metabolite analysis, environmental factors, and a transgenic...
TRANSCRIPT
1
METABOLITE ANALYSIS, ENVIRONMENTAL FACTORS, AND A TRANSGENIC APPROACH TO UNDERSTANDING STRAWBERRY (FRAGARIA X ANANASSA)
FLAVOR
By
MICHAEL LEE SCHWIETERMAN
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2013
2
© 2013 Michael Lee Schwieterman
3
To my family, friends, and colleagues
4
ACKNOWLEDGMENTS
I thank my Ph.D. committee for their patience and guidance. Deepest
appreciation to my advisor, Dr. David Clark, for providing direction, encouragement and
sound advice when it was needed most, as well as, providing the freedom to pursue
research in an unfamiliar system. I recognize Dr. Thomas Colquhoun for his continued
dedication to my professional development and positive outlook throughout my Ph.D.
education. Portions of this work are supported by grants from USDA Specialty Crop
Block Grant. Graduate funding is provided by USDA National Needs Fellowship. Great
gratitude is extended to Timothy Johnson, HHMI Undergraduate Scholar, and Yasmin
Dweik, for assistance with screening transgenic lines for volatiles and transcript
abundance and Elizabeth Jaworski for assistance with Fragaria volatile analysis.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 8
LIST OF FIGURES .......................................................................................................... 9
LIST OF ABBREVIATIONS ........................................................................................... 10
ABSTRACT ................................................................................................................... 11
CHAPTER
1 INTRODUCTION AND LITERATURE REVIEW ..................................................... 13
Introduction ............................................................................................................. 13
Fruit Development and Regulation ......................................................................... 14 Strawberry Flavor ................................................................................................... 15 Methyl Anthranilate Biosynthesis ............................................................................ 19
Fragaria x ananassa ............................................................................................... 20 Perception and Integration of Flavor ....................................................................... 22
Research Objectives ............................................................................................... 24 Identifying Flavor-Related Metabolite Targets Using Psychophysics ............... 25 Field and Postharvest Environment Factors Influencing Flavor-Related
Metabolites .................................................................................................... 25 A Transgenic Approach to Introduce F. vesca Volatile Compound in F. x
ananassa....................................................................................................... 25
2 STRAWBERRY FLAVOR: DIVERSE CHEMICAL COMPOSITIONS, A SEASONAL INFLUENCE, AND EFFECTS ON SENSORY PERCEPTION ........... 27
Background ............................................................................................................. 27 Results .................................................................................................................... 31
Progression of Harvest Season Affects Metabolic Content and Perceived Quality of Strawberry ..................................................................................... 31
Overall Liking is Subject to Ratings of Sweetness, Flavor, and Texture ........... 32 Texture Liking Correlates to Fruit Firmness...................................................... 33
Sweetness Intensity is a Result of Sugar Content ............................................ 34 Sourness Intensity is Partially Explained by Titratable Acidity .......................... 35 Flavor Intensity is Influenced by Total and Specific Volatile Content ................ 36 Specific Volatiles Enhance Sweetness Intensity Independent of Sugars ......... 38
Discussion .............................................................................................................. 38
Materials and Methods............................................................................................ 48 Plant Material ................................................................................................... 48
Volatile Analysis ............................................................................................... 49
6
Sugars and Acids Quantification ...................................................................... 50
Firmness Determination ................................................................................... 51 Sensory Analysis .............................................................................................. 51
Statistical Analysis ............................................................................................ 52
3 ENGINEERING OF THE AROMA FLAVOR VOLATILE METHYL ANTHRANILATE IN PETUNIA AND STRAWBERRY ........................................... 108
Background ........................................................................................................... 108 Results .................................................................................................................. 112
Methyl Anthranilate Content among Fragaria ................................................. 112 ZmAAMT1.1 Expression Analysis in Transgenic Plants ................................. 113
Overexpression construct and plant transformation ................................. 113 Petunia expression analysis..................................................................... 114
Strawberry expression analysis ............................................................... 115 ZmAAMT1.1 Volatile Analysis in Transgenic Plants ....................................... 115
Discussion ............................................................................................................ 116 Future Work .......................................................................................................... 121
Materials and Methods.......................................................................................... 122 Plant Material ................................................................................................. 122 Generation of Transgenic ZmAAMT1.1 Plants ............................................... 123
Overexpression construct ........................................................................ 123 Plant transformation and regeneration ..................................................... 124
RNA Isolation ................................................................................................. 124 Petunia ..................................................................................................... 124 Strawberry ................................................................................................ 125
Expression Analysis ....................................................................................... 125 Volatile Analysis ............................................................................................. 126
Statistical Analysis .......................................................................................... 128
4 EFFECTS OF ENHANCED LIGHT ENVIRONMENTS ON POSTHARVEST VOLATILE PROFILES OF ‘STRAWBERRY FESTIVAL’ ...................................... 138
Background ........................................................................................................... 138 Results .................................................................................................................. 139
Postharvest Exposure to Narrow-Bandwidth Light Alters Strawberry Volatile Content........................................................................................................ 139
Red and Black Plastic Mulch .......................................................................... 140 Reflective light qualities from red and black mulch .................................. 140
Strawberry volatile profiles are not consistently different between red and black mulch treatments .................................................................. 141
Consumers do not distinguish or prefer strawberry from red or black plastic mulch ......................................................................................... 141
Discussion ............................................................................................................ 142
Materials and Methods.......................................................................................... 144 Postharvest Narrow-Bandwidth Light Treatment ............................................ 144
Red and Black Plastic Mulch Field Conditions ............................................... 145
7
Flavor Panel ................................................................................................... 146
Volatile Analysis ............................................................................................. 146 Statistical Analysis .......................................................................................... 148
LIST OF REFERENCES ............................................................................................. 157
BIOGRAPHICAL SKETCH .......................................................................................... 168
8
LIST OF TABLES
Table page 2-1 Means of consumer, physical, and biochemical measures. ................................ 53
2-2 Standard errors of consumer, physical, and biochemical measures. .................. 70
2-3 Fruit attribute bivariate fit to harvest week. ......................................................... 87
2-4 Fruit attribute bivariate fir to consumer measure. ............................................... 89
2-5 Multiple regression for identification of sweetness enhancing volatiles. ............. 95
2-6 Index of CAS registry number, chemical name, and formula. ............................. 97
4-1 Photosynthetically active, red, and far-red radiation reflected by selective reflective mulch. ................................................................................................ 149
4-2 Consumer panels do not perceive differences between red and black plastic mulch grown strawberries. ................................................................................ 150
4-3 Volatile analysis does not detect consistent differences between red and black plastic mulch grown strawberries. ........................................................... 151
9
LIST OF FIGURES
Figure page 2-1. Cluster analysis of strawberry samples and quantified metabolites. ................... 100
2-2. Season environmental conditions. ...................................................................... 102
2-3. Individual sugars and total volatiles regressed against season progression. ...... 103
2-4. Regression of hedonic and sensory measures to physical and chemical fruit attributes. .......................................................................................................... 105
2-5. Volatile chemical structures. ............................................................................... 107
3-1. Alternative methyl anthranilate biosynthetic pathways in Zea mays and Vitis labrusca.. .......................................................................................................... 129
3-2. Identification of methyl anthranilate in Fragaria. ................................................... 130
3-3. Methyl anthranilate content among various lines of Fragaria species. ................. 131
3-4. Binary vector for stable transformation of petunia and strawberry with ZmAAMT1.1.. ................................................................................................... 132
3-5. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. ‘Mitchell Diploid’. ............................................................................................... 133
3-6. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. ‘Mitchell Diploid’. ............................................................................................... 134
3-7. Emission of methyl anthranilate from petunia flowers over-expressing ZmAAMT1.1. .................................................................................................... 135
3-8. Identification of methyl anthranilate in petunia flower over-expressing ZmAAMT1.1. .................................................................................................... 136
3-9. ZmAAMT1.1 transcript abundance in overexpressing Fragaria x ananassa cv. ‘Strawberry Festival’. ........................................................................................ 137
4-1. Spectroradiometer readings of the light qualities used in postharvest treatments......................................................................................................... 153
4-2. Effect of light treatments on selected volatile compounds in Fragaria x. ananassa cv. ‘Strawberry Festival’. .................................................................. 154
4-3. Spectrum of light reflected from red and black plastic mulch. .............................. 156
10
LIST OF ABBREVIATIONS
CDS Coding sequence
CM CHORISMATE MUTASE
COA Coenzyme A
DMF 3(2H)-furanone, 4-methoxy-2,5-dimethyl-
F. Fragaria
FID Flame ionization detector
GC Gas chromatograph
GLMS General labeled magnitude scale
LED Light emitting diode
MS Mass spectrometer
PNOS NOPALINE SYNTHASE 3’ promotor
NOST NOPALINE SYNTHASE 3’ terminator
NPTII NEOMYCIN PHOSPHOTRANSFERASE II
P. Petunia
PAR Photosynthetic active radiation
PFMV 34S Figwort mosaic virus 34S promoter
QRT-PCR Quantitative real time polymerase chain reaction
SQRT-PCR Semi-quantitative – polymerase chain reaction
SSC Soluble solids content
TA Titratable acidity
VLAMAT Vitis labrusca ANTHRANILOYL-CoA:METHANOL ACYLTRANSFERASE
ZMAAMT Zea mays ANTHRANILIC ACID METHYL TRANSFERASE
11
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
METABOLITE ANALYSIS, ENVIRONMENTAL FACTORS, AND A TRANSGENIC APPROACH TO UNDERSTANDING STRAWBERRY (FRAGARIA X ANANASSA)
FLAVOR
By
Michael Lee Schwieterman
August 2013
Chair: David G. Clark Major: Plant Molecular and Cellular Biology
Fresh strawberries (Fragaria x ananassa) are valued for their red color, juicy
texture, distinct aroma, and sweet fruity flavor. To ensure continued consumption, flavor
must be high in quality, but defining this complex trait has proven to be difficult. This
work presents a metabolite perspective on the perception, variation, and alteration of
strawberry fruit flavor to increase consumer acceptability.
In the primary study, genetic and environmentally induced variation among
strawberry is exploited by simultaneously assaying fruit for: inventories of volatile
compounds, sugars, and organic acids; physical measures of titratable acidity, soluble
solids content, and firmness; and consumer hedonic and sensory responses.
Psychophysics analysis determines seasonal effects and fruit attributes influencing
hedonics and sensory perception of strawberry fruit.
Seasonal progression negatively influences soluble solids content, primarily
through sucrose, leading to decreased volatile content. These alterations are
perceivable because sweetness intensity, flavor intensity, and texture liking significantly
influence overall liking through variations in sugar concentrations, volatiles, and
12
firmness. Specific aroma volatiles make contributions to perceived sweetness
independent of fruit sugar concentration. Volatiles that increase perception of
sweetness without adding sugar will have far-reaching effects in food chemistry, and
also provides targets for future breeding efforts of consumer defined traits.
The biosynthesis of an underrepresented volatile in commercial germplasm,
methyl anthranilate, is the target of genetically engineering Petunia x hybrida ‘Mitchell
Diploid’ and ‘Strawberry Festival’. Expression of Zea mays ANTHRANILIC ACID
METHYL TRANSFERASE 1.1 will hypothetically enhance its aroma or flavor. Petunia
flowers with expression emit methyl anthranilate at levels similar to Fragaria vesca.
Expression is confirmed in over twenty T0 lines of ‘Strawberry Festival’. Consumer
panels assaying petunia and strawberry with methyl anthranilate phenotype will assist in
assaying this volatiles influence on perception.
Metabolite inventory of diverse strawberry fruit coupled with consumer panels
identifies rare and important compounds associated with strawberry flavor. Transgenic
efforts will determine methyl anthranilate influence on consumers. Furthermore,
exploration of environmental manipulation provides some prospective technologies for
altering strawberry volatile profiles. Whether through breeding, transgenics, or
environmental manipulation increasing the flavor of strawberry will ensure the current
trend of increasing consumption of this highly nutritious food.
13
CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW
Introduction
Modern strawberry, Fragaria x ananassa, is the product of a recent
anthropomorphic botanical hybridization of otherwise geographically isolated species.
Hybrids of two octoploid species, male North American F. virginiana and female South
American F. chiloensis, began appearing in European gardens during the 18th century
(Darrow, 1966). Comparison of genomic microsatellite markers among F. x ananassa
cultivars and a geographically diverse collection of progenitors reveals this relatively
young crop species is founded on narrow genetic diversity (Chambers et al., 2013), yet
is cultivated in most arable regions of the world at a level over 4.3 million metric tons of
fruit annually (Hancock, 1999; UN, 2013).
The genus Fragaria is distributed globally throughout temperate and tropical
zones, with the most widespread distribution belonging to F. vesca. Other Fragaria
possess more geographically restricted distributions, most of which are within or
bordering that of F. vesca. A specific example is that of South American F. chiloensis.
Also, the genus exhibits a natural ploidy diversity ranging from diploid to decaploid
(Folta and Davis, 2006; Hancock, 1999). The relatively small stature and herbaceous
nature of strawberry strongly contradicts that of typical Rosaceae, but the perennial life
cycle is mutual. The morphologically distinct aggregate accessory fruit of strawberry, in
which the achenes are exposed on a swollen fleshy receptacle, has been a prize of
domestication for over two millennia (Hancock, 1999).
Modern fully ripe fruit of F. x ananassa is characterized by its large size, vibrant
red color, reduced firmness, distinct aroma, and sweet fruity flavor (Brummell and
14
Harpster, 2001; Hong and Wrolstad, 1990; Schieberle and Hofmann, 1997; Ulrich et al.,
1997; Whitaker et al., 2011). Strawberry is also a rich source of phenolics, vitamins, and
minerals contributing to the nutritional quality of the fruit and promoting human health
through antioxidant, anti-inflammatory, antimicrobial, anti-allergy, anti-hypertensive and
anticancer properties (Brown et al., 2012; Giampieri et al., 2013; Giampieri et al., 2012;
Mikulic-Petkovsek et al., 2012; Tulipani et al., 2008). Ever increasing production and
consumption of strawberry (UN, 2013) is driven by demand for high quality fruit,
secondarily beneficial to our health, and facilitated by intensive modern horticulture and
sophisticated breeding practices.
Fruit Development and Regulation
Fertilization of the many ovary/ovule inflorescence of strawberry gives rise to the
aggregate fruit (Perkins-Veazie, 1995). Here, the achenes (true fruit) are fixed on the
epidermis, the outermost layer of the swollen receptacle (false fruit), also consisting of a
cortex and internal pith (Suutarinen et al., 1998). Fruit development and ripening is
coordinated and regulated with embryo formation and achene maturation most notably
through achene localized auxin biosynthesis (Given et al., 1988; Nitsch, 1950). The
three stages of non-climacteric, auxin dependent strawberry fruit development; division,
expansion and ripening, involve gains in diameter and fresh weight. During this
transition color shifts from green to white to dark red in about forty days after anthesis
(Zhang et al., 2011a). Increasing auxin during division and expansion stages promotes
growth, peaking prior to fruit whitening when achenes mature. Decreased auxin content
coincides with fruit maturation and ripening, thus auxin biosynthesis promotes fruit
growth but inhibits ripening prior to achene maturation (Fait et al., 2008; Given et al.,
1988).
15
The dynamic state of fruit ripening is exemplified by the nearly 250 cDNAs with
significant differential expression (177 up, 70 down) in red compared to green fruit
determined using a microarray of 1700 probes (Aharoni et al., 2000). A physical
attribute of later ripening stages is the reduction of firmness. Dissolution of middle
lamella, which functions in cell-to-cell adhesion, contributes to the ‘melting’ texture of
fruit. Further, a transcript with 200-fold greater expression in ripening fruit compared to
green, POLYGALACTURONASE, contributes to fruit softening by aiding in catalytic cell
wall disassembly (Brummell and Harpster, 2001; Quesada et al., 2009; Trainotti et al.,
1999). Other differentially expressed transcripts are related to primary and secondary
metabolism, and transcription of multiple ripening–associated genes are initiated by
reduced auxin (Aharoni et al., 2002; Aharoni and O'Connell, 2002; Castillejo et al.,
2004; Manning, 1994, 1998). Transcriptional reconfiguration coordinates the final shift
for strawberry ripening. This highly metabolically active process is visualized by the late
accumulation of the predominant red pigment, pelargonidin 3-glucoside (Hoffmann et
al., 2006), an anthocyanin synthesized from the primary metabolite phenylalanine (Fait
et al., 2008). Of great metabolic interest in the final days of ripening is the accumulation
of multiple sugars and organic acids, which culminates with peak volatile emissions
(Menager et al., 2004).
Strawberry Flavor
The sweet fruity flavor and distinct aroma of a ripe strawberry is the result of a
multifaceted metabolite mixture of sugars, organic acids and volatile compounds, which
are coordinated at ripening through genetic and environmental factors. Early work in
tomato correlated fruit acceptability to sweetness and flavor, which were also shown to
be the result of sugar and volatile content (Baldwin et al., 1998). Glucose, fructose and
16
sucrose accumulate to high levels and account for over 7% of fresh berry weight
(Menager et al., 2004). Citric acid and malic acid produce sour sensations at
concentrations around two to three micromolar (Settle et al., 1986) and are two of the
predominant organic acids in strawberry, in which total content is on the order of 50
millimolar (Mikulic-Petkovsek et al., 2012).
The predominant classes of volatile compounds in ripe strawberry are esters,
lactones, terpenes, aldehydes and characteristic furanones (Menager et al., 2004;
Olbricht et al., 2008) A comparison of strawberry volatile studies underscores the
complexity in defining strawberry aroma, as each source considers a highly variable
subset of total volatiles (Hakala et al., 2002; Jetti et al., 2007; Olbricht et al., 2008;
Schieberle and Hofmann, 1997; Ulrich et al., 1997). Methods such as odor value, aroma
extract dilution analysis, and GC-olfactometry have been used to relate concentrations
of volatiles in strawberry to perception through direct analysis or threshold determination
(Zabetakis and Holden, 1997). These methodologies can be criticized for lack of
physiological relevance as complex mixtures of volatiles are perceived entirely different
than individual volatiles (Bartoshuk and Klee, 2013). These studies have identified
butanoic acid, methyl ester (623-42-7); butanoic acid, ethyl ester (105-54-4); hexanoic
acid, methyl ester (106-70-7); hexanoic acid, ethyl ester (123-66-0); 1,6-octadien-3-ol,
3,7-dimethyl- (linalool) (78-70-6); butanoic acid, 2-methyl- (116-53-0); and 2,5-dimethyl-
4-methoxy-2,3-dihydrofuran-3-one (DMF) (4077-47-8) as integral to strawberry aroma
volatiles (Hakala et al., 2002; Jetti et al., 2007; Olbricht et al., 2008; Schieberle and
Hofmann, 1997; Ulrich et al., 1997). Comparisons of consumer preference among a
17
variety of fresh strawberries and volatile analysis has described less preferable varieties
as possessing less esters, more decalactones and hexanoic acid (Ulrich et al., 1997).
During ripening, strawberry fruits become a nutrient sink and facilitate a
metabolism resulting in the biochemical constituents of strawberry flavor. In developing
strawberry a constant high sucrose sink strength (Basson et al., 2010) results in an
active metabolism able to accumulate, synthesize, and spontaneously produce a
diversity of primary and secondary metabolites (Fait et al., 2008). Transient
transformation of strawberry fruit with a RNA interference construct targeting the
predominant sucrose transporter responsible for sucrose accumulation results in
arrested ripening. Decreased sucrose and abscisic acid content measured in arrested
fruit indicates sucrose as a molecular signal in ripening (Jia et al., 2013). The constant
influx of sucrose is primary to all other aspects of fruit metabolism. It is the source for
alkanes, alcohols, aldehydes, ketones, esters, sugars, organic acids, fatty acids,
furanones, amino acids, and anthocyanins, all of which increase in concentration at one
point in development or ripening (Fait et al., 2008; Zhang et al., 2011a). Many of these
classes also represent precursors of volatile production, thus facilitating a flux through
biosynthetic pathways for the synthesis of some of the 360 identified volatile
compounds detected across Fragaria (Du et al., 2011b; Maarse, 1991).
Within a single fruit, only a fraction of volatiles are emitted and even fewer
contribute to perceived aroma. Functional genomic work has characterized strawberry
enzymes responsible for the synthesis of several volatile components of strawberry
aroma. QUINONE OXIDOREDUCTASE, an enzyme with highly specialized function, is
characterized to be responsible for 3(2H)-furanone, 4-hydroxy-2,5-dimethyl-
18
biosynthesis (Raab et al., 2006). This furanone is indicated to be paramount to
strawberry aroma, in that six of six panelists detected an orthonasal and retronasal
difference when absent in model juice (Schieberle and Hofmann, 1997). Also, this key
aroma compound is a substrate of O-METHYLTRANSFERASE activity to produce
3(2H)-furanone, 4-methoxy-2,5-dimethyl- (DMF) (Lavid et al., 2002), which is less
defining of strawberry odor (Schieberle and Hofmann, 1997). Two ALCOHOL ACYL
TRANSFERASES are characterized in commercial strawberry, which accept a range of
alcohols and acyl-CoA substrates to produce a great diversity of esters, generally
associated with fruit aroma. Also, the transcripts of these enzymes demonstrate fruit
specific expression (Aharoni et al., 2000; Cumplido-Laso et al., 2012). Linalool and
nerolidol are terpenes associated with many fruits and flowers. Volatile analysis,
enzymatic characterization, and molecular markers have confirmed the genetic and
biochemical ability to produce these compounds arises from NEROLIDOL SYNTHASE
1 (NES1). Biosynthetic ability is conferred to commercial F. x ananassa and most hybrid
progenitors, but not hexaploid, tetraploid, or diploid species (Aharoni et al., 2004;
Chambers et al., 2012).
Differences in the presence or absence of volatile compounds exist in
commercial material compared to wild germplasm. This variation in regards to flavor
related metabolites is potentially a result of artificial selection prior or post hybridization.
Domestication of F. chiloensis began at least 700 years prior to hybridization with F.
virginiana (Finn et al., 2013). All accessions of F. chiloensis (4) and F. x ananassa (112)
analyzed contain a linalool producing NES1 allele that is absent in F. vesca materials.
Volatile analysis supports the allelic distribution across Fragaria species, particularly in
19
commercial material (Chambers et al., 2012; Pyysalo et al., 1979). On the other hand,
methyl anthranilate is a common component of F. vesca, but relatively rare in F. x
ananassa (Pyysalo et al., 1979; Ulrich et al., 2007). Determination of biochemical
differences of strawberry aroma and correlated genetic elements can facilitate targeted
approaches to alter flavor of commercial fruit.
Methyl Anthranilate Biosynthesis
Methyl anthranilate is an aromatic ester that is characteristic of Concord grape,
Vitis labrusca. It has been used as a food additive to impart such flavor, for several
decades. The compound has been identified in F. x ananassa: ‘Mieze Schindler’ and F.
vesca. However, it is essentially lacking in fruit produced by commercial cultivars (Ulrich
et al., 2007). Enzymes of alternative pathways capable of producing methyl anthranilate
are characterized in Zea mays (Koellner et al., 2010) and Vitis labrusca (Wang and De
Luca, 2005) where volatile biosynthesis arises under herbivory or fruit ripening,
respectively.
ANTHRANILOYL-CoA:METHANOL ACYLTRANSFERASE of Vitis labrusca
(VlAMAT) catalyzes an alcohol acyl-transfer among anthraniloyl-coenzyme A
(anthraniloyl-CoA) and methanol for methyl anthranilate biosynthesis. This ATP
dependent reaction occurs in the grape where protein and methanol concentrations
increase to relatively high levels in fruit following the onset of ripening (Wang and De
Luca, 2005). Conversely, herbivory induced wound signaling results in up-regulation of
ANTHRANILIC ACID METHYL TRNASFERASE 1.1 of Zea mays (ZmAAMT1.1) and
anthranilic acid, which serves as the substrate for the S-adenosyl methionine dependent
reaction (Koellner et al., 2010). Previously characterized, F. x ananassa
STRAWBERRY ALCOHOL ACYLTRANSFERASE (FaSAAT) or a homolog may be
20
responsible for the production of methyl anthranilate endogenously as its reactivity with
methanol has been confirmed. However, anthraniloyl-CoA was not tested as a
substrate, thus methyl anthranilate production by FaSAAT cannot be ruled out (Aharoni
et al., 2000).
A transgenic effort for methyl anthranilate biosynthesis in strawberry is attractive
due to deficiency in commercial material, hypothetical lack of specificity for endogenous
methyl anthranilate production, and multiple elucidated pathways in other plant species.
Also, stable Agrobacterium transformation of strawberry is becoming routine with the
first report in 1990 by Nehra (1990), despite long regeneration time and sensitivity to
kanamycin antibiotic selection (Folta et al., 2006). Expedited assaying of gene function
routinely relies on transient expression via Agrobacterium infiltration of fruit tissue
(Hoffmann et al., 2006; Meng et al., 2009; Miyawaki et al., 2012). On the other hand,
stable transformation is choice when developing materials tackling commercial interests
of disease resistance (Chalavi et al., 2003; Schestibratov and Dolgov, 2005; Vellicce et
al., 2006), fruit softening (Lee and Kim, 2011), fruit growth and development (Mezzetti et
al., 2004), and aroma enhancement (Lunkenbein et al., 2006). The ease and existing
infrastructure of vegetative propagation of strawberry is encouraging for the
dissemination of transgenic commercial material.
Fragaria x ananassa
The allo-octoploid genome of F. x ananassa provides great diversity and
adaptability for breeding efforts, but prevents use of lower ploidy material in the
development of new cultivars. Inbreeding depression increases with each generation of
related cross in strawberry; however with stringent parent selection genetic gains
comparable to unrelated crosses are achievable (Shaw, 1997). Introgression of F.
21
chiloensis and F. virginiana is increasing and serves as a means of genetic diversity
(Hancock et al., 2001; Smith et al., 2003). Nonetheless, commercial cultivars are the
result of seedling selection, relying on vegetative propagation of daughter plants due to
heterozygosity of seedling progeny (Hancock, 1999; Whitaker et al., 2011).
Following initial hybridization events in the 18th century strawberry breeding
remained a personal endeavor, until the United States Department of Agriculture began
funding breeding efforts in Oregon. Efforts were initially focused on quality traits for
fresh and processed fruit, but disease resistance and abiotic tolerances soon became
priorities (Darrow, 1966). Intense breeding of strawberry has resulted in cultivars from a
relatively limited group in the United States, including proprietary development by
Driscoll’s (Watsonville, CA) and publically disseminated cultivars from the University of
California at Davis and the University of Florida. Today another shift is occurring as a
number of public and private entities, both domestic and abroad, are initiating breeding
programs. This expansion is the result of efforts to develop region specific cultivars, as
well as expanding targets for breeding including increase shelf-life, mechanical
harvestability, nutritional content, and flavor.
A highly successful product of the University of Florida’s breeding program under
Craig Chandler was “Strawberry Festival’. This cultivar is a first generation seedling
selection from a cross between ‘Rosa Linda’ and ‘Oso Grande’. ‘Strawberry Festival’
was selected for its large, firm, conical shaped fruit of desirable red internal and external
color and excellent flavor (Chandler et al., 2000). Currently, ‘Strawberry Festival’ is the
predominant cultivar by acreage in the state of Florida and therefore, an attractive
system for fundamental and applied work aimed at understanding flavor in the context
22
of the consumer. Furthermore, the commercial relevance of ‘Strawberry Festival’ in
Florida and beyond makes it an attractive candidate for cultural, postharvest and
transgenic manipulation to enhance flavor.
Perception and Integration of Flavor
Flavor is the perceptual and hedonic response to the synthesis of sensory
signals of taste, odor, and tactile sensation (Prescott, 2004). In the case of strawberry
and other fruits, sensory elicitation is the result of multiple direct interactions between
plant and human: sugars and acids, pigments, turgor and structure, and volatile
compounds, which elicit the senses of taste, vision, tactile sensation, and olfaction,
respectively, in the development of flavor (Causse et al., 2001; Christensen, 1983; Hall,
1968; Stommel et al., 2005).
The senses of taste and olfaction directly sample the chemicals present in food,
but striking distinctions must be made between the two systems. The basic taste
qualities of sweet, sour, salty, and bitter are very limited in diversity compared to
innumerable distinct olfactory qualities. Nearly 350 olfactory receptor genes were
originally putatively identified following sequencing of the human genome (Breslin,
2001; Zozulya et al., 2001). A more recent study using 1000 Genomes Project identifies
over 4,000 protein variants from 413 intact olfactory receptor loci, of which roughly 600
allelic variants per person are estimated (Olender et al., 2012). This person to person
genetic variation is suggestive of a highly personalized olfactory system. Most
importantly, the distinction is between orthonasal and retronasal olfaction. Orthonasal
olfaction is the result of smelling i.e. bringing odor in through the nose, while retronasal
olfaction is elicited by odorants traveling from oral cavity or esophagus up to nasal
cavity (Pierce and Halpern, 1996). Orthonasal olfaction introduces volatile compounds
23
to the nasal epithelium via inhalation, while retronasal olfaction is achieved during
exhalation (Masaoka et al., 2010). Specifically, the path of odorants distinguishes the
manner of interaction between consumer and potential food, with orthonasal
contributing to aroma and retronasal to flavor.
Integration of sensory stimuli relies on projection signals to various structures of
the brain. Interestingly, portions of orthonasal (smell) and retronasal (flavor) olfaction
project to different brain areas for processing (Small and Jones-Gotman, 2001), while
taste activation partly overlaps that of retronasal olfaction for integration to produce
flavor (Small et al., 2004). Co-activation of taste and retronasal olfaction, but not
orthonasal, is shown to elicit responses at otherwise independently sub-threshold
levels, exemplifying the ability of multiple sensory integration to intensify one another
(Veldhuizen et al., 2010). Mechanical blockage of retronasal olfaction during tasting of
solutions significantly reduces the ability to correctly identify solute, including sucrose
(Masaoka et al., 2010). Combination of taste and retronasal olfaction results in a
sensory system more adapt at analyzing the chemical content of food, but cross
communication also facilitates manipulation of the system.
The food industry knows of the intensification of volatile sensations by the
addition of small amounts of sweeteners to solutions containing volatiles (SjÖStrÖM
Loren and Cairncross Stanley, 1955). The ability of volatiles to enhance taste is also a
known phenomenon (Lindemann, 2001). Enhancement of perceived sweetness is
demonstrated by addition of volatiles amyl acetate (banana) (Burdach et al., 1984) and
citral (Murphy and Cain, 1980). Multiple studies show the ability of strawberry aroma to
intensify the sweetness of a sugar solution (Frank and Byram, 1988; Stevenson et al.,
24
1999), as well as pineapple, raspberry, passion fruit, lychee, and peach (Cliff and Noble,
1990; Stevenson et al., 1999). Also, sweetness enhancement has been achieved with
vanilla (Lavin and Lawless, 1998), caramel (Prescott, 1999; Stevenson et al., 1999),
and chocolate (Masaoka et al., 2010) indicating this phenomena is not only associated
with fruit volatiles. Studies to determine perceptional differences when tomato is spiked
with sugars, acids, and volatiles indicates cross talk between taste and olfaction, in
which volatiles impact perception of sweetness and vice versa (Baldwin et al., 2008).
Individual volatile compounds have been implicated in tomato to intensify perceived
sweetness independent of sugar content (Bartoshuk and Klee, 2013; Tieman et al.,
2012).
Diverse retronasal olfaction and fundamental taste sensory systems combine for
flavor perception in cortical structures of the brain. Enhanced sensitivity and accuracy in
discerning flavors arises from this cooperative effort, facilitating assessment of chemical
constituents of food via chemical senses. Multiple roles are potentially served, but
foremost survival requires finding and consuming ‘safe’ food for maintaining metabolism
and avoiding the deleterious (Breslin, 2001; Goff and Klee, 2006).
Research Objectives
The efforts of strawberry breeding, and other fruits and vegetables in general,
over the past half century have not been on quality traits such as taste, aroma or
texture. Breeder focus has been on visual appeal, firmness for post-harvest, and field
traits such as yield and resistance (Ulrich et al., 2007). With flavor associated traits
difficult to qualify and flavor as a whole at the discretion of a few breeders, present
commercial varieties likely fall short of consumer preference.
25
Identifying Flavor-Related Metabolite Targets Using Psychophysics
Amassing dense flavor-relevant metabolite data and corresponding consumer
hedonic and sensory perceptual information of a diverse set of strawberry fruit allows for
clarification of many factors contributing to strawberry flavor and consumer preference,
using a psychophysics approach. Statistical analysis of detailed metabolite inventory of
54 unique strawberry samples coupled with consumer data of roughly 100 panelists per
sample provides a means to define absolute targets in an otherwise amorphous
phenotype.
Field and Postharvest Environment Factors Influencing Flavor-Related Metabolites
The breadth of genetic diversity assayed for metabolite content is highly
complimented by environmentally induced variation in strawberry fruit flavor-related
metabolites. Integration of weather data with metabolic profiling allows for elucidating
factors that are detrimental to sugar and volatile content, which are positive contributors
to flavor. Specific postharvest light treatments indicate a potential to influence volatile
content on the shelf, while a pilot field experiment does not produce consistent effects.
A Transgenic Approach to Introduce F. vesca Volatile Compound in F. x ananassa
An uncommon commercial strawberry volatile compound, methyl anthranilate, is
the subject of an applied transgenic effort. Emission of this volatile is known and
preferred in many fruit and flowers including F. vesca, therefore heterologous
expression of ZmAAMT1.1, which is characterized to be highly specific for methyl
anthranilate biosynthesis, in ‘Strawberry Festival’ is undertaken to enhance the deficient
cultivars flavor.
26
The defining tenet of consumer-assisted selection is the integration of consumers
in the development of new cultivars. With sweetness and complex flavor being high
priorities of strawberry consumers (Colquhoun et al., 2012) it is critical to identify
metabolites that are significantly impactful upon consumer perception and
environmental factors affecting them. This work provides individual targets for breeding,
fundamental science, and transgenic efforts to produce more flavorful strawberries
using consumer-assisted selection.
27
CHAPTER 2 STRAWBERRY FLAVOR: DIVERSE CHEMICAL COMPOSITIONS, A SEASONAL
INFLUENCE, AND EFFECTS ON SENSORY PERCEPTION
Background
Modern fully ripe strawberry (F. x ananassa) fruit is characterized by its large size
(MacKenzie et al., 2011), vibrant red color (Hong and Wrolstad, 1990), reduced
firmness (Brummell and Harpster, 2001), distinct aroma (Ulrich et al., 1997), and sweet
fruity flavor (Schieberle and Hofmann, 1997). The three stages of non-climacteric, auxin
dependent strawberry fruit development; division, expansion and ripening, involve gains
in diameter and fresh weight; during which color shifts from green to white to dark red in
roughly forty days following anthesis (Zhang et al., 2011a). Ripening of strawberry fruit
results in the accumulation of multiple sugars and organic acids, culminating with peak
volatile emission (Menager et al., 2004).
Flavor is the perceptual and hedonic response to the synthesis of sensory
signals of taste, odor, and tactile sensation (Prescott, 2004). The senses of taste and
olfaction directly sample the chemicals present in food; sugars, acids, and volatiles.
These metabolites are primary sensory elicitors of taste and olfaction that attenuate the
perception and hedonics of flavor. A consumer based survey indicated sweetness and
complex flavor as consistent favorable attributes of the “ideal” strawberry experience
(Colquhoun et al., 2012). Thus a ripe strawberry is metabolically poised to elicit the
greatest sensory and hedonic responses from consumers.
During strawberry fruit development sucrose is continually imported from
photosynthetic tissue. A consistently high sucrose invertase activity contributes to
carbon sink strength in all developmental stages of fruit (Basson et al., 2010). Delivered
sucrose is hydrolyzed into glucose and fructose and these three carbohydrates
28
constitute the major soluble sugars of ripe strawberries, a result of their continual
accumulation during fruit development (Fait et al., 2008). In fact, an approximately
150% increase in their sum during ripening has been observed (Basson et al., 2010;
Menager et al., 2004). The influx of carbon initiates a complex network of primary and
secondary metabolism specific to ripening strawberry fruit (Fait et al., 2008).
The metabolic activity of ripening strawberry is visualized by the late
accumulation of the predominant red pigment, pelargonidin 3-glucoside (Hoffmann et
al., 2006), an anthocyanin derived from the primary metabolite phenylalanine (Fait et al.,
2008). The dynamics of fruit development are genetically driven as nearly 15% of
cDNAs probed using a microarray exhibit significant differential expression in red
compared to green fruit (Aharoni et al., 2000). One up regulated gene,
POLYGALACTURONASE 1.1, contributes to fruit softening (Quesada et al., 2009) by
aiding in catalytic cell wall disassembly (Trainotti et al., 1999). Reduction of firmness is
also attributed to dissolution of middle lamella, which functions in cell-to-cell adhesion
(Brummell and Harpster, 2001). Active shifts in transcript accumulation throughout
ripening result in metabolic network reconfiguration altering the chemical and physical
properties.
Metabolic profiling indicates an accumulation of sugars, organic acids, and fatty
acids as well as the consumption of amino acids during fruit development, which is likely
accountable for increases of alkanes, alcohols, aldehydes, anthocyanins, ketones,
esters, and furanones during fruit ripening (Zhang et al., 2011a). Many of these
chemical classes serve as precursors to volatile synthesis (Perez et al., 2002), thus
facilitating a metabolic flux through biosynthetic pathways for increased and diverse
29
volatile emissions in ripe strawberry fruit, predominantly furanones, acids, esters,
lactones, and terpenes (Menager et al., 2004). Over 350 volatile compounds have been
identified across Fragaria (Du et al., 2011b; Maarse, 1991), however within a single
fruit, far fewer compounds are detectable and even fewer contribute to aroma or flavor
perception.
A cross comparison of five previous studies which analyze strawberry volatiles
depicts the lack of agreement in defining chemical constituents of strawberry aroma.
Each source considers a highly variable subset of total volatiles, which are determined
by signal intensity and/or human perception of isolated compounds (Hakala et al., 2002;
Jetti et al., 2007; Olbricht et al., 2008; Schieberle and Hofmann, 1997; Ulrich et al.,
1997). Mutual volatiles across studies include butanoic acid, methyl ester (623-42-7);
butanoic acid, ethyl ester (105-54-4); hexanoic acid, methyl ester (106-70-7); hexanoic
acid, ethyl ester (123-66-0); 1,6-octadien-3-ol, 3,7-dimethyl- (linalool) (78-70-6);
butanoic acid, 2-methyl- (116-53-0); and DMF(4077-47-8), the current consensus of
integral strawberry aroma compounds. Comparisons of consumer preference among a
variety of fresh strawberries and their volatile profiles describes less preferable varieties
as possessing fewer esters, more decalactones and hexanoic acid (Ulrich et al., 1997).
The breadth of volatile phenotypes previously reported highlights the diversity across
strawberry genotypes and underscores the complexity of the aggregate trait of aroma
and flavor.
Annual horticulture of strawberry in Florida requires continual harvest of ripe fruit
from late November through March. The mild winter production environment affects fruit
quality as gradually increasing temperatures beginning in mid-January result in a late
30
season decline of soluble solids content (SSC) (MacKenzie et al., 2011). In fact,
increasing temperature is known to be responsible for increasing fruit maturation rate
and decreasing SSC independent of flowering date (MacKenzie and Chandler, 2009).
Previous work also identifies variability of SSC, as well as titratable acidity (TA) and
multiple classes of volatile compounds across harvest dates (Jouquand et al., 2008).
The complex fruit biochemistry, which is variably affected by genetic, environmental,
and developmental factors, coupled with individuals’ perceptional biases has made
defining strawberry flavor cumbersome.
Here we exploit the genetic and within-season variability of fruit to provide as
many unique strawberry experiences as possible to a large sample of consumers.
Parallel assays of ripe strawberry samples quantify fruit traits of TA, pH, SSC, and fruit
firmness, as well as the content of malic acid, citric acid, glucose, fructose, sucrose, and
81 volatile compounds. The contributions of these attributes to fruit quality was
determined by simultaneously evaluating samples for perceived sensory intensities of
sourness, sweetness, and strawberry flavor, as well as the hedonic responses of texture
and overall liking, i.e. the pleasure derived from consuming a strawberry sample, by
consumer panelists during the 2011 and 2012 seasons in Florida. Data analyses
determine progression of harvest season effects, gross variation of strawberry
experiences, and factors influencing hedonics and sensory perception of strawberry fruit
consumption using a psychophysics approach. Results suggestive of specific volatile
compounds enhancing perceived sweetness has led to an application for patent
(#13/869,132) with the United States Patent and Trademark Office.
31
Results
The inventory of 54 fully ripe unique strawberry samples (35 cultivars, 12
harvests, two seasons) assayed for TA, pH, SSC, firmness, as well as the
concentrations of malic acid, citric acid, glucose, fructose, sucrose, and quantity of 81
volatile compounds is reported (Table 2-1). Cluster analysis of relative chemical
composition of all samples and derived hierarchy of both cultivar and metabolite
relatedness is displayed (Figure 2-1). The vertical dendrogram (Figure 2-1)
demonstrates the lack of relatedness among volatile compound concentration through
large distances of initials segments, as well as the high number of clusters. Slightly
more structure was observed among the samples, horizontal dendrogram (Figure 2-1),
due to genetic or environmental effects.
Progression of Harvest Season Affects Metabolic Content and Perceived Quality of Strawberry
Ranges of weather parameters are consistent between both 2011 and 2012
seasons, except for slightly more precipitation during late January of 2011 (Figure 2-2
G, H). Solar radiation, minimum and maximum temperature all increased gradually and
showed similar trends in both seasons (Figure 2-2 A-D). Relative humidity also,
remained constant during and across seasons (Figure 2-2 E, F). One manifestation of
these environmental changes over a harvest season was the negative relationship
between SSC and harvest week (R2 = 0.444***) (p < 0.05*, 0.01**, 0.001***) (Table 2-
3). The sugars glucose, fructose, and sucrose were quantified, and their sum (total
sugar) shows a strong positive correlation to SSC (R2 = 0.733) (data not shown) and to
harvest week (R2 = 0.287***) (Table 2-3). Biochemical differences as a result of harvest
week included a significant reduction in sucrose concentration (R2 = 0.350***) (Figure 2-
32
3A). However, glucose (R2 = 0.064) (Figure 2-3B) and fructose (R2 = 0.041) (Figure 2-
3C) did not show a significant change within-season. Total volatile content decreased
as the seasons progressed (R2 = 0.338***) (Figure 2-3D). Also, a significant correlation
was observed among total volatiles and sucrose (R2 = 0.305***) (Figure 2-3E) but not
glucose (R2 = 0.005) (data not shown) or fructose (R2 = 0.001) (Figure 2-3F). The
simultaneous waning of SSC, predominantly sucrose, and volatiles was perceivable, as
overall liking decreases as the season progresses (R2 = 0.422***) (Figure 2-4E).
The hedonic response to strawberry samples was measured as overall liking
using the hedonic general labeled magnitude scale (gLMS) that ranges from -100 to
+100, i.e. least to most pleasurable experience (Bartoshuk et al., 2004; Bartoshuk et al.,
2003; Bartoshuk et al., 2005; Tieman et al., 2012). The strawberry sample with the
highest overall liking was ‘Strawberry Festival’ from first harvest week in the second
season (sn 2, wk 1), which elicited an overall liking of 36.6 (Table 2-1). The lowest, a
late season ‘Red Merlin’ (sn 1, wk 6) scored at 13.3, while the sample set median was
23.5 (Table 2-1). The benchmark ‘Strawberry Festival’ sample contains 3.5-fold more
sucrose and 27% more total volatiles than the least liked fruit (Table 2-1), demonstrating
the disparity between early and late harvest week fruit quality and its effect on
consumer preference.
Overall Liking is Subject to Ratings of Sweetness, Flavor, and Texture
In order to elucidate factors contributing to a positive strawberry experience,
overall liking of strawberry samples was fit against the hedonic measure of texture liking
and the sensory intensities of sweetness, sourness, and strawberry flavor intensity
(Figure 2-4A-D). High correlation with significant fit exists for texture liking (R2 =
0.490***) (Figure 2-4A), sweetness intensity (R2 = 0.742***) (Figure 2-4B), and
33
strawberry flavor intensity (R2 = 0.604***) (Figure 2-4D). However, sourness intensity
showed no correlation to overall liking (R2 = 0.008) (Figure 2-4C). Texture liking had a
significant influence on overall liking, and though increasing firmness contributed to
greater texture liking (R2 = 0.358***) (Figure 2-4I), firmness did not influence overall
liking (R2 = 0.034) (Table 2-4). Sweetness intensity was the strongest driver of overall
liking measured in this study. The correlation between total sugar and overall liking (R2
= 0.488***) (Figure 2-4F) demonstrated the aggregate sugar metabolites effect on
hedonic response to strawberry fruit. Total sugar concentration accounted for nearly a
majority of the observed overall liking variation but was far from a complete measure.
Sourness intensity appears to have no influence on the hedonic response to strawberry
fruit. On the other hand, a limited range of perceivable sourness intensity may be
underrepresenting the effect as fit of TA to overall liking was significant, even if minor
(R2 = 0.099*) (Figure 2-4G). Total volatiles was the second aggregate metabolite
measure having a significant enhancing effect on the overall liking of strawberry (R2 =
0.179**) (Figure 2-4H). This was not surprising, as strawberry flavor intensity exhibits
the second highest correlation to overall liking (Figure 2-4D).
Texture Liking Correlates to Fruit Firmness
The upper limit for hedonics of texture was comparable to that of overall liking
and was observed in ‘Strawberry Festival’ (sn 1, wk 2) with an average of 35.7,
however, the low texture liking value of 5.8 for ‘Mara Des Bois’ (sn 1, wk 7) indicated a
more drastic disliking of “off” textures than lowest overall liking of fruit in its entirety
(Table 2-1). Firmness of samples was assayed by measuring the force required for a
set penetration of the fruit, acting as a proxy for texture. The firmness of the fresh
strawberry exhibited nearly a five-fold difference in force, 0.2 kg for ‘Mara des Bois’ (sn
34
1, wk 7) and 1.0 kg for ‘Strawberry Festival’ (sn 1, wk 5) (Table 2-1). Increasing force of
penetration, i.e. increasing firmness of berries, was positively correlated with texture
liking, indicating a hedonic response to firmer fruit (R2 = 0.358***) (Figure 2-4I).
However, the texture liking rating for the two samples with greatest firmness is less than
expected (Figure 2-4I).
Sweetness Intensity is a Result of Sugar Content
Perceived sweetness intensity was the greatest predictor of overall liking. In fact,
the same samples scoring the highest and lowest for overall liking, ‘Strawberry Festival’
(sn 2, wk 1) and ‘Red Merlin’ (sn 1, wk 6), elicited the greatest (36.2) and least (14.59)
intense sensations of sweetness (Table 2-1). The early and late harvest week samples
supported the observed decline in perceived sweetness intensity across harvest weeks
(R2 = 0.471***) (Table 2-3), which was also observable for multiple sugar measures
(Figure 2-3A-C).
In the 54 samples assayed, the total sugar concentration ranged from 2.29 –
7.93%, a 3.5-fold difference (Table 2-1). Glucose and fructose concentrations exhibited
highly similar ranges to each other, 0.66 – 2.48% and 0.75 – 2.61%, respectively (Table
2-1), and near-perfect correlation (R2 = 0.984***) (data not shown) within a sample.
However, the concentration of glucose or fructose was not predictive of sucrose
concentration (R2 = 0.011 and 0.004, respectively) (data not shown). Sucrose
demonstrated a more dynamic state as its concentration dips as low as 0.16% and up to
2.84%, nearly a seventeen-fold difference among all samples.
Sucrose was the single metabolite with the most significant contribution to overall
liking (R2 = 0.442***) (Table 2-4). Individually, sucrose (R2 = 0.445***) (Figure 2-4M),
glucose (R2 = 0.337***) (Figure 2-4N), and fructose (R2 = 0.300***) (Table 2-4) all
35
significantly influenced the variation in sweetness intensity. However, total sugar
actually only accounted for slightly more than two-thirds of sweetness intensity variation
(R2 = 0.687***) (Figure 2-4L) likely a result of covariation of glucose and fructose.
Interestingly, the total volatile content of a sample correlated positively with sweetness
intensity, potentially accounting for up to 13.9%** of variation in sweetness intensity
(Figure 2-4O).
Sourness Intensity is Partially Explained by Titratable Acidity
The sourness intensity of ‘Red Merlin’ (sn 1, wk 6) led to the lowest maximum
consumer response of 24.6 (Table 2-1). This same sample rated as the lowest in terms
of overall liking and sweetness (Table 2-1). Acidity of strawberry fruit was assayed using
measures of pH, TA, citric acid and malic acid. The pH of strawberry samples ranged
from 3.35 to 4.12, while TA ranges from 0.44% to 1.05%. The range of malic acid
across samples was 0.078% to 0.338% while citric acid ranged from 0.441% to 1.080%
(Table 2-1). TA had the greatest correlation to sourness intensity (R2 = 0.314***) (Figure
2-4P), even compared to pH (R2 = 0.118*), malic acid (R2 = 0.189**) (Figure 2-4Q), or
citric acid (R2 = 0.146**) (Fig.3R) concentration. Citric acid concentration in general is
approximately three-fold greater than malic acid and had a significant correlation to TA
(R2 = 0.49***) (data not shown). There was no correlation of malic acid to TA (R2 = 0.01)
(data not shown). Citric acid did not show any significant correlation to overall liking (R2
= 0.056) (Table 2-4), presumably due to the minimal relationship among sourness
intensity and overall liking (R2 = 0.008) or limited range of sourness intensity ratings
(Figure 2-4C).
36
Flavor Intensity is Influenced by Total and Specific Volatile Content
In this study, strawberry flavor intensity accounts for the retronasal olfaction
component of chemical senses, which compliments sourness and sweetness intensities
contribution to taste. The overall highest sensory intensity was 37.5 for strawberry flavor
of ‘Strawberry Festival’ (sn 2, wk 1), which also rated highest for overall liking and
sweetness intensity. Opposite this, FL- 05-85 (sn 1, wk 6) delivered the least intense
strawberry flavor experience with a score of 19.4. Total volatiles in ‘Strawberry Festival’
(sn 2, wk 1) was over 50% greater than in FL 05-85 and seven more volatiles
compounds are detected (Table 2-1). Total volatiles within a sample contribute to
strawberry flavor intensity (R2 = 0.167**)(Figure 2-4T), but it was not simply the sum of
volatile constituents that explain the effect. For instance, the maximum total volatile
content detected within a sample, 27.3 µg1 gFW-1 hr-1 from ‘Camarosa’ (sn 1, wk 2), did
not result in the greatest flavor intensity (30.5) and the minimum, 8.5 µg1 gFW-1 hr-1 from
‘Sweet Anne’ (sn 2, wk 9), did not rate as the least flavorful (25.8) (Table 2-1).
The chemical diversity of the resources analyzed allowed for the identification of
81 volatile compounds from fresh strawberry fruit (Figure 2-5). The majority of
compounds are lipid derived esters, while lipid derived aldehydes account for the
majority of volatile mass. Terpenes, furans, and ketones were also represented in the
headspace of strawberry. Forty three of the eighty-one volatile compounds were not
detected ( 0.06 ng1 gFW-1 hr-1) in at least one sample i.e. 38 volatiles were measured
in all samples and appear to be constant in the genetic resources analyzed (Table 2-1).
No cultivar has detectable amounts of all 81 volatiles. Samples of ‘Strawberry Festival’,
‘Camino Real’, PROPRIETARY 6 (proprietary cultivar of commercial entity, identity
withheld), and FL 06-38 were lacking detectable amounts of just one compound,
37
benzoic acid, 2-amino-, methyl ester (134-20-3)(methyl anthranilate), which was
detectable in only ‘Mara des Bois’ and ‘Charlotte’ from the final harvest (wk 7) of season
1 (Table 2-1). ‘Chandler’ (sn 2, wk 4) was qualitatively the most deficient sample,
lacking detectable amounts of 19 of 81 compounds, had the second lowest amount of
total volatiles, and a flavor intensity of 24.8 (Table 2-1).
One ester deficient in ‘Chandler’, butanoic acid, 1-methylbutyl ester (60415-61-
4), was not detectable in eight samples, and significantly correlated to flavor intensity
(R2 = 0.233***) (Table 2-4), despite maximum mass of only 11.5 ng1 gFW-1 hr-1 (Table
2-1). Interestingly, the most abundant ester, butanoic acid, methyl ester was measured
at over 7 µg1 gFW-1 hr-1 from PROPRIETARY 2 (sn 1, wk 3) and had less correlation to
flavor (R2 = 0.097*) (Figure 2-4V) than butanoic acid, 1-methylbutyl ester. Hexanoic
acid, ethyl ester exhibits over 200-fold difference across samples, had no bearing on
sensory perception (Table 2-4). Likewise, hexanal (66-25-1) was the second most
abundant individual compound, an aldehyde detected in all samples, exceeded 11 µg1
gFW-1 hr-1(Table 2-1), and did not have a significant correlation to flavor intensity (R2 =
0.016)(Table 2-4). Conversely, two minor level aldehydes demonstrated a disparity in
effect: 1576-87-0 is enhancing toward flavor intensity (R2 = 0.239**) (Figure 2-4U), while
pentanal (110-62-3) was the only compound that negatively correlates to flavor (R2 =
0.079*) (Figure 2-4W). The significant contribution of the terpenes 1,6,10-dodecatrien-3-
ol, 3,7,11-trimethyl-, (6E)- (40716-66-3) and 1,6-octadien-3-ol, 3,7-dimethyl- to flavor
intensity positively correlated with their increasing concentration (R2 = 0.112* and R2 =
0.074*, respectively) (Table 2-4), as well as, the level of a characteristic strawberry
furan, DMF(R2 = 0.108*) (Table 2-3). In total, thirty volatiles diverse in structure and
38
degree of presence were found to have a positive relationship to flavor intensity (α =
0.05).
Specific Volatiles Enhance Sweetness Intensity Independent of Sugars
Multiple regressions of individual volatile compounds against perceived intensity
of sweetness was performed independent of either glucose, fructose, or sucrose
concentration (Table 2-5). Twenty four volatile compounds showed significant
correlations (α = 0.05) to perceived sweetness intensity independent of glucose or
fructose concentration, twenty-two of which were mutual between the two
monosaccharides. Twenty volatiles were found to enhance sweetness intensity
independent of sucrose concentration; only six of these volatiles were shared with those
independent of glucose and fructose: 1-penten-3-one (1629-58-9); 2(3H)-furanone,
dihydro-5-octyl- (2305-05-7); butanoic acid, pentyl ester (540-18-1); butanoic acid, hexyl
ester (2639-63-6); acetic acid, hexyl ester (142-92-7); and butanoic acid, 1-methylbutyl
ester. Only three compounds were found to be negatively related to sweetness
independent of at least one of the sugars: octanoic acid, ethyl ester (106-32-1)
exclusively independent of glucose; 2-pentanone, 4-methyl- (108-10-1) mutually
independent of glucose and fructose; and 2-buten-1-ol, 3-methyl-, 1-acetate (1191-16-8)
exclusively independent of sucrose.
Discussion
Exploitation of genetic diversity and environmental variation allows for a wide
range of consumer hedonic and sensory responses. A nearly three-fold difference in
overall liking of strawberry is observable within all samples. The highest and lowest
rating samples are ‘Strawberry Festival’ of the first week of season 2 and ‘Red Merlin’ of
week six in the first season; two cultivars that are grown under the same conditions, but
39
product of separate breeding programs and from opposite ends of the harvest season.
The cultivars in this study represent a large proportion of commercial strawberry
acreage in North America, breeding selections, and European cultivars. A genetic
collection to enhance the range of diversity for flavors and chemical constituents.
Despite the perennial life cycle of strawberry much commercial production uses annual
methods, which in sub-tropical Florida allows for continual harvest of ripe fruit from late
November through March. In general, progression of harvest of non-determinant, non-
climacteric fruit throughout a season results in decreased overall liking, attributed to
perceivable differences in fruit quality (Figure 2-4E).
Increasing texture liking, sweetness intensity, and strawberry flavor intensity
significantly increase overall liking, while sourness intensity is not clear (Figure 2-4A-D).
Therefore, overall liking is the cumulative measure of the experience from eating a
strawberry fruit. Integration and synthesis of response to sensory signals of taste,
olfaction, and tactile sensation constitute an eating experience (Prescott, 2004) and
drive overall liking. The senses of taste and olfaction sample the chemicals present in
food like sugars, acids, and volatile chemical compounds. These elicitors attenuate the
perception and hedonics of food (Fujimaru and Lim, 2013; Lindemann, 2001). Ratings
of strawberry fruit are correlated to specific chemical or physical attributes, especially
sweetness and flavor intensity, the two greatest drivers of overall liking.
Much work has been done to measure sugars and volatile compounds in
strawberry fruit in attempt of understanding sweetness and flavor, and these aims are in
line with consumer demand. A consumer survey using 36 attributes of strawberry
determined “sweetness” and “complex flavor” as consistent favorable characteristics of
40
the ideal strawberry experience (Colquhoun et al., 2012). Using the same gLMS scales
employed in the current study, means for ideal strawberry and tomato (Tieman et al.,
2012) overall liking, sourness intensity, and flavor intensity are similar. Ideal flavor
evoked the highest mean sensory intensity for both, 45 on an intensity scale of 0-100,
exemplifying its importance to the consumer. Interestingly, a large disparity for ideal
sweetness intensity is found; 42 and 33 for strawberry and tomato, respectively. Ideal
sweetness intensity is much greater in strawberry, potentially due to differences in
consumption. Strawberry is often consumed fresh and is a delicacy or dessert fruit,
while tomato is savory and often an ingredient in complex recipes. Therefore, the desire
for sweetness is much greater in strawberry.
The overall liking of strawberry fruit is significantly related to texture liking (Figure
2-4A), and increasing fruit firmness accounts for more than a third of increasing texture
liking (Figure 2-4I). The five-fold variation in firmness can be attributed to variation in
fruit development or softening (Table 2-1). Strawberry fruit development consists of
division, expansion, and ripening (Zhang et al., 2011a). Developmentally regulated,
ripening associated fruit softening is multifaceted (Quesada et al., 2009), including
catalytic cell wall disassembly (Trainotti et al., 1999) and dissolution of cell-to-cell
adhesion (Brummell and Harpster, 2001). The relationship between texture liking and
firmness does not appear entirely linear, because the two firmest samples are close to
average texture liking (Figure 2-4I). Excessively firm fruits may be perceived as under
ripe while those with less firmness may be considered over ripe; affecting texture liking.
Fruit can progress through ripening, from under to over ripe, in ten days (Zhang et al.,
41
2011a), exemplifying the narrow window in which multiple facets of fruit quality must
synchronize.
Despite a moderate range of intensity, perceived sourness has little to no bearing
on overall liking (Figure 2-4C). Just over 30% of sourness intensity variation can be
accounted for by positive correlation with TA. The concentrations of citric acid and malic
acid metabolites are likely additive toward the effect of TA on sourness intensity, and in
fact both organic acids have significant correlations to TA (data not shown). Despite a
lack of influence by sourness intensity on overall liking, which may be a result of limited
intensity range, metabolites of sourness have a critical role in fruit biochemistry, as
increased TA shows a significant minor correlation with overall liking (Table 2-4) and
correlates significantly with SSC (data not shown). This co-linearity is due to
accumulation of sugars and subsequent biosynthesis of organic acids during ripening of
fruit (Fait et al., 2008; Menager et al., 2004; Zhang et al., 2011a). Citric acid is the
predominant organic acid in ripe fruit (Mikulic-Petkovsek et al., 2012) and its
concentration is fairly stable during ripening. Also, it is known to act as an intermediate
between imported sucrose and fatty acid biosynthesis (Fait et al., 2008), which may
facilitate enhancement of overall liking.
The consumer rating of sweetness intensity is the primary factor contributing to
overall liking, and sweetness is the component of taste perception facilitating the
detection of sugars. Sugars are simple carbohydrates, a readily available form of
energy, and the degree of correlation among sweetness and overall liking is due to
hedonic effect (Lindemann, 2001). Variation in sweetness intensity is best explained by
sugar content (Figure 2-4L) and SSC. More commonly SSC is used to estimate sugar
42
concentration, a valid indicator of sweetness in strawberry (Jouquand et al., 2008;
Whitaker et al., 2011). Previous quantification of individual sugars within a strawberry
identifies sucrose, glucose, and fructose as the predominant soluble solids (Basson et
al., 2010; Menager et al., 2004; Mikulic-Petkovsek et al., 2012; Whitaker et al., 2011).
Sucrose concentration, more than any other measure, is responsible for the most
variation in SSC, sweetness intensity, and overall liking. (Table 2-4). Metabolites
contributing to perceived sweetness intensity have the greatest influence on the overall
hedonics of strawberry. A significant decrease in sweetness intensity occurs during the
seasons, and unfortunately overall liking decreases as well.
The extended harvest season of strawberry has an effect on fruit quality (Figure
2-4E) likely due to environmental changes (Figure 2-2) or plant maturity. These factors
are likely causative of the observable decrease in sweetness intensity as the season
progresses (Table 2-3). SSC, the best predictor of sweetness intensity, decreases
during the season as the plant is subjected to increasing temperatures (Table 2-3),
which likely alters whole plant physiology and more specifically fruit biochemistry during
development and ripening, affecting fruit quality. Development of fruit under elevated
temperature increases fruit maturation rate and decreases SSC independent of
flowering date i.e. plant maturity (MacKenzie and Chandler, 2009; MacKenzie et al.,
2011). A significant and strong decrease in sucrose and a lack of change in glucose and
fructose indicates sucrose as the waning constituent of SSC within a season (Figure 2-
3A-C). Sucrose concentration has greatest variability among the three sugars and
shows no significant relationship to glucose or fructose concentration. However, a near
perfect statistical relationship observed between glucose and fructose is likely due to
43
their biosynthetic association. During strawberry fruit development sucrose is continually
translocated from photosynthetic tissue, while a consistently high sucrose invertase
activity in fruit hydrolyzes sucrose into glucose and fructose, maintaining sink strength
of fruit (Basson et al., 2010) and in turn feed biosynthetic pathways (Fait et al., 2008).
Increased maturation rate hastens fruit development, potentially decreasing
cumulative period sucrose is imported to fruit, and inhibiting sucrose accumulation to
affect other fruit quality attributes. Total volatile content has an indirect dependence on
sucrose concentration (Figure 2-3E), and a decrease in total volatiles is observed as the
seasons progress (Figure 2-3D). Generation of glucose and fructose initiates a complex
network of primary and secondary metabolism specific to ripening strawberry fruit, in
which sucrose is principal and limiting to the strawberry fruit biosynthetic pathways (Fait
et al., 2008). The primary metabolite classes of fatty acids and amino acids are derived
from sucrose in a fruit specific metabolism and their concentrations decrease in the final
stage of ripening (Fait et al., 2008). The culmination of ripening coincides with peak
concentration of volatile secondary metabolites (Menager et al., 2004) and upregulation
of associated biosynthetic genes (Cumplido-Laso et al., 2012). Influence of harvest date
on headspace of fresh strawberry fruit is known (Pelayo-Zaldivar et al., 2005; Watson et
al., 2002). One hypothesis, increased volatile content is dependent on more free
sucrose, i.e. a larger imported reserve, facilitating greater flux through primary and
secondary metabolism. Glucose and fructose concentrations are tightly correlated,
show less variation, less seasonal influence, and lack of correlation to sucrose,
indicative of tighter biochemical regulation.
44
Strawberry flavor intensity is the second greatest determinant of overall liking
(Figure 2-4D) and accounts for perception of volatile compounds through retronasal
olfaction. A significant positive relationship exists among total volatile content and the
flavor intensity for a given sample, however, total volatile content is not entirely
explanatory of flavor intensity. The maximum rating for strawberry flavor intensity by
‘Strawberry Festival’ (sn 2, wk1) is the greatest consumer response evoked within this
study (Table 2-1), highlighting the significance of sensory perception of aroma.
However, this sample only has slightly more than 60% of total volatile mass of the
greatest sample. The extent of volatile phenotype diversity is great enough across
strawberry fruit to not only be discerned but be preferred.
Within the genetic resources of F. x ananassa analyzed in this study 81
compounds are reproducibly detected, but not one cultivar has detectable amounts of
all compounds. Accumulation of sugars, organic acids, and fatty acids, as well as the
consumption of amino acids occurs during ripening (Zhang et al., 2011a). Many of these
chemical classes serve as precursors to volatile synthesis (Perez et al., 2002), thus
facilitating a flux through biosynthetic pathways for increased and diverse volatile
emissions in ripe strawberry fruit, characterized by acids, aldehydes, esters, furanones,
lactones, and terpenes (Jetti et al., 2007; Menager et al., 2004). Over 350 volatile
compounds are identified across Fragaria (Du et al., 2011b; Maarse, 1991). The
concentrations of individual volatile compounds within fruit can have a significant
influence on flavor intensity, but which volatiles are determinant of flavor has a lack of
agreement.
45
Previous determination of flavor relevance relied on approaches in which
importance of volatiles is based on analytical signal intensity and/or human perception
of single isolated volatile compound via orthonasal olfaction (Hakala et al., 2002; Jetti et
al., 2007; Olbricht et al., 2008; Schieberle and Hofmann, 1997; Ulrich et al., 1997),
negating the complex system of strawberry fruit or actual flavor relevant retronasal
olfaction. Of the forty-six volatile compounds cited as relevant to strawberry flavor in five
studies (Hakala et al., 2002; Jetti et al., 2007; Olbricht et al., 2008; Schieberle and
Hofmann, 1997; Ulrich et al., 1997) only seven are common to at least three of the
studies, exemplifying the lack of agreement in defining flavor-relevant constituents. This
agreement includes butanoic acid, methyl ester; butanoic acid, ethyl ester; hexanoic
acid, methyl ester; hexanoic acid, ethyl ester; 1,6-Octadien-3-ol, 3,7-dimethyl- (linalool);
butanoic acid, 2-methyl-; and DMF-, all of which are quantified in this report. These
compounds exhibit adequate variability in fruit samples to discern dose dependent
effect on flavor intensity. However, only 1,6-Octadien-3-ol (linalool), 3,7-dimethyl-;
butanoic acid, ethyl ester; butanoic acid, methyl ester; and DMF show significant
positive correlation with flavor intensity (Table 2-4). These compounds that are found to
influence flavor intensity represent diverse classes, terpenoid alcohol, two esters, and a
furan, respectively, while the three compounds not fitting to flavor are all esters. With
esters accounting for the majority of chemical compounds detected in strawberry it is
possible that too much emphasis is placed on the chemical class for flavor, or that in a
complex mixture less are perceivable than when smelled individually. These volatiles
may have no bearing on strawberry flavor, but have been targets due to quantity,
threshold ratios, or simply identity.
46
Over one third of volatiles in this study significantly correlate with strawberry
flavor intensity, potentially enhancing perception of a complex and highly variable
volatile mixture (Table 2-4), seventeen of which are not of previous strawberry flavor
focus. Two of these unrecognized compounds, 1-hexanol (111-71-7) and butanoic acid,
3-methyl-, butyl ester (109-19-3), are present in the most flavorful strawberry sample but
undetected in the least flavorful (Table 2-1). This pair of compounds as well as
pentanoic acid, ethyl ester (539-82-2) and butanoic acid, 3-methyl-, octyl ester (7786-
58-5), also present/absent in the most/least flavorful, have relatively minor amounts but
show evidence of enhancing perceived sweetness intensity independent of individual
sugars. Volatiles with relatively low concentrations are indicated as new impactful
components of strawberry flavor.
Thirty-eight volatile compounds are observed to significantly enhance the
perceived intensity of sweetness; twenty-two mutually independent of glucose and
fructose, fourteen uniquely independent of sucrose, and six compounds mutually
independent of all three sugars: 1-penten-3-one; 2(3H)-furanone, dihydro-5-octyl- (γ-
dodecalactone); butanoic acid, pentyl ester; butanoic acid, hexyl ester; acetic acid,
hexyl ester; and butanoic acid, 1-methylbutyl ester (Table 2-5). In tomato, similar
analysis of a volatile subset identifies three compounds enhancing sweetness intensity
independent of fructose: geranial; 1-butanol, 3-methyl- (123-51-3); and butanal, 2-
methyl- (96-17-3) (Tieman et al., 2012). These compounds are not identified in the
current study, therefore the effect cannot be confirmed in a second system. Botanically,
tomato is considered a true fruit and demonstrates climacteric ripening, while strawberry
fruit is non-climacteric and considered an aggregate accessory fruit. The developmental
47
origin of the flesh that is consumed is divergent, exhibiting unique biochemistries, but
the observance of volatile compounds potentially enhancing perceived sweetness
appears to be widespread in fruit.
Orthonasal (smell) and retronasal (flavor) olfaction each project to different brain
areas for processing (Small and Jones-Gotman, 2001), and taste projects to the same
brain area as retronasal olfaction for integration to produce flavor (Small et al., 2004).
This integration has a remarkable consequence: taste and retronasal olfaction can
intensify one another. The food industry knows of the intensification of volatile
sensations by the addition of small amounts of sweeteners to solutions containing
volatiles (SjÖStrÖM Loren and Cairncross Stanley, 1955). The ability of volatiles to
enhance taste is also a phenomena (Burdach et al., 1984; Lindemann, 2001; Murphy et
al., 1977), and one study shows the ability of strawberry aroma to intensify the
sweetness of a sugar solution (Frank and Byram, 1988). The results here narrow the
previous effect of enhanced sweetness by strawberry aroma, a variable mixture, to
individual compounds in the fruit. These volatiles are not present at the highest amounts
in fruits and most are not targets of flavor analysis. Also, a majority appear to be
associated with lipid metabolism, like many other volatiles quantified in this work, yet
their presence or increased concentration has an enhancing effect on perceived
sweetness independent of sugars. Technically, sweetness is a facet of taste
(Lindemann, 2001). Therefore a means to convey sweetness via volatiles can serve as
an attractant to seed dispersers of wild strawberry, or perhaps it is a result of artificial
selection (Aharoni et al., 2004) to enhance a limited sugar capacity in commercial fruit.
48
Strawberry fruit ripening results in softening of flesh, peak volatile emission, and
accumulation of sugars. This highly coordinated process results in fruit with strong liking
due primarily to texture, flavor, and sweetness. However, cultivar, environmental
conditions, and their interactions influence fruit attributes, altering the composition of
strawberry. This diversity allows for a gamut of experiences such that the hedonics and
intensities of these sensations can vary greatly. The importance of sucrose to
sweetness intensity is evident, and the correlation of total volatiles to sucrose highlights
the dependence of secondary metabolism to primary metabolism. Individual volatiles
correlate to strawberry flavor intensity, helping to better define distinct, perceptually
impactful compounds from the larger mixture of the fruit. The dependence of liking on
sweetness and strawberry flavor is undermined by environmental pressures that reduce
sucrose and total volatile content. A cultivar that exhibits minimal seasonal
environmental influence presents itself as a breeding ideotype, as maintenance of
sucrose concentration may alleviate loss of overall liking. Selection for increased
concentrations of volatile compounds that act independently of sugars to enhance
sweetness can serve as an alternate approach. The volatiles described herein are
sampled mainly from current commercial cultivars and are therefore feasible targets for
varietal improvement in the short-term, whereas future studies will be necessary to
identify sweet-enhancing volatiles not already present in elite germplasm.
Materials and Methods
Plant Material
Thirty-five strawberry cultivars and selections were grown during the 2010-2011
and 2011-2012 winter seasons according to current commercial practices for annual
strawberry plasticulture in Florida (MacKenzie et al., 2011; Santos et al., 2012). The
49
cultivars were chosen to represent a large proportion of commercial strawberry acreage
in North America from both public and private breeding programs. Additional breeding
selections and European cultivars were added to enhance the range of diversity for
flavors and chemical constituents. Fully-ripe fruit by commercial standards (Strand,
2008) was harvested from three to five cultivars on Monday mornings, delivered to the
respective laboratories, and stored at 4°C in the dark overnight for simultaneous
analysis of fresh strawberry fruit volatiles, firmness, and sensory analysis on Tuesdays;
as well as sample preparation for later sugar and acid measurements. Six harvests in
both seasons allows for the complete analysis of fifty-four samples. Weather data was
obtained from the Balm, FL station of the Florida Automated Weather Network
(http://fawn.ifas.ufl.edu). Daily maximum and minimum temperature recording height
was 60 cm, and daily average relative humidity, rain, and solar radiation were recording
at 2 m.
Volatile Analysis
At least 100 grams or seven berries of each sample were removed from 4°C dark
overnight storage prior to volatile collection. Samples were homogenized in a blender
prior to splitting into three 15 gram replicates for immediate capturing of volatile
emissions and the remainder frozen in N2 (l) and stored at -80°C for later sugar and acid
quantification. A two hour collection in a dynamic headspace volatile collection system
(Underwood et al., 2005) allowed for concentration of emitted volatiles on HaySep 80-
100 porous polymer adsorbent (Hayes Seperations Inc., Bandera, TX, USA). Elution
from polymer was described by Schmelz et al. (Schmelz et al., 2003).
Quantification of volatiles in an elution was performed on an Agilent 7890A
Series gas chromatograph (GC) (carrier gas; He at 3.99 mL min-1; splitless injector,
50
temperature 220°C, injection volume 2 µl) equipped with a DB-5 column ((5%-Phenyl)-
methylpolysiloxane, 30 m length × 250 µm i.d. × 1 µm film thickness; Agilent
Technologies, Santa Clara, CA, USA). Oven temperature was programmed from 40°C
(0.5 min hold) at 5°C min-1 to 250°C (4 min hold). Signals were captured with a flame
ionization detector (FID) at 280°C. Peaks from FID signal were integrated manually with
Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA). Volatile
emissions (ng1 gFW-1 h-1) were calculated based on individual peak area relative to
sample elution standard peak area. GC-Mass Spectrometry (MS) analysis of elutions
was performed on an Agilent 6890N GC in tandem with an Agilent 5975 MS (Agilent
Technologies, Santa Clara, CA, USA) and retention times were compared with
authentic standards (Sigma Aldrich, St Louis, MO, USA) for volatile identification
(Schmelz et al., 2001). Chemical Abstract Services (CAS) registry numbers were used
to query SciFinder® substances database for associated chemical name and molecular
formula presented in Table 2-6.
Sugars and Acids Quantification
Titratable acidity, pH, and SSC were averaged from four replicates of the
supernatant of centrifuged thawed homogenates (Whitaker et al., 2011). An appropriate
dilution of the supernatant from a separate homogenate (centrifugation of 1.5 ml at
16,000 x g for 20 minutes) was analyzed using biochemical kits (per manufacturer’s
instructions) for quantification of citric acid, L-malic acid, D-glucose, D-fructose, and
sucrose (CAT# 10-139-076-035, CAT# 10-139-068-035, and CAT# 10-716-260-035; R-
Biopharm, Darmstadt, Germany) with absorbance measured at 365 nm on an Epoch
Microplate Spectrophotometer (BioTek, Winooksi, VT, USA). Metabolite average
concentration (mg 100gFW-1) was determined from two to six technical replicates per
51
pooled sample. Derived sucrose concentrations via D-glucose and D-fructose were
mathematically pooled.
Firmness Determination
Firmness of the strawberries was determined as the resistance of the fruit to
penetration (7 mm depth) at its equator with a TA.XTPlus Texture Analyzer (Texture
Technologies Corp., Scarsdale, NY, USA/Stable Micro Systems, Godalming, Surrey,
UK). The Texture Analyzer was equipped with a 50 kg load cell and an 8 mm diameter
convex tip probe. Whole fruit was punctured on the side to 7 mm down from the
epidermis at a test speed of 2 mm/sec; a flap cut off the opposite side provides stability.
Maximum force in kg for eight fruit was averaged and reported as a measure of
firmness.
Sensory Analysis
All consumer panels were approved by the University of Florida Institutional
Review Board. Over the course of two years, 166 recruited strawberry consumers (58
male, 108 female) evaluated strawberry cultivars. Ages of panelist ranged from 18 to
71, with a median age of 24. Panelists self-classified themselves as 98 White or
Caucasian, 11 Black or African-American, 1 Native American, Alaska Native or Aleutian,
41 Asian/Pacific Islander, and 15 Other. An average of 106 (range of 98-113) panelists
evaluated between three and five cultivars per session (Tieman et al., 2012). Fresh,
fully-ripe strawberry fruit was removed from overnight 4°C dark storage and allowed to
warm to room temperature prior to sensory analysis. Each panelist was given one to
two whole strawberries for evaluation, depending on cultivar availability. Panelist bit
each sample, chewed, and swallowed it. Ratings for overall liking and texture liking
were scaled on hedonic gLMS in the context of all pleasure/displeasure experiences.
52
Perceived intensity of sweetness, sourness, and strawberry flavor are scaled in context
of all sensory experiences using sensory gLMS (Bartoshuk et al., 2004; Bartoshuk et
al., 2003; Bartoshuk et al., 2005; Tieman et al., 2012). Scales were employed to
mediate valid comparisons across subjects and sessions.
Statistical Analysis
Means and standard errors for consumer, physical, and metabolite
measurements were determined from all replicates using JMP (Version 8, SAS Institute
Inc., Cary, NC, USA). Bivariate analysis among individual measurements of samples
allowed for linear fit, which included summary of fit, analysis of variance, t-test, and
correlation analysis for density ellipse. Two-way Ward hierarchical cluster analysis of all
metabolite concentrations and strawberry samples was accomplished in JMP. Amounts
of individual volatile compounds were regressed using the “enter” method in SPSS (IBM
Corp., Armonk, NY, USA). This is done individually for each of the three sugars:
glucose, fructose or sucrose to identify which compounds have an effect on sweetness
intensity (positive or negative) independent of each of the sugars. For p-values ≤.05, the
volatile makes a contribution to perceived sweetness that is independent of the sugar
tested.
53
Table 2-1. Means of consumer, physical, and biochemical measures.
HIGH 36.58 35.71 36.15 24.58 37.54
LOW 13.25 5.79 14.59 9.77 19.41
MEDIAN 23.52 25.29 22.19 18.32 25.78
FOLD DIFFERENCE
3 6 2 3 2
CULTIVAR HARVEST HARVEST
DATE OVERALL
LIKING TEXTURE
LIKING SWEETNESS INTENSITY
SOURNESS INTENSITY
STRAWBERRY FLAVOR INTENSITY
-100 to +100 -100 to +100 0 to +100 0 to +100 0 to +100
PROPRIETARY 1 2011 - 2 1/24/2011 30.75 24.89 27.72 14.68 30.58 CAMAROSA 2011 - 2 1/24/2011 26.34 26.39 23.66 21.24 30.05 FESTIVAL 2011 - 2 1/24/2011 36.10 35.71 30.34 17.87 24.27
MARA DES BOIS 2011 - 2 1/24/2011 22.49 13.00 27.58 15.87 28.61 RADIANCE 2011 - 2 1/24/2011 28.20 30.39 24.57 18.39 28.27
PROPRIETARY 2 2011 - 3 1/31/2011 31.85 24.61 31.01 17.27 33.48 CAMAROSA 2011 - 3 1/31/2011 27.76 27.73 24.76 19.07 29.50
SWEET CHARLIE 2011 - 3 1/31/2011 31.08 26.73 29.35 15.71 32.20 TREASURE 2011 - 3 1/31/2011 28.77 27.63 25.10 17.23 28.09
WINTER DAWN 2011 - 3 1/31/2011 26.05 25.60 20.68 19.46 25.40 PROPRIETARY 3 2011 - 4 2/7/2011 21.30 14.69 22.22 19.51 27.79
CAMINO REAL 2011 - 4 2/7/2011 14.06 13.95 16.16 19.77 23.41 FESTIVAL 2011 - 4 2/7/2011 20.31 23.85 18.51 18.99 23.58
WINTERSTAR 2011 - 5 2/14/2011 28.42 28.32 24.87 15.39 27.18 FESTIVAL 2011 - 5 2/14/2011 24.99 26.48 22.60 21.23 29.37 RADIANCE 2011 - 5 2/14/2011 20.98 26.83 19.83 18.69 25.58
PROPRIETARY 4 2011 - 5 2/14/2011 28.98 19.83 28.13 19.73 32.21 FL 05-85 2011 - 6 2/21/2011 19.46 23.85 17.87 11.50 19.41 ELYANA 2011 - 6 2/21/2011 23.50 27.14 22.77 12.09 24.70
FESTIVAL 2011 - 6 2/21/2011 22.53 25.30 19.75 13.81 23.98 RED MERLIN 2011 - 6 2/21/2011 13.25 21.49 14.59 24.58 23.95
SAN ANDREAS 2011 - 6 2/21/2011 19.39 26.59 18.25 21.68 25.37 ALBION 2011 - 7 2/28/2011 25.49 25.79 21.69 22.88 29.93
CHARLOTTE 2011 - 7 2/28/2011 13.87 8.66 20.16 9.77 19.72 FESTIVAL 2011 - 7 2/28/2011 17.35 23.78 15.94 15.88 20.36
MARA DES BOIS 2011 - 7 2/28/2011 15.05 5.79 24.99 12.10 24.82 MONTERREY 2011 - 7 2/28/2011 14.51 19.64 18.15 19.95 25.72
ALBION 2012 - 1 1/16/2012 34.22 32.85 33.98 16.41 36.70 FESTIVAL 2012 - 1 1/16/2012 36.58 34.79 36.15 18.24 37.54 MOJAVE 2012 - 1 1/16/2012 30.14 25.71 32.79 16.74 33.21
PROPRIETARY 3 2012 - 1 1/16/2012 28.32 20.47 30.89 15.38 31.96 CHANDLER 2012 - 4 2/6/2012 16.44 15.69 19.13 22.38 24.78 FESTIVAL 2012 - 4 2/6/2012 25.66 26.88 24.43 19.97 29.90 FL 09-127 2012 - 4 2/6/2012 24.40 25.28 23.40 17.62 27.53
TREASURE 2012 - 4 2/6/2012 28.49 28.62 26.02 18.67 29.79 WINTER DAWN 2012 - 4 2/6/2012 23.09 24.11 21.33 19.98 26.47
PROPRIETARY 5 2012 - 5 2/13/2012 26.91 25.38 24.98 16.78 27.15 ALBION 2012 - 5 2/13/2012 29.02 26.66 25.42 19.83 30.03
FESTIVAL 2012 - 5 2/13/2012 22.16 22.76 21.25 16.41 24.49 RUBYGEM 2012 - 5 2/13/2012 22.22 25.70 21.19 15.42 24.86
CAMINO REAL 2012 - 6 2/20/2012 23.54 24.51 21.34 16.98 25.49 DARSELECT 2012 - 6 2/20/2012 29.15 20.67 28.15 18.21 30.88
FESTIVAL 2012 - 6 2/20/2012 23.09 24.31 22.15 17.93 25.15 SWEET ANNE 2012 - 6 2/20/2012 24.19 27.04 24.11 21.68 28.63
BENICIA 2012 - 7 2/27/2012 20.00 26.06 19.00 19.66 24.28 FESTIVAL 2012 - 7 2/27/2012 20.85 24.62 18.85 16.90 22.08 FL 06-38 2012 - 7 2/27/2012 27.50 27.97 23.37 17.22 26.95
PORTOLA 2012 - 7 2/27/2012 23.12 27.10 19.40 20.23 24.77 VENTANA 2012 - 7 2/27/2012 18.10 25.69 15.53 20.72 22.08
PROPRIETARY 6 2012 - 9 3/12/2012 16.63 15.93 18.28 20.26 22.70 EVIE 2 2012 - 9 3/12/2012 18.99 18.59 20.09 18.40 23.96
FESTIVAL 2012 - 9 3/12/2012 20.99 21.11 20.95 13.84 22.41 GALLETA 2012 - 9 3/12/2012 15.57 15.62 18.76 22.49 24.79
SWEET ANNE 2012 - 9 3/12/2012 23.80 25.05 20.43 22.57 25.83
54
Table 2-1. Continued.
HIGH 1.01 12.25 4.12 1.05
LOW 0.21 4.45 3.35 0.44
MEDIAN 0.51 7.13 3.69 0.83
FOLD DIFFERENCE
5 3 1 2
CULTIVAR HARVEST FORCE SSC pH TA
kg %
%
PROPRIETARY 1 2011 - 2 0.51 9.15 3.73 0.74 CAMAROSA 2011 - 2 0.48 7.43 3.47 0.89 FESTIVAL 2011 - 2 0.83 8.50 3.63 0.72
MARA DES BOIS 2011 - 2 0.50 10.13 3.43 0.85 RADIANCE 2011 - 2 0.65 7.83 3.57 0.79
PROPRIETARY 2 2011 - 3 0.45 8.95 3.53 0.83 CAMAROSA 2011 - 3 0.64 8.45 3.55 0.85
SWEET CHARLIE 2011 - 3 0.52 8.98 3.77 0.67 TREASURE 2011 - 3 0.81 9.15 3.65 0.77
WINTER DAWN 2011 - 3 0.63 7.65 3.41 0.85 PROPRIETARY 3 2011 - 4 0.35 7.43 3.53 0.76
CAMINO REAL 2011 - 4 0.32 4.45 3.55 0.61 FESTIVAL 2011 - 4 0.61 6.05 3.71 0.60
WINTERSTAR 2011 - 5 0.81 6.30 3.58 0.58 FESTIVAL 2011 - 5 1.01 7.58 3.41 0.74 RADIANCE 2011 - 5 0.97 5.70 3.48 0.64
PROPRIETARY 4 2011 - 5 0.47 8.80 3.41 0.96 FL 05-85 2011 - 6 0.70 6.50 3.82 0.53 ELYANA 2011 - 6 0.81 7.13 3.72 0.57
FESTIVAL 2011 - 6 0.73 7.03 3.72 0.59 RED MERLIN 2011 - 6 0.83 7.15 3.43 0.79
SAN ANDREAS 2011 - 6 0.80 7.45 3.61 0.77 ALBION 2011 - 7 0.45 6.23 3.51 0.85
CHARLOTTE 2011 - 7 0.34 6.60 3.89 0.44 FESTIVAL 2011 - 7 0.72 5.43 3.64 0.50
MARA DES BOIS 2011 - 7 0.21 7.03 3.64 0.61 MONTERREY 2011 - 7 0.50 6.60 3.57 0.76
ALBION 2012 - 1 0.75 12.25 3.90 0.97 FESTIVAL 2012 - 1 0.63 9.50 3.85 0.90 MOJAVE 2012 - 1 0.35 10.18 3.86 0.95
PROPRIETARY 3 2012 - 1 0.48 9.73 3.83 0.92 CHANDLER 2012 - 4 0.30 6.40 3.68 0.96 FESTIVAL 2012 - 4 0.52 7.60 4.00 0.85 FL 09-127 2012 - 4 0.59 6.88 4.01 0.83
TREASURE 2012 - 4 0.46 7.68 4.03 0.84 WINTER DAWN 2012 - 4 0.47 7.53 3.86 0.99
PROPRIETARY 5 2012 - 5 0.46 6.53 3.91 0.82 ALBION 2012 - 5 0.43 7.25 4.04 0.98
FESTIVAL 2012 - 5 0.54 6.48 3.93 0.95 RUBYGEM 2012 - 5 0.66 6.58 4.12 0.64
CAMINO REAL 2012 - 6 0.45 7.28 3.89 0.92 DARSELECT 2012 - 6 0.33 9.78 4.11 0.96
FESTIVAL 2012 - 6 0.40 7.40 3.97 0.86 SWEET ANNE 2012 - 6 0.43 - - -
BENICIA 2012 - 7 0.55 6.03 3.77 0.86 FESTIVAL 2012 - 7 0.49 6.20 3.88 0.80 FL 06-38 2012 - 7 0.55 6.28 3.82 0.75
PORTOLA 2012 - 7 0.70 5.78 3.69 0.92 VENTANA 2012 - 7 0.60 6.40 3.95 0.90
PROPRIETARY 6 2012 - 9 0.32 6.50 3.45 0.74 EVIE 2 2012 - 9 0.39 6.38 3.43 0.83
FESTIVAL 2012 - 9 0.53 6.65 3.54 0.64 GALLETA 2012 - 9 0.49 7.08 3.35 1.05
SWEET ANNE 2012 - 9 0.49 6.10 3.35 0.85
55
Table 2-1. Continued.
HIGH 338.20 1080.33 7933.01 2481.98 2610.85 2840.18
LOW 78.02 440.98 2292.12 656.04 746.84 167.73
MEDIAN 220.27 744.26 4316.91 1541.08 1723.42 1020.84
FOLD DIFFERENCE
4 2 3 4 3 17
CULTIVAR HARVEST MALIC ACID
CITRIC ACID
TOTAL SUGAR
GLUCOSE FRUCTOSE SUCROSE
mg
1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
6915-15-7 77-92-9
50-99-7 57-48-7 57-50-1
PROPRIETARY 1 2011 - 2 104 766 5191 1879 1998 1314 CAMAROSA 2011 - 2 211 879 4306 1313 1456 1538 FESTIVAL 2011 - 2 338 639 5169 1903 2048 1218
MARA DES BOIS 2011 - 2 146 834 5515 1730 1967 1818 RADIANCE 2011 - 2 246 721 4137 656 747 2734
PROPRIETARY 2 2011 - 3 158 956 6167 1781 2041 2345 CAMAROSA 2011 - 3 271 833 5058 1345 1498 2216
SWEET CHARLIE 2011 - 3 190 713 6470 2352 2435 1683 TREASURE 2011 - 3 271 610 4377 1464 1520 1392
WINTER DAWN 2011 - 3 252 775 4731 1265 1479 1986 PROPRIETARY 3 2011 - 4 161 844 4269 1657 1821 791
CAMINO REAL 2011 - 4 187 525 2292 911 1068 314 FESTIVAL 2011 - 4 259 515 3316 1391 1538 387
WINTERSTAR 2011 - 5 264 557 4233 1374 1518 1342 FESTIVAL 2011 - 5 266 631 4327 1544 1705 1079 RADIANCE 2011 - 5 273 579 3436 1060 1224 1152
PROPRIETARY 4 2011 - 5 259 834 5363 1462 1615 2286 FL 05-85 2011 - 6 182 510 2945 1179 1324 442 ELYANA 2011 - 6 197 607 4496 1904 2169 424
FESTIVAL 2011 - 6 244 515 3615 1449 1647 519 RED MERLIN 2011 - 6 229 784 4079 1649 1880 549
SAN ANDREAS 2011 - 6 237 721 4275 1502 1719 1055 ALBION 2011 - 7 241 867 3440 1166 1343 931
CHARLOTTE 2011 - 7 143 520 4294 1896 2230 168 FESTIVAL 2011 - 7 255 441 2747 1127 1311 309
MARA DES BOIS 2011 - 7 78 795 3932 1539 1788 605 MONTERREY 2011 - 7 282 677 3320 1316 1500 504
ALBION 2012 - 1 219 1007 7933 2482 2611 2840 FESTIVAL 2012 - 1 281 680 6417 2187 2327 1902 MOJAVE 2012 - 1 156 862 5647 1978 2141 1528
PROPRIETARY 3 2012 - 1 144 1025 5828 1964 2150 1714 CHANDLER 2012 - 4 225 743 4018 1403 1512 1102 FESTIVAL 2012 - 4 215 561 4389 2013 2189 187 FL 09-127 2012 - 4 201 602 4970 2171 2313 486
TREASURE 2012 - 4 253 662 4771 1598 1728 1444 WINTER DAWN 2012 - 4 221 716 3736 1170 1407 1159
PROPRIETARY 5 2012 - 5 132 756 4537 1497 1642 1398 ALBION 2012 - 5 207 820 4900 1535 1676 1688
FESTIVAL 2012 - 5 261 721 4272 1560 1728 983 RUBYGEM 2012 - 5 130 743 4432 1804 1971 657
CAMINO REAL 2012 - 6 174 764 5361 2202 2319 840 DARSELECT 2012 - 6 179 964 6290 2405 2580 1306
FESTIVAL 2012 - 6 225 790 4229 1807 1973 450 SWEET ANNE 2012 - 6 252 1080 4184 1582 1767 834
BENICIA 2012 - 7 225 746 4037 1548 1711 778 FESTIVAL 2012 - 7 202 725 4488 1775 1969 744 FL 06-38 2012 - 7 229 708 4968 1859 2017 1091
PORTOLA 2012 - 7 186 866 3381 1265 1428 687 VENTANA 2012 - 7 241 811 3139 1198 1339 601
PROPRIETARY 6 2012 - 9 181 834 4766 1485 1701 1580 EVIE 2 2012 - 9 142 838 3603 1271 1472 859
FESTIVAL 2012 - 9 182 513 3680 1517 1740 424 GALLETA 2012 - 9 259 961 4658 1735 1937 987
SWEET ANNE 2012 - 9 201 870 3456 1282 1463 712
56
Table 2-1. Continued.
HIGH 27346.49 9.93 41.24 285.21 115.86 38.30
LOW 8450.24 0.00 0.00 16.80 17.43 0.00
MEDIAN 14572.86 3.20 15.34 98.36 46.99 5.68
FOLD DIFFERENCE
3 - - 17 7 -
CULTIVAR HARVEST TOTAL
VOLATILES 75-85-4 616-25-1 1629-58-9 96-22-0 110-62-3
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
alcohol alcohol ketone ketone aldehyde
PROPRIETARY 1 2011 - 2 21815.10 6.96 41.24 179.33 95.96 10.87 CAMAROSA 2011 - 2 27346.49 7.13 30.29 225.30 81.56 13.84 FESTIVAL 2011 - 2 19097.63 5.85 12.67 242.82 77.29 38.30
MARA DES BOIS 2011 - 2 17849.45 5.14 10.54 194.51 71.36 2.27 RADIANCE 2011 - 2 22308.92 8.05 13.94 202.66 73.78 11.81
PROPRIETARY 2 2011 - 3 24751.16 4.40 15.29 140.46 32.32 1.40 CAMAROSA 2011 - 3 24867.98 8.05 19.41 168.15 64.90 5.51
SWEET CHARLIE 2011 - 3 21335.50 5.32 19.04 229.19 55.66 1.10 TREASURE 2011 - 3 27216.45 9.93 17.29 266.09 83.88 1.31
WINTER DAWN 2011 - 3 22171.05 5.43 18.71 119.71 52.64 3.33 PROPRIETARY 3 2011 - 4 22791.16 8.71 22.22 150.99 115.86 8.56
CAMINO REAL 2011 - 4 16476.30 6.04 25.66 95.42 53.72 0.57 FESTIVAL 2011 - 4 27307.21 8.22 12.68 89.56 67.11 24.28
WINTERSTAR 2011 - 5 10049.72 3.32 9.68 48.13 30.02 3.95 FESTIVAL 2011 - 5 11866.30 2.13 15.59 59.40 42.88 13.92 RADIANCE 2011 - 5 11272.72 2.12 6.33 54.62 28.61 15.06
PROPRIETARY 4 2011 - 5 22279.55 0.48 22.43 249.57 67.72 1.33 FL 05-85 2011 - 6 11009.50 2.99 16.19 49.51 38.20 16.84 ELYANA 2011 - 6 11815.52 4.50 4.93 78.80 37.39 13.28
FESTIVAL 2011 - 6 14477.44 5.44 8.33 73.41 44.96 36.26 RED MERLIN 2011 - 6 13225.95 5.79 25.70 70.43 53.34 9.57
SAN ANDREAS 2011 - 6 12730.17 4.05 12.79 84.07 36.08 6.94 ALBION 2011 - 7 13917.02 3.68 17.27 56.84 60.08 0.94
CHARLOTTE 2011 - 7 15476.18 2.51 24.09 22.75 56.44 0.97 FESTIVAL 2011 - 7 11545.36 2.54 6.47 54.11 42.49 28.77
MARA DES BOIS 2011 - 7 12273.36 2.85 6.08 16.80 44.40 7.76 MONTERREY 2011 - 7 12809.80 4.31 10.29 31.57 33.43 0.97
ALBION 2012 - 1 22574.65 1.28 30.45 285.21 60.16 0.86 FESTIVAL 2012 - 1 16842.97 2.54 22.81 127.22 45.34 10.28 MOJAVE 2012 - 1 16822.84 1.54 24.83 178.58 47.28 6.21
PROPRIETARY 3 2012 - 1 14131.48 2.89 19.12 152.65 37.17 0.99 CHANDLER 2012 - 4 8893.20 0.00 0.00 72.32 55.09 0.00 FESTIVAL 2012 - 4 12239.27 6.76 8.94 169.03 49.64 17.63 FL 09-127 2012 - 4 11132.31 3.99 11.26 124.77 40.68 3.03
TREASURE 2012 - 4 17250.72 4.75 17.36 169.34 60.87 0.76 WINTER DAWN 2012 - 4 19884.41 4.88 13.48 123.57 35.94 7.94
PROPRIETARY 5 2012 - 5 9295.73 1.73 23.17 73.39 45.18 1.33 ALBION 2012 - 5 19223.80 2.42 17.20 165.96 56.03 1.09
FESTIVAL 2012 - 5 11526.96 2.38 12.33 92.75 45.20 13.01 RUBYGEM 2012 - 5 11491.14 2.18 9.69 88.93 32.68 6.87
CAMINO REAL 2012 - 6 16381.25 4.37 21.96 124.47 74.08 1.28 DARSELECT 2012 - 6 12942.55 3.52 13.89 95.15 61.92 10.81
FESTIVAL 2012 - 6 15924.67 3.03 13.51 123.50 58.09 19.21 SWEET ANNE 2012 - 6 11265.22 3.09 18.63 97.14 57.22 0.94
BENICIA 2012 - 7 12018.85 4.92 18.17 126.58 48.57 2.43 FESTIVAL 2012 - 7 17138.67 1.65 16.80 137.48 45.84 15.87 FL 06-38 2012 - 7 16576.73 2.34 8.49 99.57 41.34 5.86
PORTOLA 2012 - 7 9347.88 2.97 12.93 84.00 46.70 0.92 VENTANA 2012 - 7 12049.29 2.34 14.90 86.79 42.35 6.89
PROPRIETARY 6 2012 - 9 16025.99 2.43 18.24 107.74 36.96 0.73 EVIE 2 2012 - 9 10796.23 2.86 13.59 32.40 26.15 2.97
FESTIVAL 2012 - 9 8976.61 2.22 8.39 40.63 22.96 9.45 GALLETA 2012 - 9 14668.29 2.27 15.38 96.12 32.99 0.79
SWEET ANNE 2012 - 9 8450.24 1.18 7.39 35.24 17.43 0.42
57
Table 2-1. Continued.
HIGH 0.93 85.37 12.25 7359.57 81.41 8.69
LOW 0.00 0.09 0.46 846.65 0.09 0.00
MEDIAN 0.37 6.26 3.06 2430.27 5.22 0.00
FOLD DIFFERENCE
- 972 27 9 901 -
CULTIVAR HARVEST 1534-08-3 105-37-3 109-60-4 623-42-7 591-78-6 108-10-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ketone ester ester ester ketone ketone
PROPRIETARY 1 2011 - 2 0.53 1.81 1.83 3437.73 5.08 0.00 CAMAROSA 2011 - 2 0.61 4.55 5.39 3938.54 3.75 0.00 FESTIVAL 2011 - 2 0.61 26.83 1.63 2946.22 6.74 0.00
MARA DES BOIS 2011 - 2 0.44 7.17 3.84 1829.32 6.24 0.00 RADIANCE 2011 - 2 0.32 0.99 2.62 2093.93 4.44 0.00
PROPRIETARY 2 2011 - 3 0.42 3.25 1.14 7359.57 81.41 0.00 CAMAROSA 2011 - 3 0.84 6.24 4.08 3092.47 6.75 0.00
SWEET CHARLIE 2011 - 3 0.36 1.59 0.99 2821.39 19.94 0.00 TREASURE 2011 - 3 0.93 0.09 0.73 1569.55 20.85 0.00
WINTER DAWN 2011 - 3 0.44 0.83 1.24 2390.40 4.32 0.00 PROPRIETARY 3 2011 - 4 0.55 15.53 10.02 3205.64 12.35 0.00
CAMINO REAL 2011 - 4 0.66 3.43 1.91 2360.98 3.78 0.00 FESTIVAL 2011 - 4 0.32 51.55 3.51 4615.03 4.70 0.00
WINTERSTAR 2011 - 5 0.00 9.23 4.45 1530.58 6.86 0.00 FESTIVAL 2011 - 5 0.00 4.15 2.08 2272.42 6.17 0.00 RADIANCE 2011 - 5 0.00 6.76 5.50 1341.81 4.94 0.00
PROPRIETARY 4 2011 - 5 0.27 7.22 2.15 6785.81 57.94 0.00 FL 05-85 2011 - 6 0.29 0.92 1.35 2200.23 0.77 0.00 ELYANA 2011 - 6 0.45 1.30 0.51 1421.77 9.32 0.00
FESTIVAL 2011 - 6 0.31 12.14 1.54 3299.73 1.34 0.00 RED MERLIN 2011 - 6 0.49 0.73 1.01 1458.22 0.09 0.00
SAN ANDREAS 2011 - 6 0.33 1.85 1.57 2394.10 0.73 0.00 ALBION 2011 - 7 0.51 3.96 5.49 3152.61 2.44 0.00
CHARLOTTE 2011 - 7 0.68 3.16 5.37 2692.37 0.69 0.00 FESTIVAL 2011 - 7 0.30 17.27 2.21 2086.02 0.72 0.00
MARA DES BOIS 2011 - 7 0.36 30.38 6.69 2145.67 0.16 0.00 MONTERREY 2011 - 7 0.40 9.68 8.76 2820.74 1.11 0.00
ALBION 2012 - 1 0.43 1.37 0.46 5282.14 17.61 0.00 FESTIVAL 2012 - 1 0.33 10.39 2.26 3598.18 3.83 0.00 MOJAVE 2012 - 1 0.34 5.51 3.11 2466.44 9.28 3.01
PROPRIETARY 3 2012 - 1 0.47 3.73 1.66 1867.96 19.82 0.00 CHANDLER 2012 - 4 0.00 13.19 2.45 1632.05 25.54 0.00 FESTIVAL 2012 - 4 0.52 85.37 4.05 2345.75 4.16 8.28 FL 09-127 2012 - 4 0.56 7.01 3.68 2258.78 11.27 8.69
TREASURE 2012 - 4 0.46 6.29 7.97 2835.56 27.56 4.59 WINTER DAWN 2012 - 4 0.30 9.99 5.08 3286.53 3.75 7.24
PROPRIETARY 5 2012 - 5 0.63 8.31 5.44 1015.51 4.39 0.00 ALBION 2012 - 5 0.39 12.04 12.25 4113.08 22.53 3.00
FESTIVAL 2012 - 5 0.38 13.57 4.07 2934.78 3.68 2.31 RUBYGEM 2012 - 5 0.36 5.00 9.65 1490.23 4.94 7.61
CAMINO REAL 2012 - 6 0.33 6.12 3.84 3523.27 8.22 4.74 DARSELECT 2012 - 6 0.35 15.98 7.32 2364.50 4.40 3.79
FESTIVAL 2012 - 6 0.37 4.04 2.94 4106.50 5.37 3.28 SWEET ANNE 2012 - 6 0.35 2.00 3.01 1057.63 17.98 0.00
BENICIA 2012 - 7 0.49 7.05 7.95 846.65 27.36 0.00 FESTIVAL 2012 - 7 0.45 14.91 1.97 5497.45 4.31 6.00 FL 06-38 2012 - 7 0.50 36.13 4.49 3388.37 8.82 5.46
PORTOLA 2012 - 7 0.39 2.45 2.09 906.65 4.63 0.00 VENTANA 2012 - 7 0.30 3.16 3.25 1621.23 10.34 0.00
PROPRIETARY 6 2012 - 9 0.34 16.80 6.10 4699.23 9.97 4.16 EVIE 2 2012 - 9 0.30 6.92 8.10 1637.05 3.07 0.00
FESTIVAL 2012 - 9 0.20 11.82 2.17 3000.85 2.87 4.13 GALLETA 2012 - 9 0.35 1.96 2.25 3583.31 8.68 6.12
SWEET ANNE 2012 - 9 0.00 0.35 1.15 1509.83 7.67 0.00
58
Table 2-1. Continued.
HIGH 84.64 92.80 20.17 6.10 8.54 278.06
LOW 8.74 9.58 0.51 0.00 0.00 5.81
MEDIAN 31.50 33.06 2.33 0.29 1.71 30.42
FOLD DIFFERENCE
10 10 39 - - 48
CULTIVAR HARVEST 1576-87-0 1576-86-9 623-43-8 71-41-0 1576-95-0 556-24-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
aldehyde ketone ester alcohol alcohol ester
PROPRIETARY 1 2011 - 2 64.62 78.26 2.29 0.00 1.39 67.02 CAMAROSA 2011 - 2 73.97 79.63 7.74 0.00 3.00 60.52 FESTIVAL 2011 - 2 70.39 68.79 0.51 2.53 2.08 37.85
MARA DES BOIS 2011 - 2 38.78 54.19 3.05 0.05 1.92 5.92 RADIANCE 2011 - 2 69.95 70.06 8.11 0.00 3.18 14.88
PROPRIETARY 2 2011 - 3 78.60 65.21 5.96 0.00 1.84 278.06 CAMAROSA 2011 - 3 84.45 83.49 4.52 0.08 3.82 40.17
SWEET CHARLIE 2011 - 3 83.44 76.64 3.55 0.00 0.00 38.92 TREASURE 2011 - 3 84.64 92.80 1.88 0.00 1.15 52.65
WINTER DAWN 2011 - 3 61.61 58.78 3.68 0.28 4.39 13.53 PROPRIETARY 3 2011 - 4 52.73 78.50 3.75 1.96 1.05 227.94
CAMINO REAL 2011 - 4 36.84 34.19 5.73 0.48 0.98 13.51 FESTIVAL 2011 - 4 50.18 28.94 1.24 0.53 2.60 36.82
WINTERSTAR 2011 - 5 23.16 12.17 1.27 0.00 0.60 37.20 FESTIVAL 2011 - 5 24.28 18.28 1.01 0.00 1.55 9.70 RADIANCE 2011 - 5 31.53 14.50 7.43 0.10 0.69 10.57
PROPRIETARY 4 2011 - 5 53.67 67.09 5.23 0.55 0.78 93.07 FL 05-85 2011 - 6 18.63 19.59 0.80 0.00 0.00 7.83 ELYANA 2011 - 6 28.59 22.24 0.81 0.00 0.58 28.04
FESTIVAL 2011 - 6 26.05 22.17 0.82 0.00 0.62 16.59 RED MERLIN 2011 - 6 27.83 30.33 1.37 0.00 0.83 5.81
SAN ANDREAS 2011 - 6 27.68 26.12 0.89 0.00 0.14 9.56 ALBION 2011 - 7 23.52 26.38 7.71 0.39 0.00 37.70
CHARLOTTE 2011 - 7 12.17 15.75 20.17 2.30 0.00 249.23 FESTIVAL 2011 - 7 21.77 19.00 0.91 0.00 0.00 15.11
MARA DES BOIS 2011 - 7 8.74 9.58 7.44 0.00 0.00 11.96 MONTERREY 2011 - 7 18.24 13.37 4.28 0.15 0.00 46.02
ALBION 2012 - 1 42.60 39.14 2.63 2.42 0.00 52.19 FESTIVAL 2012 - 1 45.86 38.23 2.07 2.08 1.88 5.82 MOJAVE 2012 - 1 46.72 38.37 0.75 2.49 4.11 24.61
PROPRIETARY 3 2012 - 1 48.04 56.50 2.28 3.49 6.08 118.31 CHANDLER 2012 - 4 14.25 14.46 1.48 1.81 0.00 31.30 FESTIVAL 2012 - 4 34.40 38.15 0.78 0.24 3.81 6.84 FL 09-127 2012 - 4 22.75 24.14 2.37 0.00 5.34 23.09
TREASURE 2012 - 4 38.09 45.42 2.51 0.00 1.71 41.09 WINTER DAWN 2012 - 4 35.87 32.17 4.82 0.00 3.63 26.29
PROPRIETARY 5 2012 - 5 20.95 23.26 6.98 6.10 4.85 68.34 ALBION 2012 - 5 38.89 41.84 5.46 0.69 0.00 31.52
FESTIVAL 2012 - 5 33.58 32.70 1.33 0.31 7.32 8.55 RUBYGEM 2012 - 5 31.02 24.67 2.72 0.61 1.60 10.32
CAMINO REAL 2012 - 6 38.54 33.73 2.13 2.19 4.37 12.57 DARSELECT 2012 - 6 31.10 34.71 2.25 2.73 0.00 106.70
FESTIVAL 2012 - 6 41.77 40.98 0.97 2.40 1.71 15.45 SWEET ANNE 2012 - 6 26.02 34.44 0.65 2.90 1.49 20.57
BENICIA 2012 - 7 31.46 38.14 1.16 3.66 3.53 37.61 FESTIVAL 2012 - 7 40.58 40.70 1.15 2.14 4.04 16.74 FL 06-38 2012 - 7 28.41 30.56 2.98 2.76 1.72 46.76
PORTOLA 2012 - 7 24.38 27.04 3.48 2.96 2.21 26.48 VENTANA 2012 - 7 22.81 27.23 2.77 1.90 2.69 82.27
PROPRIETARY 6 2012 - 9 29.63 33.41 12.01 0.80 1.97 55.48 EVIE 2 2012 - 9 12.07 12.40 3.55 0.88 2.71 91.64
FESTIVAL 2012 - 9 15.38 14.13 1.21 0.21 2.96 21.41 GALLETA 2012 - 9 24.28 27.34 1.66 0.09 8.54 40.76
SWEET ANNE 2012 - 9 10.30 12.47 1.42 0.16 1.20 29.53
59
Table 2-1. Continued.
HIGH 5.59 110.34 11063.45 409.81 19.44 23.52
LOW 0.00 15.83 1072.17 5.76 1.24 0.40
MEDIAN 1.67 37.72 2025.28 41.46 4.18 3.05
FOLD DIFFERENCE
- 7 10 71 16 58
CULTIVAR HARVEST 589-38-8 105-54-4 66-25-1 123-86-4 624-24-8 29674-47-3
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ketone ester aldehyde ester ester ester/alcohol
PROPRIETARY 1 2011 - 2 1.83 110.34 1968.29 21.02 7.10 3.32 CAMAROSA 2011 - 2 0.76 81.38 6487.68 117.21 3.47 2.22 FESTIVAL 2011 - 2 2.65 50.73 3557.99 61.96 8.25 2.90
MARA DES BOIS 2011 - 2 0.57 54.34 2189.85 88.98 2.78 0.40 RADIANCE 2011 - 2 0.49 55.42 2830.28 38.56 6.00 1.38
PROPRIETARY 2 2011 - 3 2.08 72.34 2235.46 223.79 8.81 19.83 CAMAROSA 2011 - 3 1.36 74.73 3096.11 151.16 3.50 2.79
SWEET CHARLIE 2011 - 3 1.69 65.95 3242.15 41.22 8.66 2.03 TREASURE 2011 - 3 1.65 41.17 5076.19 148.51 1.35 4.99
WINTER DAWN 2011 - 3 1.54 58.02 2783.71 41.49 7.19 3.41 PROPRIETARY 3 2011 - 4 1.64 58.66 3252.41 45.78 4.12 4.17
CAMINO REAL 2011 - 4 2.98 67.98 1990.17 62.46 1.83 3.05 FESTIVAL 2011 - 4 3.50 58.22 11063.45 48.47 15.63 3.18
WINTERSTAR 2011 - 5 1.93 36.76 1357.23 32.35 4.93 1.84 FESTIVAL 2011 - 5 2.03 52.35 1177.82 12.03 5.84 4.84 RADIANCE 2011 - 5 1.65 36.20 1355.03 11.65 5.14 1.64
PROPRIETARY 4 2011 - 5 3.78 51.65 2460.07 100.84 7.78 23.52 FL 05-85 2011 - 6 0.77 38.42 1335.24 16.88 3.60 1.89 ELYANA 2011 - 6 0.71 27.79 1697.01 125.28 8.61 0.46
FESTIVAL 2011 - 6 0.77 27.39 2417.33 15.42 10.18 2.67 RED MERLIN 2011 - 6 3.01 44.16 1428.52 5.76 2.78 1.28
SAN ANDREAS 2011 - 6 0.91 30.97 2132.07 56.15 2.93 2.75 ALBION 2011 - 7 0.22 37.58 1821.58 41.43 1.71 5.54
CHARLOTTE 2011 - 7 0.21 42.06 2065.13 25.67 1.24 2.45 FESTIVAL 2011 - 7 0.42 38.02 1860.14 8.18 10.28 3.05
MARA DES BOIS 2011 - 7 0.44 20.80 2687.64 52.54 3.18 0.79 MONTERREY 2011 - 7 0.57 31.73 1814.15 220.76 2.07 4.01
ALBION 2012 - 1 2.12 37.27 3184.80 409.81 3.65 7.20 FESTIVAL 2012 - 1 1.40 40.51 2808.47 37.47 7.29 10.51 MOJAVE 2012 - 1 3.88 41.01 2629.55 187.78 6.08 5.64
PROPRIETARY 3 2012 - 1 1.98 52.62 1535.05 14.32 4.49 3.28 CHANDLER 2012 - 4 0.00 15.83 1147.02 86.61 3.85 4.31 FESTIVAL 2012 - 4 1.11 30.83 2550.02 30.00 7.41 7.24 FL 09-127 2012 - 4 0.92 25.16 1783.23 81.55 3.58 1.70
TREASURE 2012 - 4 1.85 31.76 3463.96 99.09 2.18 4.99 WINTER DAWN 2012 - 4 1.60 33.38 7116.18 29.42 9.09 10.55
PROPRIETARY 5 2012 - 5 1.04 34.88 1072.17 6.53 2.05 2.45 ALBION 2012 - 5 3.34 25.09 4951.49 363.88 3.62 12.46
FESTIVAL 2012 - 5 2.52 36.49 1813.61 41.12 6.99 8.83 RUBYGEM 2012 - 5 2.25 37.88 1787.67 51.62 4.24 1.26
CAMINO REAL 2012 - 6 5.59 42.43 1745.53 249.11 4.03 9.53 DARSELECT 2012 - 6 3.44 29.37 1709.95 94.53 7.74 2.20
FESTIVAL 2012 - 6 2.68 38.93 2200.20 34.84 9.19 9.93 SWEET ANNE 2012 - 6 3.31 35.49 1414.31 14.63 1.59 1.91
BENICIA 2012 - 7 2.67 33.13 2034.26 30.35 2.17 0.93 FESTIVAL 2012 - 7 1.44 31.66 2488.31 28.35 19.44 16.18 FL 06-38 2012 - 7 0.80 23.04 4253.17 74.97 8.20 3.98
PORTOLA 2012 - 7 2.25 37.86 1136.90 13.07 2.96 2.42 VENTANA 2012 - 7 2.10 36.30 1465.00 8.78 2.84 2.52
PROPRIETARY 6 2012 - 9 1.56 39.94 2016.30 22.01 7.95 17.24 EVIE 2 2012 - 9 3.00 35.18 1542.68 62.24 2.92 1.83
FESTIVAL 2012 - 9 1.64 21.54 1323.32 11.83 12.99 5.91 GALLETA 2012 - 9 3.89 29.33 1767.37 59.57 2.80 2.80
SWEET ANNE 2012 - 9 1.94 25.54 1153.26 12.57 1.75 0.94
60
Table 2-1. Continued.
HIGH 57.10 378.13 53.35 196.93 18382.28 343.94
LOW 0.00 1.59 0.00 17.27 3794.92 0.00
MEDIAN 1.44 57.32 17.77 40.80 7674.66 52.96
FOLD DIFFERENCE
- 237 - 11 5 -
CULTIVAR HARVEST 96-04-8 638-11-9 116-53-0 7452-79-1 6728-26-3 928-95-0
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ketone ester ester ester aldehyde alcohol
PROPRIETARY 1 2011 - 2 3.53 41.97 45.90 77.04 14335.48 92.25 CAMAROSA 2011 - 2 1.68 30.25 30.03 47.41 15185.47 78.48 FESTIVAL 2011 - 2 2.20 118.88 37.91 52.20 10600.45 9.02
MARA DES BOIS 2011 - 2 0.56 11.69 24.73 57.68 12230.43 126.08 RADIANCE 2011 - 2 1.51 75.65 39.49 87.29 15085.78 61.45
PROPRIETARY 2 2011 - 3 16.03 206.43 48.14 86.63 12931.96 2.18 CAMAROSA 2011 - 3 2.29 39.34 42.56 86.60 16752.16 49.50
SWEET CHARLIE 2011 - 3 10.51 35.48 37.92 101.23 11893.28 0.93 TREASURE 2011 - 3 6.89 281.63 44.88 107.55 18382.28 29.13
WINTER DAWN 2011 - 3 0.00 68.75 37.09 83.33 15661.83 71.96 PROPRIETARY 3 2011 - 4 3.95 42.51 53.35 88.85 13505.17 120.68
CAMINO REAL 2011 - 4 0.72 24.16 16.39 32.07 10723.21 81.37 FESTIVAL 2011 - 4 1.44 68.20 18.34 101.79 9615.52 7.37
WINTERSTAR 2011 - 5 2.63 41.69 21.80 46.72 5950.65 38.79 FESTIVAL 2011 - 5 1.03 24.69 15.50 31.94 7458.72 62.14 RADIANCE 2011 - 5 0.45 32.38 25.94 196.93 7258.31 29.59
PROPRIETARY 4 2011 - 5 3.69 122.82 34.18 70.83 10623.73 62.34 FL 05-85 2011 - 6 1.55 44.35 29.89 48.80 6670.12 62.99 ELYANA 2011 - 6 1.23 67.71 16.46 61.71 6379.28 0.00
FESTIVAL 2011 - 6 0.79 78.32 17.34 39.96 7562.82 9.99 RED MERLIN 2011 - 6 0.50 18.79 20.54 37.44 9479.61 124.13
SAN ANDREAS 2011 - 6 0.58 145.41 13.53 32.41 6926.46 30.73 ALBION 2011 - 7 0.00 77.97 1.73 57.55 7974.22 29.04
CHARLOTTE 2011 - 7 0.00 25.47 0.90 73.71 9785.12 45.12 FESTIVAL 2011 - 7 0.00 47.69 40.71 29.66 6793.29 7.10
MARA DES BOIS 2011 - 7 0.00 18.25 17.06 47.31 6226.18 21.80 MONTERREY 2011 - 7 1.44 151.12 26.91 41.23 6568.59 10.41
ALBION 2012 - 1 0.00 378.13 0.00 49.12 9284.85 51.62 FESTIVAL 2012 - 1 0.00 72.25 31.48 30.28 8842.99 41.84 MOJAVE 2012 - 1 2.39 116.93 0.00 44.42 9099.23 22.29
PROPRIETARY 3 2012 - 1 1.45 25.61 0.00 43.21 9279.66 21.62 CHANDLER 2012 - 4 57.10 16.80 0.00 18.62 3794.92 192.46 FESTIVAL 2012 - 4 1.15 83.83 26.84 29.68 5682.02 68.17 FL 09-127 2012 - 4 1.32 76.41 10.43 24.94 4505.45 141.04
TREASURE 2012 - 4 5.05 148.23 27.36 42.91 8905.78 65.42 WINTER DAWN 2012 - 4 0.60 82.02 51.73 29.56 7942.89 40.06
PROPRIETARY 5 2012 - 5 0.58 1.59 2.51 30.68 6107.65 125.08 ALBION 2012 - 5 1.30 131.19 9.34 32.39 7047.18 39.00
FESTIVAL 2012 - 5 0.69 35.09 0.00 21.13 5568.16 54.29 RUBYGEM 2012 - 5 1.01 28.61 15.82 34.85 6866.30 88.57
CAMINO REAL 2012 - 6 2.27 90.14 5.21 29.27 8227.17 343.94 DARSELECT 2012 - 6 3.33 53.48 2.40 21.39 5078.91 199.40
FESTIVAL 2012 - 6 1.42 95.80 18.20 29.11 7786.50 80.28 SWEET ANNE 2012 - 6 2.73 31.91 0.00 34.24 6743.07 202.27
BENICIA 2012 - 7 4.47 28.82 0.00 41.19 7511.25 90.63 FESTIVAL 2012 - 7 1.53 110.91 34.49 28.58 7174.23 46.44 FL 06-38 2012 - 7 1.49 95.51 19.15 32.62 5635.20 29.72
PORTOLA 2012 - 7 2.74 22.42 2.54 32.99 6446.74 70.78 VENTANA 2012 - 7 4.00 20.85 7.94 43.56 7835.52 95.77
PROPRIETARY 6 2012 - 9 1.47 61.53 5.60 38.31 7167.81 41.61 EVIE 2 2012 - 9 0.60 13.66 0.55 29.31 6490.12 58.24
FESTIVAL 2012 - 9 0.42 61.16 13.69 17.27 3810.95 24.98 GALLETA 2012 - 9 0.93 61.72 18.29 40.42 7798.82 79.02
SWEET ANNE 2012 - 9 1.74 40.88 0.00 22.51 4795.75 30.21
61
Table 2-1. Continued.
HIGH 640.91 119.22 106.05 130.12 24.21 18.47
LOW 0.87 1.51 0.00 0.00 0.00 0.00
MEDIAN 25.49 17.37 14.72 8.47 2.32 4.06
FOLD DIFFERENCE
734 79 - - - -
CULTIVAR HARVEST 111-27-3 123-92-2 624-41-9 110-43-0 2432-51-1 105-66-8
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
alcohol ester ester ketone ketone ester
PROPRIETARY 1 2011 - 2 9.11 9.75 37.36 9.54 3.18 1.06 CAMAROSA 2011 - 2 9.09 13.09 44.21 6.52 5.51 2.81 FESTIVAL 2011 - 2 2.26 2.62 5.74 14.89 18.72 10.74
MARA DES BOIS 2011 - 2 14.36 2.70 5.14 7.73 1.17 6.39 RADIANCE 2011 - 2 10.71 24.34 44.81 18.59 2.35 2.46
PROPRIETARY 2 2011 - 3 1.44 43.48 5.96 19.82 3.28 2.07 CAMAROSA 2011 - 3 7.84 9.45 28.73 12.78 8.03 5.22
SWEET CHARLIE 2011 - 3 9.64 6.98 4.40 130.12 0.00 3.45 TREASURE 2011 - 3 6.43 12.30 14.65 43.93 0.00 4.06
WINTER DAWN 2011 - 3 9.30 4.33 8.79 3.99 0.79 2.31 PROPRIETARY 3 2011 - 4 34.87 119.22 81.96 7.59 4.26 2.63
CAMINO REAL 2011 - 4 30.08 6.75 9.21 1.98 0.00 0.53 FESTIVAL 2011 - 4 7.79 2.77 8.83 6.26 12.01 7.61
WINTERSTAR 2011 - 5 23.12 10.35 18.40 4.04 0.00 7.34 FESTIVAL 2011 - 5 20.92 4.61 10.92 3.92 2.10 3.28 RADIANCE 2011 - 5 26.48 7.32 13.58 5.60 1.68 4.48
PROPRIETARY 4 2011 - 5 37.24 18.30 11.52 6.00 0.00 2.12 FL 05-85 2011 - 6 16.56 5.82 0.00 3.66 1.92 1.18 ELYANA 2011 - 6 5.18 19.43 5.21 19.90 2.68 2.40
FESTIVAL 2011 - 6 3.15 6.91 0.00 19.22 0.00 4.07 RED MERLIN 2011 - 6 51.99 1.51 17.53 1.42 0.00 0.00
SAN ANDREAS 2011 - 6 0.87 14.24 25.41 4.41 0.91 4.42 ALBION 2011 - 7 39.47 21.04 22.86 1.54 0.56 1.61
CHARLOTTE 2011 - 7 52.15 55.52 10.44 0.00 3.15 0.00 FESTIVAL 2011 - 7 7.25 4.86 9.07 0.38 5.51 2.02
MARA DES BOIS 2011 - 7 29.18 8.81 7.36 0.51 2.94 6.53 MONTERREY 2011 - 7 20.52 25.30 106.05 1.90 0.53 3.90
ALBION 2012 - 1 45.45 12.53 3.34 21.56 0.44 4.57 FESTIVAL 2012 - 1 28.56 6.77 7.29 6.08 7.63 11.41 MOJAVE 2012 - 1 31.51 17.83 9.45 25.96 0.07 5.99
PROPRIETARY 3 2012 - 1 27.14 29.70 15.82 3.90 2.12 0.00 CHANDLER 2012 - 4 640.91 70.63 37.55 8.35 0.00 5.75 FESTIVAL 2012 - 4 31.73 18.12 13.62 15.73 20.02 8.67 FL 09-127 2012 - 4 94.68 28.80 19.00 40.87 1.18 9.99
TREASURE 2012 - 4 45.06 42.31 30.94 49.17 4.63 11.36 WINTER DAWN 2012 - 4 16.40 22.80 21.51 23.76 0.33 5.67
PROPRIETARY 5 2012 - 5 62.48 32.81 7.45 6.71 2.55 1.07 ALBION 2012 - 5 19.46 39.82 16.87 21.29 1.83 18.47
FESTIVAL 2012 - 5 44.71 14.72 12.89 7.41 7.73 8.18 RUBYGEM 2012 - 5 30.28 20.33 18.43 26.20 2.28 8.87
CAMINO REAL 2012 - 6 305.02 43.57 26.48 36.58 10.02 7.75 DARSELECT 2012 - 6 156.00 65.91 25.44 31.19 9.20 9.79
FESTIVAL 2012 - 6 24.65 10.18 20.16 13.58 24.21 7.96 SWEET ANNE 2012 - 6 103.18 31.91 21.50 12.75 3.51 2.77
BENICIA 2012 - 7 49.89 50.04 17.87 8.60 1.77 4.03 FESTIVAL 2012 - 7 18.20 10.35 14.22 9.75 24.04 7.39 FL 06-38 2012 - 7 18.85 28.26 15.98 15.06 8.08 10.63
PORTOLA 2012 - 7 33.47 16.91 16.44 6.16 2.07 1.49 VENTANA 2012 - 7 42.06 36.12 26.96 12.71 2.79 1.98
PROPRIETARY 6 2012 - 9 16.78 22.10 10.68 12.49 1.76 3.46 EVIE 2 2012 - 9 30.52 58.37 14.78 6.49 2.95 3.68
FESTIVAL 2012 - 9 9.77 8.38 9.84 2.06 9.80 5.19 GALLETA 2012 - 9 26.33 16.01 10.89 12.47 3.45 7.97
SWEET ANNE 2012 - 9 15.95 23.61 15.38 4.26 1.63 1.35
62
Table 2-1. Continued.
HIGH 20.14 8.63 9.74 34.43 749.40 2.71
LOW 0.00 0.00 1.47 0.00 18.26 0.00
MEDIAN 2.54 3.16 4.38 2.79 190.28 0.40
FOLD DIFFERENCE
- - 7 - 41 -
CULTIVAR HARVEST 539-82-2 111-71-7 628-63-7 1191-16-8 106-70-7 55514-48-2
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ester aldehyde ester ester ester ester
PROPRIETARY 1 2011 - 2 0.00 4.23 3.94 2.54 517.87 0.00 CAMAROSA 2011 - 2 2.57 6.47 5.22 12.84 168.57 0.00 FESTIVAL 2011 - 2 6.12 4.32 4.14 0.60 191.30 0.00
MARA DES BOIS 2011 - 2 2.12 3.18 4.73 1.08 211.46 0.00 RADIANCE 2011 - 2 3.21 5.15 4.36 21.68 230.46 0.00
PROPRIETARY 2 2011 - 3 0.00 4.33 4.10 0.00 182.53 0.64 CAMAROSA 2011 - 3 2.59 6.70 8.16 7.85 177.26 1.17
SWEET CHARLIE 2011 - 3 1.76 4.95 4.92 0.00 579.41 0.28 TREASURE 2011 - 3 2.59 8.63 4.57 1.81 39.38 0.66
WINTER DAWN 2011 - 3 1.11 4.85 4.21 0.00 181.28 0.32 PROPRIETARY 3 2011 - 4 9.21 2.97 9.74 29.55 506.71 0.64
CAMINO REAL 2011 - 4 0.00 0.77 4.23 3.50 150.10 0.49 FESTIVAL 2011 - 4 2.71 1.20 6.64 0.94 601.98 0.16
WINTERSTAR 2011 - 5 0.36 0.00 4.07 11.72 319.32 0.38 FESTIVAL 2011 - 5 0.14 0.63 3.43 1.48 247.67 0.19 RADIANCE 2011 - 5 0.00 0.33 4.42 11.16 184.38 0.27
PROPRIETARY 4 2011 - 5 0.69 2.88 5.72 3.34 378.92 0.27 FL 05-85 2011 - 6 0.00 0.00 2.22 1.24 177.86 0.04 ELYANA 2011 - 6 0.89 0.95 6.03 2.47 352.17 0.22
FESTIVAL 2011 - 6 1.85 0.15 3.86 0.00 287.17 0.11 RED MERLIN 2011 - 6 0.00 0.81 3.18 6.79 141.67 0.28
SAN ANDREAS 2011 - 6 0.39 0.44 3.12 17.54 167.24 0.11 ALBION 2011 - 7 2.66 1.10 2.73 8.36 56.88 0.71
CHARLOTTE 2011 - 7 0.00 1.43 3.02 7.78 18.26 0.60 FESTIVAL 2011 - 7 2.04 1.21 3.71 1.56 170.82 0.93
MARA DES BOIS 2011 - 7 1.41 1.05 4.22 4.08 240.92 1.15 MONTERREY 2011 - 7 0.23 0.59 3.83 34.43 55.08 2.44
ALBION 2012 - 1 6.79 7.65 5.60 1.04 189.25 0.42 FESTIVAL 2012 - 1 3.83 2.87 2.60 1.76 232.02 0.42 MOJAVE 2012 - 1 4.63 4.20 6.57 2.23 238.63 0.46
PROPRIETARY 3 2012 - 1 0.00 1.70 3.25 2.87 314.38 0.00 CHANDLER 2012 - 4 6.36 0.00 5.35 11.86 292.32 2.71 FESTIVAL 2012 - 4 20.14 4.82 4.61 1.78 180.57 0.60 FL 09-127 2012 - 4 15.20 3.48 4.31 6.10 374.19 0.58
TREASURE 2012 - 4 5.65 7.85 5.04 6.91 99.88 0.97 WINTER DAWN 2012 - 4 3.31 4.49 6.54 4.52 188.53 0.74
PROPRIETARY 5 2012 - 5 1.70 2.07 4.40 0.65 128.06 1.07 ALBION 2012 - 5 5.24 5.89 8.66 4.74 228.08 1.34
FESTIVAL 2012 - 5 3.35 3.17 4.87 1.42 230.09 0.50 RUBYGEM 2012 - 5 2.52 4.80 4.56 6.54 229.35 0.68
CAMINO REAL 2012 - 6 6.03 7.48 6.92 1.71 175.99 0.67 DARSELECT 2012 - 6 5.47 5.80 6.21 4.45 636.03 0.55
FESTIVAL 2012 - 6 5.89 5.28 5.45 3.02 348.91 0.44 SWEET ANNE 2012 - 6 2.91 4.03 3.15 1.53 174.94 0.46
BENICIA 2012 - 7 3.16 2.06 1.80 4.66 67.54 0.29 FESTIVAL 2012 - 7 7.76 3.46 5.75 2.42 485.44 0.25 FL 06-38 2012 - 7 11.27 4.85 5.47 2.71 614.15 0.38
PORTOLA 2012 - 7 1.10 2.92 1.99 8.54 117.55 0.33 VENTANA 2012 - 7 1.48 3.15 2.97 13.61 164.55 0.18
PROPRIETARY 6 2012 - 9 5.21 3.56 5.66 3.48 749.40 0.98 EVIE 2 2012 - 9 1.62 2.64 3.40 2.46 167.41 0.36
FESTIVAL 2012 - 9 2.93 1.05 4.97 1.18 235.34 0.00 GALLETA 2012 - 9 1.27 4.01 3.07 0.82 144.95 0.39
SWEET ANNE 2012 - 9 0.31 1.96 1.47 2.32 101.93 0.00
63
Table 2-1. Continued.
HIGH 6.87 1123.40 726.88 15.43 257.91 108.16
LOW 0.28 0.00 3.59 0.83 5.68 3.22
MEDIAN 2.65 24.74 70.87 5.08 35.84 18.64
FOLD DIFFERENCE
25 - 202 19 45 34
CULTIVAR HARVEST 110-93-0 109-21-7 123-66-0 124-13-0 142-92-7 2497-18-9
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ketone ester ester aldehyde ester ester
PROPRIETARY 1 2011 - 2 4.09 6.22 7.97 9.90 45.64 29.13 CAMAROSA 2011 - 2 3.10 29.58 9.92 9.99 69.96 79.21 FESTIVAL 2011 - 2 5.35 132.50 125.58 4.92 52.94 16.30
MARA DES BOIS 2011 - 2 4.01 72.56 103.95 9.56 67.35 54.68 RADIANCE 2011 - 2 4.66 13.61 5.73 6.45 46.21 17.64
PROPRIETARY 2 2011 - 3 2.16 184.68 21.92 4.26 57.68 5.26 CAMAROSA 2011 - 3 4.82 82.90 34.95 11.54 76.65 17.42
SWEET CHARLIE 2011 - 3 6.87 46.30 80.13 9.32 72.09 5.60 TREASURE 2011 - 3 5.16 211.28 16.96 8.05 59.48 6.67
WINTER DAWN 2011 - 3 3.41 7.54 22.10 3.95 30.73 13.87 PROPRIETARY 3 2011 - 4 6.06 3.57 148.57 5.69 39.10 24.51
CAMINO REAL 2011 - 4 0.86 23.70 48.17 4.60 32.03 9.52 FESTIVAL 2011 - 4 3.57 61.45 162.29 3.00 35.01 3.98
WINTERSTAR 2011 - 5 0.97 22.95 133.45 3.37 33.59 25.97 FESTIVAL 2011 - 5 1.53 10.87 37.28 2.55 14.04 9.23 RADIANCE 2011 - 5 2.86 4.59 31.31 2.41 23.01 24.78
PROPRIETARY 4 2011 - 5 3.11 222.92 164.62 8.87 46.56 23.62 FL 05-85 2011 - 6 0.77 5.05 12.41 3.57 16.86 19.32 ELYANA 2011 - 6 1.33 132.18 75.36 2.66 109.46 5.94
FESTIVAL 2011 - 6 1.68 38.21 96.71 4.64 25.58 16.58 RED MERLIN 2011 - 6 0.28 0.00 4.79 3.78 16.14 35.49
SAN ANDREAS 2011 - 6 1.34 23.64 73.49 2.03 28.01 12.68 ALBION 2011 - 7 1.06 15.39 14.48 2.58 16.58 20.08
CHARLOTTE 2011 - 7 0.39 0.66 3.59 7.31 21.39 35.79 FESTIVAL 2011 - 7 1.59 8.76 80.61 0.83 13.84 13.77
MARA DES BOIS 2011 - 7 1.05 51.57 295.46 4.55 32.49 23.27 MONTERREY 2011 - 7 1.40 55.74 26.33 7.79 104.68 50.34
ALBION 2012 - 1 3.53 1123.40 49.89 5.17 199.02 11.15 FESTIVAL 2012 - 1 2.49 57.18 169.83 4.07 31.69 14.33 MOJAVE 2012 - 1 1.33 154.43 83.49 4.98 257.91 33.53
PROPRIETARY 3 2012 - 1 1.54 0.00 26.63 3.17 12.46 8.46 CHANDLER 2012 - 4 3.73 24.68 19.38 6.85 78.72 35.84 FESTIVAL 2012 - 4 5.05 45.17 137.24 4.08 21.52 4.00 FL 09-127 2012 - 4 2.65 149.77 208.16 4.76 113.53 12.46
TREASURE 2012 - 4 2.65 77.25 322.38 6.17 77.52 10.99 WINTER DAWN 2012 - 4 1.87 4.05 280.32 6.10 69.31 17.19
PROPRIETARY 5 2012 - 5 2.55 0.00 55.45 8.31 23.48 27.35 ALBION 2012 - 5 5.12 121.60 369.10 8.16 90.75 58.32
FESTIVAL 2012 - 5 2.99 17.64 68.25 4.41 22.63 13.67 RUBYGEM 2012 - 5 3.43 16.65 19.26 5.78 32.27 19.21
CAMINO REAL 2012 - 6 2.74 176.93 90.81 9.88 95.76 34.36 DARSELECT 2012 - 6 3.70 31.04 300.87 15.43 206.81 74.77
FESTIVAL 2012 - 6 3.85 80.27 103.95 7.18 36.66 42.17 SWEET ANNE 2012 - 6 4.08 6.84 74.49 11.22 45.04 108.16
BENICIA 2012 - 7 2.93 8.67 88.83 8.24 39.25 71.59 FESTIVAL 2012 - 7 2.59 64.12 187.23 4.76 33.82 26.46 FL 06-38 2012 - 7 2.97 99.72 726.88 6.26 76.37 20.62
PORTOLA 2012 - 7 1.46 0.80 60.21 3.44 15.41 18.08 VENTANA 2012 - 7 0.58 0.00 34.29 3.77 18.52 36.37
PROPRIETARY 6 2012 - 9 2.37 24.79 350.70 12.25 20.91 24.32 EVIE 2 2012 - 9 1.25 22.57 43.48 5.70 29.09 4.82
FESTIVAL 2012 - 9 1.87 19.02 52.54 1.61 8.42 3.22 GALLETA 2012 - 9 3.04 88.84 62.31 6.66 37.24 8.68
SWEET ANNE 2012 - 9 2.02 7.92 17.87 2.14 5.68 3.47
64
Table 2-1. Continued.
HIGH 11.52 22.42 18.23 20.36 6.53 13.43
LOW 0.00 0.00 0.00 0.00 0.00 0.15
MEDIAN 0.31 4.45 2.56 1.63 2.28 2.50
FOLD DIFFERENCE
- - - - - 91
CULTIVAR HARVEST 60415-61-4 104-76-7 2311-46-8 109-19-3 2548-87-0 540-18-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ester alcohol ester ester aldehyde ester
PROPRIETARY 1 2011 - 2 0.53 4.53 0.00 0.79 2.17 1.67 CAMAROSA 2011 - 2 0.00 1.38 0.00 1.23 3.22 1.63 FESTIVAL 2011 - 2 1.31 11.70 0.33 1.63 3.91 2.56
MARA DES BOIS 2011 - 2 0.10 1.91 0.03 2.07 2.15 2.21 RADIANCE 2011 - 2 0.14 12.21 0.00 0.40 3.64 1.60
PROPRIETARY 2 2011 - 3 1.60 4.26 2.03 20.36 1.91 11.15 CAMAROSA 2011 - 3 0.15 3.14 0.45 2.82 4.47 2.67
SWEET CHARLIE 2011 - 3 1.15 10.25 2.60 1.99 4.78 2.74 TREASURE 2011 - 3 1.15 6.23 0.00 6.15 6.53 7.55
WINTER DAWN 2011 - 3 0.47 4.77 0.00 1.60 4.77 1.10 PROPRIETARY 3 2011 - 4 0.35 2.00 5.06 0.50 2.67 0.83
CAMINO REAL 2011 - 4 0.00 0.00 7.27 0.00 0.91 0.19 FESTIVAL 2011 - 4 0.00 7.53 2.32 0.00 0.89 0.69
WINTERSTAR 2011 - 5 0.00 8.88 0.00 0.00 0.42 1.89 FESTIVAL 2011 - 5 0.00 3.41 0.00 0.00 0.41 1.03 RADIANCE 2011 - 5 0.00 4.20 0.00 0.00 0.40 0.15
PROPRIETARY 4 2011 - 5 1.34 5.41 5.28 2.09 1.75 13.43 FL 05-85 2011 - 6 0.26 3.35 0.46 0.00 0.50 0.43 ELYANA 2011 - 6 0.27 22.42 2.51 11.87 0.35 5.80
FESTIVAL 2011 - 6 0.24 8.24 1.30 0.00 0.49 1.07 RED MERLIN 2011 - 6 0.52 2.52 0.00 0.00 0.59 0.39
SAN ANDREAS 2011 - 6 0.31 12.90 1.56 0.00 0.70 1.09 ALBION 2011 - 7 0.02 1.13 0.44 0.00 1.22 1.45
CHARLOTTE 2011 - 7 0.15 0.20 0.01 0.00 0.38 0.28 FESTIVAL 2011 - 7 0.22 0.00 0.00 0.00 0.66 0.28
MARA DES BOIS 2011 - 7 0.00 2.16 0.00 0.00 0.35 1.81 MONTERREY 2011 - 7 0.12 3.69 1.72 1.06 0.45 1.21
ALBION 2012 - 1 11.52 18.50 18.17 15.65 2.45 12.32 FESTIVAL 2012 - 1 1.89 6.57 7.21 1.23 2.19 4.81 MOJAVE 2012 - 1 1.83 12.54 12.07 3.87 1.94 5.12
PROPRIETARY 3 2012 - 1 0.10 1.95 2.51 0.79 2.36 0.97 CHANDLER 2012 - 4 0.00 4.86 5.20 1.94 0.00 0.24 FESTIVAL 2012 - 4 1.26 7.46 7.27 1.56 2.64 3.81 FL 09-127 2012 - 4 1.13 11.33 11.65 3.48 2.20 6.39
TREASURE 2012 - 4 0.91 6.30 7.51 4.95 4.40 9.49 WINTER DAWN 2012 - 4 0.55 5.07 6.15 2.42 3.66 3.41
PROPRIETARY 5 2012 - 5 0.27 1.20 1.85 1.99 3.00 2.44 ALBION 2012 - 5 0.94 7.46 6.77 7.26 3.65 5.74
FESTIVAL 2012 - 5 0.16 2.79 3.16 1.23 2.97 3.08 RUBYGEM 2012 - 5 0.61 3.46 2.97 1.54 2.41 2.89
CAMINO REAL 2012 - 6 1.20 4.36 4.93 2.43 2.18 5.25 DARSELECT 2012 - 6 0.56 10.86 11.55 6.35 3.11 7.25
FESTIVAL 2012 - 6 1.06 8.61 9.71 2.80 3.82 5.11 SWEET ANNE 2012 - 6 0.31 4.08 4.90 2.50 3.14 4.05
BENICIA 2012 - 7 0.23 2.15 3.34 2.55 4.36 4.48 FESTIVAL 2012 - 7 0.69 10.91 10.75 1.62 3.28 3.86 FL 06-38 2012 - 7 0.79 17.63 18.23 6.27 5.46 10.22
PORTOLA 2012 - 7 0.10 9.68 1.97 1.76 3.50 2.04 VENTANA 2012 - 7 0.11 0.74 2.27 1.84 3.37 2.41
PROPRIETARY 6 2012 - 9 0.55 6.67 6.48 1.74 3.05 4.88 EVIE 2 2012 - 9 0.14 1.81 2.69 4.11 1.91 4.32
FESTIVAL 2012 - 9 0.38 4.34 3.88 0.25 1.65 1.26 GALLETA 2012 - 9 0.52 2.33 2.99 5.55 3.54 4.73
SWEET ANNE 2012 - 9 0.10 1.98 2.62 1.16 1.77 2.26
65
Table 2-1. Continued.
HIGH 42.14 107.78 53.62 12.98 482.77 40.01
LOW 0.00 1.54 0.00 0.13 21.64 1.31
MEDIAN 9.41 14.36 0.82 1.92 81.74 5.66
FOLD DIFFERENCE
- 70 - 102 22 30
CULTIVAR HARVEST 4077-47-8 20664-46-4 821-55-6 5989-33-3 78-70-6 124-19-6
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
furan aldehyde ketone furan alcohol aldehyde
PROPRIETARY 1 2011 - 2 12.78 29.87 0.11 3.81 137.57 22.11 CAMAROSA 2011 - 2 17.54 14.62 0.66 1.63 51.87 18.85 FESTIVAL 2011 - 2 19.87 37.83 1.43 3.16 75.99 19.24
MARA DES BOIS 2011 - 2 17.84 17.40 1.07 1.32 28.59 12.59 RADIANCE 2011 - 2 26.97 9.60 0.41 3.58 306.04 40.01
PROPRIETARY 2 2011 - 3 16.90 32.79 2.18 1.80 31.65 11.72 CAMAROSA 2011 - 3 23.65 23.72 2.30 1.13 79.98 20.75
SWEET CHARLIE 2011 - 3 28.96 26.38 9.77 4.42 161.57 32.69 TREASURE 2011 - 3 42.14 37.23 8.28 1.29 65.37 17.61
WINTER DAWN 2011 - 3 20.93 7.30 0.57 0.92 54.87 8.35 PROPRIETARY 3 2011 - 4 10.54 107.78 0.00 2.48 322.88 13.77
CAMINO REAL 2011 - 4 3.31 10.08 0.00 1.73 286.33 10.30 FESTIVAL 2011 - 4 7.91 23.99 0.00 1.68 71.60 7.05
WINTERSTAR 2011 - 5 1.26 2.50 0.00 0.78 32.98 2.12 FESTIVAL 2011 - 5 2.03 2.17 0.00 2.40 59.36 2.10 RADIANCE 2011 - 5 3.05 2.13 0.00 0.23 150.10 4.63
PROPRIETARY 4 2011 - 5 13.58 31.50 0.00 3.71 84.37 8.34 FL 05-85 2011 - 6 2.92 8.75 0.00 0.76 52.49 2.43 ELYANA 2011 - 6 5.86 12.72 0.28 0.28 62.28 4.67
FESTIVAL 2011 - 6 4.32 11.44 0.00 0.46 43.26 2.62 RED MERLIN 2011 - 6 3.73 3.25 0.00 2.11 40.05 2.28
SAN ANDREAS 2011 - 6 7.67 29.67 0.00 1.39 137.52 3.64 ALBION 2011 - 7 5.27 3.65 0.00 1.07 168.45 3.63
CHARLOTTE 2011 - 7 4.46 13.69 0.00 1.67 34.07 3.20 FESTIVAL 2011 - 7 2.70 5.25 0.00 0.88 30.15 1.31
MARA DES BOIS 2011 - 7 4.22 9.85 0.00 0.13 21.64 2.85 MONTERREY 2011 - 7 16.37 40.26 0.00 1.51 133.91 5.54
ALBION 2012 - 1 9.73 22.76 5.45 12.98 423.84 11.40 FESTIVAL 2012 - 1 7.08 12.05 2.52 3.63 104.29 5.26 MOJAVE 2012 - 1 7.95 3.34 2.94 3.22 63.18 5.66
PROPRIETARY 3 2012 - 1 9.67 8.86 0.24 7.00 240.74 5.66 CHANDLER 2012 - 4 0.00 19.73 0.00 1.56 35.92 4.09 FESTIVAL 2012 - 4 14.54 29.45 0.00 1.72 56.24 6.46 FL 09-127 2012 - 4 11.81 40.36 53.62 1.37 67.05 5.48
TREASURE 2012 - 4 16.01 33.65 11.39 1.88 67.90 8.36 WINTER DAWN 2012 - 4 13.35 4.56 25.43 1.13 51.47 5.20
PROPRIETARY 5 2012 - 5 9.29 11.72 3.61 2.27 112.00 4.44 ALBION 2012 - 5 18.44 14.10 8.28 8.69 400.74 7.71
FESTIVAL 2012 - 5 8.71 4.75 1.81 3.28 83.51 4.40 RUBYGEM 2012 - 5 6.13 11.73 5.31 3.64 97.91 4.73
CAMINO REAL 2012 - 6 8.16 24.39 4.96 6.59 244.74 11.06 DARSELECT 2012 - 6 26.02 69.41 8.77 5.87 153.20 9.67
FESTIVAL 2012 - 6 13.06 23.72 4.68 4.89 90.93 9.72 SWEET ANNE 2012 - 6 7.61 21.36 1.81 7.21 482.77 14.43
BENICIA 2012 - 7 15.11 8.58 5.87 3.65 330.32 6.09 FESTIVAL 2012 - 7 13.33 13.74 3.41 1.96 99.14 5.59 FL 06-38 2012 - 7 23.82 56.32 5.40 2.90 222.58 5.48
PORTOLA 2012 - 7 9.49 1.89 0.08 2.27 27.05 3.52 VENTANA 2012 - 7 9.32 1.54 1.05 4.40 86.68 6.13
PROPRIETARY 6 2012 - 9 8.31 25.05 2.14 0.85 79.76 6.73 EVIE 2 2012 - 9 5.86 19.66 0.99 1.71 69.84 3.64
FESTIVAL 2012 - 9 3.28 6.69 0.00 0.94 24.57 1.34 GALLETA 2012 - 9 21.08 47.33 1.96 2.47 218.27 6.18
SWEET ANNE 2012 - 9 7.41 21.61 0.00 7.17 295.85 4.04
66
Table 2-1. Continued.
HIGH 6.80 36.07 72.87 22.46 13.66 117.92
LOW 1.06 1.29 0.00 0.00 0.00 0.49
MEDIAN 2.78 8.54 6.96 3.75 0.82 10.26
FOLD DIFFERENCE
6 28 - - - 239
CULTIVAR HARVEST 103-09-3 140-11-4 2639-63-6 53398-83-7 106-32-1 112-14-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ester ester ester ester ester ester
PROPRIETARY 1 2011 - 2 4.51 7.40 2.54 2.84 0.13 11.65 CAMAROSA 2011 - 2 2.87 7.66 6.98 7.08 0.16 21.13 FESTIVAL 2011 - 2 3.29 6.81 21.49 16.38 1.21 11.03
MARA DES BOIS 2011 - 2 4.50 8.83 21.27 15.48 0.80 19.38 RADIANCE 2011 - 2 3.41 11.79 8.25 4.27 0.23 5.46
PROPRIETARY 2 2011 - 3 4.42 12.94 12.80 7.12 0.39 10.35 CAMAROSA 2011 - 3 3.96 15.69 12.79 3.99 0.62 34.07
SWEET CHARLIE 2011 - 3 3.44 25.45 17.14 3.60 1.26 28.47 TREASURE 2011 - 3 2.04 11.17 29.51 9.74 0.26 9.99
WINTER DAWN 2011 - 3 2.49 8.65 2.03 1.34 0.33 4.41 PROPRIETARY 3 2011 - 4 6.06 25.91 1.01 0.62 4.63 20.99
CAMINO REAL 2011 - 4 4.26 36.07 3.94 1.06 0.82 20.04 FESTIVAL 2011 - 4 3.84 6.47 11.68 5.12 2.07 17.37
WINTERSTAR 2011 - 5 2.94 10.12 7.39 3.65 1.29 10.17 FESTIVAL 2011 - 5 2.28 4.03 3.72 2.90 0.41 2.89 RADIANCE 2011 - 5 2.41 8.77 2.56 3.60 0.28 1.24
PROPRIETARY 4 2011 - 5 3.26 24.68 28.61 11.18 1.69 8.78 FL 05-85 2011 - 6 2.58 3.56 0.95 1.61 0.07 3.02 ELYANA 2011 - 6 2.50 19.10 0.00 1.00 1.21 103.40
FESTIVAL 2011 - 6 3.28 4.86 10.50 10.41 0.63 5.39 RED MERLIN 2011 - 6 2.07 6.98 0.63 1.24 0.13 0.49
SAN ANDREAS 2011 - 6 2.37 9.74 3.48 0.87 0.65 1.25 ALBION 2011 - 7 1.44 5.62 1.43 1.55 0.35 2.62
CHARLOTTE 2011 - 7 1.68 2.93 0.90 1.71 0.11 1.15 FESTIVAL 2011 - 7 1.68 3.57 2.31 2.28 0.68 2.49
MARA DES BOIS 2011 - 7 3.05 4.13 12.55 5.77 6.07 22.76 MONTERREY 2011 - 7 3.33 30.29 6.93 2.81 0.62 67.70
ALBION 2012 - 1 1.91 7.51 72.87 6.97 0.15 30.97 FESTIVAL 2012 - 1 1.93 3.57 8.17 8.39 1.06 6.29 MOJAVE 2012 - 1 2.19 15.81 42.52 6.27 0.51 80.78
PROPRIETARY 3 2012 - 1 1.84 4.24 0.12 0.00 0.25 3.93 CHANDLER 2012 - 4 3.56 24.18 11.30 4.21 0.00 27.23 FESTIVAL 2012 - 4 2.51 4.69 9.36 5.43 0.00 4.85 FL 09-127 2012 - 4 2.78 9.04 30.03 5.84 8.93 33.80
TREASURE 2012 - 4 2.63 8.43 13.65 4.71 5.39 16.21 WINTER DAWN 2012 - 4 2.55 8.94 1.67 0.68 6.25 10.41
PROPRIETARY 5 2012 - 5 2.41 9.79 0.60 1.20 0.00 2.93 ALBION 2012 - 5 2.96 15.31 9.56 4.68 4.31 41.16
FESTIVAL 2012 - 5 1.71 3.92 5.40 4.30 0.00 2.70 RUBYGEM 2012 - 5 1.83 5.61 3.16 3.26 0.00 13.94
CAMINO REAL 2012 - 6 3.32 26.05 30.87 12.77 2.93 29.70 DARSELECT 2012 - 6 3.57 8.36 26.13 10.14 8.35 117.92
FESTIVAL 2012 - 6 3.18 4.63 12.22 22.46 4.80 11.58 SWEET ANNE 2012 - 6 2.78 6.13 2.39 3.86 4.12 7.78
BENICIA 2012 - 7 2.99 32.97 2.82 2.86 4.39 8.61 FESTIVAL 2012 - 7 1.86 4.42 11.81 12.66 5.25 9.94 FL 06-38 2012 - 7 2.10 19.64 22.97 5.08 13.66 28.08
PORTOLA 2012 - 7 2.17 1.79 1.18 0.85 6.16 8.62 VENTANA 2012 - 7 1.06 21.96 1.13 1.42 2.32 3.62
PROPRIETARY 6 2012 - 9 6.80 12.26 6.93 3.02 9.47 13.97 EVIE 2 2012 - 9 5.20 10.43 4.18 0.78 0.95 13.53
FESTIVAL 2012 - 9 2.31 1.29 3.00 2.26 0.82 1.75 GALLETA 2012 - 9 4.11 2.97 11.96 4.40 1.79 6.70
SWEET ANNE 2012 - 9 3.42 4.24 2.02 0.61 1.70 3.25
67
Table 2-1. Continued.
HIGH 52.26 6.93 4.74 397.54 13.27 28.72
LOW 0.06 0.00 0.00 0.00 0.00 0.00
MEDIAN 4.95 1.67 0.00 21.75 1.10 1.33
FOLD DIFFERENCE
875 - - - - -
CULTIVAR HARVEST 564-94-3 3913-81-3 134-20-3 110-39-4 110-38-3 29811-50-5
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
aldehyde aldehyde ester ester ester ester
PROPRIETARY 1 2011 - 2 3.33 5.23 0.00 11.79 0.00 5.59 CAMAROSA 2011 - 2 3.66 4.22 0.00 27.44 0.00 7.58 FESTIVAL 2011 - 2 4.22 3.58 0.00 50.97 6.02 0.59
MARA DES BOIS 2011 - 2 10.95 2.72 0.00 33.50 1.22 1.11 RADIANCE 2011 - 2 52.26 2.71 0.00 6.10 0.00 0.54
PROPRIETARY 2 2011 - 3 8.12 4.23 0.00 34.71 0.00 2.00 CAMAROSA 2011 - 3 9.20 6.93 0.00 60.22 0.00 11.73
SWEET CHARLIE 2011 - 3 10.97 3.42 0.00 59.74 3.99 3.58 TREASURE 2011 - 3 10.54 5.50 0.00 53.49 0.00 2.87
WINTER DAWN 2011 - 3 2.19 1.95 0.00 3.37 0.00 0.61 PROPRIETARY 3 2011 - 4 0.78 3.53 0.00 4.28 0.00 1.74
CAMINO REAL 2011 - 4 0.84 1.31 0.00 24.94 0.00 2.53 FESTIVAL 2011 - 4 4.07 2.24 0.00 41.00 3.63 3.15
WINTERSTAR 2011 - 5 4.94 0.47 0.00 11.29 0.64 0.66 FESTIVAL 2011 - 5 0.17 0.65 0.00 4.84 0.40 0.74 RADIANCE 2011 - 5 5.12 0.78 0.00 1.17 0.37 0.80
PROPRIETARY 4 2011 - 5 9.67 3.96 0.00 48.33 1.60 0.65 FL 05-85 2011 - 6 0.64 0.79 0.00 3.64 2.38 1.17 ELYANA 2011 - 6 1.52 1.15 0.00 397.54 2.93 5.24
FESTIVAL 2011 - 6 1.47 1.02 0.00 21.95 5.77 1.35 RED MERLIN 2011 - 6 3.84 0.91 0.00 0.21 0.00 0.56
SAN ANDREAS 2011 - 6 0.06 0.55 0.00 7.00 1.64 0.26 ALBION 2011 - 7 8.36 0.51 0.00 1.69 0.00 0.46
CHARLOTTE 2011 - 7 3.84 0.67 1.46 0.00 0.00 0.40 FESTIVAL 2011 - 7 2.44 0.60 0.00 4.43 0.97 1.32
MARA DES BOIS 2011 - 7 4.30 1.42 4.74 28.14 2.30 1.73 MONTERREY 2011 - 7 0.62 1.08 0.00 46.32 0.45 28.72
ALBION 2012 - 1 6.70 1.49 0.00 263.31 13.27 2.56 FESTIVAL 2012 - 1 4.95 1.70 0.00 17.42 1.71 0.70 MOJAVE 2012 - 1 7.34 2.02 0.00 234.85 1.99 10.78
PROPRIETARY 3 2012 - 1 2.45 1.63 0.00 3.46 0.00 0.28 CHANDLER 2012 - 4 7.61 0.00 0.00 61.48 0.00 17.51 FESTIVAL 2012 - 4 6.77 2.35 0.00 31.08 7.18 1.72 FL 09-127 2012 - 4 17.13 1.84 0.00 94.26 3.87 3.33
TREASURE 2012 - 4 8.39 2.95 0.00 35.23 1.29 3.63 WINTER DAWN 2012 - 4 4.20 0.70 0.00 4.73 0.69 0.00
PROPRIETARY 5 2012 - 5 7.75 1.80 0.00 0.63 0.00 0.00 ALBION 2012 - 5 13.97 1.70 0.00 36.23 4.45 3.43
FESTIVAL 2012 - 5 3.00 1.78 0.00 6.15 0.97 0.88 RUBYGEM 2012 - 5 7.10 2.19 0.00 22.67 1.71 2.07
CAMINO REAL 2012 - 6 6.58 1.06 0.00 95.34 2.58 1.63 DARSELECT 2012 - 6 3.75 2.02 0.00 100.59 1.55 19.94
FESTIVAL 2012 - 6 6.02 2.93 0.00 23.30 5.14 0.89 SWEET ANNE 2012 - 6 4.40 1.28 0.00 8.95 4.14 0.65
BENICIA 2012 - 7 12.14 1.26 0.00 5.09 0.84 0.00 FESTIVAL 2012 - 7 6.79 2.06 0.00 19.59 3.97 0.93 FL 06-38 2012 - 7 10.22 1.88 0.00 55.04 6.14 1.79
PORTOLA 2012 - 7 2.74 1.20 0.00 4.51 0.24 2.12 VENTANA 2012 - 7 6.36 1.30 0.00 1.90 0.00 0.00
PROPRIETARY 6 2012 - 9 4.01 2.24 0.00 16.72 2.24 0.76 EVIE 2 2012 - 9 5.97 1.37 0.00 21.55 0.00 2.51
FESTIVAL 2012 - 9 2.29 0.72 0.00 6.94 2.48 1.11 GALLETA 2012 - 9 13.64 0.68 0.00 37.60 0.00 2.73
SWEET ANNE 2012 - 9 2.76 0.45 0.00 4.33 8.38 0.73
68
Table 2-1. Continued.
HIGH 191.41 6.17 346.93 5.57 12.77 12.92
LOW 0.00 0.00 0.00 0.00 2.30 0.00
MEDIAN 2.28 0.81 5.73 0.70 5.74 2.49
FOLD DIFFERENCE
- - - - 6 -
CULTIVAR HARVEST 7786-58-5 15111-96-3 706-14-9 10522-34-6 5881-17-4 128-37-0
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
ester ester furan ester hydrocarbon
PROPRIETARY 1 2011 - 2 4.53 0.85 0.68 0.44 9.73 0.67
CAMAROSA 2011 - 2 6.93 0.56 0.96 0.59 7.49 1.09 FESTIVAL 2011 - 2 1.17 1.93 0.60 1.51 8.54 2.27
MARA DES BOIS 2011 - 2 6.72 4.69 0.94 0.42 8.68 0.36 RADIANCE 2011 - 2 0.34 0.65 115.37 0.68 9.88 2.43
PROPRIETARY 2 2011 - 3 24.85 0.06 0.00 1.36 11.41 0.82 CAMAROSA 2011 - 3 16.29 2.80 1.57 1.14 10.85 2.21
SWEET CHARLIE 2011 - 3 15.07 4.29 313.79 1.33 12.77 5.49 TREASURE 2011 - 3 10.66 0.61 5.79 1.64 9.70 1.33
WINTER DAWN 2011 - 3 0.24 0.96 1.02 0.27 7.42 1.71 PROPRIETARY 3 2011 - 4 8.02 1.01 3.11 0.38 9.60 0.98
CAMINO REAL 2011 - 4 1.80 1.00 21.12 0.61 9.23 1.22 FESTIVAL 2011 - 4 1.61 6.17 0.40 1.78 10.03 3.01
WINTERSTAR 2011 - 5 0.64 1.64 20.02 0.57 5.25 1.03 FESTIVAL 2011 - 5 0.00 1.73 5.78 0.32 5.90 1.41 RADIANCE 2011 - 5 0.00 1.42 33.22 0.57 6.43 3.08
PROPRIETARY 4 2011 - 5 1.56 0.79 0.73 2.11 5.36 0.57 FL 05-85 2011 - 6 0.00 2.79 0.45 0.59 2.93 0.63 ELYANA 2011 - 6 60.26 2.25 46.44 5.57 4.56 0.70
FESTIVAL 2011 - 6 0.90 3.21 0.84 1.53 5.00 1.63 RED MERLIN 2011 - 6 0.00 0.34 6.79 0.00 2.30 0.00
SAN ANDREAS 2011 - 6 0.18 0.23 83.49 0.51 3.63 1.47 ALBION 2011 - 7 1.13 0.41 6.56 0.24 3.99 2.54
CHARLOTTE 2011 - 7 0.49 0.41 0.37 0.00 3.89 0.00 FESTIVAL 2011 - 7 0.42 2.07 0.00 0.29 3.30 1.09
MARA DES BOIS 2011 - 7 4.34 2.49 0.00 0.56 3.40 0.00 MONTERREY 2011 - 7 13.36 1.00 0.00 0.40 5.11 2.04
ALBION 2012 - 1 22.86 1.24 346.93 4.53 7.67 8.11 FESTIVAL 2012 - 1 1.05 1.07 2.62 1.23 6.13 8.09 MOJAVE 2012 - 1 60.69 0.60 191.40 2.35 3.91 0.00
PROPRIETARY 3 2012 - 1 0.94 0.48 1.68 0.00 3.04 1.54 CHANDLER 2012 - 4 37.20 0.00 78.79 2.89 9.81 12.92 FESTIVAL 2012 - 4 2.75 1.44 2.62 2.22 8.36 9.62 FL 09-127 2012 - 4 30.92 0.97 147.96 2.35 7.21 9.66
TREASURE 2012 - 4 15.68 0.98 5.18 1.32 6.34 3.64 WINTER DAWN 2012 - 4 0.00 0.50 1.67 0.42 7.76 7.92
PROPRIETARY 5 2012 - 5 2.45 0.65 5.68 0.00 3.36 9.46 ALBION 2012 - 5 14.25 0.74 148.43 1.42 7.26 11.56
FESTIVAL 2012 - 5 0.98 0.69 1.24 0.67 3.89 8.09 RUBYGEM 2012 - 5 4.63 0.79 38.39 1.26 4.08 8.35
CAMINO REAL 2012 - 6 6.41 0.82 84.65 2.68 5.73 9.55 DARSELECT 2012 - 6 191.41 0.44 292.66 1.32 5.90 8.18
FESTIVAL 2012 - 6 2.03 0.87 1.81 1.57 6.35 9.80 SWEET ANNE 2012 - 6 4.57 0.57 49.75 0.48 5.31 8.71
BENICIA 2012 - 7 5.29 0.74 39.34 0.00 4.40 6.02 FESTIVAL 2012 - 7 1.09 0.79 1.36 1.05 5.74 5.50 FL 06-38 2012 - 7 18.44 0.66 150.70 2.24 5.80 5.01
PORTOLA 2012 - 7 2.10 0.41 1.42 0.00 3.90 1.86 VENTANA 2012 - 7 0.58 0.38 9.54 0.00 3.67 0.63
PROPRIETARY 6 2012 - 9 1.23 0.61 37.57 2.17 4.48 9.08 EVIE 2 2012 - 9 34.44 0.27 33.27 0.99 4.03 7.36
FESTIVAL 2012 - 9 0.88 1.07 0.81 0.72 3.48 2.63 GALLETA 2012 - 9 14.06 0.79 25.34 1.06 5.49 6.97
SWEET ANNE 2012 - 9 1.41 0.90 32.10 0.65 5.66 3.19
69
Table 2-1. Continued.
HIGH 667.62 185.71 29.36 30.10
LOW 0.00 0.00 0.00 0.14
MEDIAN 46.90 6.38 1.46 4.66
FOLD DIFFERENCE
- - - 211
CULTIVAR HARVEST 40716-66-3 4887-30-3 5454-09-1 2305-05-7
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
alcohol ester ester furan
PROPRIETARY 1 2011 - 2 97.06 12.78 8.68 4.20 CAMAROSA 2011 - 2 26.75 9.98 4.82 5.42 FESTIVAL 2011 - 2 86.35 23.87 11.82 9.72
MARA DES BOIS 2011 - 2 9.85 8.74 1.46 5.54 RADIANCE 2011 - 2 308.02 20.59 19.16 7.73
PROPRIETARY 2 2011 - 3 5.12 2.20 0.85 2.43 CAMAROSA 2011 - 3 78.87 16.29 4.94 9.50
SWEET CHARLIE 2011 - 3 667.62 65.87 24.70 11.74 TREASURE 2011 - 3 34.85 8.92 1.62 30.10
WINTER DAWN 2011 - 3 159.43 0.00 0.00 6.49 PROPRIETARY 3 2011 - 4 74.18 4.33 0.00 16.59
CAMINO REAL 2011 - 4 36.38 8.96 1.89 1.31 FESTIVAL 2011 - 4 96.42 20.83 3.04 9.09
WINTERSTAR 2011 - 5 30.80 5.61 0.85 1.60 FESTIVAL 2011 - 5 51.21 3.16 0.81 2.78 RADIANCE 2011 - 5 198.38 0.00 0.00 3.55
PROPRIETARY 4 2011 - 5 27.41 2.62 1.27 6.68 FL 05-85 2011 - 6 7.63 1.34 0.25 3.00 ELYANA 2011 - 6 30.63 185.71 29.36 1.93
FESTIVAL 2011 - 6 43.41 33.67 1.47 3.11 RED MERLIN 2011 - 6 0.00 0.00 0.00 0.27
SAN ANDREAS 2011 - 6 46.87 3.77 0.00 3.57 ALBION 2011 - 7 12.49 0.00 0.00 1.57
CHARLOTTE 2011 - 7 0.00 0.00 0.00 0.83 FESTIVAL 2011 - 7 6.07 1.99 0.00 0.92
MARA DES BOIS 2011 - 7 0.88 7.36 1.55 1.43 MONTERREY 2011 - 7 3.32 8.36 3.97 0.14
ALBION 2012 - 1 214.55 36.92 12.37 28.69 FESTIVAL 2012 - 1 149.32 7.95 1.92 14.55 MOJAVE 2012 - 1 7.36 94.19 14.57 13.45
PROPRIETARY 3 2012 - 1 38.63 0.00 0.00 8.54 CHANDLER 2012 - 4 17.26 37.41 7.02 6.85 FESTIVAL 2012 - 4 141.27 11.47 1.50 9.55 FL 09-127 2012 - 4 159.47 36.55 8.65 4.99
TREASURE 2012 - 4 39.48 5.72 1.15 26.32 WINTER DAWN 2012 - 4 72.49 0.00 0.00 4.43
PROPRIETARY 5 2012 - 5 26.46 0.00 0.00 1.54 ALBION 2012 - 5 213.01 11.52 2.14 16.53
FESTIVAL 2012 - 5 86.59 2.24 0.79 5.33 RUBYGEM 2012 - 5 113.35 8.64 1.86 2.29
CAMINO REAL 2012 - 6 52.50 15.73 6.48 4.50 DARSELECT 2012 - 6 138.07 119.27 5.83 10.60
FESTIVAL 2012 - 6 116.93 6.07 1.64 8.30 SWEET ANNE 2012 - 6 144.53 3.85 0.00 4.81
BENICIA 2012 - 7 82.87 1.30 0.00 1.37 FESTIVAL 2012 - 7 123.21 6.69 1.20 6.86 FL 06-38 2012 - 7 244.90 30.12 6.10 10.15
PORTOLA 2012 - 7 8.16 1.79 0.00 0.97 VENTANA 2012 - 7 13.54 0.00 0.00 1.49
PROPRIETARY 6 2012 - 9 10.59 3.28 0.96 3.16 EVIE 2 2012 - 9 18.05 7.59 1.57 6.93
FESTIVAL 2012 - 9 42.61 2.80 1.03 3.20 GALLETA 2012 - 9 46.93 3.75 2.09 2.01
SWEET ANNE 2012 - 9 89.97 2.20 0.42 3.75
70
Table 2-2. Standard errors of consumer, physical, and biochemical measures.
CULTIVAR HARVEST HARVEST
DATE OVERALL
LIKING TEXTURE
LIKING SWEETNESS INTENSITY
SOURNESS INTENSITY
STRAWBERRY FLAVOR INTENSITY
-100 to +100
-100 to +100
0 to +100 0 to +100 0 to +100
PROPRIETARY 1 2011 - 2 1/24/2011 2.51 2.63 2.05 1.64 2.15 CAMAROSA 2011 - 2 1/24/2011 2.63 2.61 1.85 1.74 2.15 FESTIVAL 2011 - 2 1/24/2011 2.39 2.38 2.17 1.73 2.28
MARA DES BOIS 2011 - 2 1/24/2011 2.39 2.49 2.11 1.36 2.08 RADIANCE 2011 - 2 1/24/2011 2.29 2.29 2.04 1.71 2.05
PROPRIETARY 2 2011 - 3 1/31/2011 2.46 2.66 2.19 1.49 2.32 CAMAROSA 2011 - 3 1/31/2011 2.31 2.36 2.01 1.62 2.13
SWEET CHARLIE 2011 - 3 1/31/2011 2.54 2.72 2.16 1.63 2.31 TREASURE 2011 - 3 1/31/2011 2.57 2.61 2.07 1.69 2.08
WINTER DAWN 2011 - 3 1/31/2011 2.29 2.39 1.80 1.65 2.00 PROPRIETARY 3 2011 - 4 2/7/2011 2.47 2.89 1.98 1.84 2.14
CAMINO REAL 2011 - 4 2/7/2011 2.56 2.29 1.68 1.78 2.07 FESTIVAL 2011 - 4 2/7/2011 2.28 2.47 1.81 1.81 1.95
WINTERSTAR 2011 - 5 2/14/2011 2.74 2.61 2.09 1.42 2.07 FESTIVAL 2011 - 5 2/14/2011 2.46 2.47 1.92 1.75 2.13 RADIANCE 2011 - 5 2/14/2011 2.66 2.70 1.92 1.65 2.12
PROPRIETARY 4 2011 - 5 2/14/2011 2.54 2.32 2.21 1.66 2.27 FL 05-85 2011 - 6 2/21/2011 2.13 2.15 1.75 1.08 1.74 ELYANA 2011 - 6 2/21/2011 2.42 2.36 1.93 1.26 2.04
FESTIVAL 2011 - 6 2/21/2011 2.44 2.29 1.85 1.30 1.95 RED MERLIN 2011 - 6 2/21/2011 2.21 2.06 1.46 1.86 1.81
SAN ANDREAS 2011 - 6 2/21/2011 2.17 2.31 1.80 1.84 1.83 ALBION 2011 - 7 2/28/2011 2.48 2.51 2.11 1.63 2.17
CHARLOTTE 2011 - 7 2/28/2011 2.80 2.56 1.71 1.11 1.61 FESTIVAL 2011 - 7 2/28/2011 2.34 2.24 1.63 1.66 1.75
MARA DES BOIS 2011 - 7 2/28/2011 2.89 2.80 2.07 1.22 2.05 MONTERREY 2011 - 7 2/28/2011 2.86 2.43 1.89 1.65 2.13
ALBION 2012 - 1 1/16/2012 2.61 2.62 2.22 1.60 2.27 FESTIVAL 2012 - 1 1/16/2012 2.40 2.37 2.31 1.67 2.34 MOJAVE 2012 - 1 1/16/2012 2.51 2.63 2.33 1.55 2.23
PROPRIETARY 3 2012 - 1 1/16/2012 2.46 2.62 2.17 1.41 2.12 CHANDLER 2012 - 4 2/6/2012 2.21 2.44 1.87 1.88 1.93 FESTIVAL 2012 - 4 2/6/2012 2.58 2.48 2.25 1.68 2.35 FL 09-127 2012 - 4 2/6/2012 2.71 2.48 2.08 1.48 2.32
TREASURE 2012 - 4 2/6/2012 2.40 2.31 2.29 1.67 2.27 WINTER DAWN 2012 - 4 2/6/2012 2.16 2.53 1.84 1.70 1.97
PROPRIETARY 5 2012 - 5 2/13/2012 2.17 2.30 2.16 1.51 2.07 ALBION 2012 - 5 2/13/2012 2.57 2.37 2.16 1.75 2.19
FESTIVAL 2012 - 5 2/13/2012 2.45 2.50 1.91 1.32 1.88 RUBYGEM 2012 - 5 2/13/2012 2.62 2.56 2.11 1.50 2.19
CAMINO REAL 2012 - 6 2/20/2012 2.22 2.41 2.05 1.48 2.10 DARSELECT 2012 - 6 2/20/2012 2.65 2.64 2.36 1.80 2.24
FESTIVAL 2012 - 6 2/20/2012 2.39 2.43 2.03 1.76 2.15 SWEET ANNE 2012 - 6 2/20/2012 2.52 2.47 2.32 1.98 2.34
BENICIA 2012 - 7 2/27/2012 2.28 2.31 2.01 1.72 1.90 FESTIVAL 2012 - 7 2/27/2012 2.29 2.37 2.05 1.51 1.95 FL 06-38 2012 - 7 2/27/2012 2.37 2.26 2.01 1.53 1.99
PORTOLA 2012 - 7 2/27/2012 2.55 2.30 1.99 1.74 2.14 VENTANA 2012 - 7 2/27/2012 2.32 2.42 1.67 1.77 1.88
PROPRIETARY 6 2012 - 9 3/12/2012 2.39 2.42 2.02 1.85 2.14 EVIE 2 2012 - 9 3/12/2012 2.13 2.45 1.95 1.75 1.82
FESTIVAL 2012 - 9 3/12/2012 2.42 2.50 2.06 1.45 2.08 GALLETA 2012 - 9 3/12/2012 2.48 2.33 1.86 1.84 1.97
SWEET ANNE 2012 - 9 3/12/2012 2.09 2.10 1.91 1.76 2.01
71
Table 2-2. Continued.
CULTIVAR HARVEST SSC pH TA
%
%
PROPRIETARY 1 2011 - 2
0.03 0.01 0.02 CAMAROSA 2011 - 2
0.03 0.01 0.01
FESTIVAL 2011 - 2
0.04 0.00 0.02 MARA DES BOIS 2011 - 2
0.03 0.03 0.02
RADIANCE 2011 - 2
0.05 0.01 0.01 PROPRIETARY 2 2011 - 3
0.03 0.02 0.01
CAMAROSA 2011 - 3
0.05 0.00 0.01 SWEET CHARLIE 2011 - 3
0.05 0.01 0.00
TREASURE 2011 - 3
0.03 0.00 0.01 WINTER DAWN 2011 - 3
0.03 0.00 0.01
PROPRIETARY 3 2011 - 4
0.03 0.00 0.01 CAMINO REAL 2011 - 4
0.03 0.01 0.00
FESTIVAL 2011 - 4
0.03 0.00 0.02 WINTERSTAR 2011 - 5
0.00 0.00 0.01
FESTIVAL 2011 - 5
0.03 0.00 0.00 RADIANCE 2011 - 5
0.04 0.01 0.00
PROPRIETARY 4 2011 - 5
0.04 0.01 0.01 FL 05-85 2011 - 6
0.00 0.00 0.00
ELYANA 2011 - 6
0.03 0.00 0.01 FESTIVAL 2011 - 6
0.03 0.00 0.00
RED MERLIN 2011 - 6
0.09 0.00 0.02 SAN ANDREAS 2011 - 6
0.03 0.00 0.01
ALBION 2011 - 7
0.05 0.00 0.01 CHARLOTTE 2011 - 7
0.04 0.01 0.00
FESTIVAL 2011 - 7
0.06 0.00 0.00 MARA DES BOIS 2011 - 7
0.03 0.00 0.00
MONTERREY 2011 - 7
0.04 0.00 0.01 ALBION 2012 - 1
0.05 0.00 0.02
FESTIVAL 2012 - 1
0.00 0.00 0.01 MOJAVE 2012 - 1
0.03 0.00 0.02
PROPRIETARY 3 2012 - 1
0.05 0.00 0.02 CHANDLER 2012 - 4
0.00 0.01 0.01
FESTIVAL 2012 - 4
0.00 0.00 0.01 FL 09-127 2012 - 4
0.03 0.01 0.01
TREASURE 2012 - 4
0.03 0.00 0.00 WINTER DAWN 2012 - 4
0.03 0.01 0.01
PROPRIETARY 5 2012 - 5
0.03 0.01 0.01 ALBION 2012 - 5
0.05 0.00 0.01
FESTIVAL 2012 - 5
0.09 0.01 0.03 RUBYGEM 2012 - 5
0.03 0.01 0.01
CAMINO REAL 2012 - 6
0.03 0.01 0.02 DARSELECT 2012 - 6
0.03 0.00 0.00
FESTIVAL 2012 - 6
0.00 0.01 0.02 SWEET ANNE 2012 - 6
- - -
BENICIA 2012 - 7
0.03 0.01 0.01 FESTIVAL 2012 - 7
0.00 0.01 0.01
FL 06-38 2012 - 7
0.03 0.01 0.01 PORTOLA 2012 - 7
0.05 0.01 0.00
VENTANA 2012 - 7
0.04 0.01 0.02 PROPRIETARY 6 2012 - 9
0.00 0.00 0.02
EVIE 2 2012 - 9
0.03 0.01 0.00 FESTIVAL 2012 - 9
0.05 0.00 0.00
GALLETA 2012 - 9
0.03 0.00 0.01 SWEET ANNE 2012 - 9 0.00 0.00 0.00
72
Table 2-2. Continued.
CULTIVAR HARVEST MALIC ACID
CITRIC ACID
TOTAL SUGAR
GLUCOSE FRUCTOSE SUCROSE
mg
1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
mg1 100gFW
-
1
6915-15-7 77-92-9 50-99-7 57-48-7 57-50-1
PROPRIETARY 1 2011 - 2 2.01 11.48
15.33 5.94 39.17 CAMAROSA 2011 - 2 2.01 9.84
14.87 19.40 18.14
FESTIVAL 2011 - 2 2.01 3.28
15.60 14.09 20.36 MARA DES BOIS 2011 - 2 4.42 11.48
12.19 12.34 23.51
RADIANCE 2011 - 2 1.41 9.84
26.40 6.17 77.84 PROPRIETARY 2 2011 - 3 2.21 14.75
46.71 32.92 84.59
CAMAROSA 2011 - 3 1.01 32.79
20.31 24.69 52.04 SWEET CHARLIE 2011 - 3 0.20 1.64
39.28 12.61 15.57
TREASURE 2011 - 3 4.83 0.00
14.33 8.42 39.49 WINTER DAWN 2011 - 3 0.80 11.48
26.40 47.32 40.15
PROPRIETARY 3 2011 - 4 1.81 11.48
28.44 55.55 88.63 CAMINO REAL 2011 - 4 2.82 13.11
8.48 8.81 15.41
FESTIVAL 2011 - 4 0.40 16.39
16.90 16.02 17.58 WINTERSTAR 2011 - 5 3.42 0.00
16.36 26.99 24.61
FESTIVAL 2011 - 5 1.61 18.03
14.48 12.99 24.33 RADIANCE 2011 - 5 11.26 11.48
8.12 10.29 22.15
PROPRIETARY 4 2011 - 5 0.40 1.64
11.77 17.87 40.84 FL 05-85 2011 - 6 2.21 24.59
12.04 4.95 15.85
ELYANA 2011 - 6 2.01 13.11
14.14 16.63 28.02 FESTIVAL 2011 - 6 4.42 6.56
5.42 9.89 16.25
RED MERLIN 2011 - 6 3.02 6.56
8.46 14.84 26.77 SAN ANDREAS 2011 - 6 1.81 3.28
2.71 23.44 47.36
ALBION 2011 - 7 5.23 8.20
8.46 12.19 26.10 CHARLOTTE 2011 - 7 4.62 4.92
21.02 6.29 11.14
FESTIVAL 2011 - 7 1.61 21.31
10.16 14.40 16.32 MARA DES BOIS 2011 - 7 0.40 37.70
21.84 6.40 14.74
MONTERREY 2011 - 7 9.05 4.92
16.25 10.29 5.76 ALBION 2012 - 1 0.60 6.56
16.25 2.06 42.72
FESTIVAL 2012 - 1 2.21 1.64
2.03 18.52 28.68 MOJAVE 2012 - 1 1.01 6.56
7.95 22.69 24.65
PROPRIETARY 3 2012 - 1 1.41 1.64
14.22 14.40 39.84 CHANDLER 2012 - 4 1.61 4.92
26.40 10.29 11.44
FESTIVAL 2012 - 4 1.01 0.00
10.55 18.63 8.47 FL 09-127 2012 - 4 2.61 8.20
14.22 4.11 8.91
TREASURE 2012 - 4 0.80 0.00
2.03 4.11 22.04 WINTER DAWN 2012 - 4 2.41 4.92
16.25 12.34 4.99
PROPRIETARY 5 2012 - 5 2.01 4.92
10.16 8.23 17.43 ALBION 2012 - 5 0.20 3.28
4.98 9.26 24.58
FESTIVAL 2012 - 5 0.40 16.39
16.25 20.57 18.47 RUBYGEM 2012 - 5 0.20 4.92
16.25 24.69 19.65
CAMINO REAL 2012 - 6 1.21 6.56
21.75 37.05 37.73 DARSELECT 2012 - 6 0.80 0.00
36.56 41.15 48.27
FESTIVAL 2012 - 6 0.80 13.11
21.65 23.55 41.73 SWEET ANNE 2012 - 6 1.41 18.03
2.03 6.17 37.10
BENICIA 2012 - 7 0.20 11.48
19.20 39.30 50.27 FESTIVAL 2012 - 7 0.60 13.11
8.12 30.86 28.89
FL 06-38 2012 - 7 1.61 0.00
22.15 28.92 62.91 PORTOLA 2012 - 7 1.41 6.56
30.47 37.03 15.98
VENTANA 2012 - 7 0.60 8.20
4.06 10.29 14.34 PROPRIETARY 6 2012 - 9 1.61 4.92
14.22 14.40 35.01
EVIE 2 2012 - 9 0.00 4.92
13.78 31.31 44.14 FESTIVAL 2012 - 9 0.00 4.92
8.85 19.11 27.48
GALLETA 2012 - 9 1.61 6.56
10.87 18.51 17.54 SWEET ANNE 2012 - 9 3.42 8.20 10.16 6.17 10.39
73
Table 2-2. Continued.
CULTIVAR HARVEST TOTAL
VOLATILES 75-85-4 616-25-1 1629-58-9 96-22-0 110-62-3
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2
1.62 2.34 13.73 9.56 0.88 CAMAROSA 2011 - 2
1.47 3.28 26.53 1.93 1.17
FESTIVAL 2011 - 2
1.21 3.20 8.34 6.83 5.42 MARA DES BOIS 2011 - 2
2.00 3.75 36.97 1.74 0.08
RADIANCE 2011 - 2
1.58 0.88 27.43 4.42 0.97 PROPRIETARY 2 2011 - 3
1.01 1.67 2.22 2.27 0.19
CAMAROSA 2011 - 3
1.03 0.35 22.50 3.10 1.55 SWEET CHARLIE 2011 - 3
0.54 3.64 46.05 7.66 0.39
TREASURE 2011 - 3
3.08 1.01 20.20 5.10 0.06 WINTER DAWN 2011 - 3
1.29 0.52 3.00 2.11 0.62
PROPRIETARY 3 2011 - 4
3.12 3.46 11.53 10.37 0.24 CAMINO REAL 2011 - 4
3.05 0.30 2.21 0.25 0.11
FESTIVAL 2011 - 4
3.82 1.06 4.86 1.37 2.93 WINTERSTAR 2011 - 5
0.40 0.95 3.59 2.78 0.48
FESTIVAL 2011 - 5
1.22 0.54 0.98 2.04 1.15 RADIANCE 2011 - 5
0.55 1.22 2.93 2.62 0.83
PROPRIETARY 4 2011 - 5
0.47 1.57 13.28 4.58 0.16 FL 05-85 2011 - 6
0.69 1.04 2.32 2.12 0.92
ELYANA 2011 - 6
1.37 0.35 1.82 0.32 5.86 FESTIVAL 2011 - 6
0.92 1.50 4.05 1.57 3.07
RED MERLIN 2011 - 6
1.44 3.76 5.51 5.16 0.56 SAN ANDREAS 2011 - 6
0.70 1.17 4.75 1.13 1.10
ALBION 2011 - 7
0.24 0.84 1.51 1.29 0.04 CHARLOTTE 2011 - 7
1.13 2.82 0.93 1.78 0.14
FESTIVAL 2011 - 7
0.64 1.35 4.74 2.33 1.41 MARA DES BOIS 2011 - 7
1.00 0.72 0.91 0.61 0.64
MONTERREY 2011 - 7
1.71 1.64 6.49 3.07 0.22 ALBION 2012 - 1
0.19 2.13 16.94 5.22 0.17
FESTIVAL 2012 - 1
1.88 2.57 6.93 1.64 2.26 MOJAVE 2012 - 1
1.00 1.32 0.53 0.38 0.70
PROPRIETARY 3 2012 - 1
3.25 2.04 19.56 4.96 0.25 CHANDLER 2012 - 4
0.00 0.00 1.92 4.43 0.00
FESTIVAL 2012 - 4
0.55 0.25 7.89 2.29 2.73 FL 09-127 2012 - 4
0.49 1.41 19.82 5.36 0.63
TREASURE 2012 - 4
2.51 0.30 4.07 1.39 0.13 WINTER DAWN 2012 - 4
2.58 0.35 0.09 1.82 0.77
PROPRIETARY 5 2012 - 5
0.52 0.66 12.41 0.51 0.03 ALBION 2012 - 5
0.21 1.69 19.45 5.14 0.34
FESTIVAL 2012 - 5
0.37 1.75 16.31 6.48 3.33 RUBYGEM 2012 - 5
0.51 0.08 3.28 1.37 0.49
CAMINO REAL 2012 - 6
1.16 0.48 7.89 3.69 0.14 DARSELECT 2012 - 6
1.21 1.89 12.39 6.51 2.01
FESTIVAL 2012 - 6
0.81 2.31 22.55 3.47 4.49 SWEET ANNE 2012 - 6
0.92 0.44 4.35 1.55 0.09
BENICIA 2012 - 7
1.45 0.66 5.16 1.75 0.06 FESTIVAL 2012 - 7
0.38 2.16 11.94 3.80 3.17
FL 06-38 2012 - 7
0.45 0.38 8.69 1.90 1.72 PORTOLA 2012 - 7
0.74 0.21 7.90 3.19 0.21
VENTANA 2012 - 7
0.71 0.41 3.55 0.33 0.82 PROPRIETARY 6 2012 - 9
1.15 0.38 5.07 1.48 0.03
EVIE 2 2012 - 9
1.50 0.63 0.82 0.93 0.26 FESTIVAL 2012 - 9
1.68 2.17 21.16 7.33 2.75
GALLETA 2012 - 9
1.43 0.22 5.87 0.84 0.11 SWEET ANNE 2012 - 9 1.16 1.63 16.82 5.50 0.29
74
Table 2-2. Continued.
CULTIVAR HARVEST 1534-08-3 105-37-3 109-60-4 623-42-7 591-78-6 108-10-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.01 0.20 0.17 369.92 0.61 0.00 CAMAROSA 2011 - 2 0.14 0.63 0.55 386.20 1.45 0.00 FESTIVAL 2011 - 2 0.14 3.27 0.33 344.43 1.86 0.00
MARA DES BOIS 2011 - 2 0.01 0.52 0.28 127.52 0.85 0.00 RADIANCE 2011 - 2 0.08 0.28 0.23 57.50 0.20 0.00
PROPRIETARY 2 2011 - 3 0.01 0.15 0.33 465.89 4.76 0.00 CAMAROSA 2011 - 3 0.35 0.53 0.28 190.03 0.52 0.00
SWEET CHARLIE 2011 - 3 0.10 0.36 0.18 194.00 1.62 0.00 TREASURE 2011 - 3 0.14 0.08 0.13 112.55 1.43 0.00
WINTER DAWN 2011 - 3 0.04 0.05 0.07 50.54 0.89 0.00 PROPRIETARY 3 2011 - 4 0.13 2.59 1.51 518.04 1.44 0.00
CAMINO REAL 2011 - 4 0.00 0.21 0.17 92.89 0.28 0.00 FESTIVAL 2011 - 4 0.02 2.13 0.08 187.66 0.15 0.00
WINTERSTAR 2011 - 5 0.00 1.19 0.59 201.14 0.67 0.00 FESTIVAL 2011 - 5 0.00 0.64 0.22 354.33 0.26 0.00 RADIANCE 2011 - 5 0.00 0.80 0.65 142.67 0.91 0.00
PROPRIETARY 4 2011 - 5 0.13 0.55 0.06 441.51 3.63 0.00 FL 05-85 2011 - 6 0.02 0.11 0.19 293.84 0.17 0.00 ELYANA 2011 - 6 0.15 0.12 0.08 127.47 0.32 0.00
FESTIVAL 2011 - 6 0.06 1.84 0.25 501.85 0.63 0.00 RED MERLIN 2011 - 6 0.11 0.25 0.25 171.57 0.14 0.00
SAN ANDREAS 2011 - 6 0.02 0.53 0.26 255.08 0.21 0.00 ALBION 2011 - 7 0.13 0.16 0.22 206.13 0.20 0.00
CHARLOTTE 2011 - 7 0.17 0.20 0.06 107.74 0.20 0.00 FESTIVAL 2011 - 7 0.08 2.00 0.35 231.55 0.14 0.00
MARA DES BOIS 2011 - 7 0.03 3.38 0.54 241.50 0.09 0.00 MONTERREY 2011 - 7 0.11 0.86 0.63 228.15 0.32 0.00
ALBION 2012 - 1 0.05 0.12 0.12 245.82 0.78 0.00 FESTIVAL 2012 - 1 0.02 0.24 0.13 84.45 1.45 0.00 MOJAVE 2012 - 1 0.01 0.28 0.17 86.81 0.51 1.55
PROPRIETARY 3 2012 - 1 0.04 0.67 0.37 177.15 2.70 0.00 CHANDLER 2012 - 4 0.00 1.96 1.33 237.43 3.07 0.00 FESTIVAL 2012 - 4 0.28 4.92 0.38 96.01 0.31 0.79 FL 09-127 2012 - 4 0.12 1.57 0.83 414.77 1.97 1.58
TREASURE 2012 - 4 0.06 0.70 0.34 145.97 0.48 0.31 WINTER DAWN 2012 - 4 0.01 0.35 0.49 92.18 0.09 1.27
PROPRIETARY 5 2012 - 5 0.07 0.60 0.20 62.03 0.12 0.00 ALBION 2012 - 5 0.02 1.22 1.29 401.75 2.72 1.53
FESTIVAL 2012 - 5 0.01 1.72 0.56 360.35 0.45 1.56 RUBYGEM 2012 - 5 0.02 0.29 0.48 42.94 0.09 0.39
CAMINO REAL 2012 - 6 0.01 0.51 0.34 188.61 0.55 1.23 DARSELECT 2012 - 6 0.03 1.73 0.93 233.00 0.89 1.90
FESTIVAL 2012 - 6 0.04 0.63 0.65 371.71 1.38 1.68 SWEET ANNE 2012 - 6 0.02 0.12 0.10 71.88 1.16 0.00
BENICIA 2012 - 7 0.01 0.16 0.16 8.43 1.15 0.00 FESTIVAL 2012 - 7 0.06 1.82 0.41 650.70 1.03 0.75 FL 06-38 2012 - 7 0.05 1.86 0.53 171.42 0.52 0.57
PORTOLA 2012 - 7 0.06 0.14 0.07 42.50 0.53 0.00 VENTANA 2012 - 7 0.02 0.13 0.22 49.17 0.55 0.00
PROPRIETARY 6 2012 - 9 0.01 0.92 0.23 329.22 0.43 0.29 EVIE 2 2012 - 9 0.01 0.15 0.30 30.99 0.15 0.00
FESTIVAL 2012 - 9 0.10 4.01 1.32 854.75 1.34 2.63 GALLETA 2012 - 9 0.04 0.07 0.15 34.27 0.69 0.55
SWEET ANNE 2012 - 9 0.00 0.51 0.68 376.54 3.04 0.00
75
Table 2-2. Continued.
CULTIVAR HARVEST 1576-87-0 1576-86-9 623-43-8 71-41-0 1576-95-0 556-24-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 2.01 1.23 0.14 0.00 0.16 7.03 CAMAROSA 2011 - 2 2.81 4.32 0.67 0.00 1.53 9.01 FESTIVAL 2011 - 2 5.40 6.19 0.08 1.84 0.55 6.93
MARA DES BOIS 2011 - 2 1.51 2.29 0.17 0.42 0.39 0.77 RADIANCE 2011 - 2 2.15 1.12 0.13 0.00 0.20 0.17
PROPRIETARY 2 2011 - 3 5.28 4.55 0.33 0.00 0.81 15.14 CAMAROSA 2011 - 3 4.66 4.76 0.09 0.14 1.53 3.01
SWEET CHARLIE 2011 - 3 6.23 8.03 0.28 0.00 0.00 11.34 TREASURE 2011 - 3 6.02 7.03 0.25 0.00 0.32 2.17
WINTER DAWN 2011 - 3 7.29 5.47 0.25 0.46 1.57 3.09 PROPRIETARY 3 2011 - 4 3.98 7.59 0.34 0.15 0.12 42.17
CAMINO REAL 2011 - 4 0.02 0.57 0.02 0.10 0.98 0.63 FESTIVAL 2011 - 4 0.87 0.29 0.03 0.08 0.63 1.93
WINTERSTAR 2011 - 5 3.21 1.92 0.21 0.00 0.00 16.54 FESTIVAL 2011 - 5 0.35 0.21 0.08 0.00 0.14 1.77 RADIANCE 2011 - 5 5.68 2.17 1.02 0.37 0.09 1.54
PROPRIETARY 4 2011 - 5 3.62 5.03 0.14 0.11 0.20 5.89 FL 05-85 2011 - 6 0.32 1.18 0.08 0.00 0.00 1.32 ELYANA 2011 - 6 1.72 0.77 0.09 0.00 0.13 2.68
FESTIVAL 2011 - 6 1.33 1.65 0.03 0.00 0.32 5.05 RED MERLIN 2011 - 6 2.07 2.76 0.08 0.00 0.18 0.68
SAN ANDREAS 2011 - 6 1.01 1.53 0.04 0.00 0.14 1.40 ALBION 2011 - 7 0.33 0.59 0.29 0.18 0.00 5.04
CHARLOTTE 2011 - 7 0.55 0.86 0.03 0.33 0.00 10.14 FESTIVAL 2011 - 7 1.38 1.50 0.10 0.00 0.00 1.85
MARA DES BOIS 2011 - 7 0.20 0.38 0.55 0.00 0.00 2.01 MONTERREY 2011 - 7 0.97 1.34 0.55 0.23 0.00 4.18
ALBION 2012 - 1 2.48 2.36 0.42 0.27 0.00 5.28 FESTIVAL 2012 - 1 0.98 1.09 1.19 0.53 1.88 0.10 MOJAVE 2012 - 1 1.27 1.21 0.04 0.05 1.07 1.36
PROPRIETARY 3 2012 - 1 5.40 7.18 0.35 0.27 0.50 13.18 CHANDLER 2012 - 4 1.80 3.86 0.79 0.61 0.00 8.28 FESTIVAL 2012 - 4 1.11 1.28 0.13 0.25 0.39 0.36 FL 09-127 2012 - 4 4.93 2.60 0.54 0.00 1.65 5.85
TREASURE 2012 - 4 1.64 0.66 0.02 0.00 0.51 3.25 WINTER DAWN 2012 - 4 2.34 0.59 0.06 0.00 1.09 0.40
PROPRIETARY 5 2012 - 5 0.24 0.32 0.29 0.35 0.08 5.29 ALBION 2012 - 5 5.37 5.00 0.65 0.08 0.00 3.61
FESTIVAL 2012 - 5 3.87 3.66 0.16 0.15 0.47 1.50 RUBYGEM 2012 - 5 1.05 0.68 0.14 0.04 0.67 0.20
CAMINO REAL 2012 - 6 4.57 2.25 0.21 0.38 2.42 0.58 DARSELECT 2012 - 6 3.84 3.60 0.14 0.24 0.00 8.99
FESTIVAL 2012 - 6 5.58 4.97 0.22 0.13 1.71 1.90 SWEET ANNE 2012 - 6 0.84 1.53 0.12 0.51 0.19 1.60
BENICIA 2012 - 7 1.82 2.40 0.16 0.21 0.41 0.27 FESTIVAL 2012 - 7 3.19 2.93 0.16 0.33 0.20 2.10 FL 06-38 2012 - 7 1.02 1.40 0.04 0.77 0.16 2.97
PORTOLA 2012 - 7 0.25 0.35 0.21 0.58 0.57 1.45 VENTANA 2012 - 7 0.59 1.34 0.18 0.64 0.74 3.49
PROPRIETARY 6 2012 - 9 0.45 0.44 0.41 0.21 0.27 5.50 EVIE 2 2012 - 9 0.09 0.51 0.14 0.15 0.53 2.62
FESTIVAL 2012 - 9 4.73 5.05 0.41 0.59 1.64 7.97 GALLETA 2012 - 9 0.63 1.09 0.06 0.02 1.83 0.67
SWEET ANNE 2012 - 9 2.63 3.71 0.18 0.12 0.35 7.81
76
Table 2-2. Continued.
CULTIVAR HARVEST 589-38-8 105-54-4 66-25-1 123-86-4 624-24-8 29674-47-3
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.07 2.11 102.64 1.56 0.57 0.14 CAMAROSA 2011 - 2 0.13 24.34 4164.45 15.62 0.38 0.33 FESTIVAL 2011 - 2 0.43 4.95 494.68 10.18 1.38 0.66
MARA DES BOIS 2011 - 2 0.10 4.01 155.67 7.12 0.22 0.08 RADIANCE 2011 - 2 0.13 4.50 42.08 1.21 0.16 0.19
PROPRIETARY 2 2011 - 3 0.24 5.31 95.52 8.96 0.30 2.22 CAMAROSA 2011 - 3 0.20 7.94 36.10 2.28 0.07 0.29
SWEET CHARLIE 2011 - 3 0.38 7.46 257.72 3.17 0.58 0.15 TREASURE 2011 - 3 0.11 1.69 264.44 6.98 0.02 0.10
WINTER DAWN 2011 - 3 0.16 1.58 178.57 3.42 0.58 0.68 PROPRIETARY 3 2011 - 4 0.40 6.47 433.70 7.00 0.60 0.25
CAMINO REAL 2011 - 4 0.19 1.60 32.97 0.55 0.06 0.32 FESTIVAL 2011 - 4 0.19 2.47 8436.52 2.03 0.73 0.28
WINTERSTAR 2011 - 5 0.31 3.29 202.10 4.51 0.69 0.26 FESTIVAL 2011 - 5 0.07 6.11 116.74 1.55 0.79 0.16 RADIANCE 2011 - 5 0.25 7.42 215.95 1.73 0.74 0.26
PROPRIETARY 4 2011 - 5 0.28 7.41 138.27 6.00 0.46 0.48 FL 05-85 2011 - 6 0.25 3.78 125.54 1.86 0.39 0.24 ELYANA 2011 - 6 0.13 0.75 44.55 7.30 0.45 0.24
FESTIVAL 2011 - 6 0.07 1.79 393.73 3.09 2.05 0.24 RED MERLIN 2011 - 6 0.29 6.56 102.96 0.67 0.37 0.23
SAN ANDREAS 2011 - 6 0.10 1.30 261.61 7.71 0.38 0.60 ALBION 2011 - 7 0.08 4.30 97.95 2.77 0.15 0.71
CHARLOTTE 2011 - 7 0.08 1.46 34.54 0.87 0.08 0.41 FESTIVAL 2011 - 7 0.11 3.65 131.35 0.64 0.83 0.07
MARA DES BOIS 2011 - 7 0.08 2.30 667.84 7.42 0.42 0.08 MONTERREY 2011 - 7 0.13 4.18 117.92 14.94 0.15 0.19
ALBION 2012 - 1 0.21 2.06 233.23 29.42 0.31 0.79 FESTIVAL 2012 - 1 0.01 1.21 70.34 1.16 0.25 0.43 MOJAVE 2012 - 1 0.29 4.06 104.11 9.42 0.33 0.29
PROPRIETARY 3 2012 - 1 0.40 6.42 197.10 1.56 0.69 0.51 CHANDLER 2012 - 4 0.00 1.36 164.21 13.70 1.39 0.14 FESTIVAL 2012 - 4 0.12 1.43 105.20 1.79 0.28 0.38 FL 09-127 2012 - 4 0.22 2.67 394.51 18.08 0.83 0.07
TREASURE 2012 - 4 0.27 3.92 187.47 5.56 0.11 0.16 WINTER DAWN 2012 - 4 0.15 1.19 5375.04 0.41 0.11 0.22
PROPRIETARY 5 2012 - 5 0.17 1.84 102.93 0.54 0.14 0.08 ALBION 2012 - 5 0.62 1.63 510.40 38.49 0.38 0.91
FESTIVAL 2012 - 5 0.57 2.82 326.20 8.22 1.40 1.90 RUBYGEM 2012 - 5 0.07 2.30 66.96 2.53 0.13 0.09
CAMINO REAL 2012 - 6 0.25 2.88 115.46 17.76 0.34 0.67 DARSELECT 2012 - 6 0.40 0.95 153.22 9.16 0.76 0.20
FESTIVAL 2012 - 6 0.56 2.57 284.38 4.58 1.25 1.20 SWEET ANNE 2012 - 6 0.20 2.87 83.60 1.05 0.09 0.07
BENICIA 2012 - 7 0.07 2.22 41.00 0.49 0.19 0.26 FESTIVAL 2012 - 7 0.31 3.83 269.03 3.32 2.35 1.47 FL 06-38 2012 - 7 0.08 1.75 252.12 5.42 0.59 0.19
PORTOLA 2012 - 7 0.16 2.70 21.76 0.36 0.14 0.03 VENTANA 2012 - 7 0.36 2.62 46.33 0.59 0.15 0.20
PROPRIETARY 6 2012 - 9 0.09 0.90 166.64 1.86 0.69 0.66 EVIE 2 2012 - 9 0.31 2.33 56.49 2.30 0.16 0.08
FESTIVAL 2012 - 9 0.77 4.01 447.52 4.44 4.73 1.99 GALLETA 2012 - 9 0.34 3.36 58.88 1.40 0.05 0.19
SWEET ANNE 2012 - 9 0.44 4.25 294.99 3.22 0.16 0.27
77
Table 2-2. Continued.
CULTIVAR HARVEST 96-04-8 638-11-9 116-53-0 7452-79-1 6728-26-3 928-95-0
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.50 4.29 0.79 6.21 101.07 20.79 CAMAROSA 2011 - 2 0.10 3.54 15.48 14.86 1170.41 10.15 FESTIVAL 2011 - 2 0.50 19.69 7.33 14.89 1283.53 6.74
MARA DES BOIS 2011 - 2 0.04 0.70 3.27 3.30 527.75 26.88 RADIANCE 2011 - 2 0.28 1.61 1.74 2.57 217.87 1.87
PROPRIETARY 2 2011 - 3 3.44 0.30 0.69 6.53 655.72 1.87 CAMAROSA 2011 - 3 0.40 2.07 4.33 9.22 1075.55 21.54
SWEET CHARLIE 2011 - 3 1.26 1.44 12.44 10.87 1256.85 0.46 TREASURE 2011 - 3 0.54 5.90 3.71 5.87 990.69 3.37
WINTER DAWN 2011 - 3 0.00 7.75 1.30 9.80 1159.98 15.51 PROPRIETARY 3 2011 - 4 0.26 8.22 4.96 8.80 1122.30 4.08
CAMINO REAL 2011 - 4 0.02 0.40 2.87 2.73 306.18 5.36 FESTIVAL 2011 - 4 0.19 3.58 1.20 11.45 623.92 2.02
WINTERSTAR 2011 - 5 0.34 3.87 10.36 19.03 660.94 12.69 FESTIVAL 2011 - 5 0.17 4.09 1.92 2.17 147.31 6.13 RADIANCE 2011 - 5 0.22 4.74 5.58 168.45 1190.44 3.31
PROPRIETARY 4 2011 - 5 0.81 5.90 3.71 5.42 602.04 8.15 FL 05-85 2011 - 6 0.14 6.53 7.30 9.37 148.67 17.38 ELYANA 2011 - 6 0.26 2.17 3.56 5.92 340.10 0.00
FESTIVAL 2011 - 6 0.19 21.38 1.76 8.06 834.90 3.17 RED MERLIN 2011 - 6 0.24 2.98 2.73 5.23 751.42 30.71
SAN ANDREAS 2011 - 6 0.09 19.09 4.20 4.37 632.27 9.91 ALBION 2011 - 7 0.00 6.16 0.13 5.41 228.27 1.38
CHARLOTTE 2011 - 7 0.00 0.71 0.12 7.99 234.64 4.75 FESTIVAL 2011 - 7 0.00 4.11 6.69 2.81 436.15 1.04
MARA DES BOIS 2011 - 7 0.00 2.37 1.97 7.26 497.38 4.60 MONTERREY 2011 - 7 0.21 10.81 2.53 3.99 450.88 1.02
ALBION 2012 - 1 0.00 16.93 0.00 3.69 650.04 11.54 FESTIVAL 2012 - 1 0.00 5.39 17.28 3.17 127.96 3.73 MOJAVE 2012 - 1 0.15 5.21 0.00 1.84 317.88 1.99
PROPRIETARY 3 2012 - 1 0.34 0.28 0.00 7.11 1179.97 3.78 CHANDLER 2012 - 4 4.63 1.95 0.00 2.05 313.98 20.83 FESTIVAL 2012 - 4 0.11 2.10 1.81 0.38 42.93 3.84 FL 09-127 2012 - 4 0.08 13.43 5.47 4.88 710.27 34.69
TREASURE 2012 - 4 0.27 11.15 2.21 0.73 95.16 5.66 WINTER DAWN 2012 - 4 0.13 0.88 6.59 1.52 135.60 3.73
PROPRIETARY 5 2012 - 5 0.05 0.40 0.08 1.12 349.91 10.61 ALBION 2012 - 5 0.22 16.96 0.86 3.83 689.14 4.11
FESTIVAL 2012 - 5 0.34 12.14 0.00 3.52 1076.46 13.33 RUBYGEM 2012 - 5 0.13 0.42 1.96 0.94 242.88 7.92
CAMINO REAL 2012 - 6 0.06 5.84 5.38 2.78 655.05 26.22 DARSELECT 2012 - 6 0.47 5.62 3.79 2.10 503.36 25.46
FESTIVAL 2012 - 6 0.38 7.79 10.60 4.25 1053.76 13.59 SWEET ANNE 2012 - 6 0.08 2.70 0.00 1.25 233.43 11.00
BENICIA 2012 - 7 0.43 0.28 0.00 1.37 267.55 6.88 FESTIVAL 2012 - 7 0.16 11.52 8.80 1.86 547.27 9.69 FL 06-38 2012 - 7 0.13 8.51 9.22 3.04 401.75 2.81
PORTOLA 2012 - 7 0.08 4.07 4.52 1.03 81.71 5.48 VENTANA 2012 - 7 0.09 3.21 5.37 1.88 441.57 5.31
PROPRIETARY 6 2012 - 9 0.09 4.22 0.44 1.39 248.46 4.86 EVIE 2 2012 - 9 0.07 0.24 0.05 1.34 264.88 4.06
FESTIVAL 2012 - 9 0.42 24.96 13.69 6.15 1257.51 11.57 GALLETA 2012 - 9 0.11 1.60 2.54 2.11 321.16 10.08
SWEET ANNE 2012 - 9 0.34 12.62 0.00 5.93 1215.64 10.31
78
Table 2-2. Continued.
CULTIVAR HARVEST 111-27-3 123-92-2 624-41-9 110-43-0 2432-51-1 105-66-8
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 1.27 1.27 3.64 1.22 0.58 0.07 CAMAROSA 2011 - 2 2.13 2.77 5.73 1.31 0.39 0.57 FESTIVAL 2011 - 2 1.04 0.51 0.44 3.63 3.54 2.14
MARA DES BOIS 2011 - 2 5.17 0.04 0.25 1.02 0.16 0.52 RADIANCE 2011 - 2 1.56 2.69 0.56 0.46 0.03 0.08
PROPRIETARY 2 2011 - 3 0.96 2.28 0.28 2.20 0.19 0.64 CAMAROSA 2011 - 3 2.18 0.65 0.88 1.98 0.26 1.73
SWEET CHARLIE 2011 - 3 1.97 1.09 0.62 12.81 0.00 0.30 TREASURE 2011 - 3 1.48 0.59 0.53 2.91 0.00 0.39
WINTER DAWN 2011 - 3 1.97 0.67 0.58 0.98 0.35 0.82 PROPRIETARY 3 2011 - 4 0.66 17.25 12.27 1.64 1.00 0.54
CAMINO REAL 2011 - 4 0.92 0.85 0.96 0.84 0.00 0.13 FESTIVAL 2011 - 4 2.02 0.31 0.65 1.20 0.61 0.43
WINTERSTAR 2011 - 5 1.47 1.23 2.20 0.97 0.00 1.06 FESTIVAL 2011 - 5 1.51 1.01 1.34 0.69 0.19 0.35 RADIANCE 2011 - 5 6.31 1.31 1.98 1.36 0.15 0.63
PROPRIETARY 4 2011 - 5 3.64 0.40 0.22 0.73 0.00 0.11 FL 05-85 2011 - 6 1.90 0.52 0.00 0.70 0.11 0.27 ELYANA 2011 - 6 1.14 0.80 0.23 1.15 0.21 0.24
FESTIVAL 2011 - 6 0.85 2.18 0.00 5.05 0.00 1.09 RED MERLIN 2011 - 6 9.82 0.28 2.80 0.60 0.00 0.00
SAN ANDREAS 2011 - 6 1.38 1.22 2.88 1.68 0.26 1.23 ALBION 2011 - 7 6.29 0.90 1.09 0.44 0.22 0.09
CHARLOTTE 2011 - 7 7.38 1.32 0.63 0.00 0.34 0.00 FESTIVAL 2011 - 7 2.41 0.61 1.20 0.91 0.30 0.08
MARA DES BOIS 2011 - 7 7.62 1.18 0.85 0.58 0.30 0.79 MONTERREY 2011 - 7 3.02 1.00 6.17 0.57 0.19 0.37
ALBION 2012 - 1 7.90 0.24 0.38 1.43 0.06 0.25 FESTIVAL 2012 - 1 11.74 1.45 0.39 0.13 0.59 0.56 MOJAVE 2012 - 1 3.79 0.75 0.57 0.81 0.04 0.31
PROPRIETARY 3 2012 - 1 1.55 3.54 2.10 1.74 0.38 0.00 CHANDLER 2012 - 4 92.26 12.81 8.18 1.96 0.00 1.08 FESTIVAL 2012 - 4 3.00 2.17 0.93 2.58 0.80 0.42 FL 09-127 2012 - 4 24.55 5.13 5.15 12.01 1.01 2.96
TREASURE 2012 - 4 3.96 1.77 1.36 1.11 0.32 0.35 WINTER DAWN 2012 - 4 1.85 1.17 0.73 6.43 0.07 0.13
PROPRIETARY 5 2012 - 5 2.13 2.32 0.39 0.67 0.12 0.13 ALBION 2012 - 5 6.79 4.91 2.27 3.83 0.47 2.34
FESTIVAL 2012 - 5 2.69 4.71 4.58 3.27 2.19 2.24 RUBYGEM 2012 - 5 3.44 0.89 0.61 1.70 0.12 0.50
CAMINO REAL 2012 - 6 24.49 2.35 1.36 5.87 4.68 2.15 DARSELECT 2012 - 6 22.34 6.46 1.80 6.52 2.43 1.70
FESTIVAL 2012 - 6 0.92 0.27 1.51 2.58 2.82 0.63 SWEET ANNE 2012 - 6 18.39 1.96 2.62 0.42 0.58 0.04
BENICIA 2012 - 7 12.14 0.25 1.05 1.29 0.18 0.25 FESTIVAL 2012 - 7 1.46 0.93 1.23 1.92 3.33 1.07 FL 06-38 2012 - 7 2.86 2.08 1.51 2.27 0.71 0.95
PORTOLA 2012 - 7 12.33 1.25 0.52 0.30 0.12 0.14 VENTANA 2012 - 7 11.94 1.46 0.31 1.28 0.24 0.19
PROPRIETARY 6 2012 - 9 0.60 0.57 0.47 0.38 0.06 0.34 EVIE 2 2012 - 9 1.55 2.43 1.31 0.44 0.19 0.07
FESTIVAL 2012 - 9 5.30 2.59 3.53 4.07 4.60 2.31 GALLETA 2012 - 9 1.42 0.61 0.20 1.64 0.59 0.63
SWEET ANNE 2012 - 9 1.80 7.69 4.50 3.29 0.66 0.35
79
Table 2-2. Continued.
CULTIVAR HARVEST 539-82-2 111-71-7 628-63-7 1191-16-8 106-70-7 55514-48-2
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.00 0.17 0.29 0.92 42.41 0.00 CAMAROSA 2011 - 2 0.25 2.08 0.94 1.34 17.92 0.00 FESTIVAL 2011 - 2 1.25 1.16 1.19 0.19 34.27 0.00
MARA DES BOIS 2011 - 2 0.81 0.43 0.11 0.15 15.09 0.00 RADIANCE 2011 - 2 1.05 0.14 0.23 0.50 5.10 0.00
PROPRIETARY 2 2011 - 3 0.00 1.25 0.56 0.00 14.61 0.03 CAMAROSA 2011 - 3 1.15 1.07 1.74 0.48 4.43 0.06
SWEET CHARLIE 2011 - 3 0.61 1.31 0.41 0.00 35.53 0.14 TREASURE 2011 - 3 1.61 1.01 0.24 0.04 0.94 0.05
WINTER DAWN 2011 - 3 1.27 1.83 0.88 0.00 17.28 0.02 PROPRIETARY 3 2011 - 4 1.15 0.43 1.83 4.17 68.13 0.13
CAMINO REAL 2011 - 4 0.00 0.46 0.64 0.53 12.81 0.15 FESTIVAL 2011 - 4 0.27 0.37 0.51 0.06 28.39 0.19
WINTERSTAR 2011 - 5 0.15 0.00 0.47 0.69 30.98 0.11 FESTIVAL 2011 - 5 0.10 0.33 0.34 0.24 25.65 0.05 RADIANCE 2011 - 5 0.00 0.40 1.02 1.71 24.67 0.06
PROPRIETARY 4 2011 - 5 0.06 0.21 0.61 0.20 19.75 0.08 FL 05-85 2011 - 6 0.00 0.00 0.23 0.12 17.80 0.08 ELYANA 2011 - 6 0.08 0.60 0.51 0.08 5.78 0.05
FESTIVAL 2011 - 6 0.74 1.02 0.98 0.00 67.81 0.18 RED MERLIN 2011 - 6 0.00 0.32 0.76 1.08 19.41 0.17
SAN ANDREAS 2011 - 6 0.53 0.83 0.33 2.10 25.71 0.12 ALBION 2011 - 7 0.49 0.43 0.44 0.53 5.00 0.17
CHARLOTTE 2011 - 7 0.00 0.29 0.57 0.07 0.59 0.27 FESTIVAL 2011 - 7 0.13 0.30 0.56 0.16 10.37 0.39
MARA DES BOIS 2011 - 7 0.25 0.29 0.70 0.31 25.28 0.31 MONTERREY 2011 - 7 0.24 0.42 0.73 1.98 3.45 0.20
ALBION 2012 - 1 0.42 0.85 0.53 0.16 7.90 0.06 FESTIVAL 2012 - 1 0.12 0.13 0.56 0.16 8.95 0.02 MOJAVE 2012 - 1 0.28 0.13 0.24 0.40 9.64 0.01
PROPRIETARY 3 2012 - 1 0.00 0.45 0.50 0.31 45.03 0.00 CHANDLER 2012 - 4 5.16 0.00 0.79 1.59 46.13 0.30 FESTIVAL 2012 - 4 2.81 0.49 0.52 0.24 8.49 0.12 FL 09-127 2012 - 4 3.29 1.71 1.04 1.12 90.60 0.17
TREASURE 2012 - 4 0.44 0.37 0.36 0.17 7.61 0.05 WINTER DAWN 2012 - 4 0.30 0.21 0.42 0.42 4.69 0.23
PROPRIETARY 5 2012 - 5 0.14 0.18 0.29 0.13 12.01 0.12 ALBION 2012 - 5 0.76 1.16 1.33 0.49 27.63 0.22
FESTIVAL 2012 - 5 1.30 1.63 1.67 0.16 59.03 0.27 RUBYGEM 2012 - 5 0.22 0.57 0.26 0.31 5.45 0.02
CAMINO REAL 2012 - 6 1.14 2.39 1.00 0.21 13.25 0.10 DARSELECT 2012 - 6 0.86 1.35 0.87 0.35 89.16 0.20
FESTIVAL 2012 - 6 1.50 0.59 0.30 0.28 46.55 0.08 SWEET ANNE 2012 - 6 0.31 0.22 0.32 0.28 12.04 0.07
BENICIA 2012 - 7 0.34 0.24 0.46 0.03 1.34 0.30 FESTIVAL 2012 - 7 1.15 0.37 0.43 0.25 62.24 0.34 FL 06-38 2012 - 7 0.83 0.66 0.67 0.36 57.18 0.07
PORTOLA 2012 - 7 0.23 0.35 0.41 0.18 6.87 0.12 VENTANA 2012 - 7 0.15 0.28 0.31 0.40 7.87 0.08
PROPRIETARY 6 2012 - 9 0.19 0.19 0.37 0.13 52.33 0.05 EVIE 2 2012 - 9 0.26 0.09 0.12 0.10 6.25 0.08
FESTIVAL 2012 - 9 1.58 1.64 2.31 0.12 93.13 0.00 GALLETA 2012 - 9 0.40 0.68 0.60 0.08 5.32 0.05
SWEET ANNE 2012 - 9 0.29 1.01 0.41 0.46 25.83 0.00
80
Table 2-2. Continued.
CULTIVAR HARVEST 110-93-0 109-21-7 123-66-0 124-13-0 142-92-7 2497-18-9
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.17 0.74 1.19 0.95 4.35 5.48 CAMAROSA 2011 - 2 0.31 4.40 1.30 1.29 3.08 21.55 FESTIVAL 2011 - 2 1.37 24.63 24.02 1.97 8.74 2.72
MARA DES BOIS 2011 - 2 0.14 5.26 7.20 1.50 3.58 3.20 RADIANCE 2011 - 2 0.49 1.13 0.71 0.76 0.39 0.44
PROPRIETARY 2 2011 - 3 0.76 21.67 2.65 1.05 6.61 0.53 CAMAROSA 2011 - 3 0.51 2.75 2.03 0.80 2.76 3.39
SWEET CHARLIE 2011 - 3 1.10 4.29 7.72 1.90 7.85 0.81 TREASURE 2011 - 3 0.21 8.11 1.07 0.48 3.01 0.19
WINTER DAWN 2011 - 3 0.73 1.03 2.80 0.89 4.25 3.21 PROPRIETARY 3 2011 - 4 0.13 0.56 20.18 0.85 3.45 3.36
CAMINO REAL 2011 - 4 0.12 1.86 3.46 0.69 1.87 0.83 FESTIVAL 2011 - 4 0.35 2.89 7.88 0.43 2.57 0.07
WINTERSTAR 2011 - 5 0.14 2.12 12.82 0.41 2.51 5.63 FESTIVAL 2011 - 5 0.12 1.39 4.07 0.21 0.64 0.63 RADIANCE 2011 - 5 0.70 0.90 3.48 0.54 2.08 4.23
PROPRIETARY 4 2011 - 5 0.41 11.14 8.86 0.68 1.48 2.39 FL 05-85 2011 - 6 0.09 0.60 1.69 0.76 2.50 5.99 ELYANA 2011 - 6 0.13 6.82 4.43 0.93 5.69 0.37
FESTIVAL 2011 - 6 0.09 8.17 19.54 1.28 4.70 2.08 RED MERLIN 2011 - 6 0.30 0.00 0.62 0.91 3.33 10.05
SAN ANDREAS 2011 - 6 0.49 3.85 13.44 0.78 3.38 4.37 ALBION 2011 - 7 0.33 1.17 1.07 0.58 1.02 1.09
CHARLOTTE 2011 - 7 0.12 0.43 0.67 0.43 3.27 8.36 FESTIVAL 2011 - 7 0.23 0.23 3.55 0.41 0.67 0.43
MARA DES BOIS 2011 - 7 0.02 4.75 23.84 0.76 3.37 5.57 MONTERREY 2011 - 7 0.09 2.99 1.94 1.13 9.03 13.18
ALBION 2012 - 1 0.23 56.32 3.85 0.44 10.32 0.58 FESTIVAL 2012 - 1 0.04 2.42 8.01 0.30 2.01 0.45 MOJAVE 2012 - 1 0.15 6.48 3.31 0.14 8.90 1.30
PROPRIETARY 3 2012 - 1 0.40 0.00 5.48 0.82 1.65 1.07 CHANDLER 2012 - 4 1.63 4.17 70.50 0.18 13.83 2.34 FESTIVAL 2012 - 4 0.28 2.61 113.08 0.68 12.93 0.41 FL 09-127 2012 - 4 0.52 36.65 79.44 1.55 39.13 0.79
TREASURE 2012 - 4 0.05 4.73 164.53 0.28 6.77 0.32 WINTER DAWN 2012 - 4 0.18 0.64 229.81 1.24 28.93 0.54
PROPRIETARY 5 2012 - 5 0.21 0.00 50.68 0.82 6.18 3.46 ALBION 2012 - 5 0.60 15.13 50.49 1.54 14.86 11.44
FESTIVAL 2012 - 5 0.76 5.05 42.23 1.76 8.00 3.28 RUBYGEM 2012 - 5 0.11 0.48 15.27 0.27 2.23 0.73
CAMINO REAL 2012 - 6 0.24 13.36 14.54 0.95 4.10 2.90 DARSELECT 2012 - 6 0.65 4.65 18.09 2.66 31.01 11.08
FESTIVAL 2012 - 6 0.63 10.28 11.53 1.18 4.04 12.83 SWEET ANNE 2012 - 6 0.53 0.59 45.78 1.15 7.09 23.22
BENICIA 2012 - 7 0.44 0.40 17.72 0.25 0.63 7.70 FESTIVAL 2012 - 7 0.32 8.38 17.22 0.99 4.03 2.91 FL 06-38 2012 - 7 0.38 9.69 91.73 1.03 9.45 1.67
PORTOLA 2012 - 7 0.09 0.36 35.31 0.26 2.68 0.76 VENTANA 2012 - 7 0.03 0.00 3.85 0.27 0.33 1.48
PROPRIETARY 6 2012 - 9 0.05 1.58 20.25 0.17 0.69 0.58 EVIE 2 2012 - 9 0.13 0.81 2.11 0.45 1.41 0.66
FESTIVAL 2012 - 9 0.67 7.79 26.84 1.75 4.03 0.85 GALLETA 2012 - 9 0.13 3.28 10.28 0.36 1.40 1.25
SWEET ANNE 2012 - 9 0.60 1.97 6.43 1.36 1.75 1.24
81
Table 2-2. Continued.
CULTIVAR HARVEST 60415-61-4 104-76-7 2311-46-8 109-19-3 2548-87-0 540-18-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.02 0.44 0.00 0.08 0.19 0.18 CAMAROSA 2011 - 2 0.00 0.46 0.00 0.38 0.14 0.37 FESTIVAL 2011 - 2 0.45 2.54 0.54 0.62 0.75 0.81
MARA DES BOIS 2011 - 2 0.06 0.27 0.33 0.27 0.43 0.27 RADIANCE 2011 - 2 0.14 0.25 0.00 0.53 0.77 0.22
PROPRIETARY 2 2011 - 3 0.26 0.81 0.83 3.10 0.91 1.72 CAMAROSA 2011 - 3 0.03 0.26 0.58 0.58 0.37 0.50
SWEET CHARLIE 2011 - 3 0.10 1.39 0.41 0.42 0.70 0.66 TREASURE 2011 - 3 0.04 0.28 0.00 0.49 0.72 0.37
WINTER DAWN 2011 - 3 0.20 1.01 0.00 0.39 0.60 0.31 PROPRIETARY 3 2011 - 4 0.30 1.23 1.27 0.69 0.69 0.09
CAMINO REAL 2011 - 4 0.00 0.00 0.73 0.00 0.12 0.33 FESTIVAL 2011 - 4 0.00 0.87 0.20 0.00 0.07 0.22
WINTERSTAR 2011 - 5 0.00 0.63 0.00 0.00 0.05 0.23 FESTIVAL 2011 - 5 0.00 0.22 0.00 0.00 0.04 0.16 RADIANCE 2011 - 5 0.00 0.36 0.00 0.00 0.09 0.09
PROPRIETARY 4 2011 - 5 0.21 0.20 1.02 0.60 0.53 1.03 FL 05-85 2011 - 6 0.09 0.39 0.29 0.00 0.15 0.18 ELYANA 2011 - 6 0.03 2.22 0.66 0.91 0.04 0.54
FESTIVAL 2011 - 6 0.08 2.03 0.15 0.00 0.04 0.28 RED MERLIN 2011 - 6 0.12 1.60 0.00 0.00 0.07 0.21
SAN ANDREAS 2011 - 6 0.26 2.54 0.38 0.00 0.08 0.49 ALBION 2011 - 7 0.03 0.52 0.13 0.00 0.23 0.35
CHARLOTTE 2011 - 7 0.06 0.07 0.45 0.00 0.06 0.03 FESTIVAL 2011 - 7 0.05 0.00 0.00 0.00 0.12 0.22
MARA DES BOIS 2011 - 7 0.00 0.27 0.00 0.00 0.06 0.29 MONTERREY 2011 - 7 0.08 0.33 0.21 0.33 0.11 0.04
ALBION 2012 - 1 0.55 0.61 1.07 1.02 0.26 0.98 FESTIVAL 2012 - 1 0.12 0.23 0.41 0.21 0.19 0.34 MOJAVE 2012 - 1 0.26 0.78 0.66 0.19 0.20 0.36
PROPRIETARY 3 2012 - 1 0.19 0.59 0.48 0.23 0.56 0.26 CHANDLER 2012 - 4 0.00 0.77 1.40 0.60 0.00 1.07 FESTIVAL 2012 - 4 0.08 0.12 0.29 0.20 0.22 0.26 FL 09-127 2012 - 4 0.46 3.18 3.09 1.17 0.65 2.03
TREASURE 2012 - 4 0.21 0.37 0.37 0.13 0.27 0.45 WINTER DAWN 2012 - 4 0.13 0.24 0.09 0.32 0.25 0.23
PROPRIETARY 5 2012 - 5 0.24 0.22 0.21 0.12 0.22 0.37 ALBION 2012 - 5 0.56 1.07 1.22 1.39 0.47 0.71
FESTIVAL 2012 - 5 0.37 1.07 1.19 0.33 0.60 0.49 RUBYGEM 2012 - 5 0.09 0.14 0.14 0.19 0.16 0.32
CAMINO REAL 2012 - 6 0.06 0.40 0.68 0.51 0.44 0.80 DARSELECT 2012 - 6 0.12 1.78 1.75 0.92 0.40 1.16
FESTIVAL 2012 - 6 0.26 1.12 1.68 0.21 0.51 0.79 SWEET ANNE 2012 - 6 0.07 0.40 0.22 0.16 0.08 0.22
BENICIA 2012 - 7 0.06 0.14 0.32 0.17 0.22 0.06 FESTIVAL 2012 - 7 0.12 1.46 2.00 0.40 0.35 0.55 FL 06-38 2012 - 7 0.15 1.74 1.95 0.70 0.59 1.16
PORTOLA 2012 - 7 0.06 8.78 0.12 0.06 0.15 0.13 VENTANA 2012 - 7 0.03 0.21 0.04 0.21 0.13 0.20
PROPRIETARY 6 2012 - 9 0.07 0.43 0.89 0.31 0.43 0.46 EVIE 2 2012 - 9 0.02 0.26 0.21 0.22 0.02 0.17
FESTIVAL 2012 - 9 0.45 2.49 2.55 0.63 0.77 1.36 GALLETA 2012 - 9 0.07 0.31 0.42 0.41 0.22 0.48
SWEET ANNE 2012 - 9 0.15 0.97 1.23 0.55 0.57 0.88
82
Table 2-2. Continued.
CULTIVAR HARVEST 4077-47-8 20664-46-4 821-55-6 5989-33-3 78-70-6 124-19-6
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 1.24 1.10 0.30 0.43 5.05 1.58 CAMAROSA 2011 - 2 1.83 1.98 1.01 0.67 6.97 3.82 FESTIVAL 2011 - 2 3.87 6.71 1.24 1.45 13.84 7.92
MARA DES BOIS 2011 - 2 5.64 7.27 0.71 0.45 3.21 0.77 RADIANCE 2011 - 2 2.40 0.85 0.14 0.69 8.26 6.76
PROPRIETARY 2 2011 - 3 4.81 6.21 0.75 0.30 6.31 2.07 CAMAROSA 2011 - 3 2.61 2.91 0.77 0.32 7.51 0.50
SWEET CHARLIE 2011 - 3 5.78 6.26 2.52 1.68 32.80 10.51 TREASURE 2011 - 3 5.22 0.82 0.88 0.19 5.85 2.04
WINTER DAWN 2011 - 3 3.47 2.95 0.70 0.31 9.43 2.27 PROPRIETARY 3 2011 - 4 2.02 5.76 0.00 0.49 16.75 1.36
CAMINO REAL 2011 - 4 0.61 3.14 0.00 0.74 24.74 2.30 FESTIVAL 2011 - 4 1.21 1.70 0.00 0.30 0.78 0.65
WINTERSTAR 2011 - 5 0.41 0.38 0.00 0.04 3.14 0.53 FESTIVAL 2011 - 5 0.24 1.07 0.00 0.41 5.04 0.36 RADIANCE 2011 - 5 0.46 0.99 0.00 0.15 17.25 0.48
PROPRIETARY 4 2011 - 5 0.49 0.63 0.00 0.19 5.62 1.11 FL 05-85 2011 - 6 0.86 1.85 0.00 0.10 4.58 0.78 ELYANA 2011 - 6 1.89 1.81 0.51 0.27 10.60 1.81
FESTIVAL 2011 - 6 0.39 2.23 0.00 0.38 5.85 0.85 RED MERLIN 2011 - 6 0.79 1.03 0.00 0.32 4.69 0.49
SAN ANDREAS 2011 - 6 0.85 5.29 0.00 0.55 17.29 1.18 ALBION 2011 - 7 0.32 1.00 0.00 0.26 6.34 0.43
CHARLOTTE 2011 - 7 1.24 1.97 0.00 0.34 3.50 0.49 FESTIVAL 2011 - 7 0.61 1.74 0.00 0.17 4.46 0.40
MARA DES BOIS 2011 - 7 0.25 1.85 0.00 0.38 2.78 0.22 MONTERREY 2011 - 7 2.48 2.07 0.00 0.19 10.27 0.35
ALBION 2012 - 1 1.63 0.55 0.61 0.73 15.67 0.86 FESTIVAL 2012 - 1 0.23 0.50 0.45 0.24 0.57 0.51 MOJAVE 2012 - 1 0.66 0.69 0.57 0.10 1.90 0.35
PROPRIETARY 3 2012 - 1 1.94 2.68 0.72 1.79 40.69 2.95 CHANDLER 2012 - 4 0.00 1.74 0.00 0.65 5.11 1.43 FESTIVAL 2012 - 4 1.46 0.59 0.00 0.12 0.90 0.18 FL 09-127 2012 - 4 1.04 6.62 24.14 0.99 11.98 1.33
TREASURE 2012 - 4 1.16 0.52 6.32 0.15 1.37 0.19 WINTER DAWN 2012 - 4 0.50 0.07 23.60 0.14 1.05 0.37
PROPRIETARY 5 2012 - 5 0.51 0.16 1.60 0.17 2.51 0.16 ALBION 2012 - 5 2.62 2.30 5.42 1.01 45.20 1.38
FESTIVAL 2012 - 5 2.28 1.63 2.83 0.72 21.82 1.42 RUBYGEM 2012 - 5 0.32 0.21 1.05 0.11 2.04 0.45
CAMINO REAL 2012 - 6 0.75 3.80 2.32 1.08 21.67 1.10 DARSELECT 2012 - 6 4.00 10.28 0.14 0.89 23.49 1.10
FESTIVAL 2012 - 6 2.87 3.52 0.66 1.12 12.24 1.90 SWEET ANNE 2012 - 6 0.36 0.97 3.81 0.18 13.29 2.99
BENICIA 2012 - 7 1.41 1.12 3.23 0.18 19.18 0.22 FESTIVAL 2012 - 7 1.33 2.18 1.77 0.37 8.86 0.80 FL 06-38 2012 - 7 4.67 3.17 1.59 0.31 18.49 0.88
PORTOLA 2012 - 7 0.16 0.40 1.64 0.22 1.59 0.13 VENTANA 2012 - 7 0.37 0.39 1.72 0.59 4.59 1.38
PROPRIETARY 6 2012 - 9 0.20 0.32 0.53 0.16 1.19 0.31 EVIE 2 2012 - 9 0.95 1.56 0.41 0.25 3.32 0.34
FESTIVAL 2012 - 9 1.68 4.44 0.00 0.55 10.58 1.64 GALLETA 2012 - 9 1.83 3.22 0.69 0.21 10.60 1.17
SWEET ANNE 2012 - 9 2.21 6.96 0.00 2.51 76.16 1.87
83
Table 2-2. Continued.
CULTIVAR HARVEST 103-09-3 140-11-4 2639-63-6 53398-83-7 106-32-1 112-14-1
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.21 0.26 0.10 0.35 0.05 0.87 CAMAROSA 2011 - 2 0.58 1.11 0.55 0.80 0.02 3.18 FESTIVAL 2011 - 2 0.46 1.89 3.15 4.98 0.34 2.67
MARA DES BOIS 2011 - 2 0.28 0.68 0.22 1.05 0.01 1.03 RADIANCE 2011 - 2 0.10 0.07 0.65 0.22 0.07 0.45
PROPRIETARY 2 2011 - 3 0.80 2.80 1.98 0.73 0.09 1.53 CAMAROSA 2011 - 3 0.30 1.69 1.02 0.51 0.13 2.90
SWEET CHARLIE 2011 - 3 0.53 5.54 3.23 0.46 0.23 4.92 TREASURE 2011 - 3 0.05 1.51 2.99 0.70 0.09 0.86
WINTER DAWN 2011 - 3 0.49 2.21 0.32 0.27 0.05 0.49 PROPRIETARY 3 2011 - 4 0.63 0.84 0.13 0.08 0.42 1.65
CAMINO REAL 2011 - 4 0.58 2.91 0.35 0.18 0.18 2.09 FESTIVAL 2011 - 4 0.33 0.30 1.10 0.14 0.09 1.09
WINTERSTAR 2011 - 5 0.31 0.95 0.53 0.34 0.12 1.43 FESTIVAL 2011 - 5 0.17 0.73 0.25 0.31 0.05 0.15 RADIANCE 2011 - 5 0.21 1.43 0.30 0.42 0.02 0.48
PROPRIETARY 4 2011 - 5 0.23 1.69 2.82 0.81 0.17 0.99 FL 05-85 2011 - 6 0.04 0.51 0.15 0.41 0.03 0.36 ELYANA 2011 - 6 0.19 3.56 0.00 0.22 0.29 16.97
FESTIVAL 2011 - 6 0.20 0.80 1.59 0.56 0.15 0.75 RED MERLIN 2011 - 6 0.24 1.21 0.12 0.15 0.02 0.21
SAN ANDREAS 2011 - 6 0.32 1.96 0.70 0.24 0.12 0.26 ALBION 2011 - 7 0.18 0.62 0.09 0.13 0.06 0.32
CHARLOTTE 2011 - 7 0.06 0.37 0.07 0.07 0.13 0.17 FESTIVAL 2011 - 7 0.03 0.90 0.15 0.07 0.14 0.03
MARA DES BOIS 2011 - 7 0.38 0.49 0.59 0.93 0.17 1.05 MONTERREY 2011 - 7 0.09 1.50 0.14 0.06 0.10 3.06
ALBION 2012 - 1 0.14 0.20 3.06 0.39 0.25 1.75 FESTIVAL 2012 - 1 0.12 0.25 0.34 0.44 0.24 0.58 MOJAVE 2012 - 1 0.08 0.54 2.39 0.47 0.20 4.85
PROPRIETARY 3 2012 - 1 0.16 1.62 0.12 0.00 0.21 0.64 CHANDLER 2012 - 4 0.77 3.57 1.44 0.11 0.00 5.14 FESTIVAL 2012 - 4 0.39 0.24 0.94 0.31 0.00 4.32 FL 09-127 2012 - 4 0.59 1.24 4.69 0.63 8.31 11.26
TREASURE 2012 - 4 0.18 0.60 0.26 0.38 3.35 6.88 WINTER DAWN 2012 - 4 0.51 0.16 0.54 0.37 11.86 9.93
PROPRIETARY 5 2012 - 5 0.35 0.44 0.06 0.10 0.00 1.79 ALBION 2012 - 5 1.16 2.12 1.12 0.35 2.43 5.30
FESTIVAL 2012 - 5 0.96 1.37 1.24 1.16 0.00 2.05 RUBYGEM 2012 - 5 0.31 0.22 0.14 0.14 0.00 0.79
CAMINO REAL 2012 - 6 0.16 2.50 1.84 1.43 1.69 1.63 DARSELECT 2012 - 6 0.80 5.08 4.18 1.42 0.98 15.49
FESTIVAL 2012 - 6 0.59 0.93 2.16 6.45 2.55 3.07 SWEET ANNE 2012 - 6 0.20 0.29 0.31 0.58 4.39 4.06
BENICIA 2012 - 7 0.37 2.30 0.12 0.18 1.18 1.71 FESTIVAL 2012 - 7 0.26 0.59 0.86 1.47 1.75 1.12 FL 06-38 2012 - 7 0.56 1.86 1.68 0.05 4.83 6.28
PORTOLA 2012 - 7 0.51 0.23 0.05 0.07 5.57 3.71 VENTANA 2012 - 7 0.45 1.79 0.04 0.14 1.55 2.47
PROPRIETARY 6 2012 - 9 0.39 0.32 0.49 0.23 0.34 0.33 EVIE 2 2012 - 9 0.13 0.36 0.19 0.04 0.34 0.99
FESTIVAL 2012 - 9 0.55 1.56 0.76 0.75 1.59 2.46 GALLETA 2012 - 9 0.76 0.60 0.37 0.43 1.70 2.61
SWEET ANNE 2012 - 9 3.42 4.24 2.02 0.61 1.70 3.25
84
Table 2-2. Continued.
CULTIVAR HARVEST 564-94-3 3913-81-3 134-20-3 110-39-4 110-38-3 29811-50-5
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.48 0.09 0.00 1.14 0.00 0.55 CAMAROSA 2011 - 2 0.80 0.34 0.00 3.75 0.00 1.15 FESTIVAL 2011 - 2 1.48 0.63 0.00 9.77 0.59 0.08
MARA DES BOIS 2011 - 2 0.77 0.07 0.00 1.43 0.11 0.14 RADIANCE 2011 - 2 1.15 0.39 0.00 0.73 0.00 0.03
PROPRIETARY 2 2011 - 3 1.68 0.85 0.00 5.71 0.00 0.61 CAMAROSA 2011 - 3 1.29 0.92 0.00 9.09 0.00 1.84
SWEET CHARLIE 2011 - 3 2.57 0.58 0.00 10.25 0.89 0.74 TREASURE 2011 - 3 1.11 0.48 0.00 7.17 0.00 0.66
WINTER DAWN 2011 - 3 0.82 0.41 0.00 0.37 0.00 0.13 PROPRIETARY 3 2011 - 4 0.75 0.19 0.00 0.20 0.00 0.24
CAMINO REAL 2011 - 4 0.49 0.19 0.00 1.95 0.00 0.18 FESTIVAL 2011 - 4 0.93 0.11 0.00 2.25 0.49 0.21
WINTERSTAR 2011 - 5 0.46 0.15 0.00 2.09 0.13 0.08 FESTIVAL 2011 - 5 0.38 0.06 0.00 0.51 0.16 0.06 RADIANCE 2011 - 5 0.12 0.09 0.00 0.10 0.03 0.12
PROPRIETARY 4 2011 - 5 1.90 0.45 0.00 5.75 0.09 0.04 FL 05-85 2011 - 6 0.40 0.11 0.00 0.08 0.42 0.12 ELYANA 2011 - 6 0.68 0.28 0.00 72.84 0.72 1.09
FESTIVAL 2011 - 6 0.65 0.14 0.00 2.95 0.76 0.08 RED MERLIN 2011 - 6 0.66 0.10 0.00 0.11 0.00 0.13
SAN ANDREAS 2011 - 6 0.55 0.09 0.00 0.52 0.18 0.01 ALBION 2011 - 7 2.91 0.04 0.00 0.45 0.00 0.05
CHARLOTTE 2011 - 7 0.54 0.11 0.31 0.00 0.00 0.03 FESTIVAL 2011 - 7 0.22 0.11 0.00 0.22 0.18 0.10
MARA DES BOIS 2011 - 7 0.58 0.06 0.72 1.35 0.45 0.03 MONTERREY 2011 - 7 0.09 0.04 0.00 2.38 0.13 1.83
ALBION 2012 - 1 0.45 0.04 0.00 10.53 0.31 0.19 FESTIVAL 2012 - 1 0.16 0.26 0.00 3.26 0.10 0.13 MOJAVE 2012 - 1 0.15 0.21 0.00 17.01 0.31 0.74
PROPRIETARY 3 2012 - 1 0.33 0.21 0.00 0.64 0.00 0.14 CHANDLER 2012 - 4 0.94 0.00 0.00 7.29 0.00 1.79 FESTIVAL 2012 - 4 0.25 0.18 0.00 2.09 0.45 0.15 FL 09-127 2012 - 4 3.06 0.45 0.00 15.98 1.28 0.81
TREASURE 2012 - 4 0.99 0.16 0.00 0.47 0.29 0.07 WINTER DAWN 2012 - 4 0.40 0.08 0.00 0.74 0.75 0.00
PROPRIETARY 5 2012 - 5 0.72 0.10 0.00 0.26 0.00 0.00 ALBION 2012 - 5 0.99 0.12 0.00 3.71 0.40 0.40
FESTIVAL 2012 - 5 1.22 0.38 0.00 1.42 0.42 0.14 RUBYGEM 2012 - 5 0.61 0.13 0.00 0.86 0.47 0.12
CAMINO REAL 2012 - 6 1.31 0.08 0.00 5.59 0.14 0.13 DARSELECT 2012 - 6 0.84 0.52 0.00 14.71 0.38 2.63
FESTIVAL 2012 - 6 1.00 0.49 0.00 2.63 0.48 0.17 SWEET ANNE 2012 - 6 0.19 0.26 0.00 0.29 0.35 0.10
BENICIA 2012 - 7 1.52 0.25 0.00 0.34 0.10 0.00 FESTIVAL 2012 - 7 0.58 0.12 0.00 1.09 0.23 0.12 FL 06-38 2012 - 7 1.36 0.19 0.00 2.16 0.50 0.21
PORTOLA 2012 - 7 0.28 0.11 0.00 0.54 0.24 0.23 VENTANA 2012 - 7 0.16 0.14 0.00 0.06 0.00 0.00
PROPRIETARY 6 2012 - 9 0.25 0.21 0.00 0.77 0.25 0.11 EVIE 2 2012 - 9 0.84 0.08 0.00 2.42 0.00 0.21
FESTIVAL 2012 - 9 2.40 0.40 0.00 2.23 0.84 0.34 GALLETA 2012 - 9 1.40 0.12 0.00 1.18 0.00 0.15
SWEET ANNE 2012 - 9 1.19 0.20 0.00 1.09 2.16 0.13
85
Table 2-2. Continued.
CULTIVAR HARVEST 7786-58-5 15111-96-3 706-14-9 10522-34-6 5881-17-4 128-37-0
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 0.46 0.09 0.04 0.05 1.84 0.08 CAMAROSA 2011 - 2 1.09 0.16 0.34 0.10 1.44 0.13 FESTIVAL 2011 - 2 0.25 0.31 0.04 0.29 1.87 0.31
MARA DES BOIS 2011 - 2 0.40 0.20 0.08 0.13 0.88 0.12 RADIANCE 2011 - 2 0.05 0.11 2.08 0.23 0.42 0.20
PROPRIETARY 2 2011 - 3 4.44 0.02 0.00 0.38 2.33 0.32 CAMAROSA 2011 - 3 2.89 0.35 0.27 0.07 2.81 0.35
SWEET CHARLIE 2011 - 3 2.66 0.72 58.21 0.09 2.93 0.87 TREASURE 2011 - 3 1.58 0.17 0.57 0.43 2.93 0.04
WINTER DAWN 2011 - 3 0.13 0.22 0.28 0.01 1.29 0.11 PROPRIETARY 3 2011 - 4 0.52 0.12 0.42 0.06 0.55 0.08
CAMINO REAL 2011 - 4 0.15 0.26 1.49 0.14 0.94 0.21 FESTIVAL 2011 - 4 0.12 0.21 0.20 0.06 0.56 0.07
WINTERSTAR 2011 - 5 0.04 0.09 1.67 0.11 0.24 0.05 FESTIVAL 2011 - 5 0.00 0.11 0.63 0.07 0.56 0.06 RADIANCE 2011 - 5 0.00 0.10 3.89 0.04 0.52 0.44
PROPRIETARY 4 2011 - 5 0.24 0.10 0.03 0.26 1.10 0.09 FL 05-85 2011 - 6 0.00 0.19 0.06 0.05 0.44 0.16 ELYANA 2011 - 6 11.17 0.41 7.71 0.90 1.02 0.14
FESTIVAL 2011 - 6 0.04 0.31 0.26 0.20 0.90 0.21 RED MERLIN 2011 - 6 0.00 0.13 1.14 0.00 0.32 0.00
SAN ANDREAS 2011 - 6 0.18 0.14 11.84 0.06 0.97 0.03 ALBION 2011 - 7 0.14 0.06 0.48 0.01 0.45 0.10
CHARLOTTE 2011 - 7 0.03 0.01 0.12 0.00 0.29 0.00 FESTIVAL 2011 - 7 0.07 0.30 0.00 0.02 0.28 0.08
MARA DES BOIS 2011 - 7 0.05 0.20 0.00 0.06 0.31 0.00 MONTERREY 2011 - 7 0.91 0.03 0.00 0.03 0.21 0.17
ALBION 2012 - 1 1.17 0.13 10.49 0.17 0.16 0.61 FESTIVAL 2012 - 1 0.20 0.04 0.40 0.02 0.09 0.89 MOJAVE 2012 - 1 4.30 0.01 3.13 0.11 0.56 0.00
PROPRIETARY 3 2012 - 1 0.28 0.03 0.20 0.00 0.43 2.01 CHANDLER 2012 - 4 3.69 0.00 6.46 0.25 1.43 1.59 FESTIVAL 2012 - 4 0.10 0.05 0.17 0.07 0.15 0.65 FL 09-127 2012 - 4 5.04 0.09 16.87 0.33 1.13 1.47
TREASURE 2012 - 4 0.30 0.08 0.17 0.13 0.30 0.18 WINTER DAWN 2012 - 4 0.00 0.07 0.12 0.00 0.29 0.44
PROPRIETARY 5 2012 - 5 0.09 0.05 0.23 0.00 0.04 0.45 ALBION 2012 - 5 1.60 0.06 18.44 0.06 0.95 1.89
FESTIVAL 2012 - 5 0.14 0.15 0.56 0.09 1.15 3.78 RUBYGEM 2012 - 5 0.17 0.06 0.76 0.14 0.05 0.30
CAMINO REAL 2012 - 6 0.46 0.05 7.53 0.19 0.63 2.05 DARSELECT 2012 - 6 24.77 0.07 37.59 0.11 1.05 2.43
FESTIVAL 2012 - 6 0.24 0.09 0.17 0.27 0.88 1.84 SWEET ANNE 2012 - 6 0.14 0.05 2.15 0.08 0.20 0.70
BENICIA 2012 - 7 0.28 0.05 2.63 0.00 0.42 2.08 FESTIVAL 2012 - 7 0.11 0.04 0.19 0.08 0.60 1.88 FL 06-38 2012 - 7 0.82 0.07 12.91 0.14 0.46 2.36
PORTOLA 2012 - 7 0.13 0.05 0.11 0.00 0.25 1.13 VENTANA 2012 - 7 0.17 0.04 0.51 0.00 0.14 0.91
PROPRIETARY 6 2012 - 9 0.16 0.04 0.62 0.08 0.59 0.78 EVIE 2 2012 - 9 3.84 0.14 0.85 0.10 0.21 1.14
FESTIVAL 2012 - 9 0.25 0.33 0.45 0.23 1.24 3.38 GALLETA 2012 - 9 0.42 0.07 2.00 0.10 0.44 0.94
SWEET ANNE 2012 - 9 0.37 0.20 8.74 0.13 1.39 2.39
86
Table 2-2. Continued.
CULTIVAR HARVEST 40716-66-3 4887-30-3 5454-09-1 2305-05-7
ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1 ng
1 gFW
-1 hr
-1
PROPRIETARY 1 2011 - 2 13.53 0.55 0.40 0.53 CAMAROSA 2011 - 2 3.15 1.96 0.82 0.51 FESTIVAL 2011 - 2 10.95 2.51 0.98 1.18
MARA DES BOIS 2011 - 2 0.50 0.71 0.36 0.40 RADIANCE 2011 - 2 1.11 1.08 0.81 0.14
PROPRIETARY 2 2011 - 3 0.70 0.31 0.20 0.65 CAMAROSA 2011 - 3 10.66 2.38 1.39 0.98
SWEET CHARLIE 2011 - 3 145.11 15.86 10.01 2.63 TREASURE 2011 - 3 3.66 1.50 0.24 2.66
WINTER DAWN 2011 - 3 31.29 0.00 0.00 1.48 PROPRIETARY 3 2011 - 4 4.80 0.14 0.00 1.77
CAMINO REAL 2011 - 4 3.16 0.88 0.24 0.12 FESTIVAL 2011 - 4 3.19 1.11 0.06 0.16
WINTERSTAR 2011 - 5 4.98 0.62 0.11 0.28 FESTIVAL 2011 - 5 7.73 0.26 0.14 0.45 RADIANCE 2011 - 5 52.91 0.00 0.00 1.15
PROPRIETARY 4 2011 - 5 0.81 0.26 0.13 0.35 FL 05-85 2011 - 6 2.01 0.30 0.15 0.57 ELYANA 2011 - 6 3.53 32.68 4.93 0.56
FESTIVAL 2011 - 6 12.81 26.69 0.29 0.79 RED MERLIN 2011 - 6 0.00 0.00 0.00 0.02
SAN ANDREAS 2011 - 6 2.99 1.87 0.00 0.60 ALBION 2011 - 7 1.60 0.00 0.00 0.19
CHARLOTTE 2011 - 7 0.00 0.00 0.00 0.18 FESTIVAL 2011 - 7 2.23 0.25 0.00 0.14
MARA DES BOIS 2011 - 7 0.34 0.13 0.21 0.15 MONTERREY 2011 - 7 1.60 0.84 0.48 0.05
ALBION 2012 - 1 8.54 1.04 0.52 1.41 FESTIVAL 2012 - 1 19.39 0.75 0.50 1.68 MOJAVE 2012 - 1 0.34 5.17 0.86 1.15
PROPRIETARY 3 2012 - 1 6.30 0.00 0.00 1.37 CHANDLER 2012 - 4 1.77 2.16 0.23 1.70 FESTIVAL 2012 - 4 3.46 0.47 0.02 0.22 FL 09-127 2012 - 4 19.31 4.64 1.14 0.58
TREASURE 2012 - 4 2.83 0.91 0.29 2.22 WINTER DAWN 2012 - 4 1.75 0.00 0.00 0.11
PROPRIETARY 5 2012 - 5 1.12 0.00 0.00 0.39 ALBION 2012 - 5 34.32 1.23 0.20 2.14
FESTIVAL 2012 - 5 20.89 0.78 0.23 1.10 RUBYGEM 2012 - 5 2.79 0.19 0.29 0.28
CAMINO REAL 2012 - 6 4.89 2.42 0.89 0.38 DARSELECT 2012 - 6 14.62 15.57 0.73 1.49
FESTIVAL 2012 - 6 15.13 0.74 0.25 1.33 SWEET ANNE 2012 - 6 5.06 0.07 0.00 0.30
BENICIA 2012 - 7 7.92 0.23 0.00 0.34 FESTIVAL 2012 - 7 10.79 0.20 0.26 0.47 FL 06-38 2012 - 7 24.58 2.12 0.52 1.21
PORTOLA 2012 - 7 0.43 0.22 0.00 0.21 VENTANA 2012 - 7 0.92 0.00 0.00 0.11
PROPRIETARY 6 2012 - 9 0.61 0.01 0.05 0.16 EVIE 2 2012 - 9 0.92 0.62 0.10 0.20
FESTIVAL 2012 - 9 14.75 1.10 0.28 1.09 GALLETA 2012 - 9 3.21 0.19 0.16 0.30
SWEET ANNE 2012 - 9 26.45 1.18 0.25 1.06
87
Table 2-3. Fruit attribute bivariate fit to harvest week.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
WEEK 1629-58-9 0.489 -0.699 0.000 54 5.0 2.2 117.9 65.9 WEEK 1576-87-0 0.485 -0.697 0.000 54 5.0 2.2 37.5 20.1 WEEK SWEETNESS INTENSITY 0.471 -0.686 0.000 54 5.0 2.2 23.0 4.8 WEEK SSC 0.444 -0.666 0.000 54 5.0 2.2 7.4 1.4 WEEK STRAWBERRY FLAVOR INTENSITY 0.430 -0.656 0.000 54 5.0 2.2 26.9 3.9 WEEK OVERALL LIKING 0.422 -0.650 0.000 54 5.0 2.2 23.8 5.7 WEEK 1576-86-9 0.402 -0.634 0.000 54 5.0 2.2 37.8 21.7 WEEK SUCROSE 0.350 -0.592 0.000 54 5.0 2.2 1112.6 646.5 WEEK 6728-26-3 0.348 -0.590 0.000 54 5.0 2.2 8666.5 3359.7 WEEK TOTAL VOLATILES 0.338 -0.581 0.000 54 5.0 2.2 15814.0 5238.5 WEEK 5881-17-4 0.315 -0.561 0.000 54 5.0 2.2 6.2 2.5 WEEK 105-54-4 0.294 -0.542 0.000 54 5.0 2.2 42.0 17.1 WEEK TOTAL SUGAR 0.287 -0.536 0.000 54 5.0 2.2 4473.9 1037.2 WEEK 124-19-6 0.264 -0.513 0.000 54 5.0 2.2 8.5 7.5 WEEK 3913-81-3 0.252 -0.502 0.000 54 5.0 2.2 1.9 1.4 WEEK 96-22-0 0.242 -0.492 0.000 54 5.0 2.2 51.2 18.6 WEEK 2305-05-7 0.240 -0.490 0.000 54 5.0 2.2 6.7 6.7 WEEK 110-93-0 0.179 -0.423 0.001 54 5.0 2.2 2.7 1.5 WEEK 616-25-1 0.158 -0.398 0.003 54 5.0 2.2 15.9 7.3 WEEK 75-85-4 0.148 -0.385 0.004 54 5.0 2.2 3.9 2.2 WEEK 2639-63-6 0.141 -0.375 0.005 54 5.0 2.2 10.8 13.0 WEEK 116-53-0 0.139 -0.372 0.006 54 5.0 2.2 19.7 16.0 WEEK 142-92-7 0.137 -0.370 0.006 54 5.0 2.2 53.5 49.7 WEEK 111-71-7 0.134 -0.366 0.006 54 5.0 2.2 3.2 2.3 WEEK TEXTURE LIKING 0.132 -0.364 0.007 54 5.0 2.2 23.8 5.7 WEEK L* int 0.127 -0.357 0.008 54 5.0 2.2 54.9 5.8 WEEK 60415-61-4 0.118 -0.343 0.011 54 5.0 2.2 0.7 1.6 WEEK 5454-09-1 0.112 -0.335 0.013 54 5.0 2.2 3.7 6.2 WEEK 66-25-1 0.106 -0.325 0.017 54 5.0 2.2 2545.9 1722.0 WEEK 106-32-1 0.101 0.317 0.019 54 5.0 2.2 2.2 3.0 WEEK 7452-79-1 0.098 -0.312 0.021 54 5.0 2.2 50.0 31.0 WEEK 109-21-7 0.097 -0.311 0.022 54 5.0 2.2 72.1 157.2 WEEK 4077-47-8 0.089 -0.298 0.028 54 5.0 2.2 11.7 8.3 WEEK 123-86-4 0.087 -0.296 0.030 54 5.0 2.2 73.5 85.0 WEEK 1534-08-3 0.082 -0.286 0.036 54 5.0 2.2 0.4 0.2 WEEK 638-11-9 0.078 -0.280 0.041 54 5.0 2.2 72.7 67.2 WEEK 628-63-7 0.071 -0.266 0.052 54 5.0 2.2 4.6 1.7 WEEK A* ext 0.070 -0.265 0.053 54 5.0 2.2 36.4 3.1 WEEK 40716-66-3 0.069 -0.262 0.055 54 5.0 2.2 84.3 107.5 WEEK GLUCOSE 0.064 -0.254 0.064 54 5.0 2.2 1594.6 378.2 WEEK 110-43-0 0.060 -0.244 0.075 54 5.0 2.2 14.8 19.6 WEEK 53398-83-7 0.050 -0.223 0.105 54 5.0 2.2 5.0 4.6 WEEK 110-39-4 0.049 -0.222 0.107 54 5.0 2.2 40.8 70.0 WEEK 109-60-4 0.044 0.210 0.128 54 5.0 2.2 3.8 2.7 WEEK 564-94-3 0.043 -0.208 0.132 54 5.0 2.2 6.5 7.4 WEEK 591-78-6 0.043 -0.207 0.134 54 5.0 2.2 10.3 13.9 WEEK FRUCTOSE 0.041 -0.203 0.141 54 5.0 2.2 1766.7 381.5 WEEK TA 0.041 -0.201 0.144 54 5.0 2.2 0.8 0.1 WEEK 706-14-9 0.040 -0.200 0.146 54 5.0 2.2 44.5 81.1 WEEK 5989-33-3 0.040 -0.199 0.149 54 5.0 2.2 2.8 2.4 WEEK 104-76-7 0.038 -0.195 0.158 54 5.0 2.2 6.0 4.9 WEEK 2548-87-0 0.036 -0.191 0.167 54 5.0 2.2 2.4 1.5 WEEK 15111-96-3 0.030 -0.173 0.212 54 5.0 2.2 1.2 1.2 WEEK 109-19-3 0.029 -0.171 0.217 54 5.0 2.2 2.7 3.8 WEEK pH 0.029 -0.169 0.221 54 5.0 2.2 3.7 0.2 WEEK 108-10-1 0.028 0.167 0.228 54 5.0 2.2 1.5 2.6 WEEK 10522-34-6 0.025 -0.159 0.252 54 5.0 2.2 1.1 1.1 WEEK L* ext 0.025 -0.158 0.255 54 5.0 2.2 33.6 2.6 WEEK A* int 0.024 0.156 0.261 54 5.0 2.2 28.8 7.6 WEEK 134-20-3 0.024 0.156 0.261 54 5.0 2.2 0.1 0.7 WEEK 123-66-0 0.021 0.146 0.292 54 5.0 2.2 108.2 128.0 WEEK 623-42-7 0.019 -0.139 0.316 54 5.0 2.2 2780.2 1376.8 WEEK FORCE 0.019 -0.139 0.316 54 5.0 2.2 0.6 0.2 WEEK 4887-30-3 0.019 -0.138 0.319 54 5.0 2.2 16.9 32.5 WEEK 123-92-2 0.018 0.132 0.340 54 5.0 2.2 23.0 21.5 WEEK 96-04-8 0.016 -0.127 0.359 54 5.0 2.2 3.1 8.0 WEEK 821-55-6 0.015 -0.123 0.374 54 5.0 2.2 3.5 8.2 WEEK 539-82-2 0.012 -0.111 0.425 54 5.0 2.2 3.3 3.9 WEEK 540-18-1 0.012 -0.108 0.435 54 5.0 2.2 3.5 3.2 WEEK 128-37-0 0.010 0.099 0.475 54 5.0 2.2 4.1 3.7 WEEK 55514-48-2 0.009 0.097 0.485 54 5.0 2.2 0.5 0.5 WEEK 124-13-0 0.009 -0.096 0.491 54 5.0 2.2 5.9 3.0 WEEK 112-14-1 0.009 -0.095 0.495 54 5.0 2.2 18.3 24.0 WEEK CITRIC ACID 0.009 -0.094 0.499 54 5.0 2.2 741.0 147.2 WEEK SOURNESS INTENSITY 0.009 0.093 0.505 54 5.0 2.2 18.1 3.1 WEEK 623-43-8 0.008 0.090 0.518 54 5.0 2.2 3.4 3.4 WEEK 105-66-8 0.008 -0.088 0.528 54 5.0 2.2 5.0 3.7 WEEK B* int 0.007 0.084 0.544 54 5.0 2.2 25.8 4.5 WEEK 110-62-3 0.005 -0.074 0.597 54 5.0 2.2 7.9 8.9 WEEK 1576-95-0 0.005 -0.072 0.604 54 5.0 2.2 2.1 2.0 WEEK B* ext 0.005 -0.070 0.613 54 5.0 2.2 19.0 3.3 WEEK 2311-46-8 0.004 -0.066 0.637 54 5.0 2.2 3.9 4.4 WEEK MALIC ACID 0.004 -0.065 0.641 54 5.0 2.2 212.4 51.6 WEEK 29811-50-5 0.004 -0.064 0.643 54 5.0 2.2 3.2 5.3 WEEK 103-09-3 0.003 0.057 0.680 54 5.0 2.2 3.0 1.1 WEEK 140-11-4 0.003 -0.054 0.700 54 5.0 2.2 11.1 8.6 WEEK 2432-51-1 0.002 0.048 0.729 54 5.0 2.2 4.4 5.8 WEEK 556-24-1 0.002 -0.044 0.752 54 5.0 2.2 46.6 57.0
88
Table 2-3. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
WEEK 78-70-6 0.001 -0.038 0.787 54 5.0 2.2 128.8 113.0 WEEK 589-38-8 0.001 0.036 0.798 54 5.0 2.2 1.9 1.2 WEEK 2497-18-9 0.001 0.033 0.815 54 5.0 2.2 24.9 21.5 WEEK 1191-16-8 0.001 0.029 0.837 54 5.0 2.2 5.5 7.0 WEEK 928-95-0 0.001 0.028 0.838 54 5.0 2.2 66.8 61.7 WEEK 106-70-7 0.001 -0.027 0.845 54 5.0 2.2 252.7 164.0 WEEK 71-41-0 0.001 -0.026 0.854 54 5.0 2.2 1.0 1.3 WEEK 20664-46-4 0.000 -0.020 0.887 54 5.0 2.2 20.6 19.0 WEEK 7786-58-5 0.000 -0.019 0.890 54 5.0 2.2 12.2 28.4 WEEK 29674-47-3 0.000 -0.019 0.892 54 5.0 2.2 5.0 5.0 WEEK 110-38-3 0.000 -0.019 0.893 54 5.0 2.2 2.0 2.6 WEEK 105-37-3 0.000 0.017 0.903 54 5.0 2.2 10.1 14.1 WEEK 624-41-9 0.000 -0.010 0.945 54 5.0 2.2 18.9 18.1 WEEK 624-24-8 0.000 -0.007 0.960 54 5.0 2.2 5.6 3.7 WEEK 111-27-3 0.000 0.004 0.976 54 5.0 2.2 45.5 94.6
Note: Regression of harvest week during season (X) on panel responses and metabolite concentration (Y). Coefficient of determination (R2), correlation coefficient, p-value, sample size (n), mean and standard deviation of X and Y derived from bivariate fit in JMP 8.
89
Table 2-4. Fruit attribute bivariate fir to consumer measure.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
TOTAL SUGAR OVERALL LIKING 0.489 0.699 0.000 54 4473.9 1037.2 23.8 5.7 SSC OVERALL LIKING 0.457 0.676 0.000 54 7.4 1.4 23.8 5.7
SUCROSE OVERALL LIKING 0.442 0.665 0.000 54 1112.6 646.5 23.8 5.7 1629-58-9 OVERALL LIKING 0.437 0.661 0.000 54 117.9 65.9 23.8 5.7 1576-87-0 OVERALL LIKING 0.371 0.609 0.000 54 37.5 20.1 23.8 5.7 2305-05-7 OVERALL LIKING 0.310 0.557 0.000 54 6.7 6.7 23.8 5.7 1576-86-9 OVERALL LIKING 0.301 0.549 0.000 54 37.8 21.7 23.8 5.7 111-71-7 OVERALL LIKING 0.288 0.537 0.000 54 3.2 2.3 23.8 5.7 540-18-1 OVERALL LIKING 0.244 0.494 0.000 54 3.5 3.2 23.8 5.7
3913-81-3 OVERALL LIKING 0.241 0.491 0.000 54 1.9 1.4 23.8 5.7 110-93-0 OVERALL LIKING 0.228 0.477 0.000 54 2.7 1.5 23.8 5.7
2639-63-6 OVERALL LIKING 0.200 0.447 0.001 54 10.8 13.0 23.8 5.7 124-19-6 OVERALL LIKING 0.196 0.443 0.001 54 8.5 7.5 23.8 5.7
2548-87-0 OVERALL LIKING 0.191 0.437 0.001 54 2.4 1.5 23.8 5.7 4077-47-8 OVERALL LIKING 0.189 0.434 0.001 54 11.7 8.3 23.8 5.7 104-76-7 OVERALL LIKING 0.187 0.432 0.001 54 6.0 4.9 23.8 5.7
TOTAL VOLATILES OVERALL LIKING 0.179 0.424 0.001 54 15814.0 5238.5 23.8 5.7 638-11-9 OVERALL LIKING 0.179 0.423 0.001 54 72.7 67.2 23.8 5.7
60415-61-4 OVERALL LIKING 0.177 0.421 0.002 54 0.7 1.6 23.8 5.7 GLUCOSE OVERALL LIKING 0.175 0.419 0.002 54 1594.6 378.2 23.8 5.7 5989-33-3 OVERALL LIKING 0.168 0.410 0.002 54 2.8 2.4 23.8 5.7
40716-66-3 OVERALL LIKING 0.164 0.405 0.002 54 84.3 107.5 23.8 5.7 5881-17-4 OVERALL LIKING 0.157 0.397 0.003 54 6.2 2.5 23.8 5.7 109-19-3 OVERALL LIKING 0.154 0.392 0.003 54 2.7 3.8 23.8 5.7
L* int OVERALL LIKING 0.147 0.384 0.004 54 54.9 5.8 23.8 5.7 109-21-7 OVERALL LIKING 0.143 0.378 0.005 54 72.1 157.2 23.8 5.7 142-92-7 OVERALL LIKING 0.138 0.371 0.006 54 53.5 49.7 23.8 5.7 110-43-0 OVERALL LIKING 0.137 0.370 0.006 54 14.8 19.6 23.8 5.7
FRUCTOSE OVERALL LIKING 0.129 0.359 0.008 54 1766.7 381.5 23.8 5.7 5454-09-1 OVERALL LIKING 0.125 0.353 0.009 54 3.7 6.2 23.8 5.7 706-14-9 OVERALL LIKING 0.122 0.349 0.010 54 44.5 81.1 23.8 5.7 591-78-6 OVERALL LIKING 0.118 0.343 0.011 54 10.3 13.9 23.8 5.7 123-86-4 OVERALL LIKING 0.108 0.329 0.015 54 73.5 85.0 23.8 5.7
6728-26-3 OVERALL LIKING 0.108 0.329 0.015 54 8666.5 3359.7 23.8 5.7 53398-83-7 OVERALL LIKING 0.106 0.325 0.016 54 5.0 4.6 23.8 5.7
A* int OVERALL LIKING 0.105 -0.324 0.017 54 28.8 7.6 23.8 5.7 TA OVERALL LIKING 0.099 0.314 0.021 54 0.8 0.1 23.8 5.7
110-38-3 OVERALL LIKING 0.094 0.307 0.024 54 2.0 2.6 23.8 5.7 105-66-8 OVERALL LIKING 0.094 0.306 0.024 54 5.0 3.7 23.8 5.7 105-54-4 OVERALL LIKING 0.088 0.297 0.029 54 42.0 17.1 23.8 5.7 616-25-1 OVERALL LIKING 0.082 0.286 0.036 54 15.9 7.3 23.8 5.7 96-22-0 OVERALL LIKING 0.079 0.280 0.040 54 51.2 18.6 23.8 5.7
134-20-3 OVERALL LIKING 0.076 -0.276 0.043 54 0.1 0.7 23.8 5.7 10522-34-6 OVERALL LIKING 0.076 0.276 0.044 54 1.1 1.1 23.8 5.7
623-42-7 OVERALL LIKING 0.075 0.275 0.045 54 2780.2 1376.8 23.8 5.7 1191-16-8 OVERALL LIKING 0.072 -0.268 0.050 54 5.5 7.0 23.8 5.7 110-39-4 OVERALL LIKING 0.067 0.258 0.059 54 40.8 70.0 23.8 5.7
55514-48-2 OVERALL LIKING 0.065 -0.254 0.064 54 0.5 0.5 23.8 5.7 2311-46-8 OVERALL LIKING 0.061 0.247 0.072 54 3.9 4.4 23.8 5.7
B* int OVERALL LIKING 0.059 -0.242 0.078 54 25.8 4.5 23.8 5.7 116-53-0 OVERALL LIKING 0.058 0.240 0.080 54 19.7 16.0 23.8 5.7
CITRIC ACID OVERALL LIKING 0.056 0.237 0.084 54 741.0 147.2 23.8 5.7 pH OVERALL LIKING 0.053 0.231 0.094 54 3.7 0.2 23.8 5.7
29674-47-3 OVERALL LIKING 0.051 0.226 0.100 54 5.0 5.0 23.8 5.7 4887-30-3 OVERALL LIKING 0.051 0.226 0.101 54 16.9 32.5 23.8 5.7 564-94-3 OVERALL LIKING 0.047 0.218 0.114 54 6.5 7.4 23.8 5.7 623-43-8 OVERALL LIKING 0.041 -0.203 0.142 54 3.4 3.4 23.8 5.7 539-82-2 OVERALL LIKING 0.039 0.196 0.155 54 3.3 3.9 23.8 5.7 66-25-1 OVERALL LIKING 0.035 0.187 0.175 54 2545.9 1722.0 23.8 5.7
628-63-7 OVERALL LIKING 0.035 0.187 0.177 54 4.6 1.7 23.8 5.7 FORCE OVERALL LIKING 0.034 0.185 0.181 54 0.6 0.2 23.8 5.7
7786-58-5 OVERALL LIKING 0.033 0.182 0.188 54 12.2 28.4 23.8 5.7 A* ext OVERALL LIKING 0.033 0.182 0.189 54 36.4 3.1 23.8 5.7
71-41-0 OVERALL LIKING 0.029 0.172 0.215 54 1.0 1.3 23.8 5.7 624-41-9 OVERALL LIKING 0.028 -0.168 0.225 54 18.9 18.1 23.8 5.7 109-60-4 OVERALL LIKING 0.027 -0.166 0.231 54 3.8 2.7 23.8 5.7
MALIC ACID OVERALL LIKING 0.027 0.165 0.234 54 212.4 51.6 23.8 5.7 111-27-3 OVERALL LIKING 0.027 -0.164 0.236 54 45.5 94.6 23.8 5.7 124-13-0 OVERALL LIKING 0.024 0.154 0.267 54 5.9 3.0 23.8 5.7 78-70-6 OVERALL LIKING 0.023 0.153 0.270 54 128.8 113.0 23.8 5.7
821-55-6 OVERALL LIKING 0.022 0.148 0.286 54 3.5 8.2 23.8 5.7 624-24-8 OVERALL LIKING 0.022 0.147 0.289 54 5.6 3.7 23.8 5.7
7452-79-1 OVERALL LIKING 0.022 0.147 0.289 54 50.0 31.0 23.8 5.7 106-70-7 OVERALL LIKING 0.021 0.145 0.296 54 252.7 164.0 23.8 5.7 112-14-1 OVERALL LIKING 0.021 0.144 0.298 54 18.3 24.0 23.8 5.7
1534-08-3 OVERALL LIKING 0.018 0.135 0.332 54 0.4 0.2 23.8 5.7 20664-46-4 OVERALL LIKING 0.018 0.133 0.339 54 20.6 19.0 23.8 5.7
589-38-8 OVERALL LIKING 0.018 0.133 0.340 54 1.9 1.2 23.8 5.7 123-66-0 OVERALL LIKING 0.017 0.132 0.341 54 108.2 128.0 23.8 5.7
2432-51-1 OVERALL LIKING 0.016 0.127 0.360 54 4.4 5.8 23.8 5.7 75-85-4 OVERALL LIKING 0.014 0.119 0.390 54 3.9 2.2 23.8 5.7
928-95-0 OVERALL LIKING 0.012 -0.111 0.422 54 66.8 61.7 23.8 5.7 140-11-4 OVERALL LIKING 0.012 -0.111 0.423 54 11.1 8.6 23.8 5.7 103-09-3 OVERALL LIKING 0.011 -0.106 0.446 54 3.0 1.1 23.8 5.7 123-92-2 OVERALL LIKING 0.010 -0.099 0.475 54 23.0 21.5 23.8 5.7
B* ext OVERALL LIKING 0.009 -0.095 0.492 54 19.0 3.3 23.8 5.7 128-37-0 OVERALL LIKING 0.007 0.086 0.536 54 4.1 3.7 23.8 5.7
2497-18-9 OVERALL LIKING 0.006 -0.075 0.590 54 24.9 21.5 23.8 5.7
90
Table 2-4. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
556-24-1 OVERALL LIKING 0.004 0.065 0.638 54 46.6 57.0 23.8 5.7 29811-50-5 OVERALL LIKING 0.004 -0.062 0.658 54 3.2 5.3 23.8 5.7
110-62-3 OVERALL LIKING 0.003 0.057 0.680 54 7.9 8.9 23.8 5.7 96-04-8 OVERALL LIKING 0.003 -0.052 0.711 54 3.1 8.0 23.8 5.7
1576-95-0 OVERALL LIKING 0.002 0.040 0.773 54 2.1 2.0 23.8 5.7 106-32-1 OVERALL LIKING 0.001 -0.032 0.817 54 2.2 3.0 23.8 5.7 108-10-1 OVERALL LIKING 0.001 -0.023 0.870 54 1.5 2.6 23.8 5.7
15111-96-3 OVERALL LIKING 0.000 0.018 0.897 54 1.2 1.2 23.8 5.7 105-37-3 OVERALL LIKING 0.000 -0.009 0.946 54 10.1 14.1 23.8 5.7
L* ext OVERALL LIKING 0.000 0.004 0.976 54 33.6 2.6 23.8 5.7 FORCE TEXTURE LIKING 0.358 0.598 0.000 54 0.6 0.2 23.8 5.7
MALIC ACID TEXTURE LIKING 0.282 0.531 0.000 54 212.4 51.6 23.8 5.7 134-20-3 TEXTURE LIKING 0.277 -0.526 0.000 54 0.1 0.7 23.8 5.7 104-76-7 TEXTURE LIKING 0.231 0.480 0.000 54 6.0 4.9 23.8 5.7 623-43-8 TEXTURE LIKING 0.179 -0.423 0.001 54 3.4 3.4 23.8 5.7
1629-58-9 TEXTURE LIKING 0.151 0.388 0.004 54 117.9 65.9 23.8 5.7 103-09-3 TEXTURE LIKING 0.145 -0.381 0.004 54 3.0 1.1 23.8 5.7
1576-87-0 TEXTURE LIKING 0.145 0.381 0.005 54 37.5 20.1 23.8 5.7 638-11-9 TEXTURE LIKING 0.141 0.375 0.005 54 72.7 67.2 23.8 5.7
40716-66-3 TEXTURE LIKING 0.132 0.364 0.007 54 84.3 107.5 23.8 5.7 2548-87-0 TEXTURE LIKING 0.129 0.360 0.008 54 2.4 1.5 23.8 5.7 111-71-7 TEXTURE LIKING 0.122 0.349 0.010 54 3.2 2.3 23.8 5.7 110-38-3 TEXTURE LIKING 0.117 0.342 0.011 54 2.0 2.6 23.8 5.7
2305-05-7 TEXTURE LIKING 0.116 0.341 0.012 54 6.7 6.7 23.8 5.7 60415-61-4 TEXTURE LIKING 0.104 0.322 0.018 54 0.7 1.6 23.8 5.7 SUCROSE TEXTURE LIKING 0.102 0.320 0.018 54 1112.6 646.5 23.8 5.7 556-24-1 TEXTURE LIKING 0.097 -0.312 0.022 54 46.6 57.0 23.8 5.7 123-92-2 TEXTURE LIKING 0.090 -0.300 0.027 54 23.0 21.5 23.8 5.7
5454-09-1 TEXTURE LIKING 0.080 0.282 0.039 54 3.7 6.2 23.8 5.7 5989-33-3 TEXTURE LIKING 0.078 0.280 0.040 54 2.8 2.4 23.8 5.7 110-62-3 TEXTURE LIKING 0.076 0.276 0.043 54 7.9 8.9 23.8 5.7
55514-48-2 TEXTURE LIKING 0.076 -0.275 0.044 54 0.5 0.5 23.8 5.7 109-21-7 TEXTURE LIKING 0.067 0.260 0.058 54 72.1 157.2 23.8 5.7
TOTAL SUGAR TEXTURE LIKING 0.067 0.260 0.058 54 4473.9 1037.2 23.8 5.7 124-19-6 TEXTURE LIKING 0.065 0.256 0.062 54 8.5 7.5 23.8 5.7 110-93-0 TEXTURE LIKING 0.065 0.256 0.062 54 2.7 1.5 23.8 5.7 540-18-1 TEXTURE LIKING 0.063 0.251 0.068 54 3.5 3.2 23.8 5.7 105-66-8 TEXTURE LIKING 0.062 0.250 0.068 54 5.0 3.7 23.8 5.7 110-43-0 TEXTURE LIKING 0.062 0.249 0.070 54 14.8 19.6 23.8 5.7 109-60-4 TEXTURE LIKING 0.059 -0.244 0.076 54 3.8 2.7 23.8 5.7
1576-86-9 TEXTURE LIKING 0.058 0.241 0.079 54 37.8 21.7 23.8 5.7 4077-47-8 TEXTURE LIKING 0.058 0.241 0.080 54 11.7 8.3 23.8 5.7
pH TEXTURE LIKING 0.056 0.237 0.084 54 3.7 0.2 23.8 5.7 SSC TEXTURE LIKING 0.055 0.234 0.089 54 7.4 1.4 23.8 5.7
10522-34-6 TEXTURE LIKING 0.048 0.218 0.113 54 1.1 1.1 23.8 5.7 109-19-3 TEXTURE LIKING 0.045 0.213 0.123 54 2.7 3.8 23.8 5.7 706-14-9 TEXTURE LIKING 0.044 0.210 0.128 54 44.5 81.1 23.8 5.7
2639-63-6 TEXTURE LIKING 0.040 0.200 0.147 54 10.8 13.0 23.8 5.7 111-27-3 TEXTURE LIKING 0.039 -0.199 0.150 54 45.5 94.6 23.8 5.7
2432-51-1 TEXTURE LIKING 0.035 0.187 0.176 54 4.4 5.8 23.8 5.7 564-94-3 TEXTURE LIKING 0.035 0.186 0.177 54 6.5 7.4 23.8 5.7 110-39-4 TEXTURE LIKING 0.034 0.184 0.183 54 40.8 70.0 23.8 5.7
3913-81-3 TEXTURE LIKING 0.034 0.184 0.183 54 1.9 1.4 23.8 5.7 539-82-2 TEXTURE LIKING 0.030 0.173 0.212 54 3.3 3.9 23.8 5.7 624-24-8 TEXTURE LIKING 0.028 0.168 0.226 54 5.6 3.7 23.8 5.7 116-53-0 TEXTURE LIKING 0.026 0.163 0.240 54 19.7 16.0 23.8 5.7
TA TEXTURE LIKING 0.026 0.161 0.244 54 0.8 0.1 23.8 5.7 123-86-4 TEXTURE LIKING 0.026 0.160 0.247 54 73.5 85.0 23.8 5.7
TOTAL VOLATILES TEXTURE LIKING 0.025 0.158 0.254 54 15814.0 5238.5 23.8 5.7 5881-17-4 TEXTURE LIKING 0.025 0.157 0.256 54 6.2 2.5 23.8 5.7
66-25-1 TEXTURE LIKING 0.023 0.153 0.269 54 2545.9 1722.0 23.8 5.7 78-70-6 TEXTURE LIKING 0.023 0.152 0.272 54 128.8 113.0 23.8 5.7
124-13-0 TEXTURE LIKING 0.023 -0.152 0.273 54 5.9 3.0 23.8 5.7 142-92-7 TEXTURE LIKING 0.023 0.151 0.274 54 53.5 49.7 23.8 5.7
2311-46-8 TEXTURE LIKING 0.023 0.151 0.276 54 3.9 4.4 23.8 5.7 928-95-0 TEXTURE LIKING 0.020 -0.143 0.302 54 66.8 61.7 23.8 5.7 96-04-8 TEXTURE LIKING 0.019 -0.138 0.319 54 3.1 8.0 23.8 5.7
20664-46-4 TEXTURE LIKING 0.019 -0.137 0.324 54 20.6 19.0 23.8 5.7 821-55-6 TEXTURE LIKING 0.018 0.135 0.329 54 3.5 8.2 23.8 5.7
53398-83-7 TEXTURE LIKING 0.018 0.133 0.338 54 5.0 4.6 23.8 5.7 29811-50-5 TEXTURE LIKING 0.017 -0.131 0.346 54 3.2 5.3 23.8 5.7
128-37-0 TEXTURE LIKING 0.017 0.129 0.352 54 4.1 3.7 23.8 5.7 140-11-4 TEXTURE LIKING 0.016 -0.127 0.359 54 11.1 8.6 23.8 5.7
4887-30-3 TEXTURE LIKING 0.016 0.126 0.363 54 16.9 32.5 23.8 5.7 75-85-4 TEXTURE LIKING 0.015 0.124 0.371 54 3.9 2.2 23.8 5.7 L* ext TEXTURE LIKING 0.015 -0.123 0.377 54 33.6 2.6 23.8 5.7
1191-16-8 TEXTURE LIKING 0.015 -0.121 0.385 54 5.5 7.0 23.8 5.7 GLUCOSE TEXTURE LIKING 0.013 0.115 0.408 54 1594.6 378.2 23.8 5.7
B* ext TEXTURE LIKING 0.013 -0.113 0.417 54 19.0 3.3 23.8 5.7 624-41-9 TEXTURE LIKING 0.012 -0.111 0.424 54 18.9 18.1 23.8 5.7
6728-26-3 TEXTURE LIKING 0.012 0.108 0.435 54 8666.5 3359.7 23.8 5.7 A* ext TEXTURE LIKING 0.010 0.099 0.475 54 36.4 3.1 23.8 5.7
2497-18-9 TEXTURE LIKING 0.008 -0.092 0.508 54 24.9 21.5 23.8 5.7 71-41-0 TEXTURE LIKING 0.008 0.087 0.530 54 1.0 1.3 23.8 5.7
589-38-8 TEXTURE LIKING 0.007 0.087 0.534 54 1.9 1.2 23.8 5.7 106-32-1 TEXTURE LIKING 0.007 -0.085 0.542 54 2.2 3.0 23.8 5.7 616-25-1 TEXTURE LIKING 0.007 0.082 0.555 54 15.9 7.3 23.8 5.7 106-70-7 TEXTURE LIKING 0.006 -0.076 0.587 54 252.7 164.0 23.8 5.7
91
Table 2-4. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
B* int TEXTURE LIKING 0.006 -0.075 0.588 54 25.8 4.5 23.8 5.7 7452-79-1 TEXTURE LIKING 0.005 0.072 0.607 54 50.0 31.0 23.8 5.7 105-54-4 TEXTURE LIKING 0.005 0.068 0.626 54 42.0 17.1 23.8 5.7
A* int TEXTURE LIKING 0.004 -0.060 0.666 54 28.8 7.6 23.8 5.7 628-63-7 TEXTURE LIKING 0.003 -0.055 0.693 54 4.6 1.7 23.8 5.7 591-78-6 TEXTURE LIKING 0.003 0.054 0.700 54 10.3 13.9 23.8 5.7
7786-58-5 TEXTURE LIKING 0.003 -0.052 0.707 54 12.2 28.4 23.8 5.7 FRUCTOSE TEXTURE LIKING 0.002 0.050 0.720 54 1766.7 381.5 23.8 5.7 1576-95-0 TEXTURE LIKING 0.002 0.047 0.736 54 2.1 2.0 23.8 5.7
CITRIC ACID TEXTURE LIKING 0.002 -0.047 0.736 54 741.0 147.2 23.8 5.7 112-14-1 TEXTURE LIKING 0.001 -0.028 0.843 54 18.3 24.0 23.8 5.7 105-37-3 TEXTURE LIKING 0.001 -0.026 0.851 54 10.1 14.1 23.8 5.7
29674-47-3 TEXTURE LIKING 0.001 0.023 0.867 54 5.0 5.0 23.8 5.7 108-10-1 TEXTURE LIKING 0.001 0.023 0.869 54 1.5 2.6 23.8 5.7
15111-96-3 TEXTURE LIKING 0.000 -0.022 0.875 54 1.2 1.2 23.8 5.7 623-42-7 TEXTURE LIKING 0.000 0.017 0.905 54 2780.2 1376.8 23.8 5.7 96-22-0 TEXTURE LIKING 0.000 0.015 0.915 54 51.2 18.6 23.8 5.7
L* int TEXTURE LIKING 0.000 -0.014 0.919 54 54.9 5.8 23.8 5.7 123-66-0 TEXTURE LIKING 0.000 -0.007 0.957 54 108.2 128.0 23.8 5.7
1534-08-3 TEXTURE LIKING 0.000 0.002 0.988 54 0.4 0.2 23.8 5.7 SSC SWEETNESS INTENSITY 0.690 0.831 0.000 54 7.4 1.4 23.0 4.8
TOTAL SUGAR SWEETNESS INTENSITY 0.687 0.829 0.000 54 4473.9 1037.2 23.0 4.8 SUCROSE SWEETNESS INTENSITY 0.445 0.667 0.000 54 1112.6 646.5 23.0 4.8 1629-58-9 SWEETNESS INTENSITY 0.377 0.614 0.000 54 117.9 65.9 23.0 4.8 GLUCOSE SWEETNESS INTENSITY 0.338 0.581 0.000 54 1594.6 378.2 23.0 4.8
FRUCTOSE SWEETNESS INTENSITY 0.300 0.548 0.000 54 1766.7 381.5 23.0 4.8 2639-63-6 SWEETNESS INTENSITY 0.296 0.544 0.000 54 10.8 13.0 23.0 4.8 2305-05-7 SWEETNESS INTENSITY 0.295 0.543 0.000 54 6.7 6.7 23.0 4.8 540-18-1 SWEETNESS INTENSITY 0.254 0.504 0.000 54 3.5 3.2 23.0 4.8
1576-87-0 SWEETNESS INTENSITY 0.242 0.492 0.000 54 37.5 20.1 23.0 4.8 142-92-7 SWEETNESS INTENSITY 0.239 0.489 0.000 54 53.5 49.7 23.0 4.8
60415-61-4 SWEETNESS INTENSITY 0.233 0.482 0.000 54 0.7 1.6 23.0 4.8 1576-86-9 SWEETNESS INTENSITY 0.217 0.466 0.000 54 37.8 21.7 23.0 4.8 109-21-7 SWEETNESS INTENSITY 0.198 0.445 0.001 54 72.1 157.2 23.0 4.8 111-71-7 SWEETNESS INTENSITY 0.195 0.441 0.001 54 3.2 2.3 23.0 4.8
3913-81-3 SWEETNESS INTENSITY 0.192 0.438 0.001 54 1.9 1.4 23.0 4.8 L* int SWEETNESS INTENSITY 0.187 0.432 0.001 54 54.9 5.8 23.0 4.8
109-19-3 SWEETNESS INTENSITY 0.184 0.429 0.001 54 2.7 3.8 23.0 4.8 5989-33-3 SWEETNESS INTENSITY 0.171 0.414 0.002 54 2.8 2.4 23.0 4.8 123-86-4 SWEETNESS INTENSITY 0.158 0.397 0.003 54 73.5 85.0 23.0 4.8 706-14-9 SWEETNESS INTENSITY 0.151 0.388 0.004 54 44.5 81.1 23.0 4.8 638-11-9 SWEETNESS INTENSITY 0.151 0.388 0.004 54 72.7 67.2 23.0 4.8 110-93-0 SWEETNESS INTENSITY 0.151 0.388 0.004 54 2.7 1.5 23.0 4.8 591-78-6 SWEETNESS INTENSITY 0.144 0.379 0.005 54 10.3 13.9 23.0 4.8
A* int SWEETNESS INTENSITY 0.139 -0.373 0.005 54 28.8 7.6 23.0 4.8 TOTAL VOLATILES SWEETNESS INTENSITY 0.139 0.373 0.005 54 15814.0 5238.5 23.0 4.8
124-19-6 SWEETNESS INTENSITY 0.139 0.372 0.006 54 8.5 7.5 23.0 4.8 5454-09-1 SWEETNESS INTENSITY 0.132 0.363 0.007 54 3.7 6.2 23.0 4.8
CITRIC ACID SWEETNESS INTENSITY 0.124 0.353 0.009 54 741.0 147.2 23.0 4.8 110-39-4 SWEETNESS INTENSITY 0.123 0.351 0.009 54 40.8 70.0 23.0 4.8
53398-83-7 SWEETNESS INTENSITY 0.123 0.351 0.009 54 5.0 4.6 23.0 4.8 104-76-7 SWEETNESS INTENSITY 0.118 0.343 0.011 54 6.0 4.9 23.0 4.8
5881-17-4 SWEETNESS INTENSITY 0.112 0.334 0.014 54 6.2 2.5 23.0 4.8 4077-47-8 SWEETNESS INTENSITY 0.109 0.330 0.015 54 11.7 8.3 23.0 4.8 110-43-0 SWEETNESS INTENSITY 0.106 0.326 0.016 54 14.8 19.6 23.0 4.8
TA SWEETNESS INTENSITY 0.094 0.307 0.024 54 0.8 0.1 23.0 4.8 616-25-1 SWEETNESS INTENSITY 0.094 0.307 0.024 54 15.9 7.3 23.0 4.8
10522-34-6 SWEETNESS INTENSITY 0.092 0.304 0.026 54 1.1 1.1 23.0 4.8 40716-66-3 SWEETNESS INTENSITY 0.092 0.303 0.026 54 84.3 107.5 23.0 4.8
623-42-7 SWEETNESS INTENSITY 0.085 0.292 0.032 54 2780.2 1376.8 23.0 4.8 2311-46-8 SWEETNESS INTENSITY 0.085 0.291 0.033 54 3.9 4.4 23.0 4.8 6728-26-3 SWEETNESS INTENSITY 0.078 0.278 0.041 54 8666.5 3359.7 23.0 4.8 105-66-8 SWEETNESS INTENSITY 0.077 0.278 0.042 54 5.0 3.7 23.0 4.8
B* int SWEETNESS INTENSITY 0.075 -0.275 0.044 54 25.8 4.5 23.0 4.8 4887-30-3 SWEETNESS INTENSITY 0.075 0.274 0.045 54 16.9 32.5 23.0 4.8 110-38-3 SWEETNESS INTENSITY 0.070 0.264 0.054 54 2.0 2.6 23.0 4.8
7786-58-5 SWEETNESS INTENSITY 0.069 0.262 0.056 54 12.2 28.4 23.0 4.8 112-14-1 SWEETNESS INTENSITY 0.066 0.257 0.061 54 18.3 24.0 23.0 4.8
2548-87-0 SWEETNESS INTENSITY 0.064 0.253 0.064 54 2.4 1.5 23.0 4.8 96-22-0 SWEETNESS INTENSITY 0.063 0.250 0.068 54 51.2 18.6 23.0 4.8
1191-16-8 SWEETNESS INTENSITY 0.063 -0.250 0.068 54 5.5 7.0 23.0 4.8 105-54-4 SWEETNESS INTENSITY 0.062 0.249 0.069 54 42.0 17.1 23.0 4.8 124-13-0 SWEETNESS INTENSITY 0.053 0.231 0.093 54 5.9 3.0 23.0 4.8
29674-47-3 SWEETNESS INTENSITY 0.051 0.226 0.101 54 5.0 5.0 23.0 4.8 pH SWEETNESS INTENSITY 0.048 0.220 0.110 54 3.7 0.2 23.0 4.8
71-41-0 SWEETNESS INTENSITY 0.045 0.213 0.122 54 1.0 1.3 23.0 4.8 628-63-7 SWEETNESS INTENSITY 0.040 0.199 0.149 54 4.6 1.7 23.0 4.8 556-24-1 SWEETNESS INTENSITY 0.039 0.198 0.151 54 46.6 57.0 23.0 4.8 564-94-3 SWEETNESS INTENSITY 0.030 0.173 0.211 54 6.5 7.4 23.0 4.8
20664-46-4 SWEETNESS INTENSITY 0.029 0.171 0.215 54 20.6 19.0 23.0 4.8 624-41-9 SWEETNESS INTENSITY 0.026 -0.162 0.243 54 18.9 18.1 23.0 4.8 539-82-2 SWEETNESS INTENSITY 0.025 0.158 0.255 54 3.3 3.9 23.0 4.8
1534-08-3 SWEETNESS INTENSITY 0.021 0.146 0.292 54 0.4 0.2 23.0 4.8 106-70-7 SWEETNESS INTENSITY 0.020 0.142 0.307 54 252.7 164.0 23.0 4.8
B* ext SWEETNESS INTENSITY 0.019 -0.137 0.324 54 19.0 3.3 23.0 4.8 116-53-0 SWEETNESS INTENSITY 0.018 0.133 0.339 54 19.7 16.0 23.0 4.8
A* ext SWEETNESS INTENSITY 0.017 0.130 0.348 54 36.4 3.1 23.0 4.8 78-70-6 SWEETNESS INTENSITY 0.017 0.130 0.350 54 128.8 113.0 23.0 4.8
92
Table 2-4. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
123-66-0 SWEETNESS INTENSITY 0.017 0.129 0.352 54 108.2 128.0 23.0 4.8 55514-48-2 SWEETNESS INTENSITY 0.014 -0.120 0.387 54 0.5 0.5 23.0 4.8 7452-79-1 SWEETNESS INTENSITY 0.013 0.116 0.405 54 50.0 31.0 23.0 4.8 821-55-6 SWEETNESS INTENSITY 0.013 0.113 0.416 54 3.5 8.2 23.0 4.8 66-25-1 SWEETNESS INTENSITY 0.011 0.104 0.455 54 2545.9 1722.0 23.0 4.8
928-95-0 SWEETNESS INTENSITY 0.010 -0.101 0.468 54 66.8 61.7 23.0 4.8 589-38-8 SWEETNESS INTENSITY 0.009 0.097 0.484 54 1.9 1.2 23.0 4.8 110-62-3 SWEETNESS INTENSITY 0.009 -0.095 0.496 54 7.9 8.9 23.0 4.8 109-60-4 SWEETNESS INTENSITY 0.009 -0.095 0.496 54 3.8 2.7 23.0 4.8 111-27-3 SWEETNESS INTENSITY 0.009 -0.094 0.501 54 45.5 94.6 23.0 4.8 140-11-4 SWEETNESS INTENSITY 0.009 -0.093 0.501 54 11.1 8.6 23.0 4.8
MALIC ACID SWEETNESS INTENSITY 0.009 -0.093 0.506 54 212.4 51.6 23.0 4.8 FORCE SWEETNESS INTENSITY 0.005 -0.074 0.594 54 0.6 0.2 23.0 4.8 128-37-0 SWEETNESS INTENSITY 0.004 0.061 0.664 54 4.1 3.7 23.0 4.8 106-32-1 SWEETNESS INTENSITY 0.003 -0.055 0.694 54 2.2 3.0 23.0 4.8 623-43-8 SWEETNESS INTENSITY 0.003 -0.050 0.718 54 3.4 3.4 23.0 4.8 108-10-1 SWEETNESS INTENSITY 0.002 -0.050 0.721 54 1.5 2.6 23.0 4.8
29811-50-5 SWEETNESS INTENSITY 0.002 0.048 0.728 54 3.2 5.3 23.0 4.8 15111-96-3 SWEETNESS INTENSITY 0.002 0.048 0.731 54 1.2 1.2 23.0 4.8 2432-51-1 SWEETNESS INTENSITY 0.002 0.041 0.770 54 4.4 5.8 23.0 4.8 624-24-8 SWEETNESS INTENSITY 0.002 0.039 0.779 54 5.6 3.7 23.0 4.8 134-20-3 SWEETNESS INTENSITY 0.001 0.030 0.827 54 0.1 0.7 23.0 4.8
1576-95-0 SWEETNESS INTENSITY 0.000 0.018 0.899 54 2.1 2.0 23.0 4.8 123-92-2 SWEETNESS INTENSITY 0.000 -0.017 0.905 54 23.0 21.5 23.0 4.8
2497-18-9 SWEETNESS INTENSITY 0.000 -0.012 0.934 54 24.9 21.5 23.0 4.8 L* ext SWEETNESS INTENSITY 0.000 0.010 0.943 54 33.6 2.6 23.0 4.8
103-09-3 SWEETNESS INTENSITY 0.000 -0.007 0.960 54 3.0 1.1 23.0 4.8 105-37-3 SWEETNESS INTENSITY 0.000 0.005 0.973 54 10.1 14.1 23.0 4.8 75-85-4 SWEETNESS INTENSITY 0.000 -0.001 0.995 54 3.9 2.2 23.0 4.8 96-04-8 SWEETNESS INTENSITY 0.000 -0.001 0.996 54 3.1 8.0 23.0 4.8
TA SOURNESS INTENSITY 0.314 0.561 0.000 54 0.8 0.1 18.1 3.1 MALIC ACID SOURNESS INTENSITY 0.189 0.435 0.001 54 212.4 51.6 18.1 3.1 CITRIC ACID SOURNESS INTENSITY 0.146 0.382 0.004 54 741.0 147.2 18.1 3.1
134-20-3 SOURNESS INTENSITY 0.137 -0.370 0.006 54 0.1 0.7 18.1 3.1 pH SOURNESS INTENSITY 0.118 -0.344 0.011 54 3.7 0.2 18.1 3.1
15111-96-3 SOURNESS INTENSITY 0.106 -0.325 0.016 54 1.2 1.2 18.1 3.1 624-41-9 SOURNESS INTENSITY 0.097 0.311 0.022 54 18.9 18.1 18.1 3.1
FRUCTOSE SOURNESS INTENSITY 0.089 -0.298 0.029 54 1766.7 381.5 18.1 3.1 GLUCOSE SOURNESS INTENSITY 0.075 -0.274 0.045 54 1594.6 378.2 18.1 3.1 4887-30-3 SOURNESS INTENSITY 0.073 -0.270 0.048 54 16.9 32.5 18.1 3.1 1191-16-8 SOURNESS INTENSITY 0.068 0.261 0.056 54 5.5 7.0 18.1 3.1
78-70-6 SOURNESS INTENSITY 0.068 0.260 0.058 54 128.8 113.0 18.1 3.1 5454-09-1 SOURNESS INTENSITY 0.067 -0.259 0.058 54 3.7 6.2 18.1 3.1 110-39-4 SOURNESS INTENSITY 0.066 -0.257 0.061 54 40.8 70.0 18.1 3.1 589-38-8 SOURNESS INTENSITY 0.062 0.248 0.070 54 1.9 1.2 18.1 3.1 624-24-8 SOURNESS INTENSITY 0.054 -0.233 0.090 54 5.6 3.7 18.1 3.1 928-95-0 SOURNESS INTENSITY 0.050 0.223 0.106 54 66.8 61.7 18.1 3.1 128-37-0 SOURNESS INTENSITY 0.049 0.221 0.108 54 4.1 3.7 18.1 3.1 110-62-3 SOURNESS INTENSITY 0.047 -0.218 0.113 54 7.9 8.9 18.1 3.1
2497-18-9 SOURNESS INTENSITY 0.036 0.189 0.171 54 24.9 21.5 18.1 3.1 111-27-3 SOURNESS INTENSITY 0.036 0.189 0.172 54 45.5 94.6 18.1 3.1 96-04-8 SOURNESS INTENSITY 0.033 0.182 0.188 54 3.1 8.0 18.1 3.1
104-76-7 SOURNESS INTENSITY 0.032 -0.178 0.198 54 6.0 4.9 18.1 3.1 10522-34-6 SOURNESS INTENSITY 0.031 -0.177 0.201 54 1.1 1.1 18.1 3.1
140-11-4 SOURNESS INTENSITY 0.031 0.176 0.203 54 11.1 8.6 18.1 3.1 L* ext SOURNESS INTENSITY 0.030 0.172 0.212 54 33.6 2.6 18.1 3.1
556-24-1 SOURNESS INTENSITY 0.028 -0.167 0.226 54 46.6 57.0 18.1 3.1 55514-48-2 SOURNESS INTENSITY 0.027 0.165 0.232 54 0.5 0.5 18.1 3.1 2548-87-0 SOURNESS INTENSITY 0.027 0.165 0.233 54 2.4 1.5 18.1 3.1 623-43-8 SOURNESS INTENSITY 0.024 -0.154 0.267 54 3.4 3.4 18.1 3.1
TOTAL SUGAR SOURNESS INTENSITY 0.022 -0.148 0.287 54 4473.9 1037.2 18.1 3.1 L* int SOURNESS INTENSITY 0.021 -0.145 0.296 54 54.9 5.8 18.1 3.1 SSC SOURNESS INTENSITY 0.020 -0.142 0.305 54 7.4 1.4 18.1 3.1
112-14-1 SOURNESS INTENSITY 0.020 -0.141 0.311 54 18.3 24.0 18.1 3.1 B* ext SOURNESS INTENSITY 0.020 0.140 0.312 54 19.0 3.3 18.1 3.1 B* int SOURNESS INTENSITY 0.020 0.140 0.314 54 25.8 4.5 18.1 3.1
103-09-3 SOURNESS INTENSITY 0.017 0.129 0.354 54 3.0 1.1 18.1 3.1 1534-08-3 SOURNESS INTENSITY 0.016 -0.127 0.359 54 0.4 0.2 18.1 3.1 106-70-7 SOURNESS INTENSITY 0.016 -0.125 0.366 54 252.7 164.0 18.1 3.1 110-43-0 SOURNESS INTENSITY 0.015 -0.121 0.381 54 14.8 19.6 18.1 3.1
53398-83-7 SOURNESS INTENSITY 0.014 -0.120 0.389 54 5.0 4.6 18.1 3.1 5989-33-3 SOURNESS INTENSITY 0.014 0.117 0.398 54 2.8 2.4 18.1 3.1 5881-17-4 SOURNESS INTENSITY 0.014 0.117 0.401 54 6.2 2.5 18.1 3.1 7452-79-1 SOURNESS INTENSITY 0.013 -0.114 0.411 54 50.0 31.0 18.1 3.1 1576-95-0 SOURNESS INTENSITY 0.013 0.114 0.413 54 2.1 2.0 18.1 3.1
20664-46-4 SOURNESS INTENSITY 0.012 0.111 0.423 54 20.6 19.0 18.1 3.1 29811-50-5 SOURNESS INTENSITY 0.012 0.108 0.436 54 3.2 5.3 18.1 3.1
110-38-3 SOURNESS INTENSITY 0.012 -0.108 0.437 54 2.0 2.6 18.1 3.1 2639-63-6 SOURNESS INTENSITY 0.011 -0.107 0.443 54 10.8 13.0 18.1 3.1 123-92-2 SOURNESS INTENSITY 0.011 0.105 0.450 54 23.0 21.5 18.1 3.1 109-21-7 SOURNESS INTENSITY 0.011 -0.105 0.451 54 72.1 157.2 18.1 3.1 110-93-0 SOURNESS INTENSITY 0.011 0.105 0.452 54 2.7 1.5 18.1 3.1
29674-47-3 SOURNESS INTENSITY 0.011 0.104 0.454 54 5.0 5.0 18.1 3.1 SUCROSE SOURNESS INTENSITY 0.010 0.099 0.476 54 1112.6 646.5 18.1 3.1 4077-47-8 SOURNESS INTENSITY 0.009 0.092 0.507 54 11.7 8.3 18.1 3.1 539-82-2 SOURNESS INTENSITY 0.008 0.092 0.510 54 3.3 3.9 18.1 3.1 591-78-6 SOURNESS INTENSITY 0.008 0.091 0.514 54 10.3 13.9 18.1 3.1
A* int SOURNESS INTENSITY 0.008 0.088 0.525 54 28.8 7.6 18.1 3.1
93
Table 2-4. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
109-19-3 SOURNESS INTENSITY 0.007 -0.086 0.537 54 2.7 3.8 18.1 3.1 60415-61-4 SOURNESS INTENSITY 0.007 -0.084 0.545 54 0.7 1.6 18.1 3.1
142-92-7 SOURNESS INTENSITY 0.007 -0.081 0.559 54 53.5 49.7 18.1 3.1 111-71-7 SOURNESS INTENSITY 0.006 0.075 0.589 54 3.2 2.3 18.1 3.1 106-32-1 SOURNESS INTENSITY 0.006 0.075 0.591 54 2.2 3.0 18.1 3.1 66-25-1 SOURNESS INTENSITY 0.005 0.072 0.605 54 2545.9 1722.0 18.1 3.1
564-94-3 SOURNESS INTENSITY 0.005 0.072 0.606 54 6.5 7.4 18.1 3.1 116-53-0 SOURNESS INTENSITY 0.005 -0.068 0.625 54 19.7 16.0 18.1 3.1 109-60-4 SOURNESS INTENSITY 0.005 0.068 0.626 54 3.8 2.7 18.1 3.1
2432-51-1 SOURNESS INTENSITY 0.004 -0.064 0.644 54 4.4 5.8 18.1 3.1 1576-86-9 SOURNESS INTENSITY 0.004 0.064 0.645 54 37.8 21.7 18.1 3.1 124-13-0 SOURNESS INTENSITY 0.004 0.061 0.660 54 5.9 3.0 18.1 3.1
3913-81-3 SOURNESS INTENSITY 0.004 -0.060 0.669 54 1.9 1.4 18.1 3.1 1629-58-9 SOURNESS INTENSITY 0.003 0.058 0.678 54 117.9 65.9 18.1 3.1 628-63-7 SOURNESS INTENSITY 0.003 -0.052 0.709 54 4.6 1.7 18.1 3.1
7786-58-5 SOURNESS INTENSITY 0.003 -0.051 0.713 54 12.2 28.4 18.1 3.1 96-22-0 SOURNESS INTENSITY 0.002 0.050 0.721 54 51.2 18.6 18.1 3.1
616-25-1 SOURNESS INTENSITY 0.002 0.048 0.731 54 15.9 7.3 18.1 3.1 75-85-4 SOURNESS INTENSITY 0.002 0.047 0.737 54 3.9 2.2 18.1 3.1
706-14-9 SOURNESS INTENSITY 0.002 -0.040 0.772 54 44.5 81.1 18.1 3.1 A* ext SOURNESS INTENSITY 0.002 -0.040 0.774 54 36.4 3.1 18.1 3.1
2311-46-8 SOURNESS INTENSITY 0.002 0.039 0.779 54 3.9 4.4 18.1 3.1 TOTAL VOLATILES SOURNESS INTENSITY 0.001 0.029 0.834 54 15814.0 5238.5 18.1 3.1
40716-66-3 SOURNESS INTENSITY 0.001 -0.029 0.838 54 84.3 107.5 18.1 3.1 123-66-0 SOURNESS INTENSITY 0.001 -0.027 0.849 54 108.2 128.0 18.1 3.1
1576-87-0 SOURNESS INTENSITY 0.001 0.026 0.851 54 37.5 20.1 18.1 3.1 71-41-0 SOURNESS INTENSITY 0.001 -0.025 0.855 54 1.0 1.3 18.1 3.1
124-19-6 SOURNESS INTENSITY 0.000 0.021 0.883 54 8.5 7.5 18.1 3.1 108-10-1 SOURNESS INTENSITY 0.000 0.020 0.886 54 1.5 2.6 18.1 3.1 638-11-9 SOURNESS INTENSITY 0.000 -0.018 0.899 54 72.7 67.2 18.1 3.1
6728-26-3 SOURNESS INTENSITY 0.000 0.016 0.909 54 8666.5 3359.7 18.1 3.1 123-86-4 SOURNESS INTENSITY 0.000 -0.016 0.910 54 73.5 85.0 18.1 3.1 105-66-8 SOURNESS INTENSITY 0.000 0.011 0.938 54 5.0 3.7 18.1 3.1 105-54-4 SOURNESS INTENSITY 0.000 -0.011 0.939 54 42.0 17.1 18.1 3.1 FORCE SOURNESS INTENSITY 0.000 0.008 0.953 54 0.6 0.2 18.1 3.1 540-18-1 SOURNESS INTENSITY 0.000 -0.008 0.957 54 3.5 3.2 18.1 3.1
2305-05-7 SOURNESS INTENSITY 0.000 -0.007 0.962 54 6.7 6.7 18.1 3.1 105-37-3 SOURNESS INTENSITY 0.000 -0.006 0.964 54 10.1 14.1 18.1 3.1 623-42-7 SOURNESS INTENSITY 0.000 -0.006 0.966 54 2780.2 1376.8 18.1 3.1 821-55-6 SOURNESS INTENSITY 0.000 0.001 0.997 54 3.5 8.2 18.1 3.1
SSC STRAWBERRY FLAVOR INTENSITY 0.584 0.764 0.000 54 7.4 1.4 26.9 3.9 TOTAL SUGAR STRAWBERRY FLAVOR INTENSITY 0.569 0.755 0.000 54 4473.9 1037.2 26.9 3.9
SUCROSE STRAWBERRY FLAVOR INTENSITY 0.498 0.705 0.000 54 1112.6 646.5 26.9 3.9 1629-58-9 STRAWBERRY FLAVOR INTENSITY 0.356 0.597 0.000 54 117.9 65.9 26.9 3.9 2305-05-7 STRAWBERRY FLAVOR INTENSITY 0.283 0.532 0.000 54 6.7 6.7 26.9 3.9 540-18-1 STRAWBERRY FLAVOR INTENSITY 0.260 0.509 0.000 54 3.5 3.2 26.9 3.9
TA STRAWBERRY FLAVOR INTENSITY 0.256 0.506 0.000 54 0.8 0.1 26.9 3.9 1576-87-0 STRAWBERRY FLAVOR INTENSITY 0.239 0.488 0.000 54 37.5 20.1 26.9 3.9 2639-63-6 STRAWBERRY FLAVOR INTENSITY 0.235 0.485 0.000 54 10.8 13.0 26.9 3.9
CITRIC ACID STRAWBERRY FLAVOR INTENSITY 0.235 0.485 0.000 54 741.0 147.2 26.9 3.9 60415-61-4 STRAWBERRY FLAVOR INTENSITY 0.233 0.482 0.000 54 0.7 1.6 26.9 3.9
142-92-7 STRAWBERRY FLAVOR INTENSITY 0.227 0.477 0.000 54 53.5 49.7 26.9 3.9 1576-86-9 STRAWBERRY FLAVOR INTENSITY 0.222 0.472 0.000 54 37.8 21.7 26.9 3.9 5989-33-3 STRAWBERRY FLAVOR INTENSITY 0.208 0.456 0.001 54 2.8 2.4 26.9 3.9 GLUCOSE STRAWBERRY FLAVOR INTENSITY 0.205 0.453 0.001 54 1594.6 378.2 26.9 3.9 123-86-4 STRAWBERRY FLAVOR INTENSITY 0.205 0.453 0.001 54 73.5 85.0 26.9 3.9 111-71-7 STRAWBERRY FLAVOR INTENSITY 0.201 0.448 0.001 54 3.2 2.3 26.9 3.9 109-21-7 STRAWBERRY FLAVOR INTENSITY 0.194 0.440 0.001 54 72.1 157.2 26.9 3.9 591-78-6 STRAWBERRY FLAVOR INTENSITY 0.180 0.425 0.001 54 10.3 13.9 26.9 3.9 109-19-3 STRAWBERRY FLAVOR INTENSITY 0.179 0.424 0.001 54 2.7 3.8 26.9 3.9 706-14-9 STRAWBERRY FLAVOR INTENSITY 0.179 0.423 0.001 54 44.5 81.1 26.9 3.9
TOTAL VOLATILES STRAWBERRY FLAVOR INTENSITY 0.167 0.409 0.002 54 15814.0 5238.5 26.9 3.9 FRUCTOSE STRAWBERRY FLAVOR INTENSITY 0.166 0.407 0.002 54 1766.7 381.5 26.9 3.9
638-11-9 STRAWBERRY FLAVOR INTENSITY 0.164 0.405 0.002 54 72.7 67.2 26.9 3.9 3913-81-3 STRAWBERRY FLAVOR INTENSITY 0.158 0.398 0.003 54 1.9 1.4 26.9 3.9 616-25-1 STRAWBERRY FLAVOR INTENSITY 0.154 0.392 0.003 54 15.9 7.3 26.9 3.9
5881-17-4 STRAWBERRY FLAVOR INTENSITY 0.153 0.391 0.003 54 6.2 2.5 26.9 3.9 110-93-0 STRAWBERRY FLAVOR INTENSITY 0.137 0.370 0.006 54 2.7 1.5 26.9 3.9 124-19-6 STRAWBERRY FLAVOR INTENSITY 0.129 0.359 0.008 54 8.5 7.5 26.9 3.9
40716-66-3 STRAWBERRY FLAVOR INTENSITY 0.112 0.335 0.013 54 84.3 107.5 26.9 3.9 L* int STRAWBERRY FLAVOR INTENSITY 0.109 0.330 0.015 54 54.9 5.8 26.9 3.9
4077-47-8 STRAWBERRY FLAVOR INTENSITY 0.108 0.328 0.015 54 11.7 8.3 26.9 3.9 2311-46-8 STRAWBERRY FLAVOR INTENSITY 0.103 0.322 0.018 54 3.9 4.4 26.9 3.9 110-43-0 STRAWBERRY FLAVOR INTENSITY 0.101 0.318 0.019 54 14.8 19.6 26.9 3.9 623-42-7 STRAWBERRY FLAVOR INTENSITY 0.097 0.312 0.022 54 2780.2 1376.8 26.9 3.9
6728-26-3 STRAWBERRY FLAVOR INTENSITY 0.096 0.310 0.022 54 8666.5 3359.7 26.9 3.9 105-54-4 STRAWBERRY FLAVOR INTENSITY 0.089 0.299 0.028 54 42.0 17.1 26.9 3.9
A* int STRAWBERRY FLAVOR INTENSITY 0.087 -0.295 0.030 54 28.8 7.6 26.9 3.9 110-62-3 STRAWBERRY FLAVOR INTENSITY 0.079 -0.281 0.039 54 7.9 8.9 26.9 3.9 110-39-4 STRAWBERRY FLAVOR INTENSITY 0.079 0.281 0.040 54 40.8 70.0 26.9 3.9 78-70-6 STRAWBERRY FLAVOR INTENSITY 0.074 0.272 0.046 54 128.8 113.0 26.9 3.9
29674-47-3 STRAWBERRY FLAVOR INTENSITY 0.069 0.263 0.055 54 5.0 5.0 26.9 3.9 5454-09-1 STRAWBERRY FLAVOR INTENSITY 0.067 0.259 0.059 54 3.7 6.2 26.9 3.9
96-22-0 STRAWBERRY FLAVOR INTENSITY 0.066 0.258 0.060 54 51.2 18.6 26.9 3.9 104-76-7 STRAWBERRY FLAVOR INTENSITY 0.064 0.252 0.066 54 6.0 4.9 26.9 3.9
10522-34-6 STRAWBERRY FLAVOR INTENSITY 0.060 0.246 0.073 54 1.1 1.1 26.9 3.9 7786-58-5 STRAWBERRY FLAVOR INTENSITY 0.059 0.243 0.077 54 12.2 28.4 26.9 3.9 124-13-0 STRAWBERRY FLAVOR INTENSITY 0.057 0.239 0.081 54 5.9 3.0 26.9 3.9
94
Table 2-4. Continued.
X Y R2 CORR COEFF p-VALUE n MEAN X STD DEV X MEAN Y STD DEV Y
112-14-1 STRAWBERRY FLAVOR INTENSITY 0.056 0.237 0.084 54 18.3 24.0 26.9 3.9 2548-87-0 STRAWBERRY FLAVOR INTENSITY 0.056 0.236 0.086 54 2.4 1.5 26.9 3.9 628-63-7 STRAWBERRY FLAVOR INTENSITY 0.042 0.206 0.135 54 4.6 1.7 26.9 3.9
B* int STRAWBERRY FLAVOR INTENSITY 0.039 -0.198 0.152 54 25.8 4.5 26.9 3.9 105-66-8 STRAWBERRY FLAVOR INTENSITY 0.037 0.193 0.162 54 5.0 3.7 26.9 3.9
20664-46-4 STRAWBERRY FLAVOR INTENSITY 0.037 0.193 0.162 54 20.6 19.0 26.9 3.9 564-94-3 STRAWBERRY FLAVOR INTENSITY 0.037 0.192 0.165 54 6.5 7.4 26.9 3.9
4887-30-3 STRAWBERRY FLAVOR INTENSITY 0.034 0.185 0.180 54 16.9 32.5 26.9 3.9 110-38-3 STRAWBERRY FLAVOR INTENSITY 0.031 0.176 0.204 54 2.0 2.6 26.9 3.9
53398-83-7 STRAWBERRY FLAVOR INTENSITY 0.029 0.172 0.215 54 5.0 4.6 26.9 3.9 539-82-2 STRAWBERRY FLAVOR INTENSITY 0.026 0.160 0.247 54 3.3 3.9 26.9 3.9 134-20-3 STRAWBERRY FLAVOR INTENSITY 0.021 -0.145 0.295 54 0.1 0.7 26.9 3.9
29811-50-5 STRAWBERRY FLAVOR INTENSITY 0.020 0.143 0.303 54 3.2 5.3 26.9 3.9 556-24-1 STRAWBERRY FLAVOR INTENSITY 0.019 0.137 0.324 54 46.6 57.0 26.9 3.9 589-38-8 STRAWBERRY FLAVOR INTENSITY 0.018 0.136 0.328 54 1.9 1.2 26.9 3.9 821-55-6 STRAWBERRY FLAVOR INTENSITY 0.017 0.130 0.348 54 3.5 8.2 26.9 3.9
2432-51-1 STRAWBERRY FLAVOR INTENSITY 0.017 -0.129 0.351 54 4.4 5.8 26.9 3.9 7452-79-1 STRAWBERRY FLAVOR INTENSITY 0.016 0.125 0.369 54 50.0 31.0 26.9 3.9
66-25-1 STRAWBERRY FLAVOR INTENSITY 0.016 0.125 0.369 54 2545.9 1722.0 26.9 3.9 116-53-0 STRAWBERRY FLAVOR INTENSITY 0.015 0.122 0.379 54 19.7 16.0 26.9 3.9 128-37-0 STRAWBERRY FLAVOR INTENSITY 0.013 0.115 0.407 54 4.1 3.7 26.9 3.9
pH STRAWBERRY FLAVOR INTENSITY 0.010 0.102 0.464 54 3.7 0.2 26.9 3.9 B* ext STRAWBERRY FLAVOR INTENSITY 0.009 -0.097 0.488 54 19.0 3.3 26.9 3.9
106-70-7 STRAWBERRY FLAVOR INTENSITY 0.009 0.096 0.491 54 252.7 164.0 26.9 3.9 624-24-8 STRAWBERRY FLAVOR INTENSITY 0.009 -0.094 0.498 54 5.6 3.7 26.9 3.9 623-43-8 STRAWBERRY FLAVOR INTENSITY 0.008 -0.088 0.529 54 3.4 3.4 26.9 3.9
1534-08-3 STRAWBERRY FLAVOR INTENSITY 0.007 0.086 0.535 54 0.4 0.2 26.9 3.9 71-41-0 STRAWBERRY FLAVOR INTENSITY 0.007 0.084 0.548 54 1.0 1.3 26.9 3.9
123-66-0 STRAWBERRY FLAVOR INTENSITY 0.006 0.078 0.576 54 108.2 128.0 26.9 3.9 A* ext STRAWBERRY FLAVOR INTENSITY 0.005 0.073 0.599 54 36.4 3.1 26.9 3.9
15111-96-3 STRAWBERRY FLAVOR INTENSITY 0.005 -0.071 0.608 54 1.2 1.2 26.9 3.9 106-32-1 STRAWBERRY FLAVOR INTENSITY 0.005 -0.070 0.616 54 2.2 3.0 26.9 3.9
1191-16-8 STRAWBERRY FLAVOR INTENSITY 0.004 -0.064 0.646 54 5.5 7.0 26.9 3.9 75-85-4 STRAWBERRY FLAVOR INTENSITY 0.004 0.059 0.670 54 3.9 2.2 26.9 3.9
105-37-3 STRAWBERRY FLAVOR INTENSITY 0.002 -0.049 0.723 54 10.1 14.1 26.9 3.9 108-10-1 STRAWBERRY FLAVOR INTENSITY 0.002 -0.048 0.729 54 1.5 2.6 26.9 3.9 140-11-4 STRAWBERRY FLAVOR INTENSITY 0.002 0.048 0.729 54 11.1 8.6 26.9 3.9 FORCE STRAWBERRY FLAVOR INTENSITY 0.002 -0.048 0.730 54 0.6 0.2 26.9 3.9 111-27-3 STRAWBERRY FLAVOR INTENSITY 0.002 -0.045 0.744 54 45.5 94.6 26.9 3.9
2497-18-9 STRAWBERRY FLAVOR INTENSITY 0.002 0.045 0.746 54 24.9 21.5 26.9 3.9 624-41-9 STRAWBERRY FLAVOR INTENSITY 0.002 0.045 0.748 54 18.9 18.1 26.9 3.9 96-04-8 STRAWBERRY FLAVOR INTENSITY 0.002 0.040 0.776 54 3.1 8.0 26.9 3.9
109-60-4 STRAWBERRY FLAVOR INTENSITY 0.001 -0.037 0.792 54 3.8 2.7 26.9 3.9 L* ext STRAWBERRY FLAVOR INTENSITY 0.001 0.034 0.809 54 33.6 2.6 26.9 3.9
123-92-2 STRAWBERRY FLAVOR INTENSITY 0.001 0.032 0.819 54 23.0 21.5 26.9 3.9 55514-48-2 STRAWBERRY FLAVOR INTENSITY 0.000 -0.020 0.884 54 0.5 0.5 26.9 3.9
MALIC ACID STRAWBERRY FLAVOR INTENSITY 0.000 0.015 0.914 54 212.4 51.6 26.9 3.9 928-95-0 STRAWBERRY FLAVOR INTENSITY 0.000 -0.010 0.943 54 66.8 61.7 26.9 3.9 103-09-3 STRAWBERRY FLAVOR INTENSITY 0.000 0.006 0.968 54 3.0 1.1 26.9 3.9
1576-95-0 STRAWBERRY FLAVOR INTENSITY 0.000 -0.003 0.983 54 2.1 2.0 26.9 3.9
Note: Regression of chemical and physical measures of fruit (X) and panel responses (Y). Coefficient of determination (R2), correlation coefficient, p-value, sample size (n), mean and standard deviation of X and Y derived from bivariate fit in JMP 8.
95
Table 2-5. Multiple regression for identification of sweetness enhancing volatiles.
CAS # FRUCTOSE
t RATIO FRUCTOSE
p-VALUE
SUCROSE t RATIO
SUCROSE p-VALUE
GLUCOSE
t RATIO GLUCOSE p-VALUE
1629-58-9 5.097 0 * 2.41 0.02 * 4.696 0 * 1576-87-0 4.566 0 * 1.024 0.311 4.301 0 * 1576-86-9 4.16 0 * 0.935 0.354 3.915 0 * 2305-05-7 3.933 0 * 2.784 0.008 * 3.549 0.001 * 3913-81-3 3.694 0.001 * 1.411 0.164 3.494 0.001 * 124-19-6 3.696 0.001 * 0.226 0.822 3.402 0.001 *
6728-26-3 3.349 0.002 * -0.816 0.418 3.314 0.002 * 591-78-6 2.807 0.007 * 0.767 0.447 2.788 0.007 *
5881-17-4 2.894 0.006 * 0.608 0.546 2.662 0.01 * 540-18-1 2.71 0.009 * 2.292 0.026 * 2.515 0.015 *
2639-63-6 2.865 0.006 * 2.892 0.006 * 2.512 0.015 * 105-54-4 2.533 0.014 * 0.034 0.973 2.493 0.016 * 564-94-3 2.588 0.013 * -1.322 0.192 2.455 0.018 * 111-71-7 2.599 0.012 * 1.342 0.186 2.283 0.027 *
4077-47-8 2.414 0.019 * 0.299 0.766 2.185 0.034 * 110-93-0 2.527 0.015 * 1.43 0.159 2.165 0.035 * 638-11-9 2.311 0.025 * 1.256 0.215 2.14 0.037 * 142-92-7 2.346 0.023 * 2.943 0.005 * 2.096 0.041 *
60415-61-4 2.309 0.025 * 2.119 0.039 * 2.062 0.044 * 116-53-0 2.01 0.05 * -0.286 0.776 2.035 0.047 * 123-86-4 2.179 0.034 * 1.147 0.257 2.008 0.05 *
7452-79-1 1.959 0.056 -0.785 0.436 1.993 0.052 * 109-21-7 2.181 0.034 * 1.65 0.105 1.961 0.055 109-19-3 2.005 0.05 * 1.662 0.103 1.954 0.056 616-25-1 1.773 0.082 0.795 0.43 1.628 0.11
5454-09-1 1.804 0.077 2.085 0.042 * 1.579 0.12 96-22-0 1.82 0.075 0.912 0.366 1.576 0.121
5989-33-3 1.869 0.067 1.953 0.056 1.561 0.125 2548-87-0 1.76 0.084 0.067 0.947 1.509 0.138 623-42-7 1.455 0.152 0.419 0.677 1.452 0.153
29674-47-3 1.339 0.187 0.035 0.972 1.362 0.179 53398-83-7 1.482 0.144 2.556 0.014 * 1.283 0.205 40716-66-3 1.521 0.134 1 0.322 1.202 0.235
66-25-1 1.229 0.225 0.21 0.835 1.178 0.244 104-76-7 1.189 0.24 2.046 0.046 * 0.982 0.331 556-24-1 0.732 0.468 0.972 0.336 0.88 0.383 706-14-9 1.247 0.218 1.65 0.105 0.879 0.384 110-39-4 0.96 0.341 2.645 0.011 * 0.814 0.419 628-63-7 0.882 0.382 0.427 0.671 0.749 0.457 78-70-6 0.872 0.387 -0.1 0.921 0.7 0.487 124-13-0 0.871 0.388 0.169 0.866 0.685 0.497 75-85-4 0.736 0.465 -0.306 0.761 0.667 0.508 110-43-0 1.054 0.297 1.899 0.063 0.657 0.514 105-66-8 0.88 0.383 2.421 0.019 * 0.638 0.526 623-43-8 0.248 0.805 -1.396 0.169 0.54 0.592
1534-08-3 0.488 0.628 1.035 0.305 0.429 0.67 71-41-0 0.448 0.656 1.938 0.058 0.296 0.769
10522-34-6 0.536 0.594 2.049 0.046 * 0.288 0.775 112-14-1 0.413 0.681 2.292 0.026 * 0.284 0.777
4887-30-3 0.392 0.697 2.71 0.009 * 0.254 0.801 7786-58-5 0.362 0.718 2.027 0.048 * 0.227 0.821 103-09-3 0.172 0.864 -1.053 0.297 0.21 0.835 134-20-3 -0.009 0.993 1.386 0.172 0.2 0.842
15111-96-3 0.23 0.819 0.927 0.358 0.192 0.849 110-38-3 0.281 0.78 2.621 0.012 * 0.055 0.956 96-04-8 0.142 0.887 -0.646 0.521 0.002 0.998 123-66-0 0.066 0.948 1.064 0.292 -0.001 0.999
2311-46-8 0.238 0.813 2.211 0.032 * -0.058 0.954 29811-50-5 0.016 0.987 0.358 0.722 -0.098 0.922 1576-95-0 -0.186 0.853 -0.304 0.762 -0.231 0.819 2497-18-9 -0.313 0.756 -0.056 0.955 -0.331 0.742
96
Table 2-5. Continued.
CAS # FRUCTOSE
t RATIO FRUCTOSE
p-VALUE
SUCROSE t RATIO
SUCROSE p-VALUE
GLUCOSE
t RATIO GLUCOSE p-VALUE
20664-46-4 -0.17 0.865 1.383 0.173 -0.395 0.694 624-24-8 -0.406 0.686 0.662 0.511 -0.416 0.679 589-38-8 -0.217 0.829 0.592 0.557 -0.427 0.671 109-60-4 -0.491 0.626 -0.224 0.823 -0.454 0.652 821-55-6 -0.267 0.791 1.192 0.239 -0.467 0.642 624-41-9 -0.433 0.667 -1.323 0.192 -0.494 0.624 140-11-4 -0.361 0.72 -1.357 0.181 -0.513 0.61
1191-16-8 -0.581 0.564 -2.268 0.028 * -0.529 0.599 106-70-7 -0.321 0.75 0.802 0.426 -0.531 0.598 110-62-3 -0.572 0.57 0.997 0.323 -0.568 0.573 105-37-3 -0.623 0.536 1.964 0.055 -0.674 0.503
55514-48-2 -0.644 0.523 -0.889 0.378 -0.675 0.502 123-92-2 -0.725 0.472 0.108 0.914 -0.771 0.444 539-82-2 -0.48 0.633 2.273 0.027 * -0.802 0.426
2432-51-1 -0.956 0.344 2.033 0.047 * -1.092 0.28 128-37-0 -0.856 0.396 0.482 0.632 -1.17 0.247 111-27-3 -1.253 0.216 -0.542 0.59 -1.481 0.145 928-95-0 -1.842 0.071 -0.516 0.608 -1.521 0.134 108-10-1 -2.185 0.034 * 0.898 0.374 -2.138 0.037 * 106-32-1 -1.436 0.157 0.193 0.848 -2.36 0.022 *
Note: Individual volatile compound concentrations are regressed against perceived sweetness intensity independent of effect from glucose, fructose, or sucrose, separately. Thirty compounds (asterisk) were found to enhance intensity of sweetness independent of at least one of the three sugars. Six compounds were found to significantly enhance intensity of sweetness independent of all three sugars (α = 0.05). Analysis conducted using the “enter” method in SPSS
97
Table 2-6. Index of CAS registry number, chemical name, and formula.
CAS Registry Number
Chemical Name Formula
75-85-4 2-Butanol, 2-methyl- C5 H12 O 616-25-1 1-Penten-3-ol C5 H10 O 1629-58-9 1-Penten-3-one C5 H8 O
96-22-0 3-Pentanone C5 H10 O 110-62-3 Pentanal C5 H10 O 1534-08-3 Ethanethioic acid, S-methyl ester (9CI) C3 H6 O S 105-37-3 Propanoic acid, ethyl ester C5 H10 O2 109-60-4 Acetic acid, propyl ester C5 H10 O2 623-42-7 Butanoic acid, methyl ester C5 H10 O2 591-78-6 2-Hexanone C6 H12 O 108-10-1 2-Pentanone, 4-methyl- C6 H12 O 1576-87-0 2-Pentenal, (2E)- C5 H8 O 1576-86-9 2-Pentenal, (2Z)- C5 H8 O 623-43-8 2-Butenoic acid, methyl ester, (2E)- C5 H8 O2 71-41-0 1-Pentanol C5 H12 O
1576-95-0 2-Penten-1-ol, (2Z)- C5 H10 O 556-24-1 Butanoic acid, 3-methyl-, methyl ester C6 H12 O2 589-38-8 3-Hexanone C6 H12 O 105-54-4 Butanoic acid, ethyl ester C6 H12 O2 66-25-1 Hexanal C6 H12 O
123-86-4 Acetic acid, butyl ester C6 H12 O2 624-24-8 Pentanoic acid, methyl ester C6 H12 O2
29674-47-3 Butanoic acid, 2-hydroxy-, methyl ester C5 H10 O3 96-04-8 2,3-Heptanedione C7 H12 O2
638-11-9 Butanoic acid, 1-methylethyl ester C7 H14 O2 116-53-0 Butanoic acid, 2-methyl- C5 H10 O2 7452-79-1 Butanoic acid, 2-methyl-, ethyl ester C7 H14 O2 6728-26-3 2-Hexenal, (2E)- C6 H10 O 928-95-0 2-Hexen-1-ol, (2E)- C6 H12 O 111-27-3 Heptanal C7 H14 O 123-92-2 1-Butanol, 3-methyl-, 1-acetate C7 H14 O2 624-41-9 1-Butanol, 2-methyl-, 1-acetate C7 H14 O2 110-43-0 2-Heptanone C7 H14 O 2432-51-1 Butanethioic acid, S-methyl ester C5 H10 O S 105-66-8 Butanoic acid, propyl ester C7 H14 O2 539-82-2 Pentanoic acid, ethyl ester C7 H14 O2 111-71-7 1-Hexanol C6 H14 O 628-63-7 Acetic acid, pentyl ester C7 H14 O2 1191-16-8 2-Buten-1-ol, 3-methyl-, 1-acetate C7 H12 O2 106-70-7 Hexanoic acid, methyl ester C7 H14 O2
55514-48-2 2-Butenoic acid, 2-methyl-, ethyl ester C7 H12 O2 110-93-0 5-Hepten-2-one, 6-methyl- C8 H14 O 109-21-7 Butanoic acid, butyl ester C8 H16 O2 123-66-0 Hexanoic acid, ethyl ester C8 H16 O2 124-13-0 Octanal C8 H16 O 142-92-7 Acetic acid, hexyl ester C8 H16 O2 2497-18-9 2-Hexen-1-ol, 1-acetate, (2E)- C8 H14 O2 60415-61-4 Butanoic acid, 1-methylbutyl ester C9 H18 O2 104-76-7 1-Hexanol, 2-ethyl- C8 H18 O 2311-46-8 Hexanoic acid, 1-methylethyl ester C9 H18 O2
98
Table 2-6. Continued.
CAS Registry Number
Chemical Name Formula
109-19-3 Butanoic acid, 3-methyl-, butyl ester C9 H18 O2 2548-87-0 2-Octenal, (2E)- C8 H14 O 540-18-1 Butanoic acid, pentyl ester C9 H18 O2 4077-47-8 3(2H)-Furanone, 4-methoxy-2,5-dimethyl- C7 H10 O3 20664-46-4 2-Octenal, (2Z)- C8 H14 O 821-55-6 2-Nonanone C9 H18 O 5989-33-3 2-Furanmethanol, 5-ethenyltetrahydro-α,α,5-trimethyl-, (2R,5S)-rel- C10 H18 O2
78-70-6 1,6-Octadien-3-ol, 3,7-dimethyl- C10 H18 O 124-19-6 Nonanal C9 H18 O 103-09-3 Acetic acid, 2-ethylhexyl ester C10 H20 O2 140-11-4 Acetic acid, phenylmethyl ester C9 H10 O2 2639-63-6 Butanoic acid, hexyl ester C10 H20 O2 53398-83-7 Butanoic acid, (2E)-2-hexen-1-yl ester C10 H18 O2 106-32-1 Octanoic acid, ethyl ester C10 H20 O2 112-14-1 Acetic acid, octyl ester C10 H20 O2 564-94-3 Bicyclo[3.1.1]hept-2-ene-2-carboxaldehyde, 6,6-dimethyl- C10 H14 O 3913-81-3 2-Decenal, (2E)- C10 H18 O 134-20-3 Benzoic acid, 2-amino-, methyl ester C8 H9 N O2 110-39-4 Butanoic acid, octyl ester C12 H24 O2 110-38-3 Decanoic acid, ethyl ester C12 H24 O2
29811-50-5 Butanoic acid, 2-methyl-, octyl ester C13 H26 O2 7786-58-5 Butanoic acid, 3-methyl-, octyl ester C13 H26 O2 15111-96-3 1-Cyclohexene-1-methanol, 4-(1-methylethenyl)-, 1-acetate C12 H18 O2 706-14-9 2(3H)-Furanone, 5-hexyldihydro- C10 H18 O2
10522-34-6 Propanoic acid, 2-methyl-, nonyl ester C13 H26 O2 5881-17-4 Octane, 3-ethyl- C10 H22 128-37-0 Phenol, 2,6-bis(1,1-dimethylethyl)-4-methyl- C15 H24 O
40716-66-3 1,6,10-Dodecatrien-3-ol, 3,7,11-trimethyl-, (6E)- C15 H26 O 4887-30-3 Hexanoic acid, octyl ester C14 H28 O2 5454-09-1 Butanoic acid, decyl ester C14 H28 O2 2305-05-7 2(3H)-Furanone, dihydro-5-octyl- C12 H22 O2
Note: Chemical Abstract Services (CAS) registry numbers were used to query SciFinder® substances database for associated chemical name and molecular formula. Listed in order of increasing retention time.
99
MALIC
CITRIC
GLUCOSEFRUCTOSE
SUCROSE
75-85-4
616-25-1
1629-58-9
96-22-0
110-62-3
1534-08-3
105-37-3
109-60-4
623-42-7
591-78-6
108-10-1
1576-87-01576-86-9
623-43-8
71-41-0
1576-95-0
556-24-1
589-38-8
105-54-4
66-25-1
123-86-4
624-24-8
29674-47-3
96-04-8
638- 11-9
116-53-07452-79-1
6728-26-3
928-95-0
111-27-3
123-92-2
624-41-9
110-43-0
2432-51-1
105-66-8539-82-2
111-71-7
628-63-7
1191-16-8
106-70-7
55514-48-2
110-93-0
109-21-7
123-66-0
124-13-0
142-92-7
2497-18-9
60415-61-4
104-76-7
2311-46-8
109-19-3
2548-87-0
540-18-1
4077-47-8
20664-46-4
821-55-6
5989-33-378-70-6
124-19-6
103-09-3
140- 11-4
2639-63-6
53398-83-7
106-32-1
112-14-1
564-94-3
3913-81-3
134-20-3
110-39-4
110-38-3
29811-50-5
7786-58-5
15111-96-3
706-14-9
10522-34-6
5881-17-4
128-37-0
40716-66-3
4887-30-3
5454-09-1
2305-05-7
100
Figure 2-1. Cluster analysis of strawberry samples and quantified metabolites. Two-
way Ward cluster analysis of strawberry samples (diagonal bottom) and quantified single metabolites (right) with overall liking score of sample (top) constructed using JMP 8. Standardization of metabolite concentration is by row mean and standard deviation, with high values represented as red, average as green, and low as blue. The hierarchy and distance of segments within the vertical dendrogram indicates relatedness of concentration across samples for single metabolites. Structure of the horizontal dendrogram indicates relatedness of all metabolite concentrations among individual samples.
101
40
50
60
70
80
90
100
RE
LA
TIV
E H
UM
IDITY
(%
)
50
100
150
200
250
SO
LA
R R
AD
IAT
ION
(w
1 m
-2)
0
10
20
30
TE
MP
ER
AT
UR
E R
AN
GE
(C
)
27 D
ec 2
010
03 J
an
201
1
10 J
an
201
1
17 J
an
201
1
WK
-2
24 J
an
201
1
WK
-3
31 J
an
201
1
WK
-4
07 F
eb
201
1
WK
-5
14 F
eb
201
1
WK
-6
21 F
eb
201
1
WK
-7
28 F
eb
201
1
07 M
ar
201
1
0
1
2
3
4
TO
TA
L R
AIN
(cm
)
14 M
ar
201
1
2011 HARVEST WEEK AND DATE
40
50
60
70
80
90
100
50
100
150
200
250
0
10
20
30
26 D
ec 2
011
02 J
an
2012
09 J
an
2012
WK
-1
16 J
an
2012
23 J
an
2012
30 J
an
2012
WK
-4
06 F
eb
2012
WK
-5
13 F
eb
2012
WK
-6
20 F
eb
2012
WK
-7
27 F
eb
2012
05 M
ar
2012
0
1
2
3
4
WK
-9
12 M
ar
2012
2012 HARVEST WEEK AND DATE
A R2 = 0.250, p-value < 0.001*�
R2 = 0.068, p-value = 0.051
B R2 = 0.227, p-value < 0.001*�
R2 = 0.239, p-value < 0.001*
C R2 = 0.177, p-value = 0.001* D R2 = 0.147, p-value < 0.001*
E R2 < 0.001, p-value = 0.884 F R2 = 0.003, p-value = 0.649
G R2 = 0.037, p-value = 0.154 H R2 = 0.014, p-value = 0.307
102
Figure 2-2. Season Environmental Conditions. Daily maximum and minimum temperatures (A and B), daily average solar radiation (C and D), daily average relative humidity (E and F), and daily total rain fall (G and H) during the 2011 (A, C, E, and G) and 2012 (B, D, F, and H) seasons. Data for Balm, FL obtained from Florida Automated Weather Network (http://fawn.ifas.ufl.edu). Data spans three weeks prior to first harvest through last harvest of each season with individual harvests indicated by dotted vertical line and harvest week number. Dashed horizontal lines represent means of environmental measures. Solid lines are the bivariate fit of environmental measure across season. Coefficients of determination (R2) and p-value of fit is listed above individual scatterplots and are calculated using bivariate fit in JMP.
103
C R2 = 0.041, p-value = 0.142
0
500
1000
1500
2000
2500
3000
FR
UCT
OS
E (
mg
1 1
00
gF
W-1)
0 1 2 3 4 5 6 7 8 9 10
WEEK
B R2 = 0.064, p-value = 0.064
0
500
1000
1500
2000
2500
3000
GL
UC
OS
E (
mg1
10
0g
FW
-1)
0 1 2 3 4 5 6 7 8 9 10
WEEK
A R2 = 0.350, p-value < 0.001*
SU
CR
OS
E (
mg1
10
0g
FW
-1)
0
500
1000
1500
2000
2500
3000
0 1 2 3 4 5 6 7 8 9 10
WEEK
D R2 = 0.338, p-value < 0.001*
TO
TA
L V
OL
AT
ILE
S (
ng1
gF
W-1 h
-1)
WEEK
0
5000
10000
15000
20000
25000
30000
0 1 2 3 4 5 6 7 8 9 10
TO
TA
L V
OL
AT
ILE
S (
ng1
gF
W-1 h
-1)
SUCROSE (mg1 100gFW-1)
E R2 = 0.305, p-value < 0.001*
TO
TA
L V
OL
AT
ILE
S (
ng1
gF
W-1 h
-1)
FRUCTOSE (mg1 100gFW-1)
F R2 = 0.001, p-value = 0.785
0
5000
10000
15000
20000
25000
30000
0 500 1000 1500 2000 2500 3000
0
5000
10000
15000
20000
25000
30000
0 500 1000 1500 2000 2500 3000
Figure 2-3. Individual sugars and total volatiles regressed against season progression.
Regression of sucrose (A), glucose (B), fructose (C), and total volatiles (D) by harvest week during the seasons. Total volatile concentration is regressed against sucrose (E) and fructose (F). Sucrose (A) and total volatiles (D) demonstrate a significant negative fit to harvest week, unlike glucose (B) and fructose (C). A strong relationship between total volatile emission and sucrose concentration is found (E) that is not observed between total volatiles and glucose (data not shown) and fructose (F). Coefficient of determination (R2) and p-value of fit is listed above individual scatterplots and is calculated using bivariate fit in JMP 8. Dashed line represents mean of independent variable, solid line represents linear fit, dashed/dotted ellipse indicates 95% confidence range of data, and asterisk denotes significant fit (α = 0.05).
104
105
Figure 2-4. Regression of hedonic and sensory measures to physical and chemical fruit attributes. Hedonic overall liking is regressed against hedonic texture liking (A), sweetness intensity (B), sourness intensity (C), and strawberry flavor intensity (D). Overall liking is fitted to harvest week (E), total sugars (F), titratable acidity (G), and total volatiles (H). Texture liking is examined against puncture force (I) and harvest week (J), and forces is examined against harvest week (K). Sweetness intensity is regressed against total sugars (L), sucrose (M), glucose (N), and total volatiles (O). Intensity of sourness is fitted to titratable acidity (P), malic acid (Q), citric acid (R), and total sugars (S). Strawberry flavor intensity is regressed by total volatiles (T) and select single volatile compounds 1576-87-0 (U), 623-42-7 (V), and 110-62-3 (W).Coefficient of determination (R2) and p-value of fit is listed above individual scatterplots and is calculated using bivariate fit in JMP 8. Dashed line represents mean of independent variable, solid line represents linear fit, dashed/dotted ellipse indicates 95% confidence range of data, and asterisk denotes significant fit (α = 0.05).
106
15111-96-3 706-14-9 10522-34-6 5881-17-4 128-37-0 40716-66-3 4887-30-3 5454-09-1 2305-05-7
616-25-1 1629-58-9 96-22-0 110-62-3 1534-08-3 105-37-375-85-4 109-60-4 623-42-7
109-21-7 123-66-0 124-13-0111-71-7 628-63-7 1191-16-8 106-70-7 55514-48-2 110-93-0
142-92-7 2497-18-9 60415-61-4 104-76-7 2311-46-8 109-19-3 2548-87-0 540-18-1 4077-47-8
20664-46-4 821-55-6 5989-33-3 78-70-6 124-19-6 103-09-3 140-11-4 2639-63-6 53398-83-7
106-32-1 112-14-1 564-94-3 3913-81-3 134-20-3 110-39-4 110-38-3 29811-50-5 7786-58-5
71-41-0 1576-95-0 556-24-1 589-38-8591-78-6 108-10-1 1576-87-0 1576-86-9 623-43-8
624-24-8 29674-47-3 96-04-8 638-11-9 116-53-0 7452-79-1105-54-4 66-25-1 123-86-4
6728-26-3 539-82-2928-95-0 111-27-3 123-92-2 624-41-9 110-43-0 2432-51-1 105-66-8
107
Figure 2-5. Volatile Chemical Structure. Chemical structure of volatile compounds quantified in strawberry. Sorted by increasing retention time (left to right, top row to bottom row) and identified by CAS #.
108
CHAPTER 3 ENGINEERING OF THE AROMA FLAVOR VOLATILE METHYL ANTHRANILATE IN
PETUNIA AND STRAWBERRY
Background
Methyl anthranilate is a distinguishing constituent of volatile mixtures emitted or
synthesized by diverse plant species. Emission of methyl anthranilate originates in
multiple plant structures, often alluding to the biological role within that plant species.
The biosynthesis in reproductive structures is well known, as methyl anthranilate is a
characteristic component of the headspace of Citrus and jasmine flower (Jasminum
sambac) (Edris et al., 2008; Najman, 1993), ‘Concord’ grape (Vitis labrusca) (Massa et
al., 2008), wild strawberry (F. vesca) (Ulrich et al., 1997). Its effectiveness as a bee
attractant facilitates pollination in floral structures (Najman, 1993), while its potential
antimicrobial and antifungal capacities in essential oil of Retama raetam suggest a role
in promoting survivability of flowers and fruits (Edziri et al., 2010). Emission from
developing fruit may prevent premature foraging, as methyl anthranilate is a potent
irritant to starlings (Sturnus vulgaris) and is avoided whether in air or water (Stevens
and Clark, 1998). The leaves of Zea mays are known to emit methyl anthranilate upon
herbivory (Turlings and Benrey, 1998) and it is shown to be an indirect defense
mechanism for attraction of parasitic wasps that require specific herbivores for
oviposition (Turlings et al., 2005). With respect to humans, flowers and fruits possessing
methyl anthranilate are regarded as having favorable aromas and flavors. Also, it was
used as one of the first artificial flavors. As with most plant volatiles, methyl anthranilate
presents a means for the plant to interact with other biological entities through chemical
emission and sensory mechanisms.
109
Methyl anthranilate constitutes nine percent of volatile content in the juice of
‘Concord’ grapes (Vitis labrusca). This dominance makes these grapes one of the
richest biological sources of methyl anthranilate. Acyltransferase activity capable of
producing methyl anthranilate was identified in crude protein extracts of ripe grape
mesocarp (Figure 3-1). This activity was dependent upon precursor anthaniloyl-CoA
and methanol. Accumulation of anthranilic acid and methyl anthranilate peaked at
approximately 40 µM as grapes reached full maturity, and the concentration of methanol
also increased during the ripening of grape further supporting this biosynthesic
mechanism (Wang and De Luca, 2005).
Purified protein of ANTHRANILOYL-CoA:METHANOL ACYLTRANSFERASE
(VlAMAT) was digested, sequenced, and the transcript subsequently cloned (Wang and
De Luca, 2005). Characterization of recombinant and native protein indicates a higher
affinity and catalytic rate of VlAMAT for anthraniloyl-CoA and methanol than structurally
similar benzoyl-CoA and benzyl alcohol. However, the greatest in vitro activity of
recombinant protein is with anthraniloyl-CoA and benzyl alcohol as substrates and
relatively small amounts of benzyl alcohol is present in grape. VlAMAT transcript
abundance increases with the progression of ripening, as does anthranilic acid, VlAMAT
protein activity, and thus methyl anthranilate in ‘Concord’ grape varieties. Conversely, in
Vitis vinifera penultimate precursor, protein, and product are not detectable (Wang and
De Luca, 2005). This first instance of tissue specific methyl anthranilate biosynthesis is
due to a ripening paradigm and enzymatic specificity of VlAMAT. As a result,
biosynthesis results in a significant concentration of methyl anthranilate, contributing to
‘Concord’ grape aroma and flavor.
110
A second instance of tissue specific methyl anthranilate biosynthesis is induced
in herbivory damaged leaves of Zea mays (Koellner et al., 2010). Three paralogs of
ANTHRANILIC ACID METHYL TRANSFERASE (ZmAAMT) were cloned. Within thirty
minutes following Spodoptera larvae herbivory, jasmonic acid signaling up regulated
ZmAAMT1.1 and ZmAAMT3. Methyl anthranilate is detectable in the leaves after 30
minutes, but emission from the tissue does not occur until two hours after feeding.
Crude protein extract from herbivory damaged leaves, but not control leaves, is capable
of producing methyl anthranilate. The extract exhibits a methyl transferase activity that
is highest with S-adenosyl methionine and anthranilic acid for the synthesis of methyl
anthranilate (Figure 3-1). Crude extracts confirm biosynthesis of methyl anthranilate is
in response to herbivory. However, that alone does not distinguish which of the two
upregulated paralogs is responsible for the majority of methyl anthranilate biosynthesis.
Recombinant proteins of ZmAAMT1.1, 1.2, 2, and 3 show the highest relative
activity with anthranilic acid. Benzoic acid as substrate reaches a quarter of anthranilic
acid activity for ZmAAMT3, while ZmAAMT1.1 has only three percent relative activity.
Following herbivory, anthranilic acid increases by 12-fold to a concentration of 0.12
nmol1 gFW-1. A Km of over 2 mM for anthranilic acid is limiting to the ZmAAMT3 rate of
reaction and excludes it as the major contributor to induced methyl anthranilate
production. The 641 µM Km of ZmAAMT1.1 is at least three orders of magnitude greater
than the whole leaf anthranilic acid levels (Koellner et al., 2010), which is not optimal.
Anthranilic acid is an intermediate of tryptophan biosynthesis, which occurs in the
chloroplast. Subcellular compartmentalization of anthranilic acid produced by
ANTHRANILATE SYNTHASE, which is localized to the chloroplast (Bohlmann et al.,
111
1996), can provide the enriched environment necessary for efficient methyl anthranilate
biosynthesis.
Colocalization of protein and substrate is one means of ensuring enzymatic
specificity in vivo. Another mechanism of specificity is derived from the protein structure
as it can be exclusive to certain substrates. Comparison of homologs in Zea mays and
other species as well as site directed mutagenesis indicates substrate specificity for
anthranilic acid over salicylic acid is conferred by tyrosine 246 (Tyr-246 to Trp), while
benzoic acid is excluded by glutamine 167 (Gln-167 to His) (Koellner et al., 2010). Two
specific amino acid residues result in highly specific activity of ZmAAMT1.1 for
anthranilic acid compared to benzoic acid or salicylic acid which is preferred by other
members of the SABATH gene family (Koo et al., 2007)
Methyl anthranilate is absent from a vast majority of commercial cultivars of
strawberry. Comparison of whole fruit and GC-olfactometry of methyl anthranilate
containing F. vesca to deficient F. x ananassa imparted a ‘heavy sweet’ and a jasmine-
like orthonasal and retronasal characteristic (Ulrich et al., 2007). The sole transgenic
effort to alter strawberry aroma in literature focused on an endogenous O-
METHYLTRANSFERASE responsible for S-adenosyl methionine dependent
methylation of 3(2H)-furanone, 4-hydroxy-2,5-dimethyl- to DMF (Lunkenbein et al.,
2006). Up and downregulation of volatile synthesis is observed using sense and
antisense constructs of O-METHYLTRANSFERASE. This work attempts to introduce
methyl anthranilate into the deficient, yet commercially viable cultivar, ‘Strawberry
Festival’ through the overexpression of ZmAAMT1.1. Over-expression of tomato
(Solanum lycopersicum) PHENYLACETALDEHYDE REDUCTASE in Petunia x hybrida
112
cv. ‘Mitchell Diploid’ increased 2-phenylethanol floral emission by ten-fold (Tieman et
al., 2007). For this reason, ZmAAMT1.1 is also transformed into petunia, as an
established pipeline for efficiently generating and analyzing altered volatile phenotypes
exists. The methyl transferase of Zea mays is preferred over alcohol acyltranserase
mechanism of Vitis labrusca, mainly for its direct methylation of the primary metabolite
anthranilic acid, while the ZmAAMT1.1 paralog is selected due to its higher specificity.
Results
Methyl Anthranilate Content among Fragaria
In order to understand the extent of genetic variability for methyl anthranilate
synthesis in Fragaria methyl anthranilate had to be identified using a GC coupled to an
electron impact mass spectrometer (GC-MS). Fragaria volatile collection samples were
run on the GC-MS followed by a dilution of analytical standard methyl anthranilate.
Mass spectra corresponding to the retention time of the analytical standard from
Fragaria samples were compared to one another, methyl anthranilate standard, and
National Institute of Standards and Technology (NIST) mass reference spectra (Figure
3-2). NIST reference (Figure 3-2.A), methyl anthranilate standard (Figure 3-2.B), and F.
vesca cv. ‘Fragola Quattro Stagioni’ mass spectra showed characteristic ions 119, 151,
92, and 65 in decreasing relative abundance. However, none of these particular ions
were detected in F. x ananassa cv. ‘Strawberry Festival’.
The content of methyl anthranilate was quantified in 17 cultivars of four Fragaria
species using GC-FID to ascertain the biological variation: nine diploid F. vesca
cultivars, two hexaploid F. moschata, one octoploid F. virginiana, and five octoploid F. x
ananassa (Figure 3-3). The mean content of each cultivar was from a minimum of five
biological replicates from at least two harvest dates.
113
Within F. vesca there were eight cultivars with an average content of less than 10
ng1 gFW-1 hr-1 with ‘Hawaii-4’ having the lowest content at 2.65 ng1 gFW-1 hr-1. ‘Reine
des Vallees’ on the other hand had a mean methyl anthranilate emission of 28.77 ng1
gFW-1 hr-1, but large variance of the mean was due to phenotypic variation from harvest
to harvest. The cultivars ‘Capron’ and ‘Profumata di Tortona’ of F. moschata, a
hexaploid species, exhibited the highest mean methyl anthranilate emission quantified
in this study at 52.62 and 38.64 ng1 gFW-1 hr-1, respectively. The volatile emission from
‘Capron’ was nearly two-fold greater than the highest F. vesca accession. F. virginiana
was one of the progenitor species to modern F. x ananassa, and the F. virginiana
cultivar ‘Intensity’ did not produce any detectable amounts of methyl anthranilate. The
same was observed for four of five F. x ananassa cultivars. In fact, ‘Mara des Bois’ is
the only octoploid in which methyl anthranilate was detected. However, it was not
detectable at all points within a season and therefore had the lowest mean content of
the twelve cultivars in which methyl anthranilate was measured. A range of methyl
anthranilate emission was observed across Fragaria accession with a strong correlation
to species. Reliable and appreciable emission in diploid and hexaploid material is for all
practical purposes isolated from introgression into octoploid due to genetic architecture.
ZmAAMT1.1 Expression Analysis in Transgenic Plants
Overexpression construct and plant transformation
The coding sequence (CDS) of Zea mays ANTHRANILIC ACID METHYL
TRANSFERASE 1.1 (ZmAAMT1.1) was cloned into a Gateway entry vector,
pDONR222, and subsequently recombined with a destination vector, pHK-DEST-OE,
which generated a binary plant expression vector, pEXP-ZmAAMT1.1 (Figure 3-4), for
transformation of P. x hybrida cv. ‘Mitchell Diploid’ and F. x ananassa cv. ‘Strawberry
114
Festival’. The ZmAAMT1.1 CDS is under the control of figwort mosaic virus 34S (pFMV
34S) promoter and Agrobacterium NOPALINE SYNTHASE 3’ terminator (NOSt). Also,
within the transfer-DNA borders of the binary vector is the NEOMYCIN
PHOSPOTRANSFERASE II (NPTII) CDS, which confers kanamycin resistance in
transformed plants. Following transformation with pEXP-ZmAAMT1.1 50 ‘Mitchell
Diploid’ and 25 ‘Strawberry Festival’ T0 plantlets were regenerated in the presence of
kanamycin.
Petunia expression analysis
To determine penetrance of the ZmAAMT1.1 transgene in transformed ‘Mitchell
Diploid’ background a one-step semi-quantitative reverse transcription polymerase
chain reaction (sqRT-PCR) was used to first generate gene specific complimentary
DNA from isolated total RNA of each T0 line which was then amplified in the same
reaction. Visualization of ZmAAMT1.1 sqRT-PCR products after thirty cycles of
amplification allowed for distinguishing differences in transcript abundance among
transgenic lines. Thirty-eight lines were screened for sqRT-PCR transcript abundance of
ZmAAMT1.1 and scored by comparing electrophoresis band intensity among one
another and referencing sqRT-PCR of endogenous 18S, a consistent control for RNA
loading (Figure 3-5). All but three lines exhibited expression of ZmAAMT1.1, (transgenic
lines13, 23, and 38) while three lines exhibited very low, three low, twelve average, nine
high, and eight very high relative expression. A ZmAAMT1.1 sqRT-PCR product was
not visible in the transgenic background P. x hybrida cv. ‘Mitchell Diploid’ demonstrating
the specificity for amplification of the transgene.
Six transgenic lines were chosen for quantitative real time PCR (qRT-PCR) to
measure relative transcript based off initial semi-quantitative results (Figure 3-6).
115
ZmAAMT1.1 transcript was quantified relative to PhFBP7 using comparative Ct method.
The greatest expression was found in line 1 and 45, while 7, 13, 16, and 38 exhibited
moderate expression, and as expected no amplification was detected in wild-type
‘Mitchell Diploid’.
Strawberry expression analysis
Transcript abundance was also determined in pEXP-ZmAAMT1.1 transformed F.
x ananassa ‘Strawberry Festival’ using sqRT-PCR as in ‘Mitchell Diploid’. The RNA
loading control sqRT-PCR of endogenous 18S exhibits modest variability from sample
to sample and was taken into account when scoring ZmAAMT1.1 expression (Figure 3-
9). Two transgenic lines were scored as very low expression, four lines as low, ten as
moderate, four as high, and three as very high. The highest expression was likely found
in ZmAAMT1.1-OE 3, and therefore the best candidate for emission of greatest amount
methyl anthranilate. Purified pEXP-ZmAAMT1.1 was used as a positive amplification
control and exhibits very efficient amplification, while the negative amplification control
water ddi not amplify, as expected.
ZmAAMT1.1 Volatile Analysis in Transgenic Plants
Volatile compounds emitted from transgenic ZmAAMT1.1-OE and non-transgenic
(wild type) ‘Mitchell Diploid’ petunia were collected and quantified to determine if methyl
anthranilate phenotype was present. Mean methyl anthranilate content from two
biological replicates in 24 transgenic lines and ‘Mitchell Diploid’ is depicted in Figure 3-
7. No methyl anthranilate was detected in ‘Mitchell Diploid’ and six transgenic lines (5,
11, 13, 14, 44, and 45) using GC. Thirteen transgenic lines had detectable amounts less
than 10 ng1 gFW-1 hr-1, while four lines had methyl anthranilate content greater than 10
ng1 gFW-1 hr-1. The highest content was found in ZmAAMT1.1-OE 1 with a mean of
116
41.98 ng1 gFW-1 hr-1. GC-MS analysis of ZmAAMT1.1-OE, wild type ‘Mitchell Diploid’,
and analytical standard confirmed introduction of a novel petunia volatile compound,
methyl anthranilate, by presence of four predominant ions (119, 151, 92, and 65
determined from analytical standard and NIST) in transgenic lines, but not wild type
(Figure 3-8).
Volatile analysis of wild type and transgenic lines of ‘Strawberry Festival’ has yet
to be accomplished. Regeneration of F. x ananassa ‘Strawberry Festival’ is markedly
longer than that of P. x hybrida ‘Mitchell Diploid’. Also, short-day photoperiod flower
induction dependence of ‘Strawberry Festival’ is limiting to fruit set during long days of
summer. Volatile analysis of transgenic strawberry for presence of methyl anthranilate
will be conducted as fruit makes itself available.
Discussion
The emission of methyl anthranilate from various F. vesca and F. moschata
accessions is confirmed using MS and analytical standards. Previously, F. moschata cv
‘Cotta’ exhibited nearly three-fold greater emission of methyl anthranilate than F. vesca
ssp. vesca f. alba (Ulrich et al.). Similar results are observed with different F. vesca and
F. moschata accessions used in this work. The highest level of methyl anthranilate
emission from F. moschata cv. ‘Capron’, in excess of 50 ng1 gFW-1 hr-1, overshadows
the majority of F. vesca, approximately 5-10 ng1 gFW-1 hr-1. The only octoploid
accession to emit detectable levels of methyl anthranilate is F. x ananassa cv. ‘Mara
des Bois’ while it is undetected in four commercial cultivars. These results underscore
the lack of potential impactful volatile compound in commercial material, but the
pervasive emission in lower ploidy material justifies engineering efforts to understand
methyl anthranilate effect on aroma and flavor of Petunia and ‘Strawberry Festival’.
117
The overexpression of heterologous Z. mays ANTHRANILIC ACID METHYL
TRANSFERASE is successful at introducing emission into otherwise deficient P. x
hybrida cv. ‘Mitchell Diploid’. The use of Agrobacterium for the generation of transgenic
petunia is an effective method, especially when taking advantage of kanamycin
resistance for positive selection during plantlet regeneration (Jorgensen et al., 1996).
This is evident in the fact that all but three T0 petunias had detectable levels of
expression, while eight lines exhibited very high expression of ZmAAMT1.1 using sqRT-
PCR methods. Expression or unspecific amplification is not detected in ‘Mitchell
Diploid’, which validates the methods of the transgene transcript abundance assay.
Greater resolution of transcript level is achieved using qPCR on a subset of transgenic
lines. Lines 45 and 1 have high semi-quantitative levels and demonstrate approximately
20- and 30-fold greater expression, respectively, than line 38, all of which is estimated
to have low to average expression using semi-quantitative methods. Again, ‘Mitchell
Diploid’ exhibits no expression. The much greater magnitude of expression in line 1 is
otherwise under estimated if not for the qRT-PCR methods.
Despite detection of expression in 35 of 38 lines, the emission of methyl
anthranilate is only detectable in flowers from 18 of 24 lines analyzed. Exclusion of
enzyme from substrate or limitations in substrate flux can potentially account for this
observed discrepancy. Estimated expression in these deficient lines is far from the
highest and more often than not at the lowest end of detection. A caveat however is line
45, which exhibited second highest relative transcript abundance in qRT-PCR analysis,
but has no detectable levels of methyl anthranilate. Conversely, line 1 demonstrates the
greatest level of methyl anthranilate emission, just under 30 ng1 gFW-1 hr-1, and the
118
greatest relative expression in qRT-PCR. Lines 13 and 16 have similar expression
levels; however 13 has no detectable methyl anthranilate while 16 emits over 10 ng1
gFW-1 hr-1. The efficiency of generating petunia with transgene expression is greater
than actual detectable phenotype, and relative expression level does not always
coordinate with emission levels of methyl anthranilate. These discrepancies are quite
common with petunia transgenics (David G. Clark, personal communication). Transcript
and volatile screening of numerous ZmAAMT1.1 overexpressing ‘Mitchell Diploid’ lines
found transgenic line 1 to have the greatest transcript and methyl anthranilate
expression, successfully introducing a heterologous enzyme for the production of a
novel volatile compound.
After normalizing for mass, the headspace emission of flowers from thirteen lines
of transgenic petunia is within the range of most F. vesca fruit assayed. Of special
interest is transgenic petunia ZmAAMT1.1-OE 1 with emission measured at just under
30 ng1 gFW-1 hr-1. This quantity is on par with F. vesca ‘Reine des Vallees’, which emits
roughly three-fold more methyl anthranilate than the rest of F. vesca cultivars. Given the
success in petunia, anticipation is high that the to be determined methyl anthranilate
content of transgenic ‘Strawberry Festival’ will be comparable to F. vesca, in which the
volatile is believed to impart favorable aroma and flavor (Ulrich et al., 2007).
The transformation of strawberry is not as inherently simple as that of petunia,
but can be an effective method when taking advantage of kanamycin resistance for
positive selection during plantlet regeneration (Folta et al., 2006). A range in relative
expression is observed in all regenerated strawberry demonstrated expression of
ZmAAMT1.1 using sqRT-PCR. The greatest expression is observed in line 3, while line
119
5 has the lowest relative intensity. Observable discrepancies between transcript and
volatile emission in petunia requires a volatile screen of transformed ‘Strawberry
Festival’ prior to making assumptions of lines with methyl anthranilate emission, let
alone high levels of emission.
Successful engineering of methyl anthranilate biosynthesis likely requires
appropriate targeting of ZmAAMT1.1 to subcellular compartment containing appropriate
substrate, anthranilic acid. Anthranilic acid is the direct product of ANTHRANILATE
SYNTHASE which enzymatically cleaves a pyruvate moiety from chorismate (Bohlmann
et al., 1996), an intermediate reaction of tryptophan biosynthesis. The entirety of this
necessary pathway occurs exclusively in the chloroplast (Mano and Nemoto, 2012),
therefore transgenes need to localizes there. Web-based chloroplast transit peptide
prediction of ZmAAMT1.1 using ChloroP gives a weak probability of 0.446 at amino acid
residue 56 (Emanuelsson et al., 1999). Also, a small N-terminal helix from residue 24 to
47 is predicted by PredictProtein (Rost et al., 2004) and SWISS-MODEL (Arnold et al.,
2006). This is a characteristic motif for some chloroplast transit peptides (Bruce, 2000),
however, exact defining constituents are still poorly understood (Li and Chiu, 2010). The
detection of methyl anthranilate in transgenic petunia and previously reported
compartmentalization of tryptophan biosynthesis, including intermediate anthranilic acid,
suggests successful targeting of ZmAAMT1.1 to the plastid.
Chemical supplier Material Safety Data Sheet lists physical properties of methyl
anthranilate, which are interesting given its role as an emitted volatile. An astonishing
low vapor pressure of 3.6 Pascal and a melting point of 24º C are not conducive to high
volatility. A lag of over an hour between detection in tissue versus headspace is
120
observed in herbivory-damaged Zea mays leaves (Koellner et al., 2010), perhaps
requiring concentration to build or requiring extra time for diffusion. The hypothesized
chloroplast localized biosynthesis would require at a minimum the volatile compound to
traverse three lipid bilayer membranes. Plastid formation occurs early in petunia corolla
development, before degrading at anthesis, coinciding with maximum endogenous floral
emission (Colquhoun et al., 2010b) possibly freeing otherwise membrane constrained
methyl anthranilate. Headspace methyl anthranilate of petunia will contribute directly to
the floral fragrance perceived through orthonasal olfaction. Conversely, internal methyl
anthranilate could potentially contribute to retronasal olfaction detection while
consuming strawberry fruit. Comparison of internal and emitted volatiles will provide
insights into the relationship between emitted and pooled methyl anthranilate, which
may influence orthonasal and retronasal olfaction perception.
Petunia emission of methyl anthranilate at levels comparable to F. vesca is
attained by over-expression of ZmAAMT1.1, successfully producing a previously
unreported volatile in petunia and potentially altering floral fragrance. Previously,
alteration of endogenous petunia volatiles greatly affected pollinator/herbivore
interaction (Kessler et al.). Introduction of a novel petunia floral volatile could have
similar effects in nature, but human perception is of more immediate interest. The
widespread presence of methyl anthranilate in flavoring and aroma of natural and
synthetic products suggests a positive response to transgenic petunia would be
observed in consumer fragrance panels.
These results are also promising for efforts to engineer methyl anthranilate
emission in ‘Strawberry Festival’. In the event of methyl anthranilate phenotype, multiple
121
consequences are possible. The emission of methyl anthranilate may serve as an avian
repellent, reducing loss of ripe fruit to birds. Also, the ability to attract parasitic wasps
can alleviate herbivory pressure. In regards to postharvest, the presence of methyl
anthranilate in fruit may result in less microbial and fungal growth leading to prolonged
shelf life. The primary question however, is whether flavor or aroma of ‘Strawberry
Festival’ is enhanced by the presence of methyl anthranilate, a sweet, floral component
of F. vesca.
Future Work
Ultimately, it must be known if consumer perception is altered by the presence of
methyl anthranilate in ‘Mitchell Diploid’ or ‘Strawberry Festival’. Seed of T1
ZmAAMT1.1-OE petunia will be sown, an individual of high emission selected,
propagated, and grown out in a climate controlled glasshouse. Flowers will be
harvested for a consumer panel triangle test to ascertain a difference and/or preference
of petunia fragrance with or without methyl anthranilate, and to see if humans perceive
them as positive.
Screening of T0 ZmAAMT1.1 ‘Strawberry Festival’ fruit will hopefully identify
multiple lines with capabilities of producing methyl anthranilate. Once identified, the
appropriate line will need to be propagated and grown out in climate controlled
glasshouse for consumer flavor panels. Internal Review Board approval and consumer
written consent for the consumption of transgenic material will be obtained. Consumers
will directly compare wild-type ‘Strawberry Festival’ to a methyl anthranilate containing
transgenic line to discern any perceptual differences in overall liking, sweetness
intensity and flavor intensity.
122
More fundamental work could involve crossing homozygous petunia lines of
ZmAAMT1.1-OE x CHORISMATE MUTASE-RNAi (CM). CHORISMATE MUTASE
competes with ANTHRANILATE SYNTHASE for substrate, diverting it from tryptophan
biosynthesis to phenylpropanoid biosynthesis (Colquhoun et al., 2010a). Hypothetically,
increased flux through tryptophan biosynthesis will allow greater methyl anthranilate
biosynthesis. Metabolite analysis will rely on aqueous supernatant from centrifuged
flower tissue. Solid phase extraction will aid in sample preparation prior to analysis on
high pressure liquid chromatograph coupled to triple quadrupole MS. Multiple reaction
monitoring mode will allow for quantification of MS/MS product ions, particularly of
chorismate, anthranilic acid, methyl anthranilate, and tryptophan. Comparison of these
compounds in wild type ‘Mitchell Diploid’, ZmAAMT1.1-OE, CM-RNAi, and
ZmAAMT1.1-OE x CM-RNAi could provide insights on metabolic flux at key nodes of
aromatic amino acid synthesis in plants.
Materials and Methods
Plant Material
Inbred P. x hybrida Mitchell Diploid plants were the wild-type control and
background for transformation in all petunia experiments (Mitchell et al., 1980), while
commercially available F. x ananassa cv. ‘Strawberry Festival’ was the wild-type control
and background for transformation of strawberry experiments. All petunia were grown in
glass greenhouses (Dexter et al., 2007). Wild-type and transformed ‘Strawberry
Festival’ were grown in glass greenhouses and watered daily with Verti-Gro©
hydroponic fertilizer (0.6 grams per liter 8-12-32 with trace elements and 2%
magnesium) and supplemented with calcium nitrate (0.3 g per liter 15-0-0). Materials of
123
Figure 3-3 were grown in Citra, FL according to current commercial practices for annual
strawberry plasticulture in Florida (Whitaker et al., 2011) (Santos et al., 2012).
Generation of Transgenic ZmAAMT1.1 Plants
Overexpression construct
A pUC57 vector containing the synthesized CDS of ZmAAMT1.1 (Koellner et al.,
2010) was obtained from GenScript©. Use of Gateway® Cloning (Invitrogen) for the
generation of entry vector requires a two-step amplification scheme to incorporate
recombination site adapters to CDS of ZmAAMT1.1. The first step used Phusion
(Finnzymes) recombinant polymerase to amplify the CDS with partial attB adapters
(forward primer 5’ – AAAAAGCAGGCTTCATGCCGATGAGAATCGAGCGTGAT – 3’
and reverse primer 5’ – AGAAAGCTGGGTCTCACACATGAATTATTGCTTTCTC – 3’).
The second amplification used the first product as a template and completes the
recombination sites using attB primers (forward primer 5’ –
GGGGACAAGTTTGTACAAAAAAGCAGGC – 3’ and 5’ –
GGGGACCACTTTGTACAAGAAAGCTGGGT – 3’). BP Clonase catalyzed a
recombination reaction between polyethylene glycol purified attB PCR product and attP
pDONR222 vector for site directed recombination of ZmAAMT1.1 CDS for lethal ccdB
CDS to generate pENTR – ZmAAMT1.1. Mach1 E. coli transformation with BP Clonase
reaction was selectively screened for NPTII containing pENTR - ZmAAMT on LB agar
plates containing kanamycin. Digestion and Sanger sequencing confirmed
recombination and identity of ZmAAMT1.1.
LR Clonase catalyzed recombination between attL containing pENTR –
ZmAAMT1.1 and attR contain pHK-DEST OE for site directed recombination of
ZmAAMT1.1 CDS for lethal ccdB CDS to generate pEXP – ZmAAMT1.1.
124
The binary expression vector ultimately for plant transformation places ZmAAMT1.1
under the control of pFMV 34S (Richins et al., 1987) and nosT. The recombination
product was transformed into Mach1 E. coli. ccdB lethality selected against unreacted
pHK-DEST OE and undesired recombination products, while streptomycin LB agar
plates selected for pEXP-ZmAAMT1.1-OE, which contains the aadA1 resistance gene.
Colonies were qualified via digestion of both vector and insert of pEXP – ZmAAMT1.1,
as well as amplifying across recombination site from pFMV 34S into ZmAAMT1.1.
Plant transformation and regeneration
Fifty independent pEXP-ZmAAMT1.1-OE ‘Mitchell Diploid’ petunia were
generated using Agrobacterium mediated transformation of sterile leaf disc and
subsequent plantlet regeneration (Jorgensen et al., 1996). Twenty-five independent
pEXP-ZmAAMT1.1-OE ‘Strawberry Festival’ were generated using Agrobacterium
mediated transformation of sterilized leaf and petiole segments and subsequent plantlet
regeneration (Folta et al., 2006). Kanamycin resistance conferred by presence of NPTII
within T-DNA of pEXP – ZmAAMT1.1 allows for initial screening of plantlets. T0 petunia
were self-pollinated to maintain transgenic events through seed. T0 ‘Strawberry
Festival’ is maintained through propagation of daughter plants due to heterozygosity of
octoploid background.
RNA Isolation
Petunia
Developmental stage six petunia flower buds are tagged two days prior to
harvest of stage eight fully expanded flowers (Colquhoun et al., 2010b). At 16:00
flowers were excised from the plant at the peduncle and frozen immediately in liquid
nitrogen. Whole flower was then ground in liquid nitrogen. Total RNA was extracted
125
from approximately 500 mg of tissue according to Verdonk et al., (2003) and
reconstituted in 50 µl DEPC treated water. Residual DNA was digested with TURBO
DNase (Ambion Inc.) and RNeasy Mini Spin Column (QIAGEN) removes carry-over
metabolites prior to downstream applications.
Strawberry
Young expanding leaf tissue was harvested at 16:00 and frozen immediately in
liquid nitrogen. Leaf tissue was then ground in liquid nitrogen. Total RNA was extracted
from approximately 100 mg of tissue using 1 ml phenol extraction solution consisting of
Tris pH 6.7 +/- 0.2 saturated phenol, 0.1% SDS (w/v), 0.32 M NaOAc, and 0.01M EDTA
and 0.4 ml DEPC treated water (Ghawana et al., 2011). Ten seconds of vortex was
followed by 5 minute incubation, which was followed by the addition of 0.2 ml
chloroform. Five seconds of vortex, 5 minutes of incubation, and centrifugation at
16,000 rcf allowed for the separation of approximately 0.5 ml aqueous phase which was
transferred to a new 1.5 ml Eppendorf tube. Nucleic acids were precipitated in 0.3 ml
isopropanol and centrifuged for 5 minutes following 5 seconds of vortex and 10 minutes
of incubation. Pellet was washed in 70% ethanol, dried and reconstituted in 50 µl DEPC
treated water. TURBO DNase (Ambion Inc.) treatment digested residual DNA and
RNeasy Mini Spin Column (QIAGEN) removed carry-over metabolites prior to
downstream applications.
Expression Analysis
Abundance of ZmAAMT1.1 transcript in all viable transgenic events of petunia
and strawberry was estimated via sqRT-PCR using One-Step RT-PCR kit (QIAGEN
Co.) with 50 ng total RNA (ZmAAMT1.1 forward primer 5’ –
AGGCACCAGAGCAACTGAAG – 3’ and reverse primer 5’ –
126
CACCAGACACGAGTTCCTCA – 3’). P. x hybrida and F. x ananassa 18S were
amplified (Ph18S forward primer 5’ – TTAGCAGGCTGAGGTCTCGT – 3’ and 5’ –
AGCGGATGTTGCTTTTAGGA – 3’; Fa18s 5’ – ACCGTAGTAATTCTAGAGCT – 3’ and
5’ – CCACTATCCTACCATCGAAA – 3’) from all petunia and strawberry samples,
respectively, to visualize RNA-loading concentration and to act as a positive control for
reverse transcription and amplification. Sub-saturation amplification of 18S was
achieved at 22 and 18 cycles, while ZmAAMT1.1 requires 30 and 37 cycles for Petunia
and Fragaria, respectively. No template (H2O) controls were used in all reactions.
Products of sqRT-PCR were analyzed under ultraviolet light following electrophoresis
on 1% agarose gel with 0.5 ug1 ml-1 ethidium bromide.
∆∆Ct Quantitative qRT-PCR was performed and analyzed using a
StepOnePlus™ real-time PCR system (Applied Biosystems, Foster City, CA). Power
SYBR® Green PCR (Applied Biosystems, Foster City, CA) was used to amplify and
detect the products according to the manufacturer’s protocol. Gene specificity is
confirmed through analysis of melt curve.
Volatile Analysis
Developmental stage 8 petunia flowers were excised at the peduncle at 18:00 for
an immediate one hour volatile collection. Each sample comprised of two flowers from a
single line with at least two biological replicates of each line.
Ripe glass greenhouse grown F. x ananassa were harvested at 16:00 and then
kept at 4°C until 9:00 the following morning at which time they were prepared for a two
hour volatile collection. Each sample comprised of 15 grams of quartered and diced
berries from a single line with technical replication as possible.
127
Ripe field grown F. vesca were harvested at 9:00 in Citra, FL and kept on ice for
transport to Gainesville, FL for immediate two hour volatile collection. Each sample
comprised of approximately 15 grams of whole fruit, 5-10 berries from a single genotype
with two to three biological replicates per cultivar per harvest. Reported average volatile
content was pooled from at least two harvests.
Volatile collection apparatus was a dynamic headspace system in which emitted
volatiles are concentrated on HaySep 80-100 porous polymer adsorbent (Hayes
Separations Inc.) (Underwood et al., 2005) and then eluted as described by Schmelz
(Schmelz et al., 2003).
Quantification of volatiles in an elution was performed on an Agilent 7890A
Series GC (carrier gas; He at 3.99 mL min-1; splitless injector, temperature 220°C,
injection volume 2 µl) equipped with a DB-5 column ((5%-Phenyl)-methylpolysiloxane,
30 m length × 250 µm i.d. × 1 µm film thickness; Agilent Technologies, Santa Clara,
CA, USA). Oven temperature was programmed from 40°C (0.5 min hold) at 5°C min-1 to
250°C (4 min hold). Signals were captured with a FID at 280°C. Peaks from FID signal
were integrated manually with Chemstation B.04.01 software (Agilent Technologies,
Santa Clara, CA). Volatile emissions (ng1 gFW-1 h-1) were calculated based on
individual peak area relative to sample elution standard peak area. GC-Mass
Spectrometry (MS) analysis of elutions were performed on an Agilent 6890N GC in
tandem with an Agilent 5975 MS (Agilent Technologies, Santa Clara, CA, USA) and
retention times were compared with authentic standards (Sigma Aldrich, St Louis, MO,
USA) for volatile identification (Schmelz et al., 2001).
128
Statistical Analysis
Histograms constructed in JMP 8.0 (SAS Institute Inc.) and depict mean volatile
content per line/cultivar including standard error bars.
129
Figure 3-1. Alternative methyl anthranilate biosynthetic pathways in Zea mays and Vitis
labrusca. ATP-dependent ligation of CoA to anthranilic acid provides substrate for Vitis labrusca ANTHRANILOYL-CoA:METHANOL ACYLTRANSFERASE (VlAMAT), which catalyzes the methanol dependent acyl transfer to create methyl anthranilate. Conversely, Zea mays ANTHRANILIC ACID METHYL TRANSFERASE (ZmAAMT) directly synthesizes methyl anthranilate upon methyl donation by S-adenosyl methionine. Chloroplast compartmentalized tryptophan biosynthesis is depicted for relation to primary metabolism.
130
Figure 3-2. Identification of methyl anthranilate in Fragaria. GC-MS electron ionization spectra at retention time of 29.2 minutes for methyl anthranilate analytical standard (B), Fragaria vesca cv. ‘Fragola Quattro Stagioni’ captured volatiles (C), and Fragaria x ananassa cv. “Strawberry Festival’ captured volatiles (D). Presence of ions 119, 151, 92, and 65 (listed in decreasing relative abundance) in National Institute of Standards and Technology mass reference spectra (A), analytical standard (B), and ‘Fragola Quatrol Satgioni (C) confirms the presence of methyl anthranilate, however absence of ions in ‘Strawberry Festival’(D) indicates a lack of detectable production.
131
Figure 3-3. Methyl anthranilate content among various lines of Fragaria species.
Histograms depict average content and standard error of methyl anthranilate from at least five biological replicates across a minimum of two harvests. Diploid (2x) Fragaria vesca cultivars emit approximately 5-10 ng1 gFW-1 h-1,
except for ‘Reine des Vallees’, which emits 28.77 ng1 gFW-1 h-1. In octoploid (8X) Fragaria x ananassa methyl anthranilate is only detectable in ‘Mara des Bois’ but not any commercially relevant material. Emissions from both hexaploid (6x) Fragaria moschata cultivars are the highest measured, especially ‘Capron’ with approximately ten-fold higher content than most Fragaria vesca accessions assayed. Analysis conducted in JMP.
132
Figure 3-4. Binary vector for stable transformation of petunia and strawberry with
ZmAAMT1.1. T-DNA region within left (LB) and right borders (RB) is stably integrated into host plants. Expression of NPTII confers resistance to kanamycin selection during plantlet regeneration and is regulated by Agrobacterium NOPALINE SYNTHASE 5’ promoter (pNOS) and 3’ terminator (NOSt). Figwort mosaic virus 34S promoter (pFMV 34S) and NOSt constitutively regulate transcription of ZmAAMT1.1 coding sequence. Protein translated from transcript will have enzymatic capability of synthesizing methyl anthranilate from anthranilic acid. Forward and reverse primers 1075 and 1076 are used in expression analysis of transgenic and wild type Petunia x hybrida ‘Mitchell Diploid’ and Fragaria x ananassa ‘Strawberry Festival’. In silico vector constructed in VectorNTI.
133
Figure 3-5. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv. ‘Mitchell Diploid’. Screening of ZmAAMT1.1 transcript abundance in total RNA of T0 stage eight flower tissue to determine high expressing lines. Expected product of 156bp reached sub-saturation and differential amplification across T0 using a one-step RT-PCR at 30 cycles. The transformation plasmid, pEXP-ZmAAMT1.1, is used for an amplification control and no amplification was observed in untransformed ‘Mitchell Diploid’. A second one-step RT-PCR of 18S ribosomal RNA is used as a loading control for gene specific reaction. Lines 13, 23, and 38 had no observable expression, while three lines exhibited very low, three low, twelve average, nine high, and eight very high relative expression.
134
Figure 3-6. ZmAAMT1.1 transcript abundance in overexpressing Petunia x hybrida cv.
‘Mitchell Diploid’. Quantitative real-time PCR was used determine relative abundance of ZmAAMT1.1 transcript in over-expressing lines using ΔΔCt method relative to line 38. Line 1 exhibits the greatest expression by far, followed by 45. Lines 7, 13, 16, and 38 demonstrate moderate expression, and wild-type ‘Mitchell Diploid’ (MD) does not express ZmAAMT1.1 (ND not detected). Results compiled using StepOne.
ND ND
135
Figure 3-7. Emission of methyl anthranilate from petunia flowers over-expressing
ZmAAMT1.1. Eluents of solid phase captured headspace of T0 ZmAAMT1.1-OE Petunia x hybrida ‘Mitchell Diploid’ are run on GC-FID for quantification of volatile compounds. Methyl anthranilate, chromatograph signal at 30.54 minutes, is not detected in wild-type ‘Mitchell Diploid’ and multiple transgenic lines. A range of emission is quantified in various transgenic events, most notably ZmAAMT1.1-OE 1 with an emission of 29.5 ng1 gFW-1 h-1. Means and standard errors calculated from two biological replicates of two flowers for each transgenic line and wild-type using JMP 8.
136
Figure 3-8. Identification of methyl anthranilate in petunia flower over-expressing
ZmAAMT1.1 .GC/MS electron ionization spectra at retention time of 29.2 minutes for methyl anthranilate analytical standard (B), Petunia x hybrida cv. ‘Mitchell Diploid’ ZmAAMT1.1-OE 1 captured volatiles (C), and non-transgenic ‘Mitchell Diploid’ captured volatiles (D). Presence of ions 119, 151, 92, and 65 (listed in decreasing relative abundance) in National Institute of Standards and Technology mass reference spectra (A), analytical standard (B), and ZmAAMT1.1-OE 1 (C) confirms the presence of methyl anthranilate, however absence of ions in ‘Mitchell Diploid’ (D) indicates a lack of detectable production.
137
Figure 3-9. ZmAAMT1.1 transcript abundance in overexpressing Fragaria x ananassa
cv. ‘Strawberry Festival’. Screening of ZmAAMT1.1 transcript abundance in total RNA of T0 leaf tissue to determine high expressing lines. Expected product of 156bp reached sub-saturation and differential amplification across T0 using a one-step RT-PCR at 37 cycles. The transformation plasmid, pEXP-ZmAAMT1.1, is used for an amplification control and no amplification was observed in untransformed ‘Strawberry Festival’. A second one-step RT-PCR of 18S ribosomal RNA is used as a loading control for gene specific reaction. All lines display at least minor amplification and highest estimated expression when taking into account 18S control is in line ZmAAMT1.1-OE 3.
138
CHAPTER 4 EFFECTS OF ENHANCED LIGHT ENVIRONMENTS ON POSTHARVEST VOLATILE
PROFILES OF ‘STRAWBERRY FESTIVAL’
Background
The development of plants and specific tissues is the result of an interaction
among intrinsic genetic potentials and external environmental factors. A particularly
important environmental factor to plant development is light. In fact, a suit of
photoreceptors exist to sense and transduce information concerning light quality.
Characterization of pathways in Arabidopsis describe how signals are transduced to
ultimately influence numerous aspects of growth and development (Chen et al., 2004).
The susceptibility of strawberry fruit development and ripening to environmental
differences has become evident in regard to temperature in chapter 2 of this dissertation
as well in other studies (MacKenzie et al., 2011; Watson et al., 2002). The content of
specific sugars and general SSC is sensitive to variations in temperature and can affect
other metabolites including volatile compounds. Also, variation in light quantity and
quality during development has been shown to influence volatile content of ripe
strawberry (Kasperbauer et al., 2001; Watson et al., 2002). Previous work in North
Carolina comparing the effects of red and black plastic mulch on strawberry fruit
indicates significant increases in 12 of 19 aroma compounds, likely due to increased red
and far-red light reflected to developing fruit (Kasperbauer et al., 2001). Red mulch work
in Egypt using ‘Strawberry Festival’ indicates increases in fruit weight and total yield
compared to black reflective mulch (El-Yazied and Mady, 2012). However, mixed
results are observed in regard to yield at multiple locations within Florida using cv.
‘Camarosa’ (Locascio et al., 2005). The phenomena of volatile profiles changing in
response to environmental conditions led to exploring the effect of narrow-bandwidth
139
postharvest light and in-field selective reflective mulch to alter volatile content in
strawberry.
Two pilot experiments were conducted to gain an understanding of the effects of
light quality on strawberry volatile synthesis. The use of narrow-bandwidth light in a
postharvest system to alter volatile profiles of fruits and flowers is explored in a
published work with Postharvest Biology and Technology, Light Modulation of Volatile
Organic Compounds from Petunia Flowers and Select Fruits (Colquhoun et al., 2013).
Also, an application for patent (#61/794,406) has been submitted to the United States
Patent and Trademark Office for technology associated with this work. Within this work
light treatments are shown to specifically change the content of individual volatiles but
not all volatiles in strawberry. These specific instances and literature support
encouraged development of a field scale application to alter light environment through
the use of plastic mulches with different reflective properties.
Results
Postharvest Exposure to Narrow-Bandwidth Light Alters Strawberry Volatile Content
Volatile emissions from strawberry fruits contain a large array of compounds (Du
et al., 2011a; Maarse, 1991). A focused subset of volatile compounds is presented here,
some of which contribute to strawberry sensory perception. These include: 2-hexn-1-ol,
(2E)- (928-95-0); hexanoic acid (142-62-1); butanoic acid, 1-methylethyl ester (638-11-
9); and linalool (78-70-6). Mature strawberry fruit was harvested in the morning and
chilled at 4°C overnight in dark conditions before being exposed to 8 hours of narrow-
bandwidth light of the blue, red, or far red spectrum (Figure 4-2) as well as controls of
white fluorescent light and darkness. Volatile analysis immediately followed treatment to
140
identify light conditions capable of altering content of specific volatiles. All forms of light,
including white control, decreased the content of 2-hexen-1-ol, (2E)- compared to dark
(Figure 4-2A). Far-red light treatment selectively increased hexanoic acid (Figure 4-2B)
compared to all other treatments. Blue light decreased butanoic acid, 1-methylethyl
ester (Figure 4-2C) while negligibly affected in other treatments. Certain compounds,
such as linalool, are not affected by light treatments (Figure 4-2D). The effect of light
treatments on these selected volatile compounds in Fragaria x. ananassa cv.
‘Strawberry Festival’ validates treatment specificity for altering volatile content.
Red and Black Plastic Mulch
Reflective light qualities from red and black mulch
Light reflected from red and black plastic mulch was measured at 15 cm above
raised beds, in which “Strawberry Festival’ was growing. New red plastic mulch
reflected 8.5% more of direct photosynthetic active radiation (PAR, 400-700nm) back up
to plant canopy than black mulch (Table 4-1)(Figure 4-3A). The majority of this reflected
radiation difference was that of red light (600-700nm), but also a 7% gain in far-red light
(700-800nm) was observed to be reflected from red mulch (Figure 4-3B). Therefore the
ratio of red to far-red light reflected from red mulch is nearly identical to direct sunlight.
Black mulch exhibited a variable difference of red: far-red depending on age of mulch,
but the reflected radiation was only 1-2% of direct sunlight (Table 4-1)(Figure 4-3C).
Therefore, increased radiation was observed over red mulch, but an enhanced
spectrum in regard to the red to far-red ratio was not observed.
141
Strawberry volatile profiles are not consistently different between red and black mulch treatments
Fruit was harvested from three replicated plots of both black and red mulch
treatments for simultaneous consumer panel and volatile analysis. Fruit was harvested
in the morning and stored at 4°C overnight in the dark. Seventy-two volatile compounds
were quantified in ‘Strawberry Festival’ fruit from the same harvests as consumer
panels (Table 4-3). Significant differences in volatile content for nine compounds was
determined for January 18th, 2013, while only three varied significantly on February 13th,
2013. One of the volatiles that varied between treatments in January, hexanoic acid,
was shown to be enhanced using postharvest far-red light treatments. However, the
field effect was not reproducible, as none of the three volatiles significantly different
between mulch treatments in February overlapped with those from January. Therefore,
it can be concluded that red plastic mulch does not alter the volatile profile of
commercially produced and stored ‘Strawberry Festival’ fruit as hypothesized or
suggested by literature.
Consumers do not distinguish or prefer strawberry from red or black plastic mulch
The morning following harvest, and simultaneous to volatile collections,
approximately 100 panelists consumed and rated multiple berries from each treatment
for overall liking, texture liking, sweetness intensity, sourness intensity, and strawberry
flavor intensity. The experiment was conducted on January 18th and February 13th of
2013. No statistically significant differences were determined for any consumer rated
measures, except for sourness intensity in February (Table 4-2). Mean sourness
intensity of 13.7 and 15.7 for black and red was determined to be statistically significant
using Tukey’s honestly significant difference test. Despite this one significant difference
142
in sourness intensity it was found that red plastic mulch did not impart any difference to
overall liking, sweetness intensity, or flavor intensity compared to black mulch as
hypothesized.
Discussion
A variable response of volatile compounds to distinct light treatments is
potentially a result of photoreceptor mediated regulation of expression, stability, or
activity of enzymes required for volatile synthesis. Hexanoic acid was selectively
increased by narrow-bandwidth far-red light compared to all other treatments. This is
potentially due to a phytochrome mediated response. On the other hand, butanoic acid,
1-methlethyl ester is decreased by blue light. Therefore, perception of blue light by an
appropriate photoreceptor, such as cryptochrome, may down regulate production of this
volatile. Butanoic acid, 1-methylethyl ester has been previously reported to be
associated with flavor (Hakala et al., 2002) as well as linalool (Jetti et al., 2007; Olbricht
et al.; Ulrich et al., 1997). Both of which were found to have significant correlations to
flavor intensity in the study conducted in chapter 2 of this dissertation. Knowing the
amount of a flavor volatile can be preferentially altered presents the potential to test its
effect in an otherwise unaltered whole fruit.
Despite first-hand experience of altering volatile profiles of various fruits and
flowers, including strawberry, using postharvest light treatments, a similar effect could
not be reproducibly measured in a field scale application. Red plastic mulch does exhibit
an enhanced reflective spectrum compared to black plastic mulch. The red to far-red
ratio reflected from red mulch is similar to that of direct sunlight; therefore, the only
difference is a negligible increase in PAR. No detectable or reproducible significant
differences are observed in both consumer panels and volatile analysis.
143
The effect of colored mulch on volatile content is possibly dependent upon
genetic background, as response differences to light quality and quantity are known in
strawberry, particularly in flower induction (Hancock, 1999). Previously described
reflective mulch induced volatile differences was documented in cultivar ‘Chandler’.
Also, in that experiment significant gains in glucose, fructose, and sucrose were
attributed to red mulch verse black mulch (Kasperbauer et al., 2001). However, in this
work the cultivar ‘Strawberry Festival’ was used. Previous work in Egypt using cultivar
‘Strawberry Festival’ with red and black plastic mulch describes significant differences in
numerous growth parameters including fruit weight and yield. Soluble solid content was
not significantly affected by the mulch treatment in Egypt (El-Yazied and Mady, 2012).
The previous lack of influence on soluble solid content potentially explains no consistent
differences in volatile content measured in this work, as volatile content has been
correlated to SSC.
Differences in location and season are also potentially explanatory for lack of
consistent volatile differences or consumer perception differences. Strawberry
production in Florida occurs during the winter months when solar radiation reaching the
soil surface has the greatest proportion of red and far red light. This is due to a lower
angle of incidence and thus greater atmosphere the radiation must travel through. Egypt
and Florida sit at the same latitudes, which may account for the lack of red mulch
inducing greater volatile content. North Carolina production occurs in late spring to early
summer when the angle of incidence of sunlight is lower, thus a decreased amount of
red and far-red light reaches the soil surface. Red mulch reflects more red and far-red
light compared to black plastic mulch. Therefore, in a solar environment with less red
144
and far-red light, such as May in North Carolina compared to January in Florida, the
enhancements by red mulch may elicit a more pronounced effect.
The manner in which fruits were assayed for volatile differences in the previous
work in North Carolina (Kasperbauer et al., 2001) and this study is potentially
explanatory of differences in effects observed. Kasperbauer harvested fruit in the late
afternoon, following a full day of exposure to sunlight. Also, the fruit was frozen
immediately for later volatile analysis. Conversely, this work in Florida followed an
approach more relevant to commercial fresh strawberry. Fruit was harvested in the
mornings and stored at 4ºC in the dark overnight. It is possible the cold and/or dark
treatment negated any effects of the red mulch on volatile emission. If this is true, red
mulch may present itself as a means to enhance flavor of frozen strawberry products,
but the effects will not stand up to current postharvest practices of fresh strawberry.
Materials and Methods
Postharvest Narrow-Bandwidth Light Treatment
Fragaria x ananassa cv. ‘Strawberry Festival’ was grown according to current
commercial practices for annual strawberry plasticulture in Florida (MacKenzie et al.,
2011; Santos et al., 2012) beginning in the Fall of 2011 and continuing through the
Winter of 2012. Fully-ripe fruit by commercial standards (Strand, 2008) was harvested
at 9:00 in the morning. Fruit was transported from Citra, FL to Gainesville, FL and
stored at 4°C in the dark overnight prior to light treatments and subsequent analysis of
fresh strawberry fruit volatiles at 9:30 the following morning.
Seven berries were selected based on uniformity of appearance per treatment,
and were placed into clear plastic containers for each treatment. A dark treatment and
four light treatments were tested: white, blue, red, and far-red (Figure 4-1).
145
Monochromatic light treatments were generated using a light emitting diode (LED)
platform (Zhang et al., 2011b)}. In all cases, light treatments were 50 µmol m-2 s-1 in
separate illumination chambers within an environmentally-controlled and actively
ventilated area (22°C ± 1.5°C). The light treatments were generated using the Flora
Lamp LED arrays (Light Emitting Computers, Victoria, B.C.). The control treatment
(white light) was generated by cool white fluorescent bulbs, while the dark treatments
were performed in an identical light-tight enclosure under the same ambient conditions.
Fruit was treated for eight hours without photoperiod prior to volatile collection.
Spectroradiometer readings were obtained with a StellarNet device and visualized on
SpectraWiz software (Stellar Net, Tampa, FL).
Red and Black Plastic Mulch Field Conditions
Two treatments were replicated in three blocks consisting of approximately 150
plants per treatment replicate at the University of Florida and Institute of Food and
Agricultural Sciences Plant Science Research and Education Unit in Citra, Florida.
Planting of bare root propagules occurred on October 18th, 2012 and transplant
establishment is facilitated by ten days of overhead irrigation. Laying of Black and Red
Selective Reflective Mulch (Garden Trends, Inc.) over existing black polyethylene
occurred on November 5th, 2012. Spectroradiometer readings were obtained with a
StellarNet device and visualized on SpectraWiz software (Stellar Net, Tampa, FL).
Reflected light quality was measured at 15 cm above plastic mulch.
Harvests were conducted twice per week beginning December 18th, 2012
through March 14th, 2013. In which, fully-ripe fruit by commercial standards (Strand,
2008) was harvested at 9:00 in the morning, weather permitting. Count and mass (kg) of
marketable and cull was recorded for each replicated treatment in the field. Fruit was
146
transported from Citra to Gainesville, FL and stored at 4°C in the dark overnight in the
event of simultaneous analysis of fresh strawberry fruit volatiles and/or sensory analysis
the following morning beginning at 9:30.
Flavor Panel
All consumer panels were approved by the University of Florida Institutional
Review Board. One hundred panelists on January 18th, 2013 and 88 panelists on
February 13th, 2013 evaluated strawberry fruit grown over red and black plastic mulch
raised beds (Tieman et al., 2012). Fresh, fully-ripe strawberry fruit was removed from
overnight 4°C dark storage and allowed to warm to room temperature prior to sensory
analysis. Each panelist was given two to three whole strawberries for evaluation,
depending on cultivar availability. Panelist bit each sample, chewed, and swallowed it.
Ratings for overall liking and texture liking were scaled on hedonic gLMS in the context
of all pleasure/displeasure experiences. Perceived intensity of sweetness, sourness,
and strawberry flavor are scaled in context of all sensory experiences using sensory
gLMS (Bartoshuk et al., 2004; Bartoshuk et al., 2003; Bartoshuk et al., 2005; Tieman et
al., 2012). Scales were employed to mediate valid comparisons across subjects and
sessions.
Volatile Analysis
At least 100 grams or seven berries of each sample were removed from 4°C dark
overnight storage or postharvest narrow-bandwidth light treatment prior to volatile
collection. A single biological replicate technically replicated three times was used per
postharvest light treatment. For plastic mulch experiment volatiles were collected in
technical triplicates per three biological replicates of each treatment to achieve precise
quantitative measurement of volatile compounds emitted from strawberry fruit. Samples
147
were homogenized in a blender prior to splitting into three 15 gram technical replicates
for immediate capturing of volatile emissions and the remainder frozen in N2 (l) and
stored at -80°C. A two hour collection in a dynamic headspace volatile collection system
(Underwood et al., 2005) allowed for concentration of emitted volatiles on HaySep 80-
100 porous polymer adsorbent (Hayes Seperations Inc., Bandera, TX, USA). Elution
from polymer was described by Schmelz et al. (Schmelz et al., 2003).
Quantification of volatiles in an elution was performed on an Agilent 7890A
Series gas chromatograph (GC) (carrier gas; He at 3.99 mL min-1; splitless injector,
temperature 220°C, injection volume 2 µl) equipped with a DB-5 column ((5%-Phenyl)-
methylpolysiloxane, 30 m length × 250 µm i.d. × 1 µm film thickness; Agilent
Technologies, Santa Clara, CA, USA). Oven temperature was programmed from 40°C
(0.5 min hold) at 5°C min-1 to 250°C (4 min hold). Signals were captured with a flame
ionization detector (FID) at 280°C. Peaks from FID signal were integrated manually with
Chemstation B.04.01 software (Agilent Technologies, Santa Clara, CA). Volatile
emissions (ng1 gFW-1 h-1) were calculated based on individual peak area relative to
sample elution standard peak area. GC-Mass Spectrometry (MS) analysis of elutions
was performed on an Agilent 6890N GC in tandem with an Agilent 5975 MS (Agilent
Technologies, Santa Clara, CA, USA) and retention times were compared with
authentic standards (Sigma Aldrich, St Louis, MO, USA) for volatile identification
(Schmelz et al., 2001). Chemical Abstract Services (CAS) registry numbers were used
to query SciFinder® substances database for associated chemical name and molecular
formula presented in Table 2-6.
148
Statistical Analysis
One-way ANOVA determined statistically significant differences between
volatiles of postharvest narrow-bandwidth light treatments, volatiles of plastic mulch
treatments, and consumer ratings of plastic mulch treatments. Tukey’s honestly
significant difference test was conducted to separate means. All analyses were
conducted in JMP 8.
149
Table 4-1. Photosynthetically active, red, and far-red radiation reflected by
selective reflective mulch.
PAR (400-700 nm)
Red (600-700 nm)
Far-red (700-800 nm)
Red:Far-red
Unexposed Exposed Unexposed Exposed Unexposed Exposed Unexposed Exposed
Direct Sun µmol
1 m
-2 s
-1 2324 853 754
1.1 % Direct PAR 100.0 63.7 32.4
Black Reflective µmol
1 m
-2 s
-1 101 77 34 25 19 52
1.8 0.5 % Direct PAR 4.3 3.3 1.5 1.1 0.8 2.2
Red Reflective µmol
1 m
-2 s
-1 298 238 200 146 193 194
1.0 0.8 % Direct PAR 12.8 10.3 8.6 6.3 8.3 8.3
Difference µmol1 m
-2 s
-1 197 162 165 122 174 141
0.9 0.9 (red-black) % Direct PAR 8.5 7.0 7.1 5.2 7.5 6.1
Note: Radiation measured from unexposed mulch and 4 month exposed mulch on March 14th, 2013. Relative value is average of three replicates divided by direct PAR at time of measurement. Absolute value is product of relative and general direct PAR of 2324 µmol1 m-2 s-1.
150
Table 4-2. Consumer panels do not perceive differences between red and black plastic mulch grown strawberries.
Black Red Black verse Red Ideal
n Mean Standard Deviation
Mean Standard Deviation
ANOVA p-value
Tukey's HSD
(α=0.05) Mean
Standard Deviation
1/18/2013
Overall Liking 88 34.4 28.2 34.1 27.9 0.87 a, a
Texture Liking 88 38.0 28.4 37.8 28.9 0.92 a, a
Sweetness Intensity 88 28.7 23.4 28.9 24.1 0.93 a, a 41.2 26.1
Sourness Intensity 88 19.9 19.2 18.8 18.6 0.32 a, a 16.7 15.9
Strawberry Flavor Intensity
88 32.1 23.9 32.7 24.0 0.72 a, a 43.1 26.2
2/13/2013
Overall Liking 100 37.3 27.6 36.6 28.3 0.66 a, a
Texture Liking 100 35.9 26.9 34.4 27.0 0.24 a, a
Sweetness Intensity 100 33.8 25.5 32.2 24.9 0.22 a, a 41.7 26.1
Sourness Intensity 100 13.7 14.5 15.8 16.1 0.02 b, a 16.5 15.5
Strawberry Flavor Intensity
100 34.4 25.0 34.1 24.3 0.81 a, a 44.3 26.6
Note: Panels were conducted at two separate points of the season in which consumers rated overall liking, texture liking, sweetness intensity, sourness intensity, and strawberry flavor intensity of strawberries grown over red or black plastic mulch. All attributes were statistically indistinguishable across treatments on both dates, except for sourness intensity being greater in the red treatment on February 13, 2013. One-way ANOVA analysis conducted in JMP 8.
151
Table 4-3. Volatile analysis does not detect consistent differences between red and black plastic mulch grown strawberries.
1/18/2013 2/13/2013
Black Red Black Red
Volatile CAS #
n Mean Std
Error Mean
Std Error
ANOVA p-value
Mean Std
Error Mean
Std Error
ANOVA p-value
616-25-1 9 17.99 1.18 22.27 1.18 0.021 29.97 0.99 29.09 0.99 0.533
1629-58-9 9 127.91 6.93 147.77 6.93 0.060 223.19 7.13 222.48 7.13 0.945
96-22-0 9 50.19 2.19 52.03 2.19 0.562 63.10 2.23 65.76 2.23 0.412
110-62-3 9 43.30 2.57 42.02 2.57 0.729 35.63 1.84 34.85 1.84 0.770
1534-08-3 9 0.27 0.03 0.33 0.03 0.226 0.44 0.03 0.40 0.03 0.405
105-37-3 9 1.04 0.17 0.47 0.17 0.032 16.96 4.95 12.16 4.95 0.503
109-60-4 9 0.49 0.04 0.41 0.04 0.197 0.94 0.18 0.59 0.18 0.184
623-42-7 9 3238.9 97.71 2667.3 97.71 0.001 2633.3 214.16 2541.5 214.16 0.766
591-78-6 9 5.94 0.21 5.00 0.21 0.005 4.50 0.24 4.82 0.24 0.357
1576-87-0 9 39.84 1.95 44.77 1.95 0.093 62.39 2.17 62.14 2.17 0.937
1576-86-9 9 34.39 1.48 38.62 1.48 0.060 56.46 2.80 56.20 2.80 0.948
623-43-8 9 63.94 10.88 106.48 10.88 0.014 150.19 8.42 147.79 8.42 0.843
66-25-1 9 1466.3 54.45 1419.39 54.45 0.551 2450.9 151.42 2532.3 151.42 0.709
123-86-4 9 8.70 0.83 9.40 0.83 0.561 22.28 2.26 22.41 2.26 0.968
624-24-8 9 17.52 0.54 14.55 0.54 0.001 14.29 1.10 12.92 1.10 0.388
29674-47-3
9 8.41 0.44 7.77 0.44 0.319 8.70 0.59 8.23 0.59 0.582
96-04-8 9 0.61 0.09 0.43 0.09 0.164 0.64 0.06 0.76 0.06 0.191
638-11-9 9 102.16 5.79 108.00 5.79 0.486 139.18 5.09 119.62 5.09 0.015
116-53-0 9 31.94 1.64 30.38 1.64 0.510 28.32 2.35 26.86 2.35 0.667
7452-79-1 9 22.83 3.66 28.67 3.66 0.277 35.22 3.00 31.71 3.00 0.419
6728-26-3 9 6854.7 207.40 6911.7 207.40 0.849 7585.6 235.65 7614.1 235.65 0.933
928-95-0 9 67.18 5.42 79.51 5.42 0.127 111.01 12.49 104.99 12.49 0.738
111-27-3 9 33.38 2.17 39.14 2.17 0.079 48.49 7.59 40.53 7.59 0.469
123-92-2 9 2.81 0.15 2.74 0.15 0.720 5.18 0.29 5.20 0.29 0.962
624-41-9 9 3.27 0.28 3.26 0.28 0.989 4.55 0.30 3.93 0.30 0.158
110-43-0 9 4.31 0.26 4.05 0.26 0.491 12.65 1.07 14.91 1.07 0.156
2432-51-1 9 24.04 1.45 22.22 1.45 0.389 23.58 1.23 22.61 1.23 0.583
105-66-8 9 1.00 0.08 0.81 0.08 0.102 4.95 0.67 4.45 0.67 0.599
111-71-7 9 2.39 0.13 2.47 0.13 0.676 3.44 0.15 3.60 0.15 0.474
628-63-7 9 1.86 0.12 1.83 0.12 0.864 3.04 0.11 2.90 0.11 0.391
106-70-7 9 208.04 10.13 161.34 10.13 0.005 223.92 19.03 215.28 19.03 0.752
55514-48-2
9 1.98 0.13 2.23 0.13 0.206 1.96 0.08 1.61 0.08 0.007
539-90-2 9 8.42 0.43 8.44 0.43 0.976 17.46 0.80 17.26 0.80 0.859
142-62-1 9 133.59 18.17 267.15 18.17 0.000 376.20 23.86 355.03 23.86 0.539
110-93-0 9 2.68 0.11 2.78 0.11 0.541 4.12 0.19 4.14 0.19 0.944
109-21-7 9 30.49 4.60 38.86 4.60 0.216 117.60 9.42 114.99 9.42 0.847
123-66-0 9 9.61 0.99 5.61 0.99 0.011 73.44 16.72 71.10 16.72 0.922
124-13-0 9 4.41 0.22 4.31 0.22 0.768 5.64 0.26 5.80 0.26 0.670
142-92-7 9 14.79 0.76 15.00 0.76 0.847 27.12 1.77 28.09 1.77 0.703
2497-18-9 9 8.29 1.42 8.39 1.42 0.958 8.56 2.46 8.72 2.46 0.963
60415-61-4
9 0.64 0.07 0.81 0.07 0.098 1.61 0.10 1.44 0.10 0.228
104-76-7 9 7.98 0.49 8.45 0.49 0.506 14.55 0.27 12.51 0.27 0.000
2548-87-0 9 1.59 0.08 1.67 0.08 0.471 0.91 0.23 1.45 0.23 0.112
540-18-1 9 0.78 0.07 0.85 0.07 0.520 1.67 0.12 1.68 0.12 0.937
4077-47-8 9 3.58 0.31 3.81 0.31 0.611 7.56 0.92 6.50 0.92 0.427
20664-46-4
9 13.59 1.44 17.53 1.44 0.071 31.64 1.68 31.86 1.68 0.930
821-55-6 9 1.28 0.15 1.62 0.15 0.133 3.80 0.18 3.95 0.18 0.545
5989-33-3 9 2.10 0.13 2.01 0.13 0.629 3.68 0.22 4.09 0.22 0.196
152
Table 4-3. Continued
1/18/2013 2/13/2013
Black Red Black Red
Volatile CAS #
n Mean Std
Error Mean
Std Error
ANOVA p-value
Mean Std
Error Mean
Std Error
ANOVA p-value
78-70-6 9 51.04 3.26 48.20 3.26 0.547 58.38 4.60 57.13 4.60 0.850
124-19-6 9 4.02 0.34 4.22 0.34 0.687 9.34 0.78 9.72 0.78 0.734
103-09-3 9 0.41 0.03 0.45 0.03 0.341 0.72 0.08 0.69 0.08 0.827
140-11-4 9 1.97 0.16 1.73 0.16 0.304 1.86 0.14 1.92 0.14 0.754
2639-63-6 9 13.35 0.96 14.00 0.96 0.640 35.51 2.50 34.74 2.50 0.830
53398-83-7
9 14.13 0.81 14.68 0.81 0.642 16.99 3.00 17.91 3.00 0.830
106-32-1 9 0.10 0.03 0.07 0.03 0.488 0.97 0.33 0.83 0.33 0.759
112-14-1 9 2.83 0.22 3.14 0.22 0.328 4.36 0.36 3.97 0.36 0.451
564-94-3 9 0.65 0.04 0.63 0.04 0.710 0.52 0.05 0.47 0.05 0.474
3913-81-3 9 1.92 0.14 2.25 0.14 0.123 3.70 0.19 3.84 0.19 0.605
110-39-4 9 24.75 5.80 37.41 5.80 0.142 54.39 2.99 52.74 2.99 0.701
110-38-3 9 4.37 0.50 4.81 0.50 0.549 10.50 0.72 10.01 0.72 0.632
29811-50-5
9 0.19 0.01 0.16 0.01 0.052 0.30 0.04 0.30 0.04 0.970
7786-58-5 9 0.22 0.02 0.23 0.02 0.874 0.61 0.06 0.56 0.06 0.574
15111-96-3
9 0.23 0.04 0.35 0.04 0.061 0.76 0.06 0.83 0.06 0.465
706-14-9 9 2.52 0.58 0.94 0.58 0.073 2.12 0.15 1.94 0.15 0.393
10522-34-6
9 1.67 0.18 1.93 0.18 0.335 2.72 0.10 2.94 0.10 0.131
5881-17-4 9 1.21 0.09 1.07 0.09 0.265 1.67 0.08 1.72 0.08 0.634
128-37-0 9 0.36 0.02 0.35 0.02 0.782 0.58 0.06 0.58 0.06 0.971
40716-66-3
9 25.74 2.33 27.02 2.33 0.702 71.48 6.29 69.50 6.29 0.827
4887-30-3 9 1.82 0.31 2.46 0.31 0.160 10.99 1.03 11.65 1.03 0.658
5454-09-1 9 0.76 0.11 1.02 0.11 0.119 3.58 0.40 3.88 0.40 0.600
2305-05-7 9 3.40 0.31 3.91 0.31 0.267 11.76 0.79 10.59 0.79 0.309
TOTAL 9 12889.1
4 383.80
12535.55
383.80 0.524 15004.
39 488.73
14933.75
488.73 0.920
Note: Volatiles were collected from fresh F. x ananassa cv. ‘Strawberry Festival’ simultaneously with consumer panels. One-way ANOVA determined statistically significant differences of nine volatiles between treatments on January 18th, 2013 and three volatiles between treatments on February 13th, 2013. Significant values (α=0.05) are in bold. However, no volatile compounds showed consistent differences on both collections. One-way ANOVA analysis conducted in JMP 8.
153
Figure 4-1. Spectroradiometer readings of the light qualities used in postharvest
treatments. All treatments represent the waveform generated at a fluence rate of 50 µmol m-2 s-1. B = blue, R = red, FR = far-red, HBW = half-bandwidth.
154
Figure 4-2. Effect of light treatments on selected volatile compounds in Fragaria x.
ananassa cv. ‘Strawberry Festival’. Light decreases the content of 2-hexen-1-ol, (2E)- (928-95-0) (A) compared to dark. Far-red light treatment selectively increases hexanoic acid (142-62-1) (B) compared to all other treatments. Blue light decreases butanoic acid, 1-methylethyl ester (638-11-9) (C) while negligibly affecting other treatments. Certain compounds, like linalool (78-70-6) are not affected by light treatments (D). Volatile collections were conducted multiple times with similar results observed. Volatile content is the average of three technical replicates. Error bars represent one standard error. Data analysis conducted in JMP 8.
155
A
B
C
D
156
Figure 4-3. Spectrum of light reflected from red and black plastic mulch. Comparison of
direct sunlight to light reflected from unexposed red and black mulch (A). Difference spectrum of light reflected from red and black of unexposed and exposed mulch (B). Comparison of light reflected from unexposed and exposed black (C) and red (D) plastic mulch. Reflected measurements recorded at 15 cm above plastic mulch. Data normalized by averaging three replicates, dividing by direct PAR at time of measurement, and multiplying by general direct PAR of 2324 µmol1 m-2 s-1.
157
LIST OF REFERENCES
Aharoni A, Giri AP, Verstappen FWA, Bertea CM, Sevenier R, Sun ZK, Jongsma MA, Schwab W, Bouwmeester HJ. 2004. Gain and loss of fruit flavor compounds produced by wild and cultivated strawberry species. Plant Cell 16.
Aharoni A, Keizer LCP, Bouwmeester HJ, Sun ZK, Alvarez-Huerta M, Verhoeven HA, Blaas J, van Houwelingen A, De Vos RCH, van der Voet H, Jansen RC, Guis M, Mol J, Davis RW, Schena M, van Tunen AJ, O'Connell AP. 2000. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 12.
Aharoni A, Keizer LCP, Van den Broeck HC, Blanco-Portales R, Munoz-Blanco J, Bois G, Smit P, De Vos RCH, O'Connell AP. 2002. Novel insight into vascular, stress, and auxin-dependent and -independent gene expression programs in strawberry, a non-climacteric fruit. Plant Physiology 129, 1019-1031.
Aharoni A, O'Connell AP. 2002. Gene expression analysis of strawberry achene and receptacle maturation using DNA microarrays. Journal of Experimental Botany 53, 2073-2087.
Arnold K, Bordoli L, Kopp J, Schwede T. 2006. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 22, 195-201.
Baldwin EA, Goodner K, Plotto A. 2008. Interaction of volatiles, sugars, and acids on perception of tomato aroma and flavor descriptors. Journal of Food Science 73.
Baldwin EA, Scott JW, Einstein MA, Malundo TMM, Carr BT, Shewfelt RL, Tandon KS. 1998. Relationship between sensory and instrumental analysis for tomato flavor. Journal of the American Society for Horticultural Science 123.
Bartoshuk LM, Duffy V, Green BG, Hoffman HJ, Ko CW, Lucchina LA, Marks LE, Snyder DJ, Weiffenbach JM. 2004. Valid across-group comparisons with labeled scales: the gLMS versus magnitude matching. Physiology & Behavior 82, 109-114.
Bartoshuk LM, Duffy VB, Fast K, Green BG, Prutkin J, Snyder DJ. 2003. Labeled scales (eg, category, Likert, VAS) and invalid across-group comparisons: what we have learned from genetic variation in taste. Food Quality and Preference 14, 125-138.
Bartoshuk LM, Fast K, Snyder DJ. 2005. Differences in our sensory - Invalid comparisons with labeled scales. Current Directions in Psychological Science 14, 122-125.
Bartoshuk LM, Klee HJ. 2013. Better Fruits and Vegetables through Sensory Analysis. Current Biology 23, R374-R378.
158
Basson CE, Groenewald JH, Kossmann J, Cronje C, Bauer R. 2010. Sugar and acid-related quality attributes and enzyme activities in strawberry fruits: Invertase is the main sucrose hydrolysing enzyme. Food Chemistry 121.
Bohlmann J, Lins T, Martin W, Eilert U. 1996. Anthranilate synthase from Ruta graveolens - Duplicated AS alpha genes encode tryptophan-sensitive and tryptophan-insensitive isoenzymes specific to amino acid and alkaloid biosynthesis. Plant Physiology 111, 507-514.
Breslin PAS. 2001. Human gustation and flavour. Flavour and Fragrance Journal 16, 439-456.
Brown EM, McDougall GJ, Stewart D, Pereira-Caro G, Gonzalez-Barrio R, Allsopp P, Magee P, Crozier A, Rowland I, Gill CIR. 2012. Persistence of Anticancer Activity in Berry Extracts after Simulated Gastrointestinal Digestion and Colonic Fermentation. Plos One 7.
Bruce BD. 2000. Chloroplast transit peptides: structure, function and evolution. Trends in Cell Biology 10, 440-447.
Brummell DA, Harpster MH. 2001. Cell wall metabolism in fruit softening and quality and its manipulation in transgenic plants. Plant Molecular Biology 47.
Burdach KJ, Kroeze JHA, Koster EP. 1984. Nasal, Retronasal, and Gustatory Perception - An Experimental Comparison. Perception & Psychophysics 36.
Castillejo C, de la Fuente JI, Iannetta P, Botella MA, Valpuesta V. 2004. Pectin esterase gene family in strawberry fruit: study of FaPE1, a ripening-specific isoform. Journal of Experimental Botany 55, 909-918.
Causse M, Saliba-Colombani V, Lesschaeve I, Buret M. 2001. Genetic analysis of organoleptic quality in fresh market tomato. 2. Mapping QTLs for sensory attributes. Theoretical and Applied Genetics 102, 273-283.
Chalavi V, Tabaeizadeh Z, Thibodeau P. 2003. Enhanced resistance to Verticillium dahliae in transgenic strawberry plants expressing a Lycopersicon chilense chitinase gene. Journal of the American Society for Horticultural Science 128, 747-753.
Chambers A, Carle S, Njuguna W, Chamala S, Bassil N, Whitaker VM, Barbazuk WB, Folta KM. 2013. A genome-enabled, high-throughput, and multiplexed fingerprinting platform for strawberry (Fragaria L.). Molecular Breeding 31, 615-629.
Chambers A, Whitaker VM, Gibbs B, Plotto A, Folta KM. 2012. Detection of the linalool-producing NES1 variant across diverse strawberry (Fragaria spp.) accessions. Plant Breeding 131.
Chandler CK, Legard DE, Dunigan DD, Crocker TE, Sims CA. 2000. 'Strawberry Festival' strawberry. Hortscience 35.
159
Chen M, Chory J, Fankhauser C. 2004. Light signal transduction in higher plants. Annual Review of Genetics 38, 87-117.
Christensen CM. 1983. Effects of color on aroma, flavor and texture judgements of foods. Journal of Food Science 48, 787-790.
Cliff M, Noble AC. 1990. Time-intensity evaluation of sweetness and fruitiness and their interaction in a model solution. Journal of Food Science 55.
Colquhoun T, Schwieterman M, Gilbert J, Jaworski E, Langer K, Jones C, Rushing G, Hunter T, Olmstead J, Clark D, Folta K. 2013. Light modulation of volatile organic compounds from petunia flowers and select fruits. Postharvest Biology and Technology 86, 37-44.
Colquhoun TA, Levin LA, Moskowitz HR, Whitaker VM, Clark DG, Folta KM. 2012. Framing the perfect strawberry: an exercise in consumer-assisted selection of fruit crops. Journal of Berry Research 2, 45-61.
Colquhoun TA, Schimmel BCJ, Kim JY, Reinhardt D, Cline K, Clark DG. 2010a. A petunia chorismate mutase specialized for the production of floral volatiles. Plant Journal 61, 145-155.
Colquhoun TA, Verdonk JC, Schimmel BCJ, Tieman DM, Underwood BA, Clark DG. 2010b. Petunia floral volatile benzenoid/phenylpropanoid genes are regulated in a similar manner. Phytochemistry 71, 158-167.
Cumplido-Laso G, Medina-Puche L, Moyano E, Hoffmann T, Sinz Q, Ring L, Studart-Wittkowski C, Luis Caballero J, Schwab W, Munoz-Blanco J, Blanco-Portales R. 2012. The fruit ripening-related gene FaAAT2 encodes an acyl transferase involved in strawberry aroma biogenesis. Journal of Experimental Botany 63.
Darrow GM. 1966. The Strawberry: History, Breeding, and Physiology.
Dexter R, Qualley A, Kish CM, Ma CJ, Koeduka T, Nagegowda DA, Dudareva N, Pichersky E, Clark D. 2007. Characterization of a petunia acetyltransferase involved in the biosynthesis of the floral volatile isoeugenol. Plant Journal 49, 265-275.
Du X, Song M, Rouseff R. 2011a. Identification of New Strawberry Sulfur Volatiles and Changes during Maturation. Journal of Agricultural and Food Chemistry 59, 1293-1300.
Du XF, Plotto A, Baldwin E, Rouseff R. 2011b. Evaluation of Volatiles from Two Subtropical Strawberry Cultivars Using GC-Olfactometry, GC-MS Odor Activity Values, and Sensory Analysis. Journal of Agricultural and Food Chemistry 59, 12569-12577.
Edris AE, Chizzola R, Franz C. 2008. Isolation and characterization of the volatile aroma compounds from the concrete headspace and the absolute of Jasminum sambac (L.) Ait. (Oleaceae) flowers grown in Egypt. European Food Research and Technology 226, 621-626.
160
Edziri H, Mastouri M, Cheraif I, Aouni M. 2010. Chemical composition and antibacterial, antifungal and antioxidant activities of the flower oil of Retama raetam (Forssk.) Webb from Tunisia. Natural Product Research 24, 789-796.
El-Yazied AA, Mady MA. 2012. Plastic mulch color and potassium foliar application affect growth and productivity of strawberry ( Fragaria * ananassa Duch). Journal of Applied Sciences Research.
Emanuelsson O, Nielsen H, Von Heijne G. 1999. ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Science 8, 978-984.
Fait A, Hanhineva K, Beleggia R, Dai N, Rogachev I, Nikiforova VJ, Fernie AR, Aharoni A. 2008. Reconfiguration of the achene and receptacle metabolic networks during strawberry fruit development. Plant Physiology 148.
Finn CE, Retamales JB, Lobos GA, Hancock JF. 2013. The Chilean Strawberry (Fragaria chiloensis): Over 1000 Years of Domestication. Hortscience 48, 418-421.
Folta KM, Davis TM. 2006. Strawberry genes and genomics. Critical Reviews in Plant Sciences 25, 399-415.
Folta KM, Dhingra A, Howard L, Stewart PJ, Chandler CK. 2006. Characterization of LF9, an octoploid strawberry genotype selected for rapid regeneration and transformation. Planta 224, 1058-1067.
Frank RA, Byram J. 1988. Taste smell interactions are tastant and odorant dependent. Chemical Senses 13.
Fujimaru T, Lim J. 2013. Effects of Stimulus Intensity on Odor Enhancement by Taste. Chemosensory Perception 6, 1-7.
Ghawana S, Paul A, Kumar H, Kumar A, Singh H, Bhardwaj PK, Rani A, Singh RS, Raizada J, Singh K, Kumar S. 2011. An RNA isolation system for plant tissues rich in secondary metabolites. BMC research notes 4, 85-85.
Giampieri F, Alvarez-Suarez JM, Mazzoni L, Romandini S, Bompadre S, Diamanti J, Capocasa F, Mezzetti B, Quiles JL, Ferreiro MS, Tulipani S, Battino M. 2013. The potential impact of strawberry on human health. Natural Product Research 27, 448-455.
Giampieri F, Tulipani S, Alvarez-Suarez JM, Quiles JL, Mezzetti B, Battino M. 2012. The strawberry: Composition, nutritional quality, and impact on human health. Nutrition 28.
Given NK, Venis MA, Grierson D. 1988. Hormonal-regulation of ripening in the strawberry, a non-climacteric fruit. Planta 174, 402-406.
161
Goff SA, Klee HJ. 2006. Plant volatile compounds: Sensory cues for health and nutritional value? Science 311.
Hakala MA, Lapvetelainen AT, Kallio HP. 2002. Volatile compounds of selected strawberry varieties analyzed by purge-and-trap headspace GC-MS. Journal of Agricultural and Food Chemistry 50.
Hall RL. 1968. Flavor and flavoring seeking a concensus of definition. Food Technology 22, 1496-&.
Hancock JF. 1999. Strawberries.
Hancock JF, Callow PW, Dale A, Luby JJ, Finn CE, Hokanson SC, Hummer KE. 2001. From the Andes to the Rockies: Native strawberry collection and utilization. Hortscience 36, 221-225.
Hoffmann T, Kalinowski G, Schwab W. 2006. RNAi-induced silencing of gene expression in strawberry fruit (Fragaria x ananassa) by agroinfiltration: a rapid assay for gene function analysis. Plant Journal 48.
Hong V, Wrolstad RE. 1990. Use of HPLC separation photodiode array detection for characterization of anthocyanins. Journal of Agricultural and Food Chemistry 38.
Jetti RR, Yang E, Kurnianta A, Finn C, Qian MC. 2007. Quantification of selected aroma-active compounds in strawberries by headspace solid-phase microextraction gas chromatography and correlation with sensory descriptive analysis. Journal of Food Science 72.
Jia HF, Wang YH, Sun MZ, Li BB, Han Y, Zhao YX, Li XL, Ding N, Li C, Ji WL, Jia WS. 2013. Sucrose functions as a signal involved in the regulation of strawberry fruit development and ripening. New Phytologist 198, 453-465.
Jorgensen RA, Cluster PD, English J, Que QD, Napoli CA. 1996. Chalcone synthase cosuppression phenotypes in petunia flowers: Comparison of sense vs antisense constructs and single-copy vs complex T-DNA sequences. Plant Molecular Biology 31, 957-973.
Jouquand C, Chandler C, Plotto A, Goodner K. 2008. A Sensory and Chemical Analysis of Fresh Strawberries Over Harvest Dates and Seasons Reveals Factors That Affect Eating Quality. Journal of the American Society for Horticultural Science 133, 859-867.
Kasperbauer MJ, Loughrin JH, Wang SY. 2001. Light reflected from red mulch to ripening strawberries affects aroma, sugar and organic acid concentrations. Photochemistry and Photobiology 74, 103-107.
162
Kessler D, Diezel C, Clark DG, Colquhoun TA, Baldwin IT. 2013. Petunia flowers solve the defence/apparency dilemma of pollinator attraction by deploying complex floral blends. Ecology Letters 16, 299-306.
Koellner TG, Lenk C, Zhao N, Seidl-Adams I, Gershenzon J, Chen F, Degenhardt J. 2010. Herbivore-Induced SABATH Methyltransferases of Maize That Methylate Anthranilic Acid Using S-Adenosyl-L-Methionine. Plant Physiology 153, 1795-1807.
Koo YJ, Kim MA, Kim EH, Song JT, Jung C, Moon JK, Kim JH, Seo HS, Song SI, Kim JK, Lee JS, Cheong JJ, Do Choi Y. 2007. Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid-mediated pathogen resistance in Arabidopsis thaliana. Plant Molecular Biology 64, 1-15.
Lavid N, Schwab W, Kafkas E, Koch-Dean M, Bar E, Larkov O, Ravid U, Lewinsohn E. 2002. Aroma biosynthesis in strawberry: S-adenosylmethionine : furaneol O-methyltransferase activity in ripening fruits. Journal of Agricultural and Food Chemistry 50.
Lavin JG, Lawless HT. 1998. Effects of color and odor on judgments of sweetness among children and adults. Food Quality and Preference 9.
Lee YK, Kim I-J. 2011. Modulation of fruit softening by antisense suppression of endo-beta-1,4-glucanase in strawberry. Molecular Breeding 27, 375-383.
Li H-m, Chiu C-C. 2010. Protein Transport into Chloroplasts. Annual Review of Plant Biology, Vol 61 61, 157-180.
Lindemann B. 2001. Receptors and transduction in taste. Nature 413, 219-225.
Locascio SJ, Gilreath JP, Olson S, Hutchinson CM, Chase CA. 2005. Red and black mulch color affects production of Florida strawberries. Hortscience 40, 69-71.
Lunkenbein S, Salentijn EMJ, Coiner HA, Boone MJ, Krens FA, Schwab W. 2006. Up- and down-regulation of Fragariaxananassa O-methyltransferase: impacts on furanone and phenylpropanoid metabolism. Journal of Experimental Botany 57, 2445-2453.
Maarse H. 1991. Volatile Compounds in Foods and Beverages.
MacKenzie SJ, Chandler CK. 2009. The late season decline in strawberry fruit soluble solid content observed in Florida is caused by rising temperatures. Acta Horticulturae.
MacKenzie SJ, Chandler CK, Hasing T, Whitaker VM. 2011. The Role of Temperature in the Late-season Decline in Soluble Solids Content of Strawberry Fruit in a Subtropical Production System. Hortscience 46.
Manning K. 1994. Changes in gene-expression during strawberry fruit ripening and their regulation by auxin. Planta 194, 62-68.
163
Manning K. 1998. Isolation of a set of ripening-related genes from strawberry: their identification and possible relationship to fruit quality traits. Planta 205, 622-631.
Mano Y, Nemoto K. 2012. The pathway of auxin biosynthesis in plants. Journal of Experimental Botany 63, 2853-2872.
Masaoka Y, Satoh H, Akai L, Homma I. 2010. Expiration: The moment we experience retronasal olfaction in flavor. Neuroscience Letters 473, 92-96.
Massa MJ, Robacker DC, Patt J. 2008. Identification of grape juice aroma volatiles and attractiveness to the Mexican fruit fly (Diptera : Tephritidae). Florida Entomologist 91, 266-276.
Menager I, Jost M, Aubert C. 2004. Changes in physicochemical characteristics and volatile constituents of strawberry (cv. Cigaline) during maturation. Journal of Agricultural and Food Chemistry 52.
Meng N, Liu Y, Sun L, Du A, Li H, Zhang Z, Meng N, Liu YX, Sun LR, Du AN, Li H, Zhang ZH. 2009. Transformation of cells in strawberry fruit with injection of Agrobacterium. Journal of Shenyang Agricultural University 40, 404-407.
Mezzetti B, Landi L, Pandolfini T, Spena A. 2004. The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry. Bmc Biotechnology 4.
Mikulic-Petkovsek M, Schmitzer V, Slatnar A, Stampar F, Veberic R. 2012. Composition of Sugars, Organic Acids, and Total Phenolics in 25 Wild or Cultivated Berry Species. Journal of Food Science 77, C1064-C1070.
Mitchell AZ, Hanson MR, Skvirsky RC, Ausubel FM. 1980. Anther culture of petunia - genotypes with high-frequency of callus, root, or plantlet formation. Zeitschrift Fur Pflanzenphysiologie 100, 131-146.
Miyawaki K, Fukuoka S, Kadomura Y, Hamaoka H, Mito T, Ohuchi H, Schwab W, Noji S. 2012. Establishment of a novel system to elucidate the mechanisms underlying light-induced ripening of strawberry fruit with an Agrobacterium-mediated RNAi technique. Plant Biotechnology 29, 271-277.
Murphy C, Cain WS. 1980. Taste and Olfaction - Independence vs Interaction. Physiology & Behavior 24.
Murphy C, Cain WS, Bartoshuk LM. 1977. Mutual action of taste and olfaction. Sensory Processes 1.
Najman D. 1993. Chemical characterization of scent of Citrus flower ( Citrus sinensis L. c.v. Shamouti) compounds and their attractiveness to the honey bee ( Apis mellifera L.) workers. Thesis, x + 51 pp.
164
Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C. 1990. Agrobacterium-mediated transformation of strawberry calli and recovery of transgenic plants. Plant Cell Reports 9, 10-13.
Nitsch JP. 1950. Growth and morphogenesis of the strawberry as related to auxin. American Journal of Botany 37, 211-215.
Olbricht K, Grafe C, Weiss K, Ulrich D. 2008. Inheritance of aroma compounds in a model population of Fragaria x ananassa Duch. Plant Breeding 127.
Olender T, Waszak SM, Viavant M, Khen M, Ben-Asher E, Reyes A, Nativ N, Wysocki CJ, Ge DL, Lancet D. 2012. Personal receptor repertoires: olfaction as a model. Bmc Genomics 13, 16.
Pelayo-Zaldivar C, Ebeler SE, Kader AA. 2005. Cultivar and harvest date effects on flavor and other quality attributes of California strawberries. Journal of Food Quality 28.
Perez AG, Olias R, Luaces P, Sanz C. 2002. Biosynthesis of strawberry aroma compounds through amino acid metabolism. Journal of Agricultural and Food Chemistry 50.
Perkins-Veazie P. 1995. Growth and ripening of strawberry fruit. Horticultural Reviews 17, 267-297.
Pierce J, Halpern BP. 1996. Orthonasal and retronasal odorant identification based upon vapor phase input from common substances. Chemical Senses 21, 529-543.
Prescott J. 1999. Flavour as a psychological construct: implications for perceiving and measuring the sensory qualities of foods. Food Quality and Preference 10.
Prescott JJ. 2004. Psychological processes in flavour perception. Flavor perception.
Pyysalo T, Honkanen E, Hirvi T. 1979. Volatiles of wild strawberries, Fragaria vesca L., compared to those of cultivated berries, Fragaria x ananassa cv Senga Sengana. Journal of Agricultural and Food Chemistry 27, 19-22.
Quesada MA, Blanco-Portales R, Pose S, Garcia-Gago JA, Jimenez-Bermudez S, Munoz-Serrano A, Caballero JL, Pliego-Alfaro F, Mercado JA, Munoz-Blanco J. 2009. Antisense Down-Regulation of the FaPG1 Gene Reveals an Unexpected Central Role for Polygalacturonase in Strawberry Fruit Softening. Plant Physiology 150.
Raab T, Lopez-Raez JA, Klein D, Caballero JL, Moyano E, Schwab W, Munoz-Blanco J. 2006. FaQR, required for the biosynthesis of the strawberry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone, encodes an enone oxidoreductase. Plant Cell 18.
Richins RD, Scholthof HB, Shepherd RJ. 1987. Sequence of figwort mosaic virus DNA (Caulimovirus group). Nucleic Acids Research 15, 8451-8466.
165
Rost B, Yachdav G, Liu JF. 2004. The PredictProtein server. Nucleic Acids Research 32, W321-W326.
Santos BM, Peres NA, Price JF, Whitaker VM, Dittmar PJ, Olson SM, Smith SA. 2012. Strawberry Production in Florida. Vegetable Production Handbook, Vol. HS710. Gainesville, FL: University of Florida Institute of Food and Agricultural Sciences.
Schestibratov KA, Dolgov SV. 2005. Transgenic strawberry plants expressing a thaumatin II gene demonstrate enhanced resistance to Botrytis cinerea. Scientia Horticulturae 106, 177-189.
Schieberle P, Hofmann T. 1997. Evaluation of the character impact odorants in fresh strawberry juice by quantitative measurements and sensory studies on model mixtures. Journal of Agricultural and Food Chemistry 45.
Schmelz EA, Alborn HT, Banchio E, Tumlinson JH. 2003. Quantitative relationships between induced jasmonic acid levels and volatile emission in Zea mays during Spodoptera exigua herbivory. Planta 216, 665-673.
Schmelz EA, Alborn HT, Tumlinson JH. 2001. The influence of intact-plant and excised-leaf bioassay designs on volicitin- and jasmonic acid-induced sesquiterpene volatile release in Zea mays. Planta 214, 171-179.
Settle RG, Meehan K, Williams GR, Doty RL, Sisley AC. 1986. Chemosensory properties of sour tastants. Physiology & Behavior 36, 619-623.
Shaw DV. 1997. Trait mean depression for second-generation inbred strawberry populations with and without parent selection. Theoretical and Applied Genetics 95, 261-264.
SjÖStrÖM Loren B, Cairncross Stanley E. 1955. Role of Sweeteners in Food Flavor. Use of Sugars and Other Carbohydrates in the Food Industry, Vol. 12: American Chemical Society, 108-113.
Small DM, Jones-Gotman M. 2001. Neural substrates of taste/smell interactions and flavour in the human brain. Vol. 26. Chemical Senses, 1034.
Small DM, Voss J, Mak YE, Simmons KB, Parrish T, Gitelman D. 2004. Experience-dependent neural integration of taste and smell in the human brain. Journal of Neurophysiology 92.
Smith BJ, Hokanson SC, Lewers KS, Maas JL, Hancock JF, Serce S. 2003. Evaluation of native strawberry germplasm for resistance to anthracnose. Phytopathology 93, S79-S80.
166
Stevens GR, Clark L. 1998. Bird repellents: development of avian-specific tear gases for resolution of human-wildlife conflicts. International Biodeterioration & Biodegradation 42, 153-160.
Stevenson RJ, Prescott J, Boakes RA. 1999. Confusing tastes and smells: How odours can influence the perception of sweet and sour tastes. Chemical Senses 24.
Stommel J, Abbott JA, Saftner RA, Camp MJ. 2005. Sensory and objective quality attributes of beta-carotene and lycopene-rich tomato fruit. Journal of the American Society for Horticultural Science 130, 244-251.
Strand L. 2008. Integrated pest management for strawberries: ANR Publications.
Suutarinen J, Anakainen L, Autio K. 1998. Comparison of light microscopy and spatially resolved Fourier transform infrared (FT-IR) microscopy in the examination of cell wall components of strawberries. Food Science and Technology-Lebensmittel-Wissenschaft & Technologie 31, 595-601.
Tieman D, Bliss P, McIntyre LM, Blandon-Ubeda A, Bies D, Odabasi AZ, Rodriguez GR, van der Knaap E, Taylor MG, Goulet C, Mageroy MH, Snyder DJ, Colquhoun T, Moskowitz H, Clark DG, Sims C, Bartoshuk L, Klee HJ. 2012. The Chemical Interactions Underlying Tomato Flavor Preferences. Current Biology 22, 1035-1039.
Tieman DM, Loucas HM, Kim JY, Clark DG, Klee HJ. 2007. Tomato phenylacetaldehyde reductases catalyze the last step in the synthesis of the aroma volatile 2-phenylethanol. Phytochemistry 68, 2660-2669.
Trainotti L, Ferrarese L, Dalla Vecchia F, Rascio N, Casadoro G. 1999. Two different endo-beta-1,4-glucanases contribute to the softening of the strawberry fruits. Journal of Plant Physiology 154.
Tulipani S, Mezzetti B, Capocasa F, Bompadre S, Beekwilder J, De Vos CHR, Capanoglu E, Bovy A, Battino M. 2008. Antioxidants, phenolic compounds, and nutritional quality of different strawberry genotypes. Journal of Agricultural and Food Chemistry 56.
Turlings TCJ, Benrey B. 1998. Effects of plant metabolites on the behavior and development of parasitic wasps. Ecoscience 5, 321-333.
Turlings TCJ, Jeanbourquin PM, Held M, Degen T. 2005. Evaluating the induced-odour emission of a Bt maize and its attractiveness to parasitic wasps. Transgenic Research 14, 807-816.
Ulrich D, Hoberg E, Rapp A, Kecke S. 1997. Analysis of strawberry flavour - discrimination of aroma types by quantification of volatile compounds. Zeitschrift Fur Lebensmittel-Untersuchung Und-Forschung a-Food Research and Technology 205.
167
Ulrich D, Komes D, Olbricht K, Hoberg E. 2007. Diversity of aroma patterns in wild and cultivated Fragaria accessions. Genetic Resources and Crop Evolution 54, 1185-1196.
UN. 2013. FAOSTAT. Vol. 2013. faostat3.fao.org: Food and Agricultural Organization of the United Nations.
Underwood BA, Tieman DM, Shibuya K, Dexter RJ, Loucas HM, Simkin AJ, Sims CA, Schmelz EA, Klee HJ, Clark DG. 2005. Ethylene-regulated floral volatile synthesis in petunia corollas. Plant Physiology 138, 255-266.
Veldhuizen MG, Shepard TG, Wang MF, Marks LE. 2010. Coactivation of Gustatory and Olfactory Signals in Flavor Perception. Chemical Senses 35, 121-133.
Vellicce GR, Ricci JCD, Hernandez L, Castagnaro AP. 2006. Enhanced resistance to Botrytis cinerea mediated by the transgenic expression of the chitinase gene ch5B in strawberry. Transgenic Research 15, 57-68.
Verdonk JC, de Vos CHR, Verhoeven HA, Haring MA, van Tunen AJ, Schuurink RC. 2003. Regulation of floral scent production in petunia revealed by targeted metabolomics. Phytochemistry 62, 997-1008.
Wang J, De Luca V. 2005. The biosynthesis and regulation of biosynthesis of Concord grape fruit esters, including 'foxy' methylanthranilate. Plant Journal 44, 606-619.
Watson R, Wright CJ, McBurney T, Taylor AJ, Linforth RST. 2002. Influence of harvest date and light integral on the development of strawberry flavour compounds. Journal of Experimental Botany 53.
Whitaker VM, Hasing T, Chandler CK, Plotto A, Baldwin E. 2011. Historical Trends in Strawberry Fruit Quality Revealed by a Trial of University of Florida Cultivars and Advanced Selections. Hortscience 46, 553-557.
Zabetakis I, Holden MA. 1997. Strawberry flavour: Analysis and biosynthesis. Journal of the Science of Food and Agriculture 74.
Zhang J, Wang X, Yu O, Tang J, Gu X, Wan X, Fang C. 2011a. Metabolic profiling of strawberry (Fragariaxananassa Duch.) during fruit development and maturation. Journal of Experimental Botany 62.
Zhang T, Maruhnich SA, Folta KM. 2011b. Green light induces shade avoidance symptoms. Plant Physiology 157, 1528-1536.
Zozulya S, Echeverri F, Nguyen T. 2001. The human olfactory receptor repertoire. Genome Biology 2.
168
BIOGRAPHICAL SKETCH
Michael Lee Schwieterman was born in Sidney, Ohio. He was raised by Nancy
Louise Schwieterman and Dale Arthur Schwieterman along with one brother and three
sisters, Ryan Joseph Schwieterman, Sarah Elizabeth (Schwieterman) Hunsche, Diane
Marie Schwieterman, and Megan Rose Schwieterman. They resided on Schwiet Acres,
a small family farm focused on raising corn, soy, and steers near Sebastian, Ohio. After
graduating from Marion Local High School, Michael attended Miami University in
Oxford, Ohio where he earned a Bachelor of Science in botany and a Bachelor of
Science in zoology while also earning two minors, molecular biology and neuroscience.
Michael was engaged in mapping sensory and motor neuron integrative structures in rat
with Dr. Donna R. Scarborough, before reconnecting with his interest in plant science.
Michael developed a professional relationship with his biotechnology professor and
mentor Dr. Susan R. Barnum. Her enthusiasm for biotechnology led Michael to
participate in an undergraduate research internship at the University of Florida with Dr.
David G. Clark of the Plant Molecular and Cellular Biology (PMCB) graduate program.
After graduating from Miami University, Michael returned to the University of Florida to
pursue his Ph.D. with the PMCB. During his first year Michael completed research
rotations with Dr. Harry J. Klee, Dr. Gary F. Peter, and Dr. Wilfred Vermerris before
deciding on Dr. Clark as his Ph.D. advisor. Dr. Clark has provided invaluable advice and
mentorship in plant physiology and genetics, the philosophy and practice of science,
and professional development. It is through Dr. Clark where Michael realized his
potential, as well as developed a mature appreciation for plant science.