific microRNAs have been used to create induced pluripotent stem

82

cells (Lin et al., 2008) and to transdifferentiate fibroblasts to neurons (Ambasudhan et al., 2011;

Yoo et al., 2011). The induction of in vitro chondrogenesis using microRNA has not yet been

shown, but the tissue specificity of miR-140 makes it an excellent candidate. This approach

could be applied to cell-based cartilage repair strategies such as chondrocyte implantation and

osteochondral grafts. It will be of crucial importance to elucidate miR-140-mediated pathways in

equine cartilage development and homeostasis before applying these small molecules in

veterinary medicine.

Although miR-140 appears to be an important miRNA in chondrogenesis, several other miRNAs

with targets in chondrogenic pathways have been identified. For instance, miR-145 was reported

to directly repress Sox9 during TGF-β3 induced chondrogenic differentiation of murine MSCs

(Yang B et al., 2011) and miR-199a* inhibited BMP2-induced chondrogenesis by targeting

Smad1 (Lin et al., 2009). It would be interesting to determine whether simultaneous

overexpression of miR-140 and knockdown of miR-145 or miR-199a* would have an additive

effect on the induction of a chondrogenic phenotype.

Another parameter that merits investigation is the direct effect of transforming growth factor beta

(TGF-β) on the expression of miR-140. The addition of soluble growth factors of the TGF-β

superfamily to chondrogenic differentiation media is an established method for stimulating in

vitro chondrogenesis (Johnstone et al., 1998). However, a recent study by Davis and colleagues

has revealed that a selective group of microRNAs are directly regulated by signal transducers of

the TGFβ/BMP pathway, the Smads. The majority of miRNAs in this group contain a consensus

sequence (R-SBE) in the stem region of their primary transcripts that is similar to Smad binding

83

element (SBE). They propose a mechanism in which receptor-regulated Smads (R-Smads) bind

directly to R-SBE in pri-miRNAs in response to TGFβ or BMP-4 stimulation to provide a

platform for the recruitment of microRNA processing enzymes Drosha and DGCR8, thus

facilitating pri-miRNA cleavage by Drosha. MiR-140 was identified as one miRNA containing a

putative R-SBE. However, this study was conducted in human pulmonary artery smooth muscle

cells (PASMC) and the TGFβ or BMP-4 stimulation was applied for 24 hours or less (Davis et

al., 2010). Determining whether this mechanism also applies to the expression of miR-140

during chondrogenic differentiation will improve our understanding of the complex network of

molecular interactions that regulate chondrogenesis.

In Chapter 2, chondrogenic differentiation of eCB-MSCs in a membrane-based culture system

was compared to the traditional pellet culture system. While both systems yielded hyaline-like

cartilage tissues, peripheral areas of the pellet cultures appeared fibrous. The tissues generated in

the membrane system were more homogeneous, which suggests that nutrient and oxygen

gradients were more evenly distributed in this system. Although chondrogenic differentiation

using membrane culture has been reported (Lee et al., 2011), this study is the first to show that

membrane culture using fibronectin-coated PTFE inserts can support chondrogenesis of equine

CB-MSCs. A major concern in cartilage tissue engineering is the induction of hypertrophy in

the differentiating chondrocytes. An attempt was made to examine the expression of collagen X

using immunostaining, however the antibody used was a sample developed by a collaborator and

did not appear to stain with any specificity. To determine whether hypertrophy is present or

induced in the membrane system, it will be necessary to examine the expression of hypertrophy-

84

related markers such as MMP-13, collagen X, Runx2 and activity of ALP and to compare with

pellet culture where it is often observed (Pelttari et al., 2006).

Another obstacle to overcome is the variability with which the cells adhere to the membrane.

Fortunately, all membrane cultures remained even, multi-cell layered tissues during the

differentiation period in this study, however, attempts to replicate these results proved to be a

challenge. Uneven distribution of the cells on the membrane, formation of cell ‘clumps’ and

peeling of the cell layers from the membrane were observed during subsequent attempts. One

hypothesis for these inconsistencies is that, although the cells may bind to the fibronectin, the

fibronectin itself was not thoroughly bound to the PTFE membrane. Thus, future work should

take into consideration different types of adhesion molecules and/or different coating procedures.

An attractive alternative to the use of fibronectin is the exploitation of its integrin recognition

sequence, the RGD (arginine-glycine-aspartate) peptide (Pierschbacher & Ruoslahti, 1984). In a

study using sodium alginate scaffolds with chemically immobilized RGD peptides, cell adhesion

of human MSCs and gene expression of sox9 and collagen II following differentiation were

increased in the RGD-immobilized cell constructs compared to unmodified scaffolds (Re’em et

al., 2010). To the author’s knowledge, RGD-coating of PTFE cell culture inserts for

chondrogenic differentiation has not been reported. However, PTFE vascular grafts coated with

RGD-peptides improved endothelial cell attachment using a strategy involving a pre-coating of

poly-L-lysine, incubation with glutardialdehyde and finally RGD-peptide application

(Walluscheck et al., 1996). In theory, a similar approach could be used for cartilage tissue

engineering.

85

Figure 1: Schematic representation of biochemical reactions for RGD-coating on PTFE

(modified from Walluscheck et al., 1996).

Although much is left to be explored with regard to potential hypertrophy and inconsistent

adhesion, it appears that when eCB-MSCs are successfully differentiated in membrane culture,

the resulting cartilage tissue is superior to pellet culture. Additionally, this system is

advantageous as it can generate an increased number of differentiated cells (2 million/membrane

vs. 250 000/pellet) that could be applied to cartilage repair treatments.

In Chapter 3, the expression of 4 different microRNAs previously associated with osteoarthritis

was examined in equine articular chondrocytes treated with inflammatory stimuli. The

application of SAA caused a decrease in the expression of ECM components and a significant

increase in the expression of MMPs to similar levels as IL-1β and TNFα. This suggests that

SAA may have an important role in equine OA. While miR-140, miR-9 and miR-155 were not

differentially expressed in response to the treatments compared to controls, miR-146a expression

was significantly induced by IL-1β and SAA. This finding is consistent with previous reports

associating miR-146a with OA-related inflammation (Nakasa et al., 2008; Yamasaki et al.,

86

2009). During this study, articular chondrocytes were treated with pro-inflammatory cytokines

and SAA in order to simulate an osteoarthritic environment, however, the development and

progression of OA pathogenesis is complex and not fully understood. Assessment of miR-146a

expression in equine OA cartilage, plasma and synovial tissues compared to healthy controls,

will provide a better indication of the utility of this microRNA as a biomarker of OA. Yamasaki

et al. (2009) reported that miR-146a was highly expressed in the cartilage of patients with milder

cases of OA, but that its expression decreased with severity. It will therefore be important to

consider the severity of OA during this type of study.

In a study addressing the function of miR-146a in cartilage homeostasis, human articular

chondrocytes were treated with IL-1α, with or without pre-miR-146a mimics for 48h. They

reported that miR-146a had an antagonistic effect on catabolic signals, as miR-146a transfection

reduced the IL-1α-induced expression of matrix degrading enzymes MMP-13 and ADAMTS5,

and antagonized IL-1α-mediated suppression of collagen II and aggrecan (Li et al., 2011). These

findings support the hypothesis that in early OA, miR-146a is highly induced by inflammatory

cytokines as part of a cellular response to repair or prevent additional tissue damage, and that the

low levels of miR-146a in late-stage OA may contribute to the progression of cartilage

degradation as the catabolic signals are derepressed (Yamasaki et al., 2009).

Although evidence that miR-146a is involved in OA pathogenesis is accumulating, little is

known about its molecular interactions. In fact, the only target reported in chondrocytes is

Smad4. Using miR-146a overexpression and knockdown and 3’UTR luciferase assays, Li and

colleagues (2012) demonstrated that miR-146a directly targets Smad4 for translational repression

87

and mRNA degradation. They propose that miR-146a contributes to OA pathogenesis by

increasing the expression of VEGF and reducing cellular response to TGFβ through the

inhibition of Smad4 (Li et al., 2012). Whether miR-146a acts as an activator during early OA or

serves a protective role as previously suggested (Yamasaki et al., 2009; Li et al., 2011) is

unclear. Elucidation of novel miR-146a targets using in vitro and in vivo models of OA may

lead to a greater understanding of the pathogenesis of this disease and may indicate whether or

not miR-146a represents an appropriate therapeutic target for the treatment of OA.

Clinically, there are several problems associated with direct miRNA administration, such as

delivery to targeted cells, degradation by endogenous RNAses and immunogenic reactions.

However, Ochi and colleagues have reported on intra-articular and intravenous administration of

synthetic miRs in experimental models of arthritis with some success. The injection of double

stranded miR-15a into the joints of arthritic mice induced apoptosis in the synovium by

suppressing Bcl-2 expression and although a therapeutic effect was not demonstrated, there was

little evidence of toxicity (Nagata et al., 2009). More recently, the same group demonstrated that

intravenous administration of miR-146a prevented joint destruction by inhibiting

osteoclastogenesis in arthritic mice (Nakasa et al., 2011). Whether or not double stranded

miRNA can be taken up by chondrocytes in vivo in the joint following cartilage damage has yet

to be determined, but may present a significant challenge due to the avascularity and dense

ECM. Recently, a novel method for cartilage-targeted gene delivery was reported. Using phage

display technology, a chondrocyte affinity peptide (CAP) was identified. This peptide was

conjugated to polyethylenimine (PEI) and the resulting CAP-PEI was complexed to pRL-CMV,

a plasmid that constitutively expresses luciferase. Following CAP-PEI/DNA delivery to rabbit

88

knee joints, tissues were collected and luciferase activity was measured. They found that

transfections using CAP-modified vectors were significantly more efficient and specific than

scrambled peptide-modified vectors (Pi et al., 2011). This innovative technique could potentially

be used to deliver microRNA expression plasmids in cartilage repair therapies.

In conclusion, the hypotheses of this MSc thesis were addressed and supported by the findings

that a) miR-140 is expressed in equine cells, specifically articular chondrocytes and

differentiating eCB-MSCs, b) chondrogenic differentiation using membrane culture appeared

superior to pellet culture based on histological assessment, and c) miR-146a was differentially

expressed in response to IL-1β and SAA. Each chapter of this thesis could be considered as a

stand-alone study, but the common thread is that the purpose of each was to gain a better

understanding of cartilage development and homeostasis in the horse. Although additional work

is required to determine the suitability of miRNA-based therapeutics for equine cartilage repair, a

potential role for microRNAs in eCB-MSC chondrogenesis and OA-related inflammation has

been established.

89

REFERENCES

Abouheif MM, T Nakasa, H Shibuya, T Niimoto, W Kongcharoensombat and M Ochi. (2010). Silencing

microRNA-34a inhibits chondrocyte apoptosis in a rat osteoarthritis model in vitro. Rheumatology

49(11): 2054-60.

Adams CS and IM Shapiro. (2002). The fate of the terminally differentiated chondrocyte: evidence for

microenvironmental regulation of chondrocyte apoptosis. Critical Reviews in Oral Biology & Medicine

13(6): 465-473.

Ahmed N, R Dreier, A Gopferich, J Grifka and S Grassel. (2007). Soluble signalling factors derived from

differentiated cartilage tissue affect chondrogenic differentiation of rat adult marrow stromal cells. Cell

Physiology and Biochemistry 20: 665-678.

Ahmed TAE and MT Hincke. (2010). Strategies for articular cartilage lesion repair and functional

restoration. Tissue Engineering Part B: Reviews 16(3): 305-329.

Akhtar N, Z Rasheed, S Ramamurthy, AN Anbazhagan, FR Voss and TM Haqqi. (2010). MicroRNA-27b

regulates the expression of matrix metalloproteinase 13 in human osteoarthritis chondrocytes. Arthritis

and Rheumatism 62(5): 1361-71.

Amarilio R, SV Viukov, A Sharir, I Eshkar-Oren, RS Johnson and E Zelzer. (2007). HIF1α regulation

of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early

skeletogenesis. Development 134: 3917-3928.

Ambasudhan R, M Talantova, R Coleman, X Yuan, S Zhu, SA Lipton and S Ding. (2011). Direct

reprogramming of adult human fibroblasts to functional neurons under defined conditions. Cell Stem

Cell 9(2): 113-118.

Araldi E & E Schipani. (2010). MicroRNA-140 and the silencing of osteoarthritis. Genes & Development

24: 1075-1080.

Bailey CJ, SW Reid, DR Hodgson and RJ Rose. (1999). Impact of injuries and disease on a cohort of

two- and three year-old thoroughbreds in training. Veterinary Record 145(17): 487–493.

Baksh D, Song L and Tuan RS. (2004). Adult mesenchymal stem cells: characterization, differentiation,

and application in cell and gene therapy. Journal of Cellular and Molecular Medicine 8: 301–316.

Bartel DP. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297.

Basser PJ, Schneiderman R, Bank R, Wachtel E and Maroudas A. (1998). Mechanical properties of the

collagen network in human articular cartilage as measured by osmotic stress technique. Archives of

Biochemistry and Biophysics 351: 207–19.

Berg LC, TG Koch, T Heerkens, K Besonov, PD Thomsen and DH Betts. (2009). Chondrogenic potential

of mesenchymal stromal cells derived from equine bone marrow and umbilical cord blood. Veterinary

and Comparative Orthopaedics and Traumatology 22: 363-370.

90

Brew CJ, PD Clegg, RP Boot-Handford, JG Andrew and T Hardingham. (2010). Gene expression in

human chondrocytes in late osteoarthritis is changed in both fibrillated and intact cartilage without

evidence of generalised chondrocyte hypertrophy. Annals of Rheumatic Diseases 69: 234-240.

Brittberg M, A Lindahl, A Nilsson, C Ohlsson, O Isaksson and L Peterson. (1994). Treatment of deep

cartilage defects in the knee with autologous chondrocyte transplantation. New England Journal of

Medicine 331: 879–895.

Busschers E, JP Holt and DW Richardson. (2010). Effects of glucocorticoids and interleukin-1b on

expression and activity of aggrecanases in equine chondrocytes. American Journal of Veterinary Research

71(2): 176-185.

Cai X and BR Cullen. (2007). The imprinted H19 noncoding RNA is a primary microRNA precursor.

RNA 13: 313-316.

Carlevaro MF, S Cermelli, R Cancedda and F Descalzi Cancedda. (2000). Vascular endothelial growth

factor (VEGF) in cartilage neovascularization and chondrocyte differentiation: auto-paracrine role during

endochondral bone formation. Journal of Cell Science 113(1): 59–69.

Caron JP and RL Genovese. (2003). Principles and practices of joint disease treatment. In: M.W. Ross

and S.J. Dyson (Ed.) Diagnostics and Management of Lameness in the Horse. p. 746-763. Elsevier

Science, Philadelphia.

Castro-Malaspina H, RE Gay, G Resnick, N Kapoor, P Meyers, D Chiarieri, S McKenzie, HE Broxmeyer

and MA Moore. (1980). Characterization of human bone marrow fibroblast colony-forming cells (CFU-F)

and their progeny. Blood 56 (2): 289-301.

Chadjichristos C, Ghayor C, Kypriotou M, Martin G, Renard E, Ala-Kokko L, Suske G, de Crombrugghe

B, Pujol JP and Galéra P. (2003). Sp1 and Sp3 transcription factors mediate interleukin-1beta down-

regulation of human type II collagen gene expression in articular chondrocytes. The Journal of Biological

Chemistry 278: 39762-39772.

Chen WH, MT Lai, ATH Wu, CC Wu, JG Gelovani, CT Lin, SC Hung, WT Chiu and WP Deng. (2009).

In vitro stage-specific chondrogenesis of mesenchymal stem cells committed to chondrocytes. Arthritis

and Rheumatism 60: 450–459.

Chen CZ, L Li, HF Lodish and DP Bartel. (2004). MicroRNAs modulate hematopoietic lineage

differentiation. Science 303: 83–86.

Coyne MJ, H Cousin, JP Loftus, PJ Johnson, JK Belknap, CM Gradil, SJ Black and D Alfandari. (2009).

Cloning and expression of ADAM-related metalloproteases in equine laminitis. Veterinary Immunology

and Immunopathology 129(3–4): 231–241.

Cristino S, A Piacentini, C Manferdini, K Codeluppi, F Grassi, A Facchini and Gina Lisignoli. (2008).

Expression of CXC chemokines and their receptors is modulated during chondrogenic differentiation of

human mesenchymal stem cells grown in three-dimensional scaffold: evidence in native cartilage. Tissue

Engineering Part A 14(1): 97-105.

Darling EM and KA Athanasiou. (2005). Rapid phenotypic changes in passaged articular chondrocyte

subpopulations. Journal of Orthopaedic Research 23: 425-432.

91

Davis BN, AC Hilyard, PH Nguyen, G Lagna and A Hata. (2010). Smad proteins bind a conserved RNA

sequence to promote microrna maturation by Drosha. Molecular Cell 39(3): 373–384.

De Bari C, TB Kurth and Andrea Augello. (2010). Mesenchymal stem cells from development to

postnatal joint homeostasis, aging, and disease. Birth Defects Research (C) 90:257–271.

Desch A, Strozyk EA, Bauer AT, Huck V, Niemeyer V, Wieland T and Schneider SW. (2012). Highly

invasive melanoma cells activate the vascular endothelium via an MMP-2/Integrin αvβ5-induced

secretion of VEGF-A. The American Journal of Pathology 181(2): 693-705.

Dickhut A, Pelttari K, Janicki P, Wagner W, Eckstein V, Egermann M and Richter W. (2009).

Calcification or dedifferentiation: requirement to lock mesenchymal stem cells in a desired differentiation

stage. Journal of Cell Physiology 219(1): 219-26.

Du T and PD Zamore. (2005). MicroPrimer: the biogenesis and function of miRNA. Development 132:

4645–4652.

Dudek KA, JE Lafont, A Martinez-Sanchez and CL Murphy. (2010). Type II collagen expression is

regulated by tissue-specific mir-675 in human articular chondrocytes. The Journal of Biological

Chemistry 285: 24381-24387.

Dunn W, G DuRaine and AH Reddi. (2009). Profiling microRNA expression in bovine articular cartilage

and implications for mechanotransduction. Arthritis & Rheumatism 60: 2333–2339.

Ebert JR, WB Robertson, J Woodhouse, M Fallon, MH Zheng, T Ackland and DJ Wood. (2011). Clinical

and magnetic resonance imaging–based outcomes to 5 years after matrix-induced autologous chondrocyte

implantation to address articular cartilage defects in the knee. American Journal Sports Medicine 39(4):

753-763.

Ebisawa K, Hata K, Okada K, Kimata K, Ueda M, Torii S, Watanabe H. (2004). Ultrasound enhances

transforming growth factor beta-mediated chondrocyte differentiation of human mesenchymal stem cells.

Tissue Engineering 10 : 921-929.

Eivers SS, BA McGivney, J Gu, DE MacHugh, LM Katz and EW Hill. (2012). PGC-1α encoded by the

PPARGC1A gene regulates oxidative energy metabolism in equine skeletal muscle during exercise.

Animal Genetics 43(2): 153–162.

Elia L, M Quintavalle, J Zhang, R Contu, L Cossu, MVG Latronico, KL Peterson, C Indolfi, D Catalucci,

J Chen, SA Courtneidge and G Condorelli. (2009). The knockout of miR-143 and -145 alters smooth

muscle cell maintenance and vascular homeostasis in mice: correlates with human disease. Cell Death and

Differentiation 16: 1590–1598.

Fehr JE, GW Trotter, JT Oxford and DA Hart. (2000). Comparison of Northern blot hybridization and a

reverse transcriptase-polymerase chain reaction technique for measurement of mRNA expression of

metalloproteinases and matrix components in articular cartilage and synovial membrane from horses with

osteoarthritis. American Journal of Veterinary Research 61(8): 900-905.

Fortier LA and RKW Smith. (2008). Regenerative medicine for tendinous and ligamentous injuries of

sport horses. Veterinary Clinics of North America: Equine Practice 24(1): 191-201.

92

Fosang AJ, FM Rogerson, CJ East and H Stanton. (2008). ADAMTS-5: the story so far. European Cells

and Materials 15: 11-26.

Frenz DA, Akiyama SK, Paulsen DF and Newman SA. (1989). Latex beads as probes of cell surface-

extracellular matrix interactions during chondrogenesis: evidence for a role for amino-terminal heparin-

binding domain of fibronectin. Developmental Biology 136(1): 87-96.

Gadjanski I, K Spiller and G Vunjak-Novakovic. (2012). Time-dependent processes in stem cell-based

tissue engineering of articular cartilage. Stem Cell Reviews and Reports 8 (3): 863-881.

Glasson SS, R Askew, B Sheppard, B Carito, T Blanchet, HL Ma, CR Flannery, D Peluso, K Kanki, Z

Yang, MK Majumdar and EA Morris. (2005). Deletion of active ADAMTS5 prevents cartilage

degradation in a murine model of osteoarthritis. Nature 434: 644-648.

Goodrich LR and AJ Nixon. (2006). Medical treatment of osteoarthritis in the horse – A review. The

Veterinary Journal 171: 51–69.

Grad S, Eglin D, Alini M and Stoddart MJ. (2011). Physical stimulation of chondrogenic cells in vitro:

a review. Clinical Orthopaedics and Related Research 469(10): 2764-72.

Guest DJ, Smith MR, Allen WR. (2008). Monitoring the fate of autologous and allogeneic mesenchymal

progenitor cells injected into the superficial digital flexor tendon of horses: preliminary study. Equine

Veterinary Journal 40(2): 178–181.

Guan Y-J, X Yang, L Wei and Q Chen. (2011). MiR-365: a mechanosensitive microRNA stimulates

chondrocyte differentiation through targeting histone deacetylase 4. The FASEB Journal 25: 4457-4466.

Guo X, TF Day, X Jiang, L Garrett-Beal, L Topol and Y Yang. (2004). Wnt/-catenin signaling is

sufficient and necessary for synovial joint formation. Genes & Development 18:2404-2417.

Hangody L, G Vásárhelyi, LR Hangody, Z Sükösd, G Tibay, L Bartha and G Bodó. (2008). Autologous

osteochondral grafting—Technique and long-term results. Injury 39(1): 32-39.

Hardingham TE and AJ Fosang. (1992). Proteoglycans: many forms and many functions. FASEB Journal

6: 861–70.

Hong E and AH Reddi. (2012). MicroRNAs in chondrogenesis, articular cartilage and osteoarthritis:

implications for tissue engineering. Tissue Engineering Part B: Reviews. -Not available-, ahead of print.

Hong S, A Derfoul, L Pereira-Mouries and DJ Hall. (2009). A novel domain in histone deacetylase 1 and

2 mediates repression of cartilage-specific genes in human chondrocytes. The FASEB Journal 23(10):

3539-3552.

Huang W, UI Chung, HM Kronenberg, and B de Crombrugghe. (2001). The chondrogenic transcription

factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of

endochondral bones. Proceedings of the National Academy of Sciences 98: 160-165.

Iliopoulos D, KN Malizos, P Oikonomou and A Tsezou. (2008). Integrative microrna and proteomic

approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory

networks. PLoS ONE 3(11): e3740.

93

Iqbal J, JL Bird, AP Hollander and MT Bayliss. (2004). Effect of matrix depleting agents on the

expression of chondrocyte metabolism by equine chondrocytes. Research in Veterinary Science 77(3):

249–256.

Johnstone B, TM Hering, AI Caplan, VM Goldberg and JU Yoo. (1998). In vitro chondrogenesis of bone

marrow-derived mesenchymal progenitor cells. Experimental Cell Research 238(1): 265-272.

Jones SW, G Watkinsy, N Le Goody, S Roberts, CL Murphy, SMV Brockbank, MRC Needham, SJ Read

and P Newham. (2009). The identification of differentially expressed microRNA in osteoarthritic tissue

that modulate the production of TNF-a and MMP13. Osteoarthritis and Cartilage 17: 464-472.

Kandel RA, M Grynpas, R Pilliar, J Lee, J Wang, S Waldman, P Zalzal, M Hurtig and CIHR-

Bioengineering of Skeletal Tissues Team. (2006). Repair of osteochondral defects with biphasic

cartilage-calcium polyphosphate constructs in a Sheep model. Biomaterials 27: 4120–4131.

Kanichai M, Ferguson D, Prendergast P and Campbell VA. (2008). Hypoxia promotes chondrogenesis in

rat mesenchymal stem cells: A role for AKT and hypoxia-inducible factor (HIF)-1α. Journal of Cellular

Physiology 216: 708–715.

Kapoor M, J Martel-Pelletier, D Lajeunesse, J-P Pelletier and H Fahmi. (2011). Role of proinflammatory

cytokines in the pathophysiology of osteoarthritis. Nature Reviews Rheumatology 7: 33-42.

Kataoka N, M Fujita and M Ohno. (2009). Functional association of the microprocessor complex with the

spliceosome. Molecular and Cellular Biology 29(12): 3243-3254.

Kellner K, Liebsch G, Klimant I, Wolfbeis OS, Blunk T, Schulz MB and Göpferich A. (2002).

Determination of oxygen gradients in engineered tissue using a fluorescent sensor. Biotechnology and

Bioengineering 80:73–83.

Kern S, H Eichler, J Stoeve, H Klüter and K Bieback. (2006). Comparative analysis of mesenchymal stem

cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells 24(5): 1294–1301.

Khan IM, SN Redman, R Williams, GP Dowthwaite, SF Oldfield, CW Archer. (2007). The development

of synovial joints. Current Topics in Developmental Biology 79: 1-36.

Khan WS, Adesida AB, Tew SR, Lowe ET and Hardingham TE. (2010), Bone marrow-derived

mesenchymal stem cells express the pericyte marker 3G5 in culture and show enhanced chondrogenesis

in hypoxic conditions. Journal of Orthopaedic Research 28: 834–840.

Kim D, J Song and E-J Jin. (2010). MicroRNA-221 regulates chondrogenic differentiation through

promoting proteosomal degradation of slug by targeting mdm2. The Journal of Biological Chemistry

285(35): 26900–26907.

Kim YJ, HJ Kim and GI Im. (2008). PTHrP promotes chondrogenesis and suppresses hypertrophy from

both bone marrow-derived and adipose tissue-derived MSCs. Biochemical and Biophysical Research

Communications 373(1): 104-8.

Kim HJ, JD Delaney and T Kirsch. (2010). The role of pyrophosphate/phosphate homeostasis in terminal

differentiation and apoptosis of growth plate chondrocytes. Bone 47(3): 657-665.

94

Knutsen G, L Engebretsen, TC Ludvigsen, JO Drogset, T Grøntvedt, E Solheim, T Strand, S Roberts, V

Isaksen and O Johansen. (2004). Autologous chondrocyte implantation compared with microfracture in

the knee a randomized trial. The Journal of Bone & Joint Surgery 86(3): 455-464.

Kobayashi T, J Lu, BS Cobb , SJ Rodda, AP McMahon, E Schipani, M Merkenschlager and HM

Kronenberg. (2008). Dicer-dependent pathways regulate chondrocyte proliferation and differentiation.

Proceedings of the National Academy of Sciences. 105: 1949–1954.

Koch TG, T Heerkens, PD Thomsen and DH Betts. (2007). Isolation of mesenchymal stem cells from

equine umbilical cord blood. BMC Biotechnology 7(26).

Koch TG, PD Thomsen and DH Betts. (2009). Improved isolation protocol for equine cord blood-derived

mesenchymal stromal cells. Cytotherapy 11(4): 443-447.

Kogler G, S Sensken and P Wernet. (2006). Comparative generation and characterization of pluripotent

unrestricted somatic stem cells with mesenchymal stem cells from human cord blood. Experimental

Hematology 34(11): 1589–1595.

Kondo S, Cha SH, Xie WF and Sandell LJ. (2001). Cytokine regulation of cartilage-derived retinoic acid-

sensitive protein (CD-RAP) in primary articular chondrocytes: suppression by IL-1, bfGF, TGFbeta and

stimulation by IGF-1. Journal of Orthopaedic Research 19(4):712-719.

Koyama E, Shibukawa Y, Nagayama M, Sugito H, Young B, Yuasa T, Okabe T, Ochiai T, Kamiya

N, Rountree RB, Kingsley DM, Iwamoto M, Enomoto-Iwamoto M and Pacifici M. (2008). A distinct

cohort of progenitor cells participates in synovial joint and articular cartilage formation during mouse

limb skeletogenesis. Developmental Biology 316: 62–73.

Kortesidis A, A Zannettino, S Isenmann, S Shi, T Lapidot and S Gronthos. (2005). Stromal-derived

factor-1 promotes the growth, survival, and development of human bone marrow stromal stem cells.

Blood 105: 3793-3801.

Krichevsky AM, KC Sonntag, O Isacson and KS Kosik. (2006). Specific microRNAs modulate

embryonic stem cell–derived neurogenesis. Stem Cells 24: 857–864.

Lacourt M, C Gao, A Li, C Girard, G Beauchamp, JE Henderson, S Laverty. (2012). Relationship

between cartilage and subchondral bone lesions in repetitive impact trauma-induced equine osteoarthritis.

Osteoarthritis and Cartilage 20(6): 572-583.

Lagos-Quintana M, R Rauhut, W Lendeckel and T Tuschl. (2001). Identification of novel genes coding

for small expressed RNAs. Science 294: 853–858.

Lee RC, RL Feinbaum and Victor Ambros. (1993). The C. elegans heterochronic gene lin-4

encodes small RNAs with antisense complementarity to lin-14. Cell 75: 843–854.

Lee CR, AJ Grodzinsky, H-P Hsu, SD Martin and M Spector. (2000). Effects of harvest and selected

cartilage repair procedures on the physical and biochemical properties of articular cartilage in the canine

knee. Journal of Orthopaedic Research 18: 790–799.

Lee OK, TK Kuo, W-M Chen, K-D Lee, S-L Hsieh and T-H Chen. (2004). Isolation of multipotent

mesenchymal stem cells from umbilical cord blood. Blood 103(5): 1669-1675.

95

Lee WD, Hurtig MB, Kandel RA, Stanford WL. Membrane culture of bone marrow stromal cells yields

better tissue than pellet culture for engineering cartilage-bone substitute biphasic constructs in a two-step

process. Tissue Engineering Part C: Methods. 17: 939-948, 2011.

Lefebvre V, Peeters-Joris C and Vaes G. (1990). Modulation by interleukin 1 and tumor necrosis factor a

of production of collagenase, tissue inhibitor of metalloproteinases and collagen types in differentiated

and dedifferentiated articular chondrocytes. Biochimica Biophysica Acta 1052: 366-378.

Lefebvre V and P Smits. (2005). Transcriptional control of chondrocyte fate and differentiation. Birth

Defects Research Part C: Embryo Today 75(3): 200-212.

Lewis BP, CB Burge and DP Bartel. (2005). Conserved seed pairing, often flanked by adenosines,

indicates that thousands of human genes are microRNA targets. Cell 120(1): 15-20.

Li J, J Huang, L Dai, D Yu, Q Chen, X Zhang and K Dai. (2012). MiR-146a, an IL-1b responsive

miRNA, induces vascular endothelial growth factor and chondrocyte apoptosis by targeting Smad4.

Arthritis Research & Therapy 14: R75.

Li X, G Gibson, J-S Kim, J Kroin, S Xu, AJ van Wijnen, H-J Im. (2011). MicroRNA-146a is linked to

pain-related pathophysiology of osteoarthritis. Gene 480(1–2): 34-41.

Liang Z, H Zhuang, G Wang, Z Li, H Zhang, T Yu and B Zhang. (2012). MiRNA-140 is a negative

feedback regulator of MMP-13 in IL-1β-stimulated human articular chondrocyte C28/I2 cells.

Inflammation Research 61(5): 503-509.

Lin S-L, DC Chang, S Chang-Lin, C-H Lin, DTS Wu, DT Chen and S-Y Ying. (2008). Mir-302

reprograms human skin cancer cells into a pluripotent ES-cell-like state. RNA 14: 2115-2124.

Lin EA, L Kong, X-H Bai, Y Luan and C Liu. (2009). miR-199a*, a bone morphogenic protein 2-

responsive microRNA, regulates chondrogenesis via direct targeting to Smad1. The Journal of Biological

Chemistry 284: 11326-11335.

Mankin, HJ. (1982). The response of articular cartilage to mechanical injury. Journal of Bone and Joint

Surgery 64: 460.

Markway BD, G-K Tan, G Brooke, JE Hudson, JJ Cooper-White and MR Doran. (2010). Enhanced

chondrogenic differentiation of human bone marrow-derived mesenchymal stem cells in low oxygen

environment micropellet cultures. Cell Transplantation 19: 29-42.

Martinez-Sanchez A, KA Dudek and CL Murphy. (2012). Regulation of human chondrocyte function

through direct inhibition of cartilage master regulator Sox9 by MicroRNA-145. The Journal of Biological

Chemistry 287: 916-924.

McGivney BA, PA McGettigan, JA Browne, ACO Evans, RG Fonseca, BJ Loftus, A Lohan, DE

MacHugh, BA Murphy, LM Katz and EW Hill. (2010). Characterization of the equine skeletal muscle

transcriptome identifies novel functional responses to exercise training. BMC Genomics 11: 398.

Miyaki S, T Nakasa, S Otsuki, SP Grogan, R Higashiyama, A Inoue, Y Kato, T Sato, MK Lotz and H

Asahara. (2009). MicroRNA-140 is expressed in differentiated human articular chondrocytes and

modulates interleukin-1 responses. Arthritis and Rheumatism 60(9): 2723-2730.

96

Miyaki S, T Sato, A Inoue, S Otsuki, Y Ito, S Yokoyama, Y Kato, F Takemoto, T Nakasa, S Yamashita,

S Takada, MK Lotz, H Ueno-Kudo and H Asahara. (2010). MicroRNA-140 plays dual roles in both

cartilage development and homeostasis. Genes and Development 24: 1173-1185.

Moulharat N, Lesur C, Thomas M, Rolland-Valognes G, Pastoureau P, Anract P, De Ceuninck F and

Sabatini M. (2004). Effects of transforming growth factor-beta on aggrecanase production and

proteoglycan degradation by human chondrocytes in vitro. Osteoarthritis and Cartilage 12: 296-305.

Murakami S, V Lefebvre and B de Crombrugghe. (2000). Potent inhibition of the master chondrogenic

factor Sox9 gene by interleukin-1 and tumor necrosis factor-α. The Journal of Biological Chemistry 275:

3687-3692.

Murata M, K Yudoh and K Masuko. (2008). The potential role of vascular endothelial growth factor

(VEGF) in cartilage: How the angiogenic factor could be involved in the pathogenesis of osteoarthritis?

Osteoarthritis and Cartilage 16(3): 279-286.

Nagata Y, T Nakasa, Y Mochizuki, M Ishikawa, S Miyaki, H Shibuya, K Yamasaki, N Adachi, H

Asahara and M Ochi. (2009). Induction of apoptosis in the synovium of mice with autoantibody-mediated

arthritis by the intraarticular injection of double-stranded MicroRNA-15a. Arthritis & Rheumatism 60(9):

2677–2683.

Nakamura Y, JB Inloes, T Katagiri and T Kobayashi. (2011). Chondrocyte-specific microRNA-140

regulates endochondral bone development and targets dnpep to modulate bone morphogenetic protein

signaling. Molecular and Cellular Biology 31(14): 3019-3028.

Nakasa T, S Miyaki, A Okubo, M Hashimoto, K Nishida, M Ochi and H Asahara. (2008). Expression of

microRNA-146 in rheumatoid arthritis synovial tissue. Arthritis & Rheumatism 58(5): 1284–1292.

Nakasa T, H Shibuya, Y Nagata, T Niimoto and M Ochi. (2011). The inhibitory effect of microRNA-

146a expression on bone destruction in collagen-induced arthritis. Arthritis & Rheumatism 63(6): 1582–

1590.

Nehrer S and Minas T. (2000). Treatment of articular cartilage defects. Investigative Radiology 35(10):

639-46.

Nelea V, Luo L, Demers CN, Antoniou J, Petit A, Lerouge S, R Wertheimer M and Mwale F. (2005).

Selective inhibition of type X collagen expression in human mesenchymal stem cell differentiation on

polymer substrates surface-modified by glow discharge plasma. Journal of Biomedical Materials

Research 75A: 216–223.

Ng LJ, S Wheatley, GE Muscat, J Conway-Campbell, J Bowles, E Wright, DM Bell, PP Tam, KS Cheah

and P Koopman. 1997. SOX9 binds DNA, activates transcription, and coexpresses with type II collagen

during chondrogenesis in the mouse. Developmental.Biology 183: 108-121.

Nicolas FE, H Pais, F Schwach, M Lindow, S Kauppinen, V Moulton and T Dalmay. (2008).

Experimental identification of microRNA-140 targets by silencing and overexpressing miR-140. RNA

14: 2513-2520.

Nicoloso MS, R Spizzo, M Shimizu, S Rossi and GA Calin. (2009). MicroRNAs — the micro steering

wheel of tumour metastases. Nature Reviews Cancer 9: 293-302.

97

Nomura M, Hosaka Y, Kasashima Y, Ueda H, Takehana K, Kuwano A and Arai K. (2007). Active

expression of matrix metalloproteinase-13 mRNA in the granulation tissue of equine superficial digital

flexor tendinitis. The Journal of Veterinary Medical Science 69(6): 637-9.

Ohgawara T, S Kubota, H Kawaki, S Kondo, T Eguchi, N Kurio, E Aoyama, A Sasaki and M Takigawa.

(2009). Regulation of chondrocytic phenotype by micro RNA 18a: involvement of Ccn2/Ctgf as a major

target gene. FEBS Letters 583: 1006–1010.

Pacini S, Spinabella S, Trombi L, Fazzi R, Galimberti S, Dini F, Carlucci F and Petrini M. (2007).

Suspension of bone marrow-derived undifferentiated mesenchymal stromal cells for repair of superficial

digital flexor tendon in race horses. Tissue Engineering 13(12): 2949–2955.

Paik S, HS Jung, S Lee, DS Yoon, MS Park and JW Lee. (2012). miR-449a Regulates the

Chondrogenesis of Human Mesenchymal Stem Cells Through Direct Targeting of Lymphoid Enhancer-

Binding Factor-1. Stem Cells and Development 21(18): 3298-308.

Pais H, FE Nicolas, SM Soond, TE Swingler, IM Clark, A Chantry, V Moulton and T Dalmay. (2010).

Analyzing mRNA expression identifies Smad3 as a microRNA-140 target regulated only at protein level.

RNA 16: 489-494.

Palmer GD, A Steinert, A Pascher, E Gouze, J-N Gouze, O Betz, B Johnstone, CH Evans and

SC Ghivizzani. (2005). Gene-induced chondrogenesis of primary mesenchymal stem cells in vitro.

Molecular Therapy 12: 219–228.

Pelttari K, A Winter, E Steck, KGoetzke, T Hennig, BG Ochs, T Aigner and W Richter. (2006).

Premature induction of hypertrophy during in vitro chondrogenesis of human mesenchymal stem cells

correlates with calcification and vascular invasion after ectopic transplantation in SCID mice. Arthritis

and Rheumatism 54(10):3254-66.

Pi Y, X Zhang, J Shi, J Zhu, W Chen, C Zhang, W Gao, C Zhou, Y Ao. (2011). Targeted delivery of non-

viral vectors to cartilage in vivo using a chondrocyte-homing peptide identified by phage display.

Biomaterials 32(26): 6324-6332.

Pierschbacher MD and E Ruoslahti. (1984). Variants of the cell recognition site of fibronectin that retain

attachment-promoting activity. Proceedings of the National Academy of Sciences 81(19): 5985-5988.

Re’em T, O Tsur-Gang, S Cohen. (2010). The effect of immobilized RGD peptide in macroporous

alginate scaffolds on TGFβ1-induced chondrogenesis of human mesenchymal stem cells. Biomaterials

31(26): 6746-6755.

Rountree RB, Schoor M, Chen H, Marks ME, Harley V, Mishina Y, Kingsley DM. (2004). BMP receptor

signaling is required for postnatal maintenance of articular cartilage. PLoS Biology 2:e355.

Rubinstein P, RE Rosenfeld, JW Adamson and CE Stevens. (1993). Stored placental blood for unrelated

bone marrow reconstitution. Blood 81: 1679 –1690.

Saito S, S Kondo, S Mishima, N Ishiguro, Y Hasegawa, LJ Sandell and H Iwata. (2002). Analysis of

cartilage-derived retinoic-acid-sensitive protein (CD-RAP) in synovial fluid from patients with

osteoarthritis and rheumatoid arthritis. Journal of Bone and Joint Surgery 84-B:1066-1069.

98

Salminen H, Vuorio E, Saamanen AM. (2001). Expression of Sox9 and type IIA procollagen during

attempted repair of articular cartilage damage in a transgenic mouse model of osteoarthritis. Arthritis and

Rheumatism 44: 947–55.

Sandri S, D Rodriguez, E Gomes, H Pequeno Monteiro, M Russo and A Campa. (2008) Is serum

amyloid A an endogenous TLR4 agonist? Journal of Leukocyte Biology 83(5): 1174-1180.

Saris DBF, J Vanlauwe, J Victor, M Haspl, M Bohnsack, Y Fortems, Vandekerckhove B, Almqvist

KF, Claes T, Handelberg F, Lagae K, van der Bauwhede J,Vandenneucker H, Yang KG, Jelic M,

Verdonk R, Veulemans N, Bellemans J and Luyten FP. Characterized chondrocyte implantation results in

better structural repair when treating symptomatic cartilage defects of the knee in a randomized controlled

trial versus microfracture. American Journal of Sports Medicine 36(2): 235-46.

Schuerwegh AJ, EJ Dombrecht, WJ Stevens, JF Van Offel, CH Bridts and LS De Clerck. (2003).

Influence of pro-inflammatory (IL-1α, IL-6, TNF-α, IFN-γ) and anti-inflammatory (IL-4) cytokines on

chondrocyte function. Osteoarthritis and Cartilage 11(9): 681–687.

Seguin CA and Bernier SM. (2003). TNFalpha suppresses link protein and type II collagen expression in

chondrocytes: Role of MEK1/2 and NF-kappaB signaling pathways. Journal of Cellular Physiology 197:

356-369.

Sekiya I, BL Larson, JT Vuoristo, RL Reger and DJ Prockop. (2005). Comparison of effect of BMP-2, -

4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell and

Tissue Research 320:269-276.

Silver IA. Measurement of pH and ionic composition of pericellular sites. (1975). Philosophical

Transactions of the Royal Society B: Biological Sciences 271:261–72.

Smith RK, Korda M and Blunn GW. (2003). Isolation and implantation of autologous equine

mesenchymal stem cells from bone marrow into the superficial digital flexor tendon as a potential novel

treatment. Equine Veterinary Journal 35(1): 99–102.

Solchaga LA, K Penick, VM Goldberg, AI Caplan and JF Welter. (2010). Fibroblast growth factor-2

enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived

mesenchymal stem cells. Tissue Engineering Part A 16(3): 1009–1019.

Son B-R, LA Marquez-Curtis, M Kucia, M Wysoczynski, AR Turner, J Ratajczak, MZ Ratajczak and A

Janowska-Wieczorek. (2006). Migration of bone marrow and cord blood mesenchymalstem cells in vitro

is regulated by stromal-derived factor-1-CXCR4 and hepatocyte growth factor-c-met axes and involves

matrix metalloproteinases. Stem Cells 24: 1254–1264.

Stanczyk J, DML Pedrioli, F Brentano, O Sanchez-Pernaute,C Kolling, RE Gay, M Detmar, S Gay and D

Kyburz. (2008). Altered expression of microRNA in synovial fibroblasts and synovial tissue in

rheumatoid arthritis. Arthritis and Rheumatism 58: 1001–1009.

Stanton H, Rogerson FM, East CJ, Golub SB, Lawlor KE, Meeker CT, Little CB, Last K, Farmer PJ,

Campbell IK, Fourie AM and Fosang AJ (2005) ADAMTS5 is the major aggrecanase in mouse cartilage

in vivo and in vitro. Nature 434: 648-652.

99

Steck E, Bertram H, Abel R, Chen B, Winter A and Richter W. (2005). Induction of intervertebral disc-

like cells from adult mesenchymal stem cells. Stem Cells. 23(3):403−411.

Steinert AF, GD Palmer, C Pilapil, U Nöth, CH Evans and SC Ghivizzani. (2009). Enhanced in

vitro chondrogenesis of primary mesenchymal stem cells by combined gene transfer. Tissue Engineering

Part A 15(5): 1127-1139.

Steinwachs MR, T Guggi and PC Kreuz. (2008). Marrow stimulation techniques. Injury 39(1): 26-31.

Stenderup K, J Justuesen, C Clausen and M Kassem. (2003). Aging is associated with decreased maximal

life span and accelerated senescence of bone marrow stromal cells. Bone 33: 919 –926.

Sukenik S, Henkin J, Zimlichman S, Skibin A, Neuman L, Pras M, Horowitz J and Shainkin-Kestenbaum

R. (1988). Serum and synovial fluid levels of serum amyloid A protein and C-reactive protein in

inflammatory and noninflammatory arthritis. Journal of Rheumatology 15(6):942-5.

Swingler TE, G Wheeler, V Carmont, HR Elliott, MJ Barter, M Abu-Elmagd, ST Donell, RP Boot-

Handford, MK Hajihosseini, A Münsterberg, T Dalmay, DA Young and IM Clark. (2012). The

expression and function of microRNAs in chondrogenesis and osteoarthritis. Arthritis and Rheumatism

64(6): 1909-19.

Taganov KD, MP Boldin, K Chang and D Baltimore. (2006). NF-κB-dependent induction of microRNA

miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proceedings of the

National Academy of Sciences 103(33): 12481-12486.

Tardif G, D Hum, J-P Pelletier, N Duval and J Martel-Pelletier. (2009). Regulation of the IGFBP-5 and

MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes. BMC

Musculoskeletal Disorders 10: 148.

Tortorella MD, Malfait AM, Deccico C and Arner E. (2001). The role of ADAM-TS4 (aggrecanase-1)

and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation. Osteoarthritis and Cartilage 9(6):

539-52.

Trumble TN, GW Trotter, JR Thom Oxford, W McIlwraith, S Cammarata, JL Goodnight, RC

Billinghurst and DD Frisbie. (2001). Synovial fluid gelatinase concentrations and matrix

metalloproteinase and cytokine expression in naturally occurring joint disease in horses. American

Journal of Veterinary Research 62(9): 1467-1477.

Tuddenham L, G Wheeler, S Ntounia-Fousara, J Waters, MK Hajihosseini, I Clark and T Dalmay. (2006).

The cartilage specific microRNA-140 targets histone deacetylase 4 in mouse cells. FEBS Letters 580:

4214-4217.

Vallon R, F Freuler, N Desta-Tsedu, A Robeva, J Dawson, P Wenner, P Engelhardt, L Boes, J Schnyder,

C Tschopp, R Urfer and G Baumann. (2001). Serum Amyloid A (apoSAA) expression is up-regulated in

rheumatoid arthritis and induces transcription of matrix metalloproteinases. Journal of Immunology 166:

2801-2807.

Vinatier C, D Mrugala, C Jorgensen, J Guicheux and D Noël. (2009). Cartilage engineering: a crucial

combination of cells, biomaterials and biofactors, Trends in Biotechnology 27(5): 307-314.

100

von der Mark K and H von der Mark. (1977). Immunological and biochemical studies of collagen type

transition during in vitro chondrogenesis of chick limb mesodermal cells. Journal of Cell Biology 73:

736-747.

Wakitani S, Mitsuoka T, Nakamura N, Toritsuka Y, Nakamura Y and Horibe S. (2004). Autologous bone

marrow stromal cell transplantation for repair of fullthickness articular cartilage defects in human

patellae: two case reports. Cell Transplantation 13(5):595−600.

Walluscheck KP, G Steinhoff, S Kelm and A Haverich. (1996). Improved endothelial cell attachment on

ePTFE vascular grafts pretreated with synthetic RGD-containing peptides. European Journal of Vascular

and Endovascular Surgery 12(3): 321–330.

Wang Y, Ding C, Wluka AE, Davis S, Ebeling PR, Jones G and Cicuttini FM. (2006). Factors affecting

progression of knee cartilage defects in normal subjects over 2 years. Rheumatology 45(1): 79-84.

Wienholds E, WP Kloosterman, E Miska, E Alvarez-Saavedra, E Berezikov, E de Bruijn, HR Horvitz, S

Kauppinen and RHA Plasterk. (2005). MicroRNA expression in zebrafish embryonic development.

Science 309: 310-311.

Wightman B, I Ha and G Ruvkun. (1993). Posttranscriptional regulation of the heterochronic gene lin-14

by lin-4 mediates temporal pattern formation in C. elegans. Cell 75: 855–862.

Wilke MM, DV Nydam and AJ Nixon. (2007). Enhanced early chondrogenesis in articular defects

following arthroscopic mesenchymal stem cell implantation in an equine model. Journal of Orthopaedic

Research 25: 913-925.

Williams GM, EF Chan, MM Temple-Wong, WC Bae, K Masuda, WD Bugbee and RL Sah. (2010).

Shape, loading, and motion in the bioengineering design, fabrication, and testing of personalized synovial

joints. Journal of Biomechanics 43(1): 156-165.

Winter J, S Jung , S Keller, RI Gregory and S Diederichs. (2009). Many roads to maturity: microRNA

biogenesis pathways and their regulation. Nature Cell Biology 11(3):228-34.

Wohn DY. (2012). Korea okays stem cell therapies despite limited peer-reviewed data. Nature Medicine

18: 329.

Xin M, EM Small, LB Sutherland, X Qi, J McAnally, CF Plato, JA Richardson , R Bassel Duby and EN

Olson. (2009). MicroRNAs miR-143 and miR-145 modulate cytoskeletal dynamics and responsiveness of

smooth muscle cells to injury. Genes & Development 23:2166-2178.

Xu N, T Papagiannakopoulos, G Pan, JA Thomson and KS Kosik. (2009) MicroRNA-145 regulates oct4,

sox2, and klf4 and represses pluripotency in human embryonic stem cells. Cell 137(4):647-58.

Yamasaki K, T Nakasa, S Miyaki, M Ishikawa, M Deie, N Adachi, Y Yasunaga, H Asahara and M Ochi.

(2009). Expression of MicroRNA-146a in osteoarthritis cartilage. Arthritis & Rheumatism 60: 1035–

1041.

Yang B, H Guo, Y Zhang, L Chen, D Ying and S Dong. (2011). MicroRNA-145 regulates chondrogenic

differentiation of mesenchymal stem cells by targeting Sox9. PLoS ONE 6(7): e21679.

101

Yang J, S Qin, C Yi, G Ma, H Zhu, W Zhou, Y Xiong, X Zhu, Y Wang, L He and X Guo. (2011). MiR-

140 is co-expressed with Wwp2-C transcript and activated by Sox9 to target Sp1 in maintaining the

chondrocyte proliferation. FEBS Letters 585 (19): 2992-2997.

Yoo AS, AX Sun, L Li, A Shcheglovitov, T Portmann, Y Li, C Lee-Messer, RE Dolmetsch, RW Tsien

and GR Crabtree. (2011). MicroRNA-mediated conversion of human fibroblasts to neurons. Nature 476:

228-231.

Zehentner BK, C Dony and H Burtscher. (1999). The transcription factor Sox9 is involved in BMP-2

signaling. Journal of Bone and Mineral Research 14(10): 1734–1741.

Zerega B, A Paganoa, A Pianezzi, V Ulivi, L Camardella, R Cancedda and F Descalzi Cancedda. (2004).

Expression of Serum Amyloid A in chondrocytes and myoblasts differentiation and inflammation:

possible role in cholesterol homeostasis. Matrix Biology 23: 35–46.

Zhang X, M Hirai, S Cantero, R Ciubotariu, L Dobrila, A Hirsh, K Igura, H Satoh, I Yokomi, T

Nishimura, S Yamaguchi, K Yoshimura, P Rubinstein and TA Takahashi. (2011). Isolation and

characterization of mesenchymal stem cells from human umbilical cord blood: Reevaluation of critical

factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as

compared to mesenchymal stem cells from bone marrow and adipose tissue. Journal of Cellular

Biochemistry 112: 1206–1218.

Zhong N, J Sun, Z Min, W Zhao, R Zhang, W Wang, J Tian, L Tian, J Ma, D Li, Y Han and S Lu. (2012).

MicroRNA-337 is associated with chondrogenesis through regulating TGFBR2 expression. Osteoarthritis

and Cartilage 20(6): 593-602.

Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T and Zheng Y. (2009).

In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an

integrated ab initio and comparative genomic approach. Genomics 94(2):125-31.

Zhu W, O Boachie-Adjei, BA Rawlins, B Frenkel, AL Boskey, LB Ivashkiv and CP Blobel. (2007). A

novel regulatory role for stromal-derived factor-1 signaling in bone morphogenic protein-2 osteogenic

differentiation of mesenchymal C2C12 cells. The Journal of Biological Chemistry 282:18676-18685.

Zuk PA, M Zhu, P Ashjian, DA De Ugarte, JI Huang, H Mizuno, ZC Alfonso, JK Fraser, P Benhaim

and MH Hedrick. (2002). Human adipose tissue is a source of multipotent stem cells. Molecular Biology

of the Cell 13(12): 4279-4295.

102

APPENDIX 1. Screening of eCB-MSCs

All eCB-MSC cell lines were screened for chondrogenic potential by differentiating pellets for

two weeks then staining with Toluidine Blue. Strongly stained pellets with hyaline-like

morphology (lacunae formation) were grouped as high chondrogenic potential (CP) eCB-MSCs,

while weakly stained pellets were grouped as low CP eCB-MSCs.

103

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedures for culturing eCB-

MSCs, including thawing, expansion, passaging and cryopreservation.

2.0 Related Documents

Document Document No.

Equine cord blood collection and processing SOP.TK.1.0

Cell count using Trypan Blue SOP.TK.2.1

3.0 Definitions

FBS: Fetal Bovine Serum

PBS: Phosphate Buffered Salt solution

HBSS: Hank’s Balanced Salt Solution

EDTA: Ethylenediaminetetraacetic acid

DMEM: Dulbecco’s modified eagle medium

DMSO: Dimethyl sulfoxide

RT: Room temperature

4.0 General Equipment & Materials

Pipette aid & sterile serological pipettes (5, 10 and 25 ml; Corning, cat. nos. 4487, 4488 and 4489, respectively)

RAININ micropipettes & autoclaved sterile tips

Sterile centrifuge tubes (15 ml and 50 ml; Corning, cat. no. 430290)

Sterile bottles with 0.22um filter top.

Rack for centrifuge tubes

Waste Disposal Cup

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Trypan Blue 0.4%

Hemocytometer

Inverted phase contrast microscope

5.0 Procedure

5.1 Reagent Preparation

Title: Cell culture of equine cord-blood derived mesenchymal stromal cells

Prepared by: Approved by: Document no.: SOP.TK.2.0

Carmon Co & Midori Buechli Thomas Koch Review Date: 2012.12.3

104

5.1.1 Expansion Media - 500 ml

Thaw 150 ml FBS (Note: significant batch variability between lots), 5 ml Pen/Strep (10,000IU/mL) and 5 ml L-glutamine (100mM).

Remove 150ml from the 500ml DMEM Lonza bottle to 50ml tubes, date, initial and store in 4°C [7 tubes can be pooled (350 ml) and filter sterilized to make a new bottle].

Add 150 ml of FBS, 5 ml Pen/Strep and 5 ml L-glutamine.

Label bottle with contents, date and initials, store at 4°C.

5.1.2 DPBS 1x

Dilute DPBS 10X stock using MilliQ water (found in the sterilization suite. Record volume taken in log book).

Filter sterilize, aliquot in 50ml tubes, date and initial, store at 4°C.

5.1.3 Trypsin EDTA – 1000 ml

Set up 700mL of Milli-Q water in a 1L-graduated cylinder on a stir plate with a magnetic stir bar.

Add 100mL of HBSS, 1.2 grams of NaHCO3, 0.46 grams of EDTA, 2.5 grams of trypsin, and 200μL of phenol red solution.

Add NaOH until a pH of 8.0 is reached, as EDTA dissolves best at this pH. As the EDTA dissolves, the pH will decrease, so the pH of the solution should be monitored and adjusted during preparation. ! CRITICAL be patient with EDTA dissolving, you may damage the EDTA by rushing the process.

Once all reagents have completely dissolved, add Milli-Q water until the volume of solution of 1L. Adjust the pH of the solution to 7.2-7.4.

Filter sterilize the solution and aliquot into 50mL centrifuge tubes. Label, date, initial, store at -20˚C.

5.1.4 Cryopreservation media

Determine the volume of freezing media required.

Add 20% DMSO to the required volume of expansion media (note- add the DMSO to the media, NOT vice versa).

Cool the solution in the fridge before use. **Before any cell culturing, prepare a culture hood by raising the sash, and spraying ethanol

over the entire surface. Spray down all items that are entering the hood. Allow minimum 5

minutes of air exchange in the hood before cell work.

5.2 Thawing eCB-MSCs

Select a cryovial, note the OVC ID#, e.g. 1289, and the location under Tank/Canister, e.g. TK1/5 in your lab book and mark as removed in the liquid nitrogen log book with date and initials

Spray the cryovial, loosen the lid inside the hood, tighten

Thaw in the 37° C water bath until a sliver of ice remains

In the hood, transfer contents to a labelled 15 ml tube

105

Add 5ml expansion media dropwise and stir with pipette tip. Before the entire 5ml is added, mix by aspirating up and down

Rinse cryovial with 1-2ml of the suspension and add to the 15 ml tube

Centrifugre 150 x g, 5min, RT (blue buttons change settings)

Carefully remove the supernatant without disturbing the pellet at the bottom

Resuspend the pellet with 5 ml expansion media by aspirating up and down

Perform a cell count using trypan blue (see SOP.TK.2.1) and note cell viability and live cells/ml

Seed cells at 5000 live cells/cm2. Label all flasks with culture name, passage number (Pfrozen+1), date and initials

Rock flasks (do not swirl), loosen the caps and incubate at 37.5° C, 5%CO2

5.3 Changing media (every 2-3 days)

Using the microscope, determine the confluency of the culture (what percentage of the surface of the flask is covered). Generally, for <60%, change media, but different cultures grow at different rates so a judgement call will have to be made based on the specific MSC line

In the hood, aliquot the required volume of expansion media into 50ml tube/s and warm in the water bath

Aspirate old media from flask and expel into the waste beaker

Add required volume fresh media (4ml for 25cm2, 12ml for 75cm2, 28ml for 175cm2)

Pipette down the side of the flask to avoid disturbing the cells adhered to the bottom

Rock flasks and incubate at 37.5° C, 5% CO2

5.4 Passaging eCB-MSCs

Warm required volumes of expansion media, trypsin EDTA and 1x DPBS in the water bath

Remove media from flask and rinse the culture surface with DPBS (5ml for T75)

Add trypsin to cover the culture surface (4ml for T75, 1.5ml for T25, 7ml for T175). Rock flask and incubate at 37.5°C for 5 mins

Use the microscope to make sure the cells are round and detached

Place flask in upright position and add an equal volume of media to inactivate the trypsin

Pipette up and down to get single cell suspension and transfer to a labeled 15ml tube

Rinse culture surface with another volume of media and add this to the tube

Centrifuge 150 x g, 5min, RT

Discard the supernatant and resuspend the pellet with 5 ml expansion media

Perform a cell count using trypan blue (see SOP.TK.2.1) and note cell viability and live cells/ml

Seed new flasks (with passage = P+1) or cryopreserve cells

5.5 Cryopreservation

106

After passaging, obtain 2x desired final concentration, e.g. desired 1.0x106/ml, concentrate to 2.0x106/ml

Centrifuge 150 x g, 5min, RT

Resuspend with required volume of expansion media to obtain 2x final concentration, then refrigerate

Prepare the required volume of cryopreservation media, cool before use

Label cryovials (found under the incubator) by hand or using the labelmaker. Include culture name, passage number, total live cells, date frozen and initials

Add cryopreservation media 1:1 with cell suspension – dropwise (avoid osmotic shock to cells), mix

Aspirate solution into pipette and expel 1ml to each cryovial

Put cryovials into the “Mr Freezie” (note Isopropyl alcohol (IPA) use max=5) and place in the -80ºC overnight

Enter sample information into the liquid nitrogen log book, e.g.

Project ID OVC ID# Tank/Canister #Samples Contents Date frozen

Midori 1370 TK1/3 2x4vials 1eCB1006p4-33 2e6/vial

Sept22.10

Label canes with the OVC ID#. Retrieve the cryovials from the -80 and place in canes, then place in the liquid nitrogen tank. (Wear insulated gloves and face protection when using liquid nitrogen)

107

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure outlines the procedure to count cells using trypan

blue. Trypan blue is a dye that can penetrate into cells that have damaged cell

membranes, i.e. dead cells.

2.0 General Equipment & Materials

RAININ micropipettes & autoclaved sterile tips

1.5ml tube containing cell suspension

Trypan Blue 0.1%

Hemocytometer

EtOH 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Inverted phase contrast microscope

3.0 Procedure

In the hood, transfer a small volume of the cell suspension (tip of the pipette) to a 1.5ml tube

On the bench top, add 20ul of cell suspension to 20ul of trypan blue

Pipette up and down to mix

Add 10ul to each chamber of the hemocytometer

Count 8 chambers using the 10x objective

Using the cell counter, count total cells on the left and dead cells on the right (Live cells are round and clear, dead cells are blue)

Calculate cell viability, live cells/mL, volume of cell suspension required and volume of media required according to the following:

Cell viability: (Total-dead)/total x100 = ______%

Total live cell count: [(Total-dead)/nb chambers] x dilution factor x 10 000 =_____cells/ml

Seeding requirement: 5000 cells/cm2 x size of flask cm2 = ________ cells

Cell suspension vol requirement: Seeding requirement/total live cell count =_____ml susp.

Media culture volume: Media vol flask – cell susp. Vol = _______ ml of media

Add the calculated volumes of expansion media and cell suspension to the flask

Clean the hemocytometer with 70% EtOH.

Title: Cell counting using Trypan Blue

Prepared by: Approved by: Document no.: SOP.TK.2.1

Midori Buechli Thomas Koch Review Date: 2012.12.3

108

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for inducing MSCs

towards a chondrogenic cell fate using standard pellet culture or membrane-based

culture.

2.0 Related Documents

Document Document No.

Cell Culture of eCB-MSCs SOP.TK.2.0

Cell count using Trypan Blue SOP.TK.2.1

3.0 Definitions

MSC: Mesechymal stromal cells

PBS: Phosphate Buffered Salt solution

RT: Room temperature

ITS: Insulin Transferrin Selenium

DMEM: Dulbecco’s modified eagle medium

ABAM: Antibacterial-antimycotic

TGFβ: Transforming Growth Factor Beta

PTFE: Polytetrafluoroethylene

4.0 General Equipment & Materials

Pipette aid & sterile serological pipettes (5, 10 and 25 ml; Corning, cat. nos. 4487, 4488 and 4489, respectively)

RAININ micropipettes & autoclaved sterile tips

Sterile centrifuge tubes (15 ml and 50 ml; Corning, cat. no. 430290)

Sterile bottles with 0.22um filter top.

Rack for centrifuge tubes

Waste Disposal Cup

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Centrifuge

Trypan Blue 0.4%

Hemocytometer

Title: Chondrogenic induction of MSCs – membrane and pellet protocols

Prepared by: Approved by: Document no.: SOP.TK.3.0

Midori Buechli & Carmon Co Thomas Koch Review Date: 2012.12.3

109

Polypropylene V-bottom plates (Phenix, cat. no. MPG-651201)

PTFE cell culture inserts 0.4um (Millipore cat. no. PICM01250)

5.0 Procedure

5.1 Reagent Preparation

5.1.1 Chondrogenic Media

Thaw ITS, Proline and ABAM in the water bath

Prepare Chondrogenic media according to the table below. NOTE: Add the ascorbic acid and TGFβ immediately before use.

Filter sterilize using bottle with 0.2 um filter top

Location Reagent Volume for 250ml media

Fridge High Glucose DMEM 240 ml

-20 freezer ITS 1X 2.5 ml

Cupboard Glutamax 200mM 2.5 ml

Fridge in 15ml tubes Sodium pyruvate 100mM 2.5 ml

Fridge in solid/freezer aliquots

Dexamethosone

(100nM in media)

150 µl

-20 freezer Proline 10 mg

-20 freezer ABAM 2.5 ml

Cupboard Ascorbic acid **Add FRESH 1 mg per 10 ml media used

-80 freezer TGFβ3 **Add FRESH 5 µl per 10 ml media used

5.1.2 Coating membranes

Place membranes in a 24 well plate with sterile tweezers

Add 150ul of fibronectin to 1350ul of DMEM. Vortex.

Pipette 100ul of this solution evenly onto the cell culture membranes

Dry overnight in the culture hood with the lid tilted for airflow and the lights off

Before use, UV irradiate for 30 minutes.

NOTE: Coated (DRY) membranes can be stored in a sealed autoclave paper bag. Date and initial.

5.2 Membrane Culture

Expand cells according to SOP.TK.2.0 when a sufficient cell number is reached for the number of membranes to be seeded.

Trypsinize the cells and perform a cell count. Concentrate the cells to 5 x 106 cells/mL in expansion media.

Seed 400uL in each cell culture insert to obtain 2 x 106 cells/membrane.

110

Add 600uL expansion media around the insert.

Incubate at 37.5° C, 5%CO2.

After 24 hours, carefully aspirate the spent expansion media using a 1000uL pipette.

Add 1.5mL chondrogenic media, with ascorbic acid and TGFβ3 added fresh, to each well. NOTE: Aim the pipette tip at the top edge of the cell culture insert so that media runs down the inside and outside wall.

Change chondrogenic media every 2-3 days thereafter for 14-28 days.

5.3 Pellet Culture using 96-well plates

Expand cells according to SOP.TK.2.0 when a sufficient cell number is reached for the number of pellets to be seeded.

Trypsinize the cells and perform a cell count.

Add the required cell suspension volume to seed 2.50 x 105 cells per pellet in the polypropylene plates.

Centrifuge 200 x g, 5 min, RT.

Resuspend the pellet in 200uL chondrogenic media.

Centrifuge 200 x g, 10 min, RT.

Incubate at 37.5° C, 5% CO2 or 5% O2.

Observe small white spherical pellets in the bottom of the plate.

Change chondrogenic media every 2-3 days for 14-28 days. NOTE: Can use a multichannel pipette to add and remove media, but be sure to check the wells after aspirating to make sure that the pellet is still there.

111

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for processing,

embedding and sectioning tissues for histology and immunostaining.

2.0 Related Documents

Document Document No.

3.0 Definitions

IHC: immunohistochemistry

PBS: Phosphate Buffered Salt solution

RT: Room temperature

4.0 General Equipment & Materials

15ml conical tubes

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

10% Formalin

Histoprep 2-propanol

Plastic petri dish

Tissue processor

Tissue cassettes

Lens paper

Tissue embedder and embedding trays

Microtome

Water bath

Snowcoat X-tra Slides White for IHC (Surgipath, cat.no. 3800200)

5.0 Procedure

5.1 Tissue Fixation

For termination of membrane cultures: Remove spent media and turn the insert upside down in a petri dish. Hold the insert with tweezers and cut the membrane out using a scalpel. It is best to slice from one side, then the other and meet at the center.

Title: Tissue preparation for Histology and Immunohistochemistry

Prepared by: Approved by: Document no.: SOP.TK.4.0

Midori Buechli & Carmon Co Thomas Koch Review Date: 2012.12.3

112

Deposit samples (membranes, pellets or other tissues) into labelled 15mL tubes containing enough PBS to cover the sample

In the fume hood, change the PBS to 10% Formalin Leave the samples to fix overnight at 4°C. In the fume hood, change the formalin to 70% EtOH. The samples can then

be processed immediately or stored at 4°C for ~1 week.

5.2 Tissue Processing

Retrieve the samples from the 4°C. In the fume hood in the Histology room, put down paper towels, prepare one beaker with 70% 2-propanol (enough to cover your cassettes) and one small beaker with a few mL of Eosin working solution. Cut squares of lens paper if there aren’t enough there. Label the cassettes in pencil.

Place membrane/pellet on lens paper o Cover with a few drops of eosin stain o Fold the lens paper around the tissue so it will be easy to unfold later

Place the sample in the labelled cassette and place in the 70% alcohol beaker

Place cassettes only (no alcohol) in the processor o Close the latch o Program the processor to delayed start and choose a low fill level o The next morning, retrieve samples at the time indicate

5.3 Embedding

Turn on the embedder

Remove the cassettes from the processor and transfer them to the heating compartment of the embedder. (Hold the paper plate under the basket during transfer to prevent wax from dripping on the floor)

Let the embedder heat up for 30 minutes

Flush the processor according to the instructions.

Take a cassette out of the heating compartment and place on the heated surface

Open the cassette and unwrap the lens paper

Place a metal embedding tray of appropriate size under the wax dispenser and fill the ‘well’ with wax.

Place the sample in the centre of the tray. For the membranes, cut/fold in half on the cutting board using a scalpel blade then place upright in the wax. Make sure there are no bubbles around the tissue.

Press the labelled part of the cassette down into the wax and pour more wax on top to fill.

Cover the cold surface with wax to prevent cracking. Place the trays on this surface to harden the wax.

When the top of the wax in shiny, the wax block can be removed from the tray.

If the wax is cracked or has bubbles etc, place back in heating compartment for half an hour and re-embed

5.4 Sectioning

113

Fill the water bath with water and warm for 15 minutes.

Trim the wax down to the level of the tissue o Press the trim button o Position the wax block near the blade but not touching o Trim until you reach the tissue o Put the cassette back on ice

Section at 5µ using the microtome o Press the section button o Slice at least 3 sections o Carefully place sections on water bath

Pick up section with slide (labelled) o Gently separate desired sections using the tweezers o Pick up the section by approaching the section at a perpendicular

angle to the slide o When the section curls, lift up the slide and the section will be picked

up with it o For slides destined for IHC, be sure to have at least 2 sections on

each slide (a negative control (-1°Ab) is required for IHC)

Dry on rack

Place on slide warmer or the slide incubator overnight

114

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for staining tissues for

Hematoxylin and Eosin and Toluidine Blue.

2.0 Related Documents

Document Document No.

Tissue preparation for Histology and IHC SOP.TK.4.0

3.0 Definitions

IHC: immunohistochemistry

H&E: Hematoxylin and Eosin

NaCl: Sodium Chloride

HCl: Hydrochloric acid

IPA: Isopropyl alcohol

4.0 General Equipment & Materials

Slides with tissue sections

Stains (H&E reagents prepared by Helen)

Xylene

Isopropyl alcohol

Coverslips

5.0 Procedure

5.1 Reagent preparation

5.1.1 Toluidine Blue Stock solution

Add 1g Toluidine Blue powder to 100mL 70%EtOH

Mix to dissolve

5.1.2 1% Sodium Chloride (fresh)

Prepare 1% NaCl in distilled water. E.g. 2g NaCl in 200mL water.

Mix to dissolve

pH to 2.0 with HCl 1N

Title: Histology – Toluidine Blue and Hematoxylin and Eosin staining

Prepared by: Approved by: Document no.: SOP.TK.4.1

Midori Buechli & Carmon Co Thomas Koch Review Date: 2012.12.3

115

5.1.3 Toluidine Blue Working Solution 10%

Add 25mL of Toluidine Blue Stock to 225mL of fresh 1% NaCl

Mix well.

This solution must be made fresh before use.

5.2 Toluidine Blue Staining

Turn the fan on before staining

Deparaffinize in xylene, 3 changes, 2 minutes each

100% IPA, 3 changes, 2 minutes each

70% IPA, 2 minutes

Hydrate in Deionized water, 2 minutes

Stain sections in toluidine blue working solution for 3 minutes.

Wash in distilled water, 3 changes.

Dehydrate: 4 dips 95% IPA, 10 dips 100% IPA (2 changes), Xylene 3 changes, 2 minutes each.

Mount out of the last xylene.

5.3 Hematoxylin and Eosin Staining

Turn the fan on before staining

Deparaffinize in xylene, 3 changes, 2 minutes each

100% IPA, 3 changes, 2 minutes each

70% IPA, 2 minutes

Hydrate in Deionized water, 2 minutes

Stain in Harris hematoxylin solution for 8 minutes

Wash in running tap water for 5 minutes

Differentiate in 1% acid alcohol for 30 seconds

Wash running tap water for 1 minute

Bluing in 0.2% ammonia water for 30 seconds to 1 minute

Wash in running tap water for 5 minutes

Rinse in 95% alcohol, 10 dips

Counterstain in eosin solution for 1 minute

Dehydrate through 3 changes 100% IPA, 2 minutes each and 3 changes Xylene, 2 minutes each

Mount out of the last xylene.

5.4 Mounting

Place a stack of several paper towels in the fume hood

Bring the last xylene container with the boat of slides into the fume hood

Pick up the slide with the tweezers and dry the back with a kimwipe o Be careful not to disturb the stained tissue

Place the cover slip on the paper towel and add one drop of mounting glue in the centre

Place the slide (with the tissue facing downwards) onto the coverslip o The mounting glue will spread out over the slide o Remove any air bubbles by pressing on the coverslip

Allow the slides to air dry in the fume hood.

116

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for staining cartilage

and cartilage-like tissues for collagens type I and II.

2.0 Related Documents

Document Document No.

Tissue preparation for Histology and IHC SOP.TK.4.0

3.0 Definitions

IHC: immunohistochemistry

RT: Room temperature

Ab: Antibody

NaCl: Sodium Chloride

PBS: Phosphate buffered saline

FBS: Fetal bovine serum

IPA: Isopropyl alcohol

DAB: Diaminobenzidine chromagen

HRP: Horse radish peroxidase

4.0 General Equipment & Materials

Slides with tissue sections

Proteinase K

Hyaluronidase

Anti-collagen type I, mAb (VWR int’l, cat.no. CA60801-158)

Anti-collagen type II (Iowa Hybridoma Bank, cat.no. II-II6B3)

DAKO pen, Envision+ HRP mouse, DAB Chromagen (DAKO Cytomation, cat.nos. S2002, K4000, K3467)

FBS

Xylene

Isopropyl alcohol

Coverslips

5.0 Procedure

5.1 Reagent preparation

Title: Immunostaining of cartilage/cartilage-like tissues

Prepared by: Approved by: Document no.: SOP.TK.4.2

Midori Buechli Thomas Koch Review Date: 2012.12.3

117

5.1.1 Sodium acetate buffer, pH 5.5, + 150mM NaCl

Acetic Acid 0.2M o Add 2.89mL glacial acetic acid to 250mL water o Mix well and store at RT

Sodium acetate 0.2M o Add 6.8g of sodium acetate to 250ml water o Mix well and store at RT

Sodium acetate buffer, pH 5.5, + 150mM NaCl o Mix 8.8ml 0.2M Acetic acid with 41.2ml 0.2M Sodium acetate o Add 0.88g NaCl o pH to 5.5 using the acetic acid and sodium acetate solutions o Bring the final volume to 100mL with distilled water o Mix well and store at RT

5.1.2 Hyaluronidase 1600U/mL

Look for the number of units on the bottle (U/mg)

Calculate the number of mgs required to obtain 1600U/mL

Weigh and dissolve in the sodium acetate buffer, pH5.5, 150mM NaCl

Aliquot and store at -20°C

5.1.3 Proteinase K

Prepare a 5mg/mL stock solution using dH2O. Aliquot and store at -20°C.

Prepare a 20μg/mL working solution by diluting the stock solution in PBS. E.g. 20uL of stock solution plus 5mL PBS.

Aliquot and store at -20°C or use immediately.

5.2 Deparaffinization and hydration

Turn the fan on

Deparaffinize in xylene, 3 changes, 2 minutes each

100% IPA, 3 changes, 2 minutes each

70% IPA, 2 minutes

Hydrate in Deionized water, 2 minutes

Remove the slides from the staining boat and place in humidified chamber (tupperware with moistened paper towel lining the bottom and grate on top)

** For all subsequent steps DO NOT to let the sections dry**

5.3 Antigen Retrieval

Use the DAKO pen to separate the (+) section from the (-) section.

Add 100-200uL (enough to cover) of proteinase K 20μg/mL working solution to each section using a dropper

At all times, do not pipette directly onto the tissue section as it could wash the tissue off the slide

Incubate at RT for 10 minutes with the lid on loosely

o Tip off the proteinase K solution and wash the slides 3x with PBS, 2 minutes each

118

o Add 100-200uL (enough to cover) of hyaluronidase 1600U/mL solution to each section using a dropper

o Incubate at 37°C for 20 minutes with the lid on loosely o Tip off the hyaluronidase solution and wash the slides 3x with PBS, 2

minutes each

5.4 Blocking

Prepare a 3% blocking solution o E.g. 5 slides x 2 section/slide = 10sections

x 200uL blocking/section = 2000uL blocking required

o 2000uL x 30% = 60uL FBS o Add 1940uL PBS

Apply the blocking solution to the sections

Incubate for 30 minutes at RT.

Wash the slides 3x with PBS, 2 minutes each

5.5 Primary Antibody incubation

Prepare Antibody dilutions. The following table provides an example.

Antibody Dilution Nb Samples Vol. (x 200uL) Antibody Vol.

Collagen I 1:250 7 1400 5.6uL

Collagen II 1:50 6 1200 24uL

Optimization of dilution will be required for new antibodies

Apply 200uL of primary antibody dilution to the (+) section and 200uL of PBS to the (-) control.

Incubate at 4°C overnight.

5.6 Secondary Antibody incubation

Take the slides out of the fridge and allow to reach RT (10 minutes)

Wash the slides 3x with PBS, 2 minutes each

Add 2-3 drops of secondary antibody (DAKO Envision+ HRP) to cover the (+) and (-)

Incubate at RT for 1 hour.

Wash the slides 3x with PBS, 2 minutes each

5.7 DAB colour development

Prepare the required amount of DAB chromagen o 100uL of solution per section (+) and (-) o Add 1 drop of DAB chromagen into 1ml of substrate o Can only prepare 1ml increments

o Left over solution can be store at 4°C for ~1 week

Add 2-3 drops of DAB solution to cover the (+) and (-)

Incubate for the predetermined amount of time

119

o The incubation time with DAB needs to be optimized for each antibody at the specific primary Ab dilution

o For Collagen I: 12 seconds o For Collagen II: 20 seconds

Tap off the solution and quickly place in a container of water to stop the reaction.

Rinse in running water.

Counterstain with hematoxylin o 1 dip in Harris hematoxylin o Dip in water to remove the excess stain o Dip in ammonia water until blue

Dehydrate through 3 changes 100% IPA, 2 minutes each and 3 changes Xylene, 2 minutes each

Mount out of the last xylene.

5.6 Mounting

Place a stack of several paper towels in the fume hood

Bring the last xylene container with the boat of slides into the fume hood

Pick up the slide with the tweezers and dry the back with a kimwipe o Be careful not to disturb the stained tissue

Place the cover slip on the paper towel and add one drop of mounting glue in the centre

Place the slide (with the tissue facing downwards) onto the coverslip o The mounting glue will spread out over the slide o Remove any air bubbles by pressing on the coverslip

Allow the slides to air dry in the fume hood.

120

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for isolating RNA from

monolayer cultures and chondrogenic differentiated tissues using the mirVana miRNA

isolation kit.

2.0 Related Documents

Document Document No.

3.0 Definitions

RNA: Ribonucleic acid

PBS: Phosphate Buffered Salt solution

EDTA: Ethylenediaminetetraacetic acid

DMEM: Dulbecco’s modified eagle medium

RT: Room temperature

4.0 General Equipment & Materials

Pipette aid & sterile serological pipettes (5, 10 and 25 ml; Corning, cat. nos. 4487, 4488 and 4489, respectively)

RAININ micropipettes & RNAse free tips

RNAse free 1.5mL microfuge tubes

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

mirVana miRNA isolation kit

Acid-Phenol: Chloroform

RNAse ZAP

Centrifuge

Heating block

Fume hood

Nanodrop

5.0 Procedure

**Perform all RNA isolations in the RNA room to avoid contamination.

5.1 Reagent Preparation

Title: RNA isolation using mirVana miRNA isolation kit

Prepared by: Approved by: Document no.: SOP.TK.5.0

Midori Buechli Thomas Koch Review Date: 2012.12.3

121

5.1.1 Wash solutions

Add 21ml ACS grade 100% ethanol to miRNA Wash Soln 1. Mix well (Check box).

Add 40 ml ACS grade 100% ethanol to Wash Soln 2/3. Mix well (Check box).

Note: Cap tightly, ignore precipitate that may form in Wash Soln 2/3.

5.2 Preparation and notes for RNA isolation

Turn the heater on and set the temperature to 55°C

Clean lab bench and pipettors with RNAse zap, alcohol and bleach

Change gloves frequently

Use RNase-free tips.

Wash equipment for homogenization with detergent and rinse thoroughly

5.3 Sample Disruption

Monolayer cultures: pellet 1.0x106 cells in a 1.5 ml microfuge tube and wash by resuspending in 1 ml 1xPBS. Centrifuge 150 x g, 5 min, RT. Place cells on ice.

Remove PBS and add 500ul lysis/binding solution.

Vortex.

Chondrogenic pellets: pool 4-5 pellets in a 1.5 ml microfuge tube and add 500ul lysis/binding solution.

Add 10ul Proteinase K to each sample, vortex, incubate 10 minutes at 55°C.

Use the handheld homogenizer to homogenize the pellets. Change tips after each sample.

5.4 Organic Extraction

Add 50ul miRNA Homogenate Additive and mix well by vortexing.

Leave on ice 10 min.

In the fume hood, add 500ul Acid-Phenol:Chloroform. (Note: be sure to withdraw from bottom phase of bottle)

Vortex 30-60 sec.

Centrifuge 5 min, 10 000 x g, RT. If the interphase is cloud-like, repeat centrifugation.

Remove the aqueous phase and transfer to a fresh tube. Note the volume removed.

5.5 Total RNA Isolation

Add 1.25 volumes of RT 100% ethanol to the aqueous phase recovered

Place Filter Cartridge into Collection Tubes and apply up to 700ul at a time

Centrifuge 15 s, 10 000 x g, RT. Discard flow through and repeat until all the solution is through.

Add 700ul miRNA Wash Soln 1 and centrifuge 5-10 sec. Discard flow through.

Add 500ul Wash Soln 2/3 and centrifuge 5-10 sec. Discard flow through. Repeat.

122

Spin assembly for 1 min, 10 000 x g, RT

Transfer Filter Cartridge to fresh Collection tube.

Add 100 ul of 95°C Elution Solution to centre of filter and close cap. (Note: Add 50ul of elution solution for pooled pellet samples)

Spin 20-30 sec at max speed to recover RNA.

5.6 RNA integrity

Open the Nanodrop software and select Nucleic Acid.

Clean the pedestals using water and kimwipes.

Load a clean water sample to initialize.

Change the nucleic acid type to RNA.

Load 1uL elution solution and hit Blank. Clean pedestals.

Flick sample to mix. Load 1uL sample and hit Measure. Note the concentration and the OD 260/280. This value should be 1.8-2.0.

Wipe the pedestals with a kimwipe after each measurement.

If you are running many samples, blank again every 3-5 samples.

123

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for isolating RNA from

monolayer cultures using TRI Reagent.

2.0 Related Documents

Document Document No.

3.0 Definitions

RNA: Ribonucleic acid

PBS: Phosphate Buffered Salt solution

RT: Room temperature

4.0 General Equipment & Materials

Pipette aid & sterile serological pipettes (5 ml; Corning 4487)

RAININ micropipettes & RNAse free tips

RNAse free 1.5mL microfuge tubes

Ethanol 75% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

TRI Reagent

Chloroform

Isopropanol

RNAse free water

RNAse Zap

Centrifuge

Fume hood

Heating block

Nanodrop

5.0 Procedure

**Perform all RNA isolations in the RNA room to avoid contamination.

5.1 Preparation and notes for RNA isolation

Turn the heating block on and set the temperature to 55°C

Title: RNA isolation using TRI Reagent

Prepared by: Approved by: Document no.: SOP.TK.5.1

Midori Buechli Thomas Koch Review Date: 2012.12.3

124

Turn on the centrifuge and set the temperature to 4°C

Clean lab bench and pipettors with RNAse zap, bleach and alcohol

Change gloves frequently

Use RNase-free tips.

5.2 Homogenization

Monolayer cultures in multiwell plates: Remove media and rinse culture surfaces with PBS.

Add 100uL TRI Reagent per cm2 (e.g. 200uL/well in a 24-well plate) and pipette up and down to disrupt the cells.

Transfer the solution to RNAse free 1.5mL microfuge tube.

Incubate at room temperature for 5 minutes.

5.3 RNA extraction

Perform all subsequent steps in the fume hood

Add 40uL chloroform per 100uL TRI Reagent, mix vigorously for 15s.

Incubate RT for 10 min.

Centrifuge 12 000 x g, 15 min, 4°C. If the interphase is cloud-like, repeat centrifugation.

5.4 RNA precipitation

Transfer the aqueous phase to a clean tube.

Add isopropanol at the same volume as Tri Reagent used. Vortex.

Incubate RT for 10 min.

Centrifuge 12 000 x g, 8 min, 4°C.

Carefully discard supernatant without touching the bottom of the tube. A gel-like pellet may or may not be visible.

Add 75% ethanol at 2x the volume of Tri Reagent used. Vortex.

Centrifuge 7 500 x g, 5 min, 4°C.

5.5 RNA solubilisation

Carefully remove the supernatant without disturbing the pellet (Note: if no pellet is visible, do not panic. Just leave a few uL at the bottom of the tube)

Air dry 3-5 minutes. Make sure they DO NOT completely dry.

Dissolve with RNAse free water 50-100uL.

Incubate at 55°C in the heating block for 10 minutes.

5.6 RNA integrity

Open the Nanodrop software and select Nucleic Acid.

Clean the pedestals using water and kimwipes.

Load a clean water sample to initialize.

Change the nucleic acid type to RNA.

Load 1uL nuclease free water and hit Blank. Clean pedestals.

Flick sample to mix. Load 1uL sample and hit Measure. Note the concentration and the OD 260/280. This value should be 1.8-2.0.

If you are running many samples, blank again every 3-5 samples.

125

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for creating double

stranded complementary DNA from single stranded RNA

2.0 Related Documents

Document Document No.

RNA isolation using the mirVana miRNA isolation kit

SOP.TK.5.0

RNA isolation using TRI Reagent SOP.TK.5.1

3.0 Definitions

RNA: Ribonucleic acid

RT: Reverse transcriptase

cDNA: complementary DNA

PCR: Polymerase chain reaction

MM: Master Mix

4.0 General Equipment & Materials

RAININ micropipettes & RNAse free tips

RNAse free 1.5mL and 0.2mL microfuge tubes

Ethanol 75% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

RNAse free water

Invitrogen Reverse transcription kit

Thermocycler

Ice

5.0 Procedure

5.1 Preparation and Calculations

Determine the amount of RNA to reverse transcribe based on the sample with the lowest RNA concentration. Use 0.2-2ug per reaction depending on the amount of RNA in the samples.

Example: Lowest RNA conc. in set of samples = 36ng/uL

Max volume for RNA= 9.9 ul

Title: Reverse transcription using standard oligodT protocol

Prepared by: Approved by: Document no.: SOP.TK.6.0

Midori Buechli Thomas Koch Review Date: 2012.12.3

126

Conc. x vol. = 36ng/uL x 9.9 uL = 356.4 ng ~ 350ng

Therefore, 350ng must be used for all samples.

Determine the volume of RNA and water required for each sample in order to have 350ng RNA/sample in 9.9uL.

Example: 350ng ÷ 124ng/uL = 2.82 uL RNA sample

Vol water to add = 9.9 – 2.82 = 7.08 uL water

Clean lab bench and pipettors with RNAse zap, bleach and alcohol

Change gloves frequently

Use RNase-free tips and tubes

Make sure you have enough reagents for the number of samples you want to run

5.2 Reverse transcription

Retrieve reverse transcription kit from the -20°C and thaw on ice. This will include 5x buffer, 0.1M DTT, 10mM dNTPs, RNAsin (or RNAse out), Superscript II and oligodT.

Dilute the RNA samples according to the calculations in section 5.1.

Add 1.6uL oligodT to each sample.

Turn the thermocycler ON, find program (RT-Laura on #1) or create new program with the following settings

72°C for 2 minutes

42°C for 2 minutes

42°C for 60 minutes

70°C for 30 minutes

4°C forever

Verify parameters, Run, Pause (this allows the machine to warm up while you prepare your MM).

Prepare the MM for number of samples + 1 or + 5-10%. Vortex

Reagent (1x) (5x)

5x Buffer 4 20

DTT 2 10

dNTPs 1 5

RNAsin 0.5 2.5

Superscript II 1 5

Unselect pause and wait until the chamber reaches 72°C.

Add the samples to the thermocycler for the 72°C, 2 min.

At 42°C, place the MM in the chamber to warm. Add 8.5uL MM to each sample. Proceed until the end of the program.

When finished, hit stop and turn the machine off. Store cDNA samples at -

20°C.

127

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for creating

complementary DNA for specific microRNAs

2.0 Related Documents

Document Document No.

RNA isolation using the mirVana miRNA isolation kit

SOP.TK.5.0

RNA isolation using TRI Reagent SOP.TK.5.1

3.0 Definitions

RNA: Ribonucleic acid

RT: Reverse transcriptase

cDNA: complementary DNA

PCR: Polymerase chain reaction

MM: Master Mix

miRNA: microRNA

4.0 General Equipment & Materials

RAININ micropipettes & RNAse free tips

RNAse free 1.5mL and 0.2mL microfuge tubes

Ethanol 75% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

RNAse free water

TaqMan Reverse Transcription kit

TaqMan microRNA primers

RNA samples

Thermocycler

Ice

5.0 Procedure

5.1 Preparation and Calculations

Title: Reverse transcription for microRNAs using TaqMan microRNA assay kit

Prepared by: Approved by: Document no.: SOP.TK.6.1

Midori Buechli Thomas Koch Review Date: 2012.12.3

128

Determine the volume of RNA and water required for each sample in order to have 100ng RNA/sample in 5 uL. BUT for each sample you need to make cDNA for each microRNA you are studying, so be sure to prepare enough RNA dilution.

Example: 100ng ÷ 165ng/uL = 0.61 uL RNA sample

Vol water to add = 5 – 0.61 = 4.39 uL water

BUT let’s say your microRNAs of interest are miR-140, miR-9 and miR-

146, PLUS your housekeeper U6 snRNA.

Then you will need to multiply those volumes by the number of

microRNAs of interest +1.

Example: RNA volume = 0.61 x (4+1) = 3.05 uL RNA

Volume of water = 4.39 x (4+1) = 21.95 uL dH2O

Clean lab bench and pipettors with RNAse zap, bleach and alcohol

Change gloves frequently

Use RNase-free tips and tubes

Make sure you have enough reagents for the number of samples you want to run

5.2 Reverse transcription

Retrieve reverse transcription kit and TaqMan primers from the -20°C and thaw on ice. This will include buffer, dNTPs, RNAse inhibitor and multiscribe.

Dilute the RNA samples according to the calculations in section 5.1.

Turn the thermocycler ON, find program (microRNA on #2) or create new program with the following settings

16°C for 30 minutes

42°C for 30 minutes

85°C for 5 minutes

4°C forever

Prepare the MM for number of samples + 1 or + 5-10%. Vortex

Reagent (1x) (15x)

Buffer 1.50 22.5

Multiscribe 1.00 15.0

dNTPs 0.15 2.25

RNAse inhibitor 0.19 2.85

dH2O 4.16 62.4

Add 7uL MM, 3uL primers, 5uL RNA dilution in 0.2 mL PCR tubes. Vortex.

Spin down.

Add the samples to the thermocycler and run the program.

When finished, hit stop and turn the machine off. Store cDNA samples at -

20°C.

129

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for running quantitative

real-time polymerase chain reaction for messenger RNAs using a SYBR green-based

protocol and LightCycler machinery.

2.0 Related Documents

Document Document No.

RNA isolation using the mirVana miRNA isolation kit

SOP.TK.5.0

RNA isolation using TRI Reagent SOP.TK.5.1

Reverse Transcription using standard oligodT protocol

SOP.TK.6.0

3.0 Definitions

mRNA: messenger ribonucleic acid

RT: Real-time

cDNA: complementary DNA

qPCR: Quantitative polymerase chain reaction

MM: Master Mix

4.0 General Equipment & Materials

RAININ micropipettes & RNAse free tips

Nuclease free 1.5mL microfuge tubes

Ethanol 75% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Nuclease free water

LightCycler FastStart DNA Master SYBR Green I (Roche, cat. no. 12239264001)

LightCycler 480 Multiwell Plate 384 (Roche, cat.no. 05102430001)

cDNA from samples and calibrator

LightCycler 480

Forward and reverse primers

Multistepper

Title: Quantitative Polymerase Chain Reaction for messenger RNAs using SYBR green

Prepared by: Approved by: Document no.: SOP.TK.7.0

Midori Buechli Thomas Koch Review Date: 2012.12.3

130

Ice

Centrifuge with adaptors for plates

5.0 Procedure

5.1 Preparation

Be sure that your primer sequences align to your gene of interest and in the right species (use http://blast.ncbi.nlm.nih.gov/Blast.cgi)

Prepare primer stocks at 100μM, then dilute some to 10μM as working stock

Make sure you have enough reagents for the number of samples you want to run

Plan how to pipette out your samples before starting. It’s easy to get confused when pipetting a 384-well plate or even a 96-well plate. E.g. mark out the triplicates on the plate itself, mark the triplicates in the tip boxes, draw a diagram or list which samples below in which wells.

5.2 Preparation of PCR mix

Retrieve the SYBR Green Master, cDNA and primers (forward and reverse)

from the -20°C and thaw on ice.

Prepare the MM for number of samples + 5-10% (do not forget to calculate enough MM for the blank control and the calibrator). Vortex.

Reagent (1x) (140x)

SYBR Green Master 5.0 700

Water 1.0 140

Primer F 10uM 1.0 140

Primer R 10uM 1.0 140

In a shallow styrofoam box lid filled with ice (prevents evaporation during prolonged pipetting), use the Multistepper (if available) to add 8uL of MM to each well.

Add 2uL of cDNA to each well. NOTE: Do not forget to run triplicates. NOTE: Do not forget to run a blank with water instead of cDNA and the calibrator.

Centrifuge the plate at 3000rpm for 2 minutes, RT.

5.3 LightCycler 480 instrument protocol

Turn on the instrument and open the LightCycler 480 Software. Wait for the machine to warm up and for the light on the machine to turn green.

Make sure the appropriate adaptor is in the machine (384 vs. 96-well)

Put the plate in

Set up a program using the following parameters:

131

NOTE: Do NOT forget to change the plate type to white or clear (whichever you happen to have), detection type to SYBR Green I, the plate to 384 and the reaction volume to 10uL.

Start Run.

When the run is finished, take the plate out and turn the machine off. The plate can be saved at -20°C if you want to have any of the products sequenced.

132

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for running quantitative

real-time polymerase chain reaction for microRNAs using TaqMan microRNA assays

and LightCycler machinery.

2.0 Related Documents

Document Document No.

RNA isolation using the mirVana miRNA isolation kit

SOP.TK.5.0

RNA isolation using TRI Reagent SOP.TK.5.1

Reverse Transcription using TaqMan microRNA assays

SOP.TK.6.1

3.0 Definitions

miRNA: micro ribonucleic acid

RT: Real-time

cDNA: complementary DNA

qPCR: Quantitative polymerase chain reaction

MM: Master Mix

4.0 General Equipment & Materials

RAININ micropipettes & RNAse free tips

Nuclease free 1.5mL microfuge tubes

Ethanol 75% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Nuclease free water

LightCycler 480 Multiwell Plate 384 (Roche, cat.no. 05102430001)

microRNA-specific cDNA from samples and calibrator

LightCycler 480

TaqMan probes (Life Tech, cat.no.4427975)

TaqMan Universal PCR Master Mix, NoAmpErase UNG (Life Tech, cat.no.4324018)

Multistepper

Title: Quantitative Polymerase Chain Reaction for microRNAs using TaqMan microRNA assays

Prepared by: Approved by: Document no.: SOP.TK.7.1

Midori Buechli Thomas Koch Review Date: 2012.12.3

133

Ice

Centrifuge with adaptors for plates

5.0 Procedure

5.1 Preparation

Be sure that the sequences of the TaqMan probes align with your miRNA of interest in the species you’re studying

Make sure that your control miRNA is expressed in all your samples at a similar level for all treatment groups

Make sure you have enough reagents for the number of samples you want to run

Plan how to pipette out your samples before starting. It’s easy to get confused when pipetting a 384-well plate or even a 96-well plate. E.g. mark out the triplicates on the plate itself, mark the triplicates in the tip boxes, draw a diagram or list which samples belong in which wells.

5.2 Preparation of PCR mix

Retrieve the TaqMan probes and cDNA samples from the -20°C and thaw on ice.

Retrieve the Universal PCR MM from the fridge and keep on ice.

Prepare the MM for number of samples + 5-10% (do not forget to calculate enough MM for the blank control and the calibrator). Vortex.

Reagent (1x) (150x)

Universal PCR MM 10 1500

Water 7.67 1150.5

Primer 1.0 150

In a shallow styrofoam box lid filled with ice (prevents evaporation during prolonged pipetting), use the Multistepper (if available) to add 18.67 uL of MM to each well.

Add 1.5 uL of cDNA to each well. NOTE: Do not forget to run triplicates. NOTE: Do not forget to run a blank with water instead of cDNA and the calibrator.

Centrifuge the plate at 3000rpm for 2 minutes, RT.

5.3 LightCycler 480 instrument protocol

Turn on the instrument and open the LightCycler 480 Software. Wait for the machine to warm up and for the light on the machine to turn green.

Make sure the appropriate adaptor is in the machine (384 vs. 96-well)

Put the plate in

Set up a program using the following parameters:

134

Program Temperature

(°C)

Acquisition mode

Time Ramp Rate

(°C/s)

Pre-incubation 95 none 10min 4.8

Amplification

95 none 15sec 4.8

60 Single 60sec 2.5

72 None 1sec 4.8

Cooling 40 None 30sec 2.0

NOTE: Do NOT forget to change the plate type to white or clear (whichever you happen to have), detection type to Monocolour Hydrolysis Probe, the plate to 384 and the reaction volume to 20uL.

Start Run.

When the run is finished, take the plate out and turn the machine off. The plate can be saved at -20°C if you want to have any of the products sequenced.

135

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for isolating chondrocytes from fresh articular cartilage.

2.0 Related Documents

Document Document No.

Cell count using Trypan Blue SOP.TK.2.1

3.0 Definitions

PBS: Phosphate Buffered Salt solution

MCIII: Third Metacarpal

DMEM: Dulbecco’s modified eagle medium

FCS: Fetal calf serum

4.0 General Equipment & Materials

Plastic bags and tape

Hair trimmer

Disposable scalpels

Sterile centrifuge tubes (15 ml and 50 ml; Corning, cat. no. 430290)

Cell strainers 70μm (BD Falcon, cat. No. 352350)

Pipette aid & sterile serological pipettes (5, 10 and 25 ml; Corning, cat. nos. 4487, 4488 and 4489, respectively)

RAININ micropipettes & autoclaved sterile tips

Rack for centrifuge tubes

Waste Disposal Cup

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Centrifuge

Trypan Blue 0.4%

Hemocytometer

5.0 Procedure

5.1 Reagent Preparation

5.1.1 Digestion Solution 1

Title: Chondrocyte isolation from articular cartilage

Prepared by: Approved by: Document no.: SOP.TK.8.0

Midori Buechli Thomas Koch Review Date: 2012.12.3

136

Prepare approximately 10mL per 300mg cartilage

1.5mg/ml pronase, 1% pen-strep and 1% gentamycin in LG-DMEM

Filter sterilize 0.2 μm.

5.1.2 Digestion Solution 2

Prepare approximately 10mL per 300mg cartilage

1.5mg/ml collagenase type II, 1% pen-strep and 1% gentamycin in LG-DMEM

Filter sterilize 0.2 μm.

5.1.3 Chondrocyte Media

Prepare chondrocyte media according to the following table:

Reagent Final Concentration Volume for 500ml

HG-DMEM with GlutaMAX n/a 442.5 mL

FCS 10% 50 mL

Pen-strep 1% 5 mL

Gentamycin 1% 2.5 mL

Ascorbic acid (1mg/mL) 0.25mg/mL 125 uL

**If using HG-DMEM without GlutaMAX, be sure to add glutamine or glutamax.

5.2 Sample Collection

Equine joints are collected 0-16 hours after euthanasia, then the cartilage can be collected immediately or can be refrigerated overnight

Cover both ends (the hoof and the cut end) with plastic bags and tape in place.

Shave off the hair using trimmers, then clean the surface with 70% EtOH

Designate three scalpels; one for removing the skin (dirtiest), one for dissecting the joint (less dirty) and one for removing the cartilage samples (cleanest).

Using scalpel 1, cut all the way around the leg at either end (a few cm from the taped part), then make one cut down the length of the leg to connect the two previous cuts. Cut in between the skin and the tissue to remove the rectangle of skin.

Find two ligaments at the back of the fetlock joint and cut them with scalpel 2. Cut the ligaments on either side of the joint until the joint opens up. Cut to completely separate the two pieces.

With scalpel 3, slice the cartilage and deposit into weighed 50ml conical tubes containing sterile PBS. NOTE: Any pieces of cartilage that are not directly put into the tube should be considered as contaminated and should be discarded, i.e. if they touch your glove or the table.

5.3 Cartilage Digestion

In the lab, weigh the tubes again and determine the mass of cartilage harvested.

In the culture hood, finely mince (<1mm) the cartilage shavings in a petri dish in a bit of PBS to prevent drying.

137

Add ~ 300mg cartilage to a 50mL tube and add 10mL of Digestion Solution 1.

Seal the lid tightly and lie the tube down on its side in the 37°C incubator/shaker (if this machine is not available, place in the regular incubator and vortex several times throughout the incubation). Incubate for 1 hour.

Remove as much of Digestion Solution 1 as possible without removing too much sample.

Add 10mL Digestion Solution 2 and incubate in the same manner as 1, but for 18 hours.

5.4 Seeding the chondrocytes

Mix the solution by pipetting up and down.

Strain the cells using a 70μm filter and pool into a 50mL tube (if you had several tubes in digestion for the same sample)

Centrifuge 900 rpm, 5 min, RT.

Discard supernatant and resuspend the pellets with 1x PBS.

Centrifuge 900 rpm, 5 min, RT.

Discard supernatant and resuspend the pellets with chondrocyte media.

Perform a cell count (SOP.TK.2.1) and note live, dead, total cell counts and cell viability.

Seed cells at 200 000 cells/cm2. E.g. 400 000 cells/well in a 24-well plate.

NOTE: if you want to study chondrocyte-specific properties, do not passage the cells, they tend to dedifferentiate. Let them settle from the stress of the isolation for a couple days, then run experiments day 3 post-isolation.

138

KOCH Lab Standard Operating Procedure

1.0 Purpose

This standard operating procedure (SOP) outlines the procedure for extracting protein

from cells without degradation by proteases.

2.0 Related Documents

Document Document No.

3.0 Definitions

HEPES:

EDTA: Ethylenediaminetetraacetic acid

NaCl: Sodium Chloride

NaF: Sodium Fluoride

PBS: Phosphate buffered saline

4.0 General Equipment & Materials

Sterile centrifuge tubes (15 ml and 50 ml; Corning, cat. no. 430290)

Pipette aid & sterile serological pipettes (5, 10 and 25 ml; Corning, cat. nos. 4487, 4488 and 4489, respectively)

RAININ micropipettes & autoclaved sterile tips

Ethanol 70% (vol/vol) ! CAUTION Ethanol is highly flammable. It may also cause eye and respiratory tract irritation.

Sterile 1.5mL microfuge tubes

Centrifuge that can reach 4°C

Protein lysis buffer

Protease inhibitors

Ice

BioRad DC protein assay

5.0 Procedure

5.1 Reagent Preparation 5.1.1 Protein Lysis Buffer

50mM HEPES pH 7.6

Title: Protein extraction from cells

Prepared by: Approved by: Document no.: SOP.TK.9.0

Midori Buechli Thomas Koch Review Date: 2012.12.3

139

100mM NaCl

10mM EDTA

1% Triton X

4mM Na-Pyrophosphate

Stored at 4°C.

5.1.2 Protease inhibitors stock solutions

2mM Na-Orthovanadate

10mM NaF

cOmplete protease inhibitor cocktail 1:25 (Roche)

Each of these is stored at -20°C

5.1.3 Protein Lysis Buffer with protease inhibitors

Prepare this solution immediately before use (cannot be stored) o Approximately 200uL required per sample

Reagent Number of uL per mL Volume for 2.5ml

Na-orthovanadate 20 50

NaF 20 50

cOmplete protease inh. 40 100

Protein Lysis Buffer 920 2300

Keep on ice

5.2 Cell Lysis and protein collection

Harvest the cells using Trypsin/EDTA protocol (See SOP.TK.2.0)

Distribute cells into 1.5mL microfuge tubes

Centrifuge 8000 x g, 2 minutes, RT.

Remove supernatant and add 200uL 1xPBS. Spin.

Remove 150uL of the supernatant and resuspend the pellet with the remaining 50uL of PBS supernatant.

Add 200uL of the protein lysis buffer + protease inhibitors and pipette up and down

Leave on Ice for 10 minutes

Centrifuge 40 000 x g, 10 minutes, at 4 °C. o Cell debris is at the bottom and the protein is in the supernatant

Transfer and aliquot the supernatant to fresh tubes and store at -20 or -80°C.

5.3. Protein Quantification using BioRad DC protein assay

Prepare working reagent, require 25uL/sample o E.g. 20uL Reagent S + 1mL Reagent A]

Prepare protein standard using BSA in lysis buffer (0.25, 0.5, 0.75, 1.0, 1.25, 1.5 mg/ml)

Pipette 5uL of standards and samples in triplicate into a 96-well plate

140

Add 25uL working reagent to each well

Add 200uL Reagent B to each well and mix gently to avoid bubbles

Incubate RT for 15 minutes

Read the absorbance at 750nm.

Determine the concentration of protein in the samples by extrapolating against the standard curve.