matrilineal genealogy of hynobius (caudata: hynobiidae) and a …labs.eeb.utoronto.ca/murphy/pdfs of...

Asian Herpetological Research 2012, 3(4): 288–302DOI: 10.3724/SP.J.1245.2012.00288

1. Introduction

An understanding of patterns of biodiversity requires the integration of historical and environmental factors

Matrilineal Genealogy of Hynobius (Caudata: Hynobiidae) and a Temporal Perspective on Varying Levels of Diversity among Lineages of Salamanders on the Japanese Islands

Yuchi ZHENG1*, Rui PENG1, 2, Robert W. MURPHY3, 4, Masaki KURO-O5, Lujun HU1 and Xiaomao ZENG1*

1 Department of Herpetology, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, Sichuan, China

2 Sichuan Key Laboratory of Conservation Biology on Endangered Wildlife, College of Life Sciences, Sichuan University, Chengdu 610064, Sichuan, China

3 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223, Yunnan, China

4 Centre for Biodiversity and Conservation Biology, Royal Ontario Museum, 100 Queen’s Park, Toronto, ON M5S 2C6, Canada

5 Department of Biology, Hirosaki University, Hirosaki 036-8561, Japan

* Corresponding authors: Dr. Yuchi ZHENG, from Chengdu Institute of Biology (CIB), the Chinese Academy of Sciences, focuses his research on systematics and biogeography of amphibians; and Dr. Xiaomao ZENG, also from CIB, centers her research on systematics and chromosomal evolution of amphibians and reptiles.E-mail: [email protected] (Yuchi ZHENG); [email protected] (Xiaomao ZENG) Received: 11 October 2012 Accepted: 5 December 2012

(Svenning and Skov, 2005; Hawkins et al., 2006; Donoghue, 2008; Jetz and Fine, 2012). Species diversity in a region is often considered as the product of net diversification rate (speciation rate minus extinction rate), time, and dispersal (Ricklefs, 2004; Wiens and Donoghue, 2004; Rabosky, 2009). Thus, time is an important historical factor when interpreting patterns of species richness. The idea that species richness might be correlated with how long the constituent lineages have been evolving in the area has a long history in the

Keywords tempo of diversification, salamander, Japanese Archipelago, Hynobius, cryptic species, northern glacial refugium

Abstract Previous work found that different Japanese lineages of salamanders had quite different levels of species and genetic diversity. Lineages vary from having one to several species and the extent of genetic variation among lineages differs substantially. Most speciose, genus Hynobius contains 18 species and several potential cryptic species. We explore genetic diversity in this genus by combining comprehensive sampling and mitochondrial DNA sequences. Based on this and previous analyses of salamanders, relative times of divergence are employed to evaluate the relationship between age and diversity among the four major lineages whose distributions broadly overlap on the islands. For Hynobius, our analyses are congruent with the previously reported high level of cryptic diversity in morphology and allozymes, particularly in species composed of non-sister matrilines. Both species and genetic diversity correlate with the relative ages of the lineages. This correlation indicates that the variation in levels of diversity can be explained, to a considerable extent, by the hypothesis that older insular lineages have accumulated greater diversity. In addition to the Korean Peninsula, H. leechii might have survived in another Pleistocene glacial refugium north of the peninsula and this refugium provided a source of colonization after the last glacial maximum.

Yuchi ZHENG et al. Matrilineal Genealogy of Hynobius No. 4 289

evolutionary time hypothesis (Willis, 1922; Fischer, 1960; Stebbins, 1974) and the time-for-speciation effect (Stephens and Wiens, 2003). These perspectives and their variants help explain patterns of species diversity on a variety of spatial scales and in various taxonomic groups (Borges and Brown, 1999; Hawkins et al., 2005, 2007; Pyron and Burbrink, 2009; Roncal et al., 2011), including amphibians (Wiens et al., 2006, 2009; Kozak and Wiens, 2010).

Lineages of salamanders on Japanese islands exhibit quite different levels of species diversity. Five genera occur on islands north of a zoogeographical boundary known as Watase’s line between the Palearctic and Oriental regions (Okada, 1927; Tanaka et al., 1975): the hynobiids Salamandrella keyserlingii, Onychodactylus, and Hynobius; the salamandrid Cynops pyrrhogaster; and the cryptobranchid Andrias japonicus. Among them, the distribution of S. keyserlingii is restricted to the northeastern margin of the islands, which is also the southeastern edge of the current distribution of this widespread Eurasian species (Poyarkov and Kuzmin, 2008). The other four genera generally range widely and overlap extensively on the islands (Figure 1). Andrias japonicus is endemic to Japan, and it has limited genetic variation throughout its range (Matsui et al., 2008). Onychodactylus occurs on Japanese islands and the adjacent Asian mainland. Of the two species endemic to Japan, O. japonicus has a high level of genetic variation and possible cryptic taxonomic diversi ty (Yoshikawa et al . , 2008, 2010a, b, 2012; Poyarkov et al., 2012). Cynops pyrrhogaster is endemic to Japan and also has a high level of genetic diversity, suggesting the existence of cryptic species (Tominaga et al., 2010; Tominaga et al., in press). Hynobius occurs on Japanese islands, Taiwan Island (China), and mainland Asia. Eighteen species of Hynobius are endemic to Japan (Frost, 2011) and potential cryptic taxonomic diversity occurs within several species (e.g., Tominaga et al., 2005a; Matsui et al., 2006; Nishikawa et al., 2007). The occurrence of each of these four genera in Japan likely owes to a single colonization event that largely either concurred with or after the Miocene separation of the islands from mainland Asia (Maruyama et al., 1997; Matsui et al., 2008; Yoshikawa et al., 2008; Zhang P. et al., 2008; Tominaga et al., 2010; Li et al., 2011; Zheng et al., 2011).

The various levels of diversity among these lineages may be a function of time since colonization. Although lineage-ages have been estimated previously, cross-

study comparisons are complicated by the employment of differing calibration strategies and molecular markers, among-lineage rate variation, and innate uncertainty of the molecular clock itself (e.g., Matsui et al., 2008; Zhang P. et al., 2008; Tominaga et al., 2010). The simultaneous estimation of ages based on a molecular phylogeny containing all these lineages can circumvent this problem when using relaxed molecular clock methods.

Estimations of taxonomic diversity of constituent lineages can facilitate evaluations of the relationship between age and diversity. Phylogenetic analyses based on extensive sampling are available for Japanese lineages of Andrias, Onychodactylus, and Cynops (e.g., Matsui et al., 2008; Yoshikawa et al., 2008; Tominaga et al., in press); Hynobius requires evaluation. In Japan, some species of Hynobius may contain cryptic taxonomic diversity, especially H. boulengeri, H. naevius, H. nebulosus, and H. yatsui, as evidenced by allozymes, morphology, and matrilineal genealogies (e.g., Tominaga et al., 2005a, b, 2006; Matsui et al., 2006; Nishikawa et al., 2007). Previous studies involve a relatively small taxonomic scale, i.e., a few species. On the islands, great morphological similarity among species of Hynobius confounds their identification; often locality data are necessary (Nishikawa et al., 2007). Moreover, newly revealed cryptic species are not always the sister lineages of the named species (Donald et al., 2005; Bickford et al., 2007; Seifert, 2009). A genealogical study involving widespread sampling, including not only the Japanese species but also species from other areas, may reinforce the results of previous studies on Hynobius and provide new insights. It will not only facilitate the evaluation of diversity of this genus, but also provide an understanding of the dispersal history of its members.

The Korean Peninsula and adjacent areas host six species and proposed species of Hynobius (Baek et al., 2011). Except for H. leechii, all other species occur on the southern part of the peninsula only. Within its southern range, H. leechii has high levels of mitochondrial DNA (mtDNA) diversity (Baek et al., 2011) yet very low levels of diversity in allozymes and mtDNA exist in the northern range of this species (Zeng and Fu, 2004). This “southern richness and northern purity” pattern is consistent with the southern Korean Peninsula providing a glacial refugium for both animals and plants (Hewitt, 2000; Kong, 2000; Serizawa et al., 2002; Zhang H. et al., 2008). Notwithstanding, Zeng and Fu (2004) reported a substantial genetic difference between the southern (two individuals) and northern forms of H. leechii, thus indicating a possible northern refugium outside the

Asian Herpetological Research290 Vol. 3

peninsula (Provan and Bennett, 2008), as proposed for rodents (Serizawa et al., 2002; Lee et al., 2008).

Herein, we first explore the matrilineal history and diversity of the genus Hynobius based on comprehensive sampling and apply the results to propose taxonomic hypotheses. On the basis of this and previous molecular

analyses of salamanders, we simultaneously estimate the relative divergence times to evaluate the relationship between lineage-age and current diversity among salamanders on the Japanese islands. The species S. keyserlingii is not included in this study because its restricted insular distribution is considerably isolated from

Figure 1 Distribution of salamanders on the Japanese islands. Distributions (black) of the species of Hynobius and Cynops pyrrhogaster were obtained from IUCN (2011). The ranges (black) of Onychodactylus and Andrias japonicus were mapped following Yoshikawa et al. (2008) and Matsui et al. (2008), respectively.

135°E 145°

30°N

45°

Andrias japonicus135°E 145°

Cynops pyrrhogaster

30°N

45°

OnychodactylusHynobius

Kyushu Island

Shikoku Island

Honshu

Hokkaido

Island

Island


the ranges of most other lineages. Finally, we examine the possibility of a northern glacial refugium for H. leechii using increased sample sizes and sampling sites from both the northern and southern parts of its distribution.

2. Material and methods

2.1 Taxon sampling and DNA sequencing Genealogical analyses of Hynobius used a total of 368 individuals from 30 of the 32 species (Frost, 2011) as the ingroup. Three sets of DNA sequence data were available for this genus. The first included the entire mitochondrial genome (e.g., Zhang et al., 2006; Zheng et al., 2011). Second, data from the mitochondrial gene cyt b included 1141 bp, the full length (e.g., Matsui et al., 2007; Lai and Lue, 2008; Sakamoto et al., 2009; Baek et al., 2011). The third data set included two mitochondrial fragments: a 12S–16S, ~1075 bp fragment including the intervening tRNA gene (GenBank accession No. AY915973–96) and a ~1455 bp fragment consisting of the complete ND2 and part of COI genes and the tRNA genes between them (AY915925–48) (Macey et al., 2005, unpublished data). All these GenBank sequences of Hynobius as of February, 2012 were included in the analyses. Several individuals with cyt b sequence data also had a 12S sequence (Tominaga et al., 2006) that overlapped substantially with the 12S–16S fragment; these 12S sequences were included in the analysis. We sequenced the mitochondrial genomes of one individual each of five species, cyt b from 50 individuals representing 23 sampling sites plus three individuals without precise locality data, and the 12S–16S fragment of one individual (JQ929919–77). Mitochondrial genomes of five species (H. hidamontanus, H. kimurae, H. lichenatus, H. nigrescens, and H. tsuensis) were sequenced for the first time with the purpose of including more distinct full-length sequences in the supermatrix approach. The other samples sequenced concentrated on mainland species, especially H. leechii. Two species of Batrachuperus and Liua were included in the outgroup based on the current phylogeny (Peng et al., 2010; Zheng et al., 2011). Details of the sampling and PCR primers were presented in Supplementary Material 1. No DNA sequences were available from H. hirosei and H. turkestanicus.

Sequences of all nine mitochondrial light-strand encoded genes were converted into their complementary strand. Alignment was conducted with ClustalX v. 1.83 (Thompson et al., 1997) and checked by eye. Homologies of non-coding genes were checked against the secondary structures of tRNAs determined using tRNAscan-SE

v. 1.21 (Lowe and Eddy, 1997) and the rRNA secondary structures of Xenopus laevis (Cannone et al., 2002) and the salamander Ambystoma mexicanum (Wuyts et al., 2004). Amino acid sequences were used to confirm homologies for coding regions. Sites of questionable homology were excluded from analysis.

2.2 Molecular phylogenetic analysis of the genus Hynobius All 13 protein-coding, two rRNA, and 22 tRNA mitochondrial genes were analyzed in combination. Because no overlaps occurred between sequences of some haplotypes, two datasets were analyzed separately, each composed of different subsets of taxa based on aligned sequences (Supplementary Material 2). In the larger dataset, Data-L, all haplotypes had an overlapping fragment of cyt b. In the smaller dataset, Data-S, 12S overlapped. A six-partition strategy was applied to both datasets. A separate partition was defined for each codon position from all protein-coding genes, another for each rRNA gene, and one partition for the concatenated tRNA genes (Mueller et al., 2004; Zhang and Wake, 2009). The Bayesian information criterion (BIC) and the corrected Akaike information criterion (AICc) implemented in jModelTest v. 0.1.1 (Posada, 2008) were used to select an evolutionary model that best fit each dataset partition (Posada and Buckley, 2004; Tamura et al., 2011).

Bayesian inference (BI) and maximum likelihood (ML) analyses were conducted on both datasets. BI was performed using MrBayes v. 3.1.2 (Ronquist and Huelsenbeck, 2003) on the CIPRES web portal (Miller et al., 2010). Four Monte Carlo Markov chains (MCMC) were used to obtain 20 million generations. Six independent runs were performed to ensure that analyses were not trapped in local optima. Trees were sampled every 1000 generations and the last 10 000 sample trees were used to construct a majority rule consensus tree and the frequency of nodal resolution was termed a Bayesian posterior probability (BPP). ML analyses were conducted using RAxML v. 7.2.6 (Stamatakis, 2006). The rapid hill-climbing algorithm (Stamatakis et al., 2007) was used and 200 inferences were executed. Nodal support was estimated with nonparametric bootstrap proportions (Felsenstein, 1985) involving 1000 replicates. In addition, the Shimodaira-Hasegawa (S-H) test (Shimodaira and Hasegawa, 1999) was conducted using RAxML to evaluate the significance of alternative topologies.

For H. leechii, an unrooted network approach was employed to visualize associations among the haplotypes of cyt b. At the 95% confidence level, the statistical parsimony analysis was performed using TCS v. 1.21 (Clement et al., 2000).


2.3 Estimating sequence divergence In Hynobius, genetic diversity assessments for cyt b and 12S used uncorrected nucleotide p-distances calculated in MEGA v. 5.05 (Tamura et al., 2011) based on the alignment for genealogical analysis. Pairwise distances were calculated for all haplotypes and between-group mean distances were obtained when necessary. Substantial p-distances between H. leechii and H. yangi, H. boulengeri and H. kimurae, and H. amjiensis and H. yiwuensis served as conservative interspecific reference points.

2.4 Molecular clock analysis A total of 38 species of salamanders were selected as representatives for the clock analysis. Most hypothesized divergence events, i.e., nodes in phylogenetic trees, leading to Japanese lineages of the genera Andrias, Cynops, Hynobius, and Onychodactylus were included; several weakly supported events were not included to avoid historical uncertainty. In addition to the 12S–16S and cyt b fragments, only the mtDNA fragment ND1–COI (approximately 2040 bp before alignment) was also available for all these species as of February, 2012. These three fragments were concatenated for analysis. Two anuran species, Xenopus tropicalis and Ascaphus truei, were selected as outgroup members (Cannatella et al., 2009; Zhang and Wake, 2009). Details of sampling for the molecular clock analysis were provided in Supplementary Material 3. We employed the same methods of sequence alignment, dataset partitioning, and selection of a substitution model as noted above. The sequence alignment was presented in Supplementary Material 2.

We used a reference topology involving 38 sampled species of salamanders for the molecular clock analysis. This consisted of results that were congruent for previous molecular studies and our analyses. Compared with our three-fragment dataset, Data-MC, some other datasets had more comprehensive taxon sampling for particular lineages and/or more loci (i.e., the complete mitochondrial genome) (Vieites et al., 2007; Matsui et al., 2008; Yoshikawa et al., 2008; Zhang P. et al., 2008; Zhang and Wake, 2009; Zheng et al., 2011). The likelihood ratio test rejected (P < 0.001) the hypothesis that our data evolved according to a strict molecular clock. Therefore, two widely used, relaxed molecular clock methods were adopted: the penalized likelihood approach (PL; Sanderson, 2002) and the Bayesian approach developed by Thorne, Kishino, and their colleagues (TK; Thorne et al., 1998; Kishino et al., 2001; Thorne and Kishino, 2002).

No calibrations were used in the molecular clock analysis because we focused on the temporal sequence of divergence. Given the poor fossil record for salamanders,

calibration would have used a large probability distribution (Anderson, 2008, 2012; Zhang and Wake, 2009) and estimated divergence times of this group would have varied broadly (e.g., Vieites et al., 2009). Such uncertainty would likely obscure the temporal sequence of interest. As a result, and also because the uncertainty in the root age would be a major source of uncertainty in the estimates of node ages (Wiens, 2007), the ingroup root, the Cryptobranchoidea–Salamandroidea split, was fixed with an arbitrary number.

For PL, branch lengths in the ML framework (Schwartz and Mueller, 2010) were estimated on the reference topology using RAxML. The PL analysis was performed using r8s v. 1.71 (Sanderson, 2003), in which estimates had two decimal places. The ingroup root was fixed at the arbitrary value of 500 to facilitate the comparison of estimates. The smoothing parameter value was set to 16, which was selected from values between 0.01 and 10 000 by conducting a cross-validation test. To assess error levels in estimates, 200 partitioned bootstrap replicate datasets were generated (in RAxML) and analyzed with the help of Torsten Eriksson’s r8s-bootkit available at http://www.bergianska.se/index_forskning_soft.html (Sanderson and Doyle, 2001). In doing this, the cross-validation test was performed for each bootstrapped dataset.

The TK analysis followed the manual of Rutschmann (2005) and was implemented with PAML v. 4 (Yang, 2007) and Multidivtime (Thorne and Kishino, 2002). The ingroup root was constrained to a value between 4.999 and 5.001 because calibrations could not be fixed in Multidivtime and an ingroup root age prior of between 0.1 and 10 time units was recommended in the Multidivtime readme file. The priors for rate of evolution at the root branch and the standard deviation (SD) of the rate were set to the same value, which was 1/2 of the mean of ML distances between species-pairs descended from the root node divided by 5. The priors for the Brownian motion constant and the SD of the constant were both set to 1. The beta prior on proportional branch depth was set to 1. The number of samples, cycles between samples, and cycles before the first sample were set to values of 10 000, 100, and 2 000 000, respectively. The analysis was run twice and the results were compared to ensure that the MCMC reached stationarity.

As a comparison of proportional time estimates for different divergence events, ratios between the estimates were calculated. Calculation of the ratio used estimates from PL based on Data-MC and mean estimates from the TK approach. The 95% confidence interval of the ratio


was estimated using either 200 bootstrap replicates (PL) or the 10 000 samples of the MCMC (TK). A ratio value was first calculated for each bootstrap replicate or sample, and then the confidence interval was calculated as either bootstrap mean ± 1.96 SD (PL; normality not rejected at a 0.05 level by the Kolmogorov-Smirnov test implemented in SPSS v. 12.0) or by sorting the 10 000 resulting values and reporting the 250th and 9750th values (TK).

3. Results

3.1 Molecular phylogenetic analysis Data-L contained 263 haplotypes and 15 069 nucleotide sites, of which 5061 sites were variable, and 3780 were potentially parsimony-informative among the ingroup members. Among the haplotypes, 23 were based on complete or nearly complete mitochondrial genomes and 262 overlapped cyt b at 637 sites. The exception, Hkim-1, contained 370 sites of the overlapping region. Data-S had 53 haplotypes and 15 069 positions, of which 5081 were variable and 3870 were potentially parsimony-informative among the ingroup members. A total of 23 haplotypes were based on mitochondrial genomes, 46 overlapped by 2334 positions, and all haplotypes overlapped 12S at 532 sites. In both datasets the overlapping regions between coding genes ATP8 and ATP6 (ten positions), ND4L and ND4 (seven positions), and ND5 and ND6 (15 positions) were treated as a second codon position. RAxML applied one substitution model to all DNA data partitions and the GTR+I+G model was used. Models with a proportion of invariable sites were mostly selected for individual partitions. For BI, a same set of model parameters were selected by BIC and AICc for Data-L, but different parameters were selected by the two criteria for Data-S. Consequently, separate BI analyses of Data-S used parameters selected by BIC and AICc and the results were compared. Substitution models selected for individual dataset partitions were listed in Supplementary Material 4.

The ML and BI analyses of Data-L produced two very similar topologies with most major lineages being well-supported. As the only notable difference, H. glacialis formed the sister group of H. arisanensis + H. sonani on the ML tree (Figure 2), while the relationship among H. glacialis, H. formosanus, and H. arisanensis + H. sonani remained unresolved on the BI tree. All the other differences involved poorly supported, intraspecific relationships, mostly within particular lineages. Both approaches resolved two lineages for H. leechii, termed A and B. Lineage A was distributed in the southern part of the species’ range. In Lineage B, all the three haplotypes

from the northern area formed a sublineage (Figure 2, Northern Sublineage) that clustered within samples from the southern area.

The ML and BI analyses of Data-S produced nearly identical topologies in which most nodes were well-supported. Independent BI analyses using model parameters selected by BIC and AICc produced identical topologies and similar BPPs. Only one difference emerged between the ML and BI trees; the ML tree (Supplementary Material 5) resolved Hyat-1 as the sister group of the lineage containing haplotypes Hhid-G, Hbou-100, and Hnae-100. In the BI tree, the relationships among Hyat-1, Hnae-1, and the lineage containing Hhid-G, Hbou-100, and Hnae-100 were unresolved.

Weakly-supported alternative topologies were obtained for haplotypes Hnae-1, Hneb-G, and Hyat-1 from Data-L and Data-S yet these trees were mostly compatible (Figure 2; Supplementary Material 5). Thus, some samples included only in Data-S were integrated into the Data-L tree (Figure 2). Combined, a total of 39 major lineages of Hynobius were identified. Some haplotypes of H. boulengeri, H. naevius, H. nebulosus, and H. yatsui did not cluster with conspecific samples. For H. nebulosus, the forced unification of all haplotypes from Kyushu Island (Hneb-G, Hneb-9, and Hneb-100) in the Data-S tree was not rejected by the S-H test (P > 0.05). The same result occurred for Hneb-G and Hneb-9 in the tree from Data-L (P > 0.05). Our gene trees were similar to those of previous studies (Matsui et al., 2007; Lai and Lue, 2008; Nishikawa et al., 2010; Baek et al., 2011; Li et al., 2011; Zheng et al., 2011).

For H. leechii, after excluding sites with missing data, the network analysis for cyt b contained 740 sites and 27 haplotypes. It resolved two groups corresponding to Lineage A and Lineage B. In the network corresponding to Lineage B (Figure 3), the three northern haplotypes clustered together and connected to the interior southern haplotypes through 10 unobserved intermediate haplotypes.

3.2 Sequence divergence Pairwise and between-group p-distances were estimated for overlapping regions of cyt b (637 sites) and 12S (532 sites) (Table 1). The interspecific reference distances ranged of 6.31%–12.66% (cyt b) and 1.69–3.01% (12S). Similar levels of divergence were observed when Hnae-100, Hyat-1, Hyat-2, Hbou-100, Hneb-8, and Group-II (Figure 2) were compared with other lineages. These six lineages were from the four species that did not cluster into a single matriline.


Blon-G Batrachuperus londongensisLtsi-G Liua tsinpaensis

Hret-GHret-1 Hynobius retardatus

Hbou-1 H. boulengeriHkim-1

Hkim-2Hkim-G

H. kimurae

Hfuc-2Hfuc-1

Hfuc-4Hfuc-6Hfuc-3

H. fuca

Hfor-2Hfor-1

Hfor-3Hfor-4

H. formosanus

Hgla-1 H. glacialisHson-3

Hson-9Hson-2Hson-7Hson-8

Hson-1

Hson-4Hson-5

H. sonani

Hari-1Hari-G1

Hari-4Hari-2Hari-Gf2Hari-3

Hari-6Hari-8

Hari-9

H. arisanensis

Hnig-100Hnig-91

Hnig-GH. nigrescens

Habe-100 H. abeiHtak-100 H. takedai

Hlic-3Hlic-1

Hlic-2Hlic-3139Hlic-G

H. lichenatus

Hneb-8Hneb-7

Hneb-1Hneb-91Hneb-2

Hneb-4Hneb-3Hneb-5Hneb-6

Group-II

Htok-29Htok-27

Htok-1Htok-3Htok-25Htok-26

Htok-24Htok-23Htok-19

Htok-21Htok-22Htok-17

Htok-13Htok-15

Htok-11Htok-9Htok-10Htok-GHtok-7

H. tokyoensis

Hyat-1Hste-100 H. stejnegeri

Hgua-G2Hgua-Gc1 H. guabangshanensis

Hchi-GHchi-1 H. chinensis

Hmao-GHmao-3 H. maoershanensis

Hamj-GHamj-4

Hamj-1Hamj-2

H. amjiensis

Hyiw-301Hyiw-6

Hyiw-302Hyiw-G

Hyiw-2865Hyiw-219Hyiw-7Hyiw-3CHyiw-3289Hyiw-4Hyiw-5CHyiw-3

Hyiw-228

H. yiwuensis

Hnae-100Hbou-100

Hnae-1 H. naevius

Hkat-1 H. katoiHhid-G H. hidamontanus

Hyat-2Hyat-35Hyat-36


Hyat-39Hyat-40

Hyat-51Hyat-48Hyat-50Hyat-49Hyat-42Hyat-46

Hyat-47Hyat-45Hyat-44Hyat-43

Hyat-20Hyat-27Hyat-29Hyat-28Hyat-26Hyat-24

Hyat-25Hyat-21


Hyat-31Hyat-32

Hyat-34Hyat-33

Hyat-5Hyat-3

Hyat-4Hyat-19Hyat-8Hyat-11Hyat-9Hyat-16Hyat-14Hyat-15

Hyat-7Hyat-6

Hyat-18Hyat-10Hyat-12Hyat-17Hyat-13

H. yatsuiKyushu-B

*

*

*

*

*

**

**

* ***

*

*

*

*

*

*

* ***

**

**

*

*

*

*

*

**

***

*

* *

**

*

*

*

*

0.05 substitutions/site

node 1

node 2

A


**

*

*

* **

*

*

*

*

*

*

*

*

*

*

*

*

*

* *

**

*

Hoki-100 H. okiensisHtsu-G H. tsuensis

Hneb-9Hneb-G H. nebulosus

Hsp-92Hdun-100 H. dunni

Hyan-2Hyan-25LHyan-1

Hyan-3Hyan-7Hyan-8

Hyan-11Hyan-4Hyan-10Hyan-6Hyan-9Hyan-5Hyan-G

H. yangi

Hlee-1Hlee-3133

Hlee-6Hlee-8Hlee-7

Hlee-27Hlee-3

Hlee-5Hlee-4

Hlee-2Hlee-21

Hlee-20Hlee-13Hlee-12Hlee-9Hlee-10Hlee-11Hlee-22

Hlee-19Hlee-18

Hlee-24Hlee-G1Hlee-91

Hlee-92Hlee-Gy2

Hlee-16Hlee-15

Hlee-17Hlee-14

H. leechii

Hsp3-1Hsp3-2Hsp3-6

Hsp3-5Hsp3-3Hsp3-4

Hsp3-9Hsp3-10Hsp3-8Hsp3-11Hsp3-7

Hynobius sp. 3

Hque-1Hque-3

Hque-5Hque-4Hque-2

Hque-9Hque-8

Hque-10Hque-7

Hque-6Hque-23

Hque-22Hque-G1Hque-24Hque-G2Hque-11

Hque-12Hque-14Hque-13

Hque-15Hque-21Hque-19

Hque-20Hque-18Hque-16Hque-17

H. quelpaertensis

Hsp2-3Hsp2-4Hsp2-2

Hsp2-1Hsp2-5

Hsp2-7Hsp2-6Hsp2-9Hsp2-8Hsp2-11

Hsp2-10

Hynobius sp. 2

Hsp1-1Hsp1-2

Hsp1-3Hsp1-5

Hsp1-4Hsp1-8Hsp1-6Hsp1-7Hsp1-19Hsp1-20

Hsp1-16Hsp1-21Hsp1-9Hsp1-17

Hsp1-12Hsp1-13

Hsp1-14Hsp1-15Hsp1-18

Hsp1-11Hsp1-10

Hynobius sp. 1

0.05 substitutions/site

node 2

node 1B

NorthernSublineage

Clade B

Clade A

(Baek et al., 2011)

(Baek et al., 2011)

(Baek et al., 2011)

Figure 2 The matrilineal genealogy of Hynobius inferred from a maximum likelihood (ML) analysis of the large mitochondrial dataset Data-L in which all haplotypes overlapped the fragment for cyt b. Nodes with ML bootstrap proportions (BP) ≥ 90 and Bayesian posterior probabilities (BPP) ≥ 95 are indicated as asterisks. Nodes with 90 > BP ≥ 70 and BPP ≥ 95 and nodes with 90 > BP ≥ 70 and 95 > BPP ≥ 80 are marked by closed and open circles, respectively. Vertical bars indicate species designation or lineage assignment. Dashed branches indicate mapped samples from small dataset Data-S where the fragments of 12S overlapped. Arrow indicates a node not recovered in the Bayesian inference analysis. Haplotype names correspond with those in Supplementary Material 1.


3.3 Proportional time estimates Proportional time estimates for four splitting events were compared, including the basal split in Hynobius, the split between the Japanese lineage of Onychodactylus and O. zhaoermii from northeastern China, between C. pyrrhogaster and C. ensicauda, and between A. japonicus and A. davidianus. For PL, branch lengths were estimated with the GTR+I+G model (Supplementary Material 4). PL and TK approaches yielded similar estimates for these events and the same three-level temporal sequence of the events (Figure 4). The basal split in Hynobius predated all others. Splits within Onychodactylus and Cynops occurred near simultaneously and were relatively recent events, ranging from 0.54 to 0.67 times that of Hynobius. The split for Andrias ranged from 0.22 to 0.24 of that for Hynobius, and thus it was the youngest. Differences between these divergences time were statistically significant; the 95% confidence interval of a ratio between two levels of time was less than one. Several divergences between Japanese species of Hynobius were temporally close to the basal split of this genus in the PL and TK analyses (Figure 4).

4. Discussion

4.1 Age-diversity relationship in salamanders of the Japanese islands Time is critical for understanding the drivers of diversity (Wiens et al., 2009; Rabosky, 2012; Kozak and Wiens, 2012). Among the four lineages of

Japanese salamanders studied, lineage-age estimates are positively related to species richness and phylogenetic diversity.

In East Asia, the ancestral distribution of extant Hynobius is estimated to occur on land masses of the current Japanese islands (Li et al., 2011). Thus, it is likely

Table 1 Estimated nucleotide distances among salamanders of the genus Hynobius. Haplotype and lineage names correspond with names in Figure 2 and Supplementary Material 1.

ComparisonNucleotide p-distance (%)

cyt b (637 sites) 12S (532 sites)

H. leechii – H. yangi 6.31a 1.69a

H. boulengeri – H. kimurae 8.95a 3.01a

H. amjiensis – H. yiwuensis 12.66a 1.72a

Hnae-1 – other haplotypes ≥ 10.20 ≥ 1.88

Hnae-100 – other haplotypes — ≥ 2.44

Hyat-1 – other haplotypes ≥ 9.89 ≥ 1.88

Hyat-2 – other haplotypes ≥ 8.32 ≥ 2.63

Hbou-100 – other haplotypes — ≥ 2.26

Hneb-8 – H. tokyoensis 13.44a —

Hneb-8 – Group-II 11.19a —

Group-II – H. tokyoensis 11.19a —

Hneb-G – Hneb9 7.85 —

Hneb-G – (Hneb9 + Hneb100) — 1.22a

a Between-group mean distances.

35°

40°N

125°E 130°

Hlee-17

Hlee-15

Hlee-14

Hlee-Gy2

Hlee-16

Hlee-21

Hlee-19

Hlee-18Hlee-12

Hlee-10,11Hlee-13

Hlee-20

Hlee-22

Hlee-91

Hlee-24

Hlee-G1 Hlee-92

Hlee-9 Lineage B

Figure 3 Network for cyt b haplotypes from Lineage B of Hynobius leechii and sampling sites of this species. Lines represent single mutational changes. Ovals are sampled haplotypes. Closed circles represent haplotypes that are necessary intermediates but not encountered. Shaded ovals are haplotypes found in the northern sampling sites indicated by triangles. Occurrences of haplotype Hlee-92 are indicated by closed triangles. Haplotype names correspond with those in Figure 2 and Supplementary Material 1. Two haplotypes used in the genealogical analysis are identical after excluding positions with missing data. Locality data for three specimens are not precise enough to be included in the map (Supplementary Material 1).


that this area was colonized by Hynobius no later than the basal split (node H, Figure 4) among East Asian members of the genus, which is dated at about 11–23 million years ago (Zheng et al., 2011). As the oldest lineage, this genus gradually diverged long ago to form 18 species plus some possible cryptic species in Japan (Figures 2, 4). In contrast to Hynobius, the genera Andrias, Onychodactylus, and Cynops each have one endemic lineage (one or two species) on the islands. All of them nest within relatives occurring outside the islands (Matsui et al., 2008; Yoshikawa et al., 2008; Zhang P. et al., 2008; Tominaga et al., 2010). Consequently, the divergence times between these endemic lineages and their congeneric sister taxa (C and A, Figure 4) or close relatives (O, Figure 4; see below)

are used here as indicators of how long each lineage has been evolving on land masses of the islands.

The lineages of Onychodactylus and C. pyrrhogaster have moderate periods of evolutionary time and corresponding levels of diversity. Date estimates for splitting events O and C are significantly younger in being 0.54 to 0.67 times less than that for H (Figure 4). In O. japonicus sensu lato, using complete sequences of cyt b, Yoshikawa et al. (2008) recognized four considerably differentiated lineages (p-distances 5.5%–9.6%). They suggested the presence of cryptic species. In support of this, extensive genetic and morphological variation occurs in this species and several candidates of cryptic species and one new species, O. nipponoborealis, were

Cryptobranchus alleganiensisAndrias davidianusAndrias japonicusOnychodactylus zhaoermiiOnychodactylus japonicus sensu latoParadactylodon mustersiPachyhynobius shangchengensisLiua tsinpaensisBatrachuperus londongensisHynobius kimuraeHynobius arisanensisHynobius nigrescensHynobius lichenatusHynobius tokyoensisHynobius quelpaertensisHynobius leechiiHynobius yangiHynobius nebulosusHynobius tsuensisHynobius hidamontanusHynobius yiwuensisHynobius amjiensisHynobius guabangshanensisHynobius chinensisHynobius maoershanensisHynobius retardatusEurycea bislineataAmbystoma mexicanumSalamandrina terdigitataLyciasalamandra flavimembrisEchinotriton andersoniTaricha rivularisEuproctus platycephalusTriturus cristatusCynops orientalisCynops orphicusCynops pyrrhogasterCynops ensicauda

A

H

O

A/H = 0.24 (0.16–0.35)O/H = 0.58 (0.43–0.79)

TK

A/O = 0.41 (0.27–0.62)

A/H = 0.22 (0.16–0.29)O/H = 0.58 (0.42–0.74)

PL

A/O = 0.38 (0.27–0.52)

C/H = 0.67 (0.48–0.91)

A/C = 0.36 (0.24–0.55)

C

C/H = 0.54 (0.41–0.73)

A/C = 0.40 (0.27–0.53)

Figure 4 The time-calibrated tree of salamanders based on the mitochondrial dataset Data-MC containing 3693 nucleotide positions. Proportional times for nodes were estimated using the Bayesian approach developed by Thorne, Kishino, and their colleagues (TK). Gray bars through the nodes indicate 95% highest posterior densities for estimates. Numbers in parentheses are 95% confidence intervals. PL = the penalized likelihood approach. Bold species names indicate species that occur on the Japanese islands north of Watase’s line. The outgroup is not shown.


reported in follow-up studies (Yoshikawa et al., 2010a, b, 2012; Poyarkov et al., 2012). The same magnitude of difference for the complete cyt b sequences also occurs in C. pyrrhogaster, based on limited samples of this wide-ranging species (Tominaga et al., 2010). Based on a comprehensive sampling, Tominaga et al. (in press) recently suggested that they were actually four species. Andrias japonicus has the shortest period of evolutionary time and lowest level of genetic diversity. Date estimates for the split of Andrias (A) range from 0.22 to 0.24 times of the estimate for Hynobius, and this is significantly later than the splits of Onychodactylus and Cynops. Compared with its sister species in mainland Asia, A. japonicus exhibits less genetic divergence (Murphy et al., 2000; Matsui et al., 2008). These correlations indicate that the varying levels of diversity among lineages of salamanders on the Japanese islands likely owe, to a considerable extent, to the amount of time that each lineage has been evolving in the region.

Our molecular clock analyses cover a time-span of about 200–300 million years (Roelants et al., 2007; Vieites et al., 2007, 2009). Substitutions between some highly divergent sequences are likely severely saturated (e.g., Zheng et al., 2011). However, this does not imply that the evolutionary time-order revealed from the analysis is unreliable. In the molecular clock approach, divergence times between organisms relate to numbers of substitutions accumulated in sequences. Saturation due to multiple hits usually results in greater percentage of underestimated substitutions between more divergent sequences (Nei and Kumar, 2000; Arbogast et al., 2002). As proportional time estimates were compared as ratios in this study, the effect of saturation would likely compress the difference between divergence dates, rather than result in a statistically significant order of time.

Poyarkov et al. (2012) recently described a new species, Onychodactylus zhangyapingi, which may complicate our analysis. Onychodactylus zhangyapingi occurs in northeastern China and is the sister group of Japanese congeners (Poyarkov et al., 2012). This relationship suggests that we likely overestimated the relative age of Japanese Onychodactylus (O). The reason of the exclusion of this species in our final analysis is that the available data for this new species are far less than those in dataset Data-MC. Nevertheless, the splitting event O between O. zhaoermii and (O. zhangyapingi + Japanese Onychodactylus) and the split between O. zhangyapingi and Japanese Onychodactylus are close to each other and both are relatively deep (Poyarkov et al., 2012). Therefore, our overestimate is likely insignificant

to the age-diversity pattern (Figure 4).

4.2 Cryptic diversity in Japanese Hynobius In addition to lineages corresponding to the 17 (of 18) species sampled, six other major lineages were identified including Hnae-100, Hyat-1, Hyat-2, Hbou-100, Hneb-8, and Group-II (Figure 2; Supplementary Material 5). The genetic distances between them and other lineages were at least similar to the reference interspecific distances of the genus (Table 1). The two major lineages of H. naevius, Hnae-1 and Hnae-100, were not sister lineages and they corresponded to lineages identified by Tominaga et al. (2006). Lineage 1 was from northwestern Kyushu Island (Hnae-1) and Lineage 2 from the other populations (Hnae-100). Because the type locality of H. naevius was estimated to be in the northwestern Kyushu Island (Tominaga and Matsui, 2007), the other populations may be a cryptic species. Consistent with this finding, these two groups differ by two of 20 allozyme loci (fixed alleles at sIDH-A and nearly fixed at mACOH-A) and by two-dimensional scaling of allozyme data based on 19 (of 20) polymorphic loci (Tominaga et al., 2005a). Two-dimensional scaling analyses of morphology also separate the lineages (Tominaga et al., 2005b; Tominaga and Matsui, 2008).

Three major lineages occur among samples of H. yatsui: the lineage from Kyushu Island, Hyat-2, and Hyat-1, of which the former two are sister-lineages (Figure 2; Supplementary Material 5). The former lineage contains all haplotypes on the island and this includes the type locality of H. yatsui (Tominaga and Matsui, 2008). This lineage, named KYUSHU or Kyushu-B, is clearly distinguishable from non-Kyushu populations by allozymes (e.g., loci PGDH-A and PGM-C), morphology, and matrilineal studies (Tominaga et al., 2005a, b, 2006; Tominaga and Matsui, 2008). The non-Kyushu Island morphological groups and genetic lineages, including Hyat-1 and Hyat-2, suggest cryptic diversity and this requires further study.

Samples of H. boulengeri comprise two distantly related lineages. The lineage represented by haplotypes Hbou-1 and Hbou-101 corresponds to the true H. boulengeri, as restricted to Honshu Island by Nishikawa et al. (2007) based on morphological and allozymic variation. The other lineage, Hbou-100, may represent either an unnamed species (Nishikawa et al. 2007) or H. hirosei, which was removed from the synonymy of H. boulengeri by Nishikawa et al. (2007). The precise collecting locality of Hbou-100 remains unknown and this precludes a determination.

Hynobius nebulosus has three haplotypes from


near the type locality of Nagasaki: Hneb-G, Hneb-9, and Hneb-100. Other, distantly related samples form two major lineages that are not sister groups: Group-II and Hneb-8 (Figure 2). Lineages represented by the three haplotypes may be sister-groups (S-H test, P > 0.05) and the genetic distances between them are less than most values for the reference species (Table 1). Therefore, we follow Matsui et al. (2006) in assigning all three haplotypes to H. nebulosus. Allozyme analyses for H. nebulosus sensu lato identify three candidate cryptic species: eastern, montane, and Chugoku groups (Matsui et al., 2006). Our Group-II corresponds to the eastern group. Because the sampling site (Gobo-shi) of lineage Hneb-8 was not included in the study of Matsui et al. (2006), we cannot determine if this is another of their potential cryptic species.

Underestimations of variation may obscure our understanding of evolutionary processes (Olsson et al., 2005; Kaliontzopoulou et al., 2011). Our analyses reinforce the high level of cryptic diversity within Japanese Hynobius as revealed in previous morphological and allozymic studies, particularly by the recognition of non-monogenealogical (sensu Murphy and Méndez de la Cruz, 2010; Gao et al., 2012) species. This finding supports the importance of having dense taxon sampling in genealogical and taxonomic studies (e.g., Olsson et al., 2005). A cryptic species is not necessarily the sister group of the species from which it differs (Donald et al., 2005; Bickford et al., 2007; Seifert, 2009), especially for groups such as amphibians that exhibit conserved morphological evolution and extensive homoplasy (Parra-Olea and Wake, 2001; Fouquet et al., 2007).

4.3 Northern glacial refugium of Hynobius leechii Multiple refugia might have served H. leechii during Pleistocene glacial cycling. This species currently occurs on the Korean Peninsula and adjacent northeastern China with a general north-south distribution. Substantial genetic diversity occurs on the southern peninsula yet with a similar sampling area to the southern one, extremely low diversity occurs northwards. The genealogy reveals a southern origin of the northern form (Figure 2). This pattern indicates that the southern peninsula provided a glacial refugium for H. leechii (Hewitt, 2000; Provan and Bennett, 2008), and this has been indicated for a variety of organisms (e.g., Kong, 2000; Serizawa et al., 2002; Zhang H. et al., 2008).

For H. leechii, another refugium probably existed north of the peninsula. Several observations are consistent with this notion. First, among the three northern haplotypes, Hlee-92, the only haplotype found in most sampling sites

(Supplementary Material 1), is widespread throughout the northern sampling area (Figure 3). The two other haplotypes, Hlee-G1 and Hlee-91, differ from the former by one or two nucleotide substitutions only (Figure 3). Their distributions are far more restricted geographically and this pattern infers a local origin. These distributions suggest a postglacial range expansion (Provan and Bennett, 2008). Second, on the network and genealogy, these haplotypes substantially differ from the most closely related interior southern haplotypes, in the case of the network by at least ten unobserved haplotypes involving 11 substitutions. A p-distance of 1.49% based on the 740 sites of cyt b separates them. It is unlikely that this level of divergence accumulated during a northwards post-last glacial maximum (LGM) dispersal of this species from the Korean Peninsula refugium (Canestrelli et al., 2006; Provan and Bennett, 2008). Given the broadly used evolutionary rate of 0.64%–1.00% divergence per million years per lineage for vertebrate cyt b gene (e.g., Tominaga et al., 2010), these haplotypes should have diverged long before the LGM, which occurred about 0.02 Ma. The northern form probably persisted in situ throughout the LGM. These results agree with the notion that postglacial colonization of high latitude regions can be from local sources within or close to the regions, rather than from the more distant, southern refugium (Stewart and Lister, 2001; Pearson, 2006).

Acknowledgments We are grateful to Jinzhong FU, Qiang DAI, Xianguang GUO, Jiatang LI, Li DING, and two anonymous reviewers for valuable suggestions and comments. We thank Song HUANG, Jianli XIONG, and Yun XIA for their help with this work. This work was supported by the National Natural Science Foundation of China (NSFC-30870287, NSFC-30900134), the Chinese Academy of Sciences (09C3011100, KSCX2-YW-Z-0906, KSCX2-EW-J-22), and the Natural Sciences and Engineering Research Council (Canada) Discovery Grant 3148.

References

Anderson J. S. 2008. Focal review: The origin(s) of modern amphibians. Evol Biol, 35: 231–247

Anderson J. S. 2012. Fossils, molecules, divergence times, and the origin of Salamandroidea. Proc Natl Acad Sci USA, 109: 5557–5558

Arbogast B. S., Edwards S. V., Wakeley J., Beerli P., Slowinski J. B. 2002. Estimating divergence times from molecular data on phylogenetic and population genetic timescales. Annu Rev Ecol Syst, 33: 707–740

Baek H. J., Lee M. Y., Lee H., Min M. S. 2011. Mitochondrial


DNA data unveil highly divergent populations within the genus Hynobius (Caudata: Hynobiidae) in South Korea. Mol Cells, 31: 105–112

Bickford D., Lohman D. J., Sodhi N. S., Ng P. K. L., Meier R., Winker K., Ingram K. K., Das I. 2007. Cryptic species as a window on diversity and conservation. Trends Ecol Evol, 22: 148–155

Borges P. A. V., Brown V. K. 1999. Effect of island geological age on the arthropod species richness of Azorean pastures. Biol J Linn Soc, 66: 373–410

Canestrelli D., Cimmaruta R., Costantini V., Nascetti G. 2006. Genetic diversity and phylogeography of the Apennine yellow-bellied toad Bombina pachypus, with implications for conservation. Mol Ecol, 15: 3741–3754

Cannatella D. C., Vieites D. R., Zhang P., Wake M. H., Wake D. B. 2009. Amphibians (Lissamphibia). In Hedges S. B., Kumar S. (Eds.), The Timetree of Life. New York: Oxford University Press, 353–356 pp

Cannone J. J., Subramanian S., Schnare M. N., Collett J. R., D’Souza L. M., Du Y., Feng B., Lin N., Madabusi L. V., Muller K. M., Pande N., Shang Z., Yu N., Gutell R. R. 2002. The comparative RNA web (CRW) site: An online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinform, 3: 2

Clement M., Posada D., Crandall K. A. 2000. TCS: A computer program to estimate gene genealogies. Mol Ecol, 9: 1657–1660

Donald K. M., Kennedy M., Spencer H. G. 2005. The phylogeny and taxonomy of austral monodontine topshells (Mollusca: Gastropoda: Trochidae), inferred from DNA sequences. Mol Phylogenet Evol, 37: 474–483

Donoghue M. J. 2008. A phylogenetic perspective on the distribution of plant diversity. Proc Natl Acad Sci USA, 105: 11549–11555

Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39: 783–791

Fischer A. G. 1960. Latitudinal variations in organic diversity. Evolution, 14: 64–81

Fouquet A., Gilles A., Vences M., Marty C., Blanc M., Gemmell N. J. 2007. Underestimation of species richness in Neotropical frogs revealed by mtDNA analyses. PLoS One, 10: e1109

Frost D. R. 2011. Amphibian species of the world: An online reference. Version 5.5 (31 January, 2011). Electronic database accessible at http://research.amnh.org/vz/herpetology/amphibia/. American Museum of Natural History, New York, USA

Gao Y., Wan S. Y., Luo J., Murphy R. W., Du R., Wu S. F., Zhu C. L., Li Y., Poyarkov A. D., Nguyen S. N., Luan P. T., Zhang Y. P. 2012. Quaternary palaeoenvironmental oscillations drove the evolution of the Eurasian Carassius auratus complex (Cypriniformes, Cyprinidae). J Biogeogr, 39: 2264–2278

Hawkins B. A., Diniz-Filho J. A. F., Jaramillo C. A., Soeller S. A. 2006. Post-Eocene climate change, niche conservatism, and the latitudinal diversity gradient of New World birds. J Biogeogr, 33: 770–780

Hawkins B. A., Diniz-Filho J. A. F., Jaramillo C. A., Soeller S. A. 2007. Climate, niche conservatism, and the global bird diversity gradient. Am Nat, 170: S16–S27

Hawkins B. A., Diniz-Filho J. A. F., Soeller S. A. 2005. Water links the historical and contemporary components of the

Australian bird diversity gradient. J Biogeogr, 32: 1035–1042Hewitt G. M. 2000. The genetic legacy of the Quaternary ice ages.

Nature, 405: 907–913IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2.

<http://www.iucnredlist.org>Jetz W., Fine P. V. A. 2012. Global gradients in vertebrate

diversity predicted by historical area-productivity dynamics and contemporary environment. PLoS Biol, 10: e1001292

Kaliontzopoulou A., Pinho C., Harris D. J., Carretero M. A. 2011. When cryptic diversity blurs the picture: A cautionary tale from Iberian and North African Podarcis wall lizards. Biol J Linn Soc, 103: 779–800

Kishino H., Thorne J. L., Bruno W. J. 2001. Performance of a divergence time estimation method under a probabilistic model of rate evolution. Mol Biol Evol, 18: 352–361

Kong W. S. 2000. Vegetational history of the Korean Peninsula. Global Ecol Biogeogr, 9: 391–402

Kozak K. H., Wiens J. J. 2010. Niche conservatism drives elevational diversity patterns in Appalachian salamanders. Am Nat, 176: 40–54

Kozak K. H., Wiens J. J. 2012. Phylogeny, ecology, and the origins of climate-richness relationships. Ecology, 93: S167–S181

Lai J. S., Lue K. Y. 2008. Two new Hynobius (Caudata: Hynobiidae) salamanders from Taiwan. Herpetologica, 64: 63–80

Lee M. Y., Lissovsky A. A., Park S. K., Obolenskaya E. V., Dokuchaev N. E., Zhang Y., Yu L., Kim Y. J., Voloshina I., Myslenkov A., Choi T. Y., Min M. S., Lee H. 2008. Mitochondrial cytochrome b sequence variations and population structure of Siberian chipmunk (Tamias sibiricus) in northeastern Asia and population substructure in South Korea. Mol Cells, 26: 566–575

Li J., Fu C., Lei G. 2011. Biogeographical consequences of Cenozoic tectonic events within East Asian margins: A case study of Hynobius biogeography. PLoS One, 6: e21506

Lowe T. M., Eddy S. R. 1997. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res, 25: 955–964

Maruyama S., Isozaki Y., Kimura G., Terabayashi M. 1997. Paleogeographic maps of the Japanese islands: Plate tectonic synthesis from 750 Ma to the present. Island Arc, 6: 121–142

Matsui M., Nishikawa K., Utsunomiya T., Tanabe S. 2006. Geographic allozyme variation in the Japanese clouded salamander, Hynobius nebulosus (Amphibia: Urodela). Biol J Linn Soc, 89: 311–330

Matsui M., Tominaga A., Hayashi T., Misawa Y., Tanabe S. 2007. Phylogenetic relationships and phylogeography of Hynobius tokyoensis (Amphibia: Caudata) using complete sequences of cytochrome b and control region genes of mitochondrial DNA. Mol Phylogenet Evol, 44: 204–216

Matsui M., Tominaga A., Liu W. Z., Tanaka-Ueno T. 2008. Reduced genetic variation in the Japanese giant salamander, Andrias japonicus (Amphibia: Caudata). Mol Phylogenet Evol, 49: 318–326

Miller M. A., Pfeiffer W., Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), 14 November 2010, New Orleans, LA, 1–8 pp


Mueller R. L., Macey J. R., Jaekel M., Wake D. B., Boore J. L. 2004. Morphological homoplasy, life history evolution, and historical biogeography of plethodontid salamanders inferred from complete mitochondrial genomes. Proc Natl Acad Sci USA, 101: 13820–13825

Murphy R. W., Fu J., Upton D. E., De Lema T., Zhao E. M. 2000. Genetic variability among endangered Chinese giant salamanders, Andrias davidianus. Mol Ecol, 9: 1539–1547

Murphy R. W., Méndez de la Cruz F. R. 2010. The herpetofauna of Baja California and its associated islands: A conservation assessment and priorities. In Wilson L. D., Townsend J. H., Johnson J. D. (Eds.), Conservation of Mesoamerican Amphibians and Reptiles. Eagle Mountain: Eagle Mountain Publishing, 238–273 pp

Nei M., Kumar S. 2000. Molecular evolution and phylogenetics. Oxford: Oxford University Press, 40–41 pp

Nishikawa K., Jiang J. P., Matsui M., Mo Y. M., Chen X. H., Kim J. B., Tominaga A., Yoshikawa N. 2010. Invalidity of Hynobius yunanicus and molecular phylogeny of Hynobius salamander from continental China (Urodela, Hynobiidae). Zootaxa, 2426: 65–67

Nishikawa K., Matsui M., Tanabe S., Sato S. 2007. Morphological and allozymic variation in Hynobius boulengeri and H. stejnegeri (Amphibia: Urodela: Hynobiidae). Zool Sci, 24: 752–766

Okada Y. 1927. A study on the distribution of tailless batrachians of Japan. Annot Zool Japon, 11: 137–143

Olsson U., Alström P., Ericson P. G. P., Sundberg P. 2005. Non-monophyletic taxa and cryptic species—evidence from a molecular phylogeny of leaf-warblers (Phylloscopus, Aves). Mol Phylogenet Evol, 36: 261–276

Parra-Olea G., Wake D. B. 2001. Extreme morphological and ecological homoplasy in tropical salamanders. Proc Natl Acad Sci USA, 98: 7888–7891

Pearson R. G. 2006. Climate change and the migration capacity of species. Trends Ecol Evol, 21: 111–113

Peng R., Zhang P., Xiong J. L., Gu H. F., Zeng X. M., Zou F. D. 2010. Rediscovery of Protohynobius puxiongensis (Caudata: Hynobiidae) and its phylogenetic position based on complete mitochondrial genomes. Mol Phylogenet Evol, 56: 252–258

Posada D. 2008. jModelTest: Phylogenetic model averaging. Mol Biol Evol, 25: 1253–1256

Posada D., Buckley T. R. 2004. Model selection and model averaging in phylogenetics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst Biol, 53: 793–808

Poyarkov N. A., Che J., Min M. S., Kuro-o M., Yan F., Li C., Iizuka K., Vieites D. R. 2012. Review of the systematics, morphology and distribution of Asian Clawed Salamanders, genus Onychodactylus (Amphibia, Caudata: Hynobiidae), with the description of four new species. Zootaxa, 3465: 1–106

Poyarkov N. A., Kuzmin S. L. 2008. Phylogeography of the Siberian newt Salamandrella keyserlingii by mitochondrial DNA sequence analysis. Rus J Genet, 44: 948–958

Provan J., Bennett K. D. 2008. Phylogeographic insights into cryptic glacial refugia. Trends Ecol Evol, 23: 564–571

Pyron R. A., Burbrink F. T. 2009. Can the tropical conservatism hypothesis explain temperate species richness patterns? An

inverse latitudinal biodiversity gradient in the New World snake tribe Lampropeltini. Global Ecol Biogeogr, 18: 406–415

Rabosky D. L. 2009. Ecological limits on clade diversification in higher taxa. Am Nat, 173: 662–674

Rabosky D. L. 2012. Testing the time-for-speciation effect in the assembly of regional biotas. Methods Ecol Evol, 3: 224–233

Ricklefs R. E. 2004. A comprehensive framework for global patterns in biodiversity. Ecol Lett, 7: 1–15

Roelants K., Gower D. J., Wilkinson M., Loader S. P., Biju S. D., Guillaume K., Moriau L., Bossuyt F. 2007. Global patterns of diversification in the history of modern amphibians. Proc Natl Acad Sci USA, 104: 887–892

Roncal J., Blach-Overgaard A., Borchsenius F., Balslev H., Svenning J. C. 2011. A dated phylogeny complements macroecological analysis to explain the diversity patterns in Geonoma (Arecaceae). Biotropica, 43: 324–334

Ronquist F., Huelsenbeck J. P. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572–1574

Rutschmann F. 2005. Bayesian molecular dating using PAML/multidivtime. A step-by-step manual. University of Zurich, Switzerland. Available at: <http://www.plant.ch>

Sakamoto M., Tominaga A., Matsui M., Sakata K., Uchino A. 2009. Phylogeography of Hynobius yatsui (Amphibia: Caudata) in Kyushu, Japan. Zool Sci, 26: 35–47

Sanderson M. J. 2002. Estimating absolute rates of molecular evolution and divergence times: A penalized likelihood approach. Mol Biol Evol, 19: 101–109

Sanderson M. J. 2003. R8s: Inferring absolute rates of molecular evolution and divergence times in the absence of a molecular clock. Bioinformatics, 19: 301–302

Sanderson M. J., Doyle J. A. 2001. Sources of error and confidence intervals in estimating the age of angiosperms from rbcL and 18S rDNA data. Am J Bot, 88: 1499–1516

Schwartz R. S., Mueller R. L. 2010. Branch length estimation and divergence dating: estimates of error in Bayesian and maximum likelihood frameworks. BMC Evol Biol, 10: 5

Seifert B. 2009. Cryptic species in ants (Hymenoptera: Formicidae) revisited: We need a change in the alpha-taxonomic approach. Myrmecol News, 12: 149–166

Serizawa K., Suzuki H., Iwasa M. A., Tsuchiya K., Pavlenko M. V., Kartavtseva I. V., Chelomina G. N., Dokuchaev N. E., Han S. H. 2002. A spatial aspect on mitochondrial DNA genealogy in Apodemus peninsulae from East Asia. Biochem Genet, 40: 149–161

Shimodaira H., Hasegawa M. 1999. Multiple comparisons of loglikelihoods with applications to phylogenetic inference. Mol Biol Evol, 16: 1114–1116

Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22: 2688–2690

Stamatakis A., Blagojevic F., Nikolopoulos D., Antonopoulos C. 2007. Exploring new search algorithms and hardware for phylogenetics: RAxML meets the IBM cell. J VLSI Signal Process, 48: 271–286

Stebbins G. L. 1974. Flowering Plants: Evolution above the Species Level. Cambridge: Harvard University Press

Stephens P. R., Wiens J. J. 2003. Explaining species richness from


continents to communities: The time-for-speciation effect in emydid turtles. Am Nat, 161: 112–128

Stewart J. R., Lister A. M. 2001. Cryptic northern refugia and the origins of the modern biota. Trends Ecol Evol, 16: 608–613

Svenning J. C., Skov F. 2005. The relative roles of environment and history as controls of tree species composition and richness in Europe. J Biogeogr, 32: 1019–1033

Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28: 2731–2739

Tanaka K., Saugstad E. S., Mizusawa K. 1975. Mosquitoes of the Ryukyu Archipelago (Diptera: Culicidae). Mosq Syst, 7: 207–233

Thompson J. D., Gibson T. J., Plewniak F., Jeanmougin F., Higgins D. G. 1997. The Clustal X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res, 24: 4876–4882

Thorne J. L., Kishino H. 2002. Divergence time and evolutionary rate estimation with multilocus data. Syst Biol, 51: 689–702

Thorne J. L., Kishino H., Painter I. S. 1998. Estimating the rate of evolution of the rate of molecular evolution. Mol Biol Evol, 15: 1647–1657

Tominaga A., Matsui M. 2007. Estimation of the type locality of Hynobius naevius (Temminck and Schlegel, 1838), a salamander from Japan (Amphibia: Caudata). Zool Sci, 24: 940–944

Tominaga A., Matsui M. 2008. Taxonomic status of a salamander species allied to Hynobius naevius and a reevaluation of Hynobius naevius yatsui Oyama, 1947 (Amphibia, Caudata). Zool Sci, 25: 107–114

Tominaga A., Matsui M., Nishikawa K., Tanabe S. 2006. Phylogenetic relationships of Hynobius naevius (Amphibia: Caudata) as revealed by mitochondrial 12S and 16S rRNA genes. Mol Phylogenet Evol, 38: 677–684

Tominaga A., Matsui M., Nishikawa K., Tanabe S., Sato S. 2005a. Genetic differentiations of Hynobius naevius (Amphibia, Hynobiidae) as revealed by allozyme analysis. Biochem Syst Ecol, 33: 921–937

Tominaga A., Matsui M., Nishikawa K., Tanabe S., Sato S. 2005b. Morphological discrimination of two genetic groups of a Japanese salamander, Hynobius naevius (Amphibia, Caudata). Zool Sci, 22: 1229–1244

Tominaga A., Matsui M., Yoshikawa N., Nishikawa K., Hayashi T., Misawa Y., Tanabe S., Ota H. Phylogeny and historical demography of Cynops pyrrhogaster (Amphibia: Urodela): Taxonomic relationships and distributional changes associated with climatic oscillations. Mol Phylogenet Evol (In press)

Tominaga A., Ota H., Matsui M. 2010. Phylogeny and phylogeography of the sword-tailed newt, Cynops ensicauda (Amphibia: Caudata), as revealed by nucleotide sequences of mitochondrial DNA. Mol Phylogenet Evol, 54: 910–921

Vieites D. R., Min M. S., Wake D. B. 2007. Rapid diversification and dispersal during periods of global warming by plethodontid salamanders. Proc Natl Acad Sci USA, 104: 19903–19907

Vieites D. R., Zhang P., Wake D. B. 2009. Salamanders (Caudata). In Hedges S. B., Kumar S. (Eds.), The Timetree of Life. New York: Oxford University Press, 365–368 pp

Wiens J. J. 2007. Global patterns of diversification and species

richness in amphibians. Am Nat, 170: S86–S106Wiens J. J., Donoghue M. J. 2004. Historical biogeography,

ecology, and species richness. Trends Ecol Evol, 19: 639–644Wiens J. J., Graham C. H., Moen D. S., Smith S. A., Reeder T.

W. 2006. Evolutionary and ecological causes of the latitudinal diversity gradient in hylid frogs: Treefrog trees unearth the roots of high tropical diversity. Am Nat, 168: 579–596

Wiens J. J., Sukumaran J., Pyron R. A., Brown R. M. 2009. Evolutionary and biogeographic origins of high tropical diversity in Old World frogs (Ranidae). Evolution, 63: 1217–1231

Willis J. C. 1922. Age and Area. Cambridge: Cambridge University Press

Wuyts J., Perriere G., Van de Peer Y. 2004. The European ribosomal RNA database. Nucleic Acids Res, 32: D101–D103

Yang Z. 2007. PAML 4: Phylogenetic analysis by maximum likelihood. Mol Biol Evol, 24: 1586–1591

Yoshikawa N., Matsui M., Nishikawa K. 2010a. Allozymic variation and phylogeography of two genetic types of Onychodactylus japonicus (Amphibia: Caudata: Hynobiidae) sympatric in the Kinki District, Japan. Zool Sci, 27: 344–355

Yoshikawa N., Matsui M., Nishikawa K. 2012. Genetic structure and cryptic diversity of Onychodactylus japonicus (Amphibia, Caudata, Hynobiidae) in northeastern Honshu, Japan, as revealed by allozymic analysis. Zool Sci, 29: 229–237

Yoshikawa N., Matsui M., Nishikawa K., Kim J. B., Kryukov A. 2008. Phylogenetic relationships and biogeography of the Japanese clawed salamander, Onychodactylus japonicus (Amphibia: Caudata: Hynobiidae), and its congener inferred from the mitochondrial cytochrome b gene. Mol Phylogenet Evol, 49: 249–259

Yoshikawa N., Matsui M., Nishikawa K., Misawa Y., Tanabe S. 2010b. Allozymic variation in the Japanese clawed salamander, Onychodactylus japonicus (Amphibia: Caudata: Hynobiidae), with special reference to the presence of two sympatric genetic types. Zool Sci, 27: 33–40

Zeng X., Fu J. 2004. Low genetic diversity in Chinese Hynobius leechii, with comments on the validity of Hynobius mantchuricus. Amphibia-Reptilia, 25: 119–122

Zhang H., Yan J., Zhang G., Zhou K. 2008. Phylogeography and demographic history of Chinese black-spotted frog populations (Pelophylax nigromaculata): Evidence for independent refugia expansion and secondary contact. BMC Evol Biol, 8: 21

Zhang P., Chen Y. Q., Zhou H., Liu Y. F., Wang X. L., Papenfuss T. J., Wake D. B., Qu L. H. 2006. Phylogeny, evolution, and biogeography of Asiatic salamanders (Hynobiidae). Proc Natl Acad Sci USA, 103: 7360–7365

Zhang P., Papenfuss T. J., Wake M. H., Qu L., Wake D. B. 2008. Phylogeny and biogeography of the family Salamandridae (Amphibia: Caudata) inferred from complete mitochondrial genomes. Mol Phylogenet Evol, 49: 586–597

Zhang P., Wake D. B. 2009. Higher-level salamander relationships and divergence dates inferred from complete mitochondrial genomes. Mol Phylogenet Evol, 53: 492–508

Zheng Y., Peng R., Kuro-o M., Zeng X. 2011. Exploring patterns and extent of bias in estimating divergence time from mitochondrial DNA sequence data in a particular lineage: A case study of salamanders (Order Caudata). Mol Biol Evol, 28: 2521–2535

Supplementary Material 1. Samples for genealogical analyses and primers used in PCR. Table 1. Samples for genealogical analyses of Hynobius. For several relatively short sequences, a single sequence can be assigned to different haplotypes.

Haplotype GenBank Accession No. Taxon Specimen

Catalogue No.

Locality Coordinates

containing

12S

containing

cyt b

mt genome 12S–16S

or 12S

ND2–COI cyt b

Reference

Hynobius

H. abei KUHE13514 — — Habe-100 — — AY915987 AY915939 — —

H. amjiensis NTNUB241800 Anji, Zhejiang, China N30°41′, E119°44′ — Hamj-1 — — — DQ652226 Lai and Lue, 2008

H. amjiensis NTNUB241798 Anji, Zhejiang, China N30°41′, E119°44′ — Hamj-2 — — — DQ652225 Lai and Lue, 2008

H. amjiensis CIB-2000-JF213 Mt. Longwang, Zhejiang, China N30°24′, E119°27′ — Hamj-4 — — — AY300152 Fu et al., 2003

H. amjiensis — Mt. Longwang, Zhejiang, China — Hamj-G Hamj-G DQ333808 DQ333808 DQ333808 DQ333808 Zhang et al., 2006

H. amjiensis MVZHerp231110 Mt. Longwang, Zhejiang, China N30°24′, E119°27′ — Hamj-G — — — AY300151 Fu et al., 2003

H. amjiensis CIB-XM3112 Mt. Longwang, Zhejiang, China N30°24′, E119°27′ — Hamj-G — — — JQ929949 This study

H. amjiensis CIB-XM3114 Mt. Longwang, Zhejiang, China — — Hamj-G — — — JQ929948 This study

H. amjiensis CAS194376 Zhejiang, China — Hamj-100 — — AY915980 AY915932 — —

H. arisanensis NTNUB201650 Taitung, Taiwan, China N23°16′, E120°58′ — Hari-1 — — — DQ652224 Lai and Lue, 2008

H. arisanensis ZC17 — — — Hari-2 — — — DQ652223 Lai and Lue, 2008


H. arisanensis NTNUB201669 Chiayi, Taiwan, China N23°31′, E120°48′ — Hari-3 — — — DQ652218 Lai and Lue, 2008


H. arisanensis ZC11 — — — Hari-Gf2 — — — DQ652220 Lai and Lue, 2008

H. arisanensis — Nantou, Taiwan, China — Hari-Gf2 Hari-Gf2 DQ333816 DQ333816 DQ333816 DQ333816 Zhang et al., 2006; Li et al., 2011

H. arisanensis NTNUB 201673 Chiayi, Taiwan, China N23°31′, E120°48′ — Hari-6 — — — DQ652219 Lai and Lue, 2008



H. arisanensis — — — Hari-G1 Hari-G1 EF462213 EF462213 EF462213 EF462213 —

H. boulengeri KUHE25653 Kamikitayama-mura, Nara Pref., Japan — Hbou-1 Hbou-1 — AB201671 — AB266675 Tominaga et al., 2006; Matsui et al., 2007b; Nishikawa et al., 2007

H. boulengeri J-36 — — Hbou-100 — — AY915984 AY915936 — —

H. boulengeri KUHE25655 Kamikitayama-mura, Nara Pref., Japan N34°11′, E136°06′ Hbou-101 — — AY915994 AY915946 — Nishikawa et al., 2007

H. chinensis — Yichang, Hubei, China — — Hchi-1 — — — EF076244 Li et al., 2011

H. chinensis CIB-XM2249 Changyang, Hubei, China N30°35′, E110°40′ — Hchi-G — — — JQ929927 This study




H. chinensis CIB-XM2853 Changyang, Hubei, China N30°35′, E110°40′ Hchi-G Hchi-G HM036353 HM036353 HM036353 HM036353 Zheng et al., 2011

H. dunni KUHE24848 — — Hdun-100 — — AY915974 AY915926 — —

Hynobius sp. CIB-XM1430 Japan — Hsp-92 Hsp-92 — JQ929977b — JQ929925

b This study

H. formosanus YH11 — — — Hfor-1 — — — DQ652212 Lai and Lue, 2008

H. formosanus NTNUB201690 Taichung, Taiwan, China N24°17′, E121°01′ — Hfor-2 — — — DQ652204 Lai and Lue, 2008

H. formosanus NTNUB201689 — — — Hfor-3 — — — DQ652202 Lai and Lue, 2008

H. formosanus NTNUB201695 Taichung, Taiwan, China N24°22′, E121°23′ — Hfor-4 — — — DQ652201 Lai and Lue, 2008

H. formosanus MVZHerp197238 Nantou, Taiwan, China N24°06′, E121°11′ Hfor-100 — — AY915992 AY915944 — —

H. fuca NTNUB201743 Hsinchu, Taiwan, China N24°30′, E121°05′ — Hfuc-1 — — — DQ652199 Lai and Lue, 2008

H. fuca NTNUB201749 Mt. Siakeluo, Taiwan, China N24°33′, E121°11′ — Hfuc-2 — — — DQ652198 Lai and Lue, 2008

H. fuca NTNUB201748 Mt. Lala, Taiwan, China N24°42′, E121°25′ — Hfuc-3 — — — DQ652197 Lai and Lue, 2008

H. fuca NTNUB241551 Mt. Beichatian, Taiwan, China N24°47′, E121°26′ — Hfuc-3 — — — DQ652195 Lai and Lue, 2008



H. glacialis NTNUB201676 Mt. Nanhu, Taiwan, China N24°22′, E121°26′ — Hgla-1 — — — DQ652203 Lai and Lue, 2008

H. glacialis NTNUB201687 Mt. Nanhu, Taiwan, China N24°22′, E121°25′ — Hgla-1 — — — DQ652200 Lai and Lue, 2008

H. guabangshanensis — — — — Hgua-Gc1 Hgua-G2

— — — EF076245 Li et al., 2011

H. guabangshanensis 070319 Qiyang, Hunan, China — — Hgua-Gc1 Hgua-G2

— — — AB548373 Nishikawa et al., 2010

H. guabangshanensis — — — — Hgua-Gc1 Hgua-G2

— — — EF616473 Li et al., 2011

H. guabangshanensis — Qiyang, Hunan, China — Hgua-Gc1 Hgua-Gc1 DQ333819 DQ333819 DQ333819 DQ333819 Zhang et al., 2006; Li et al., 2011

H. guabangshanensis — — — Hgua-G2 Hgua-G2 GU384690 GU384690 GU384690 GU384690 —

H. guabangshanensis CIB-XM1683 Mt. Guabang, Hunan, China N26°38′, E111°58′ — Hgua-Gc1 Hgua-G2

— — — JQ929942 This study





H. hidamontanus CIB-XM3132 Hakuba-mura, Nagano Pref., Japan — Hhid-G Hhid-G JQ929919 JQ929919 JQ929919 JQ929919 This study

H. hidamontanus KUHE9484 Hakuba-mura, Nagano Pref., Japan — Hhid-G — — AY915983 AY915935 — Matsui et al., 2002

H. katoi KUHE37128 Shizuoka, Misakubo-cho, Japan — — Hkat-1 — — — AB266673 Matsui et al., 2007b

H. kimurae — — — — Hkim-1 — — — AY341746 Vences et al., 2003

H. kimurae KUHE16689 Shiga, Otsu-shi, Japan — — Hkim-2 — — — AB266674 Matsui et al., 2007b

H. kimurae CIB-XM3136 Kyoto City, Kyoto Pref., Japan — Hkim-G Hkim-G JQ929920 JQ929920 JQ929920 JQ929920 This study

H. kimurae KUHE22370 — — Hkim-100 — — AY915995 AY915947 — —

H. leechii — southern Korean Peninsula, Korea — — Hlee-1 — — — GU552606 Baek et al., 2011

















H. leechii — southern Korean Peninsula, Korea — — Hlee-18 — — — HM132064 Baek et al., 2011




H. leechii KUHE38284 Gyeongju-si, Gyeongsangbuk-do, Korea — — Hlee-22 — — — AB548376 Nishikawa et al., 2010

H. leechii — Korea — — Hlee-24 — — — EU157028 Poyarkov and Kuzmin, 2008

H. leechii — Mt. Changbai, Jilin, China — Hlee-G1 Hlee-G1 DQ333811 DQ333811 DQ333811 DQ333811 Zhang et al., 2006

H. leechii MVZHerp233465 Yongdae-ri, Kangwon-do, Korea — — Hlee-27 — — — AY315819 Zeng and Fu, 2004

H. leechii MVZHerp233464 Yongdae-ri, Kangwon-do, Korea — — Hlee-27 — — — AY315813 Zeng and Fu, 2004

H. leechii MVZHerp235008 Fengcheng, Liaoning, China N40°31′, E123°58′ — Hlee-91 — — — AY315814 Zeng and Fu, 2004

H. leechii ROM39958 Liaoyang, Liaoning, China N40°58′, E123°39′ — Hlee-91 — — — AY315811 Zeng and Fu, 2004

H. leechii CIB-XM2000105 Fengcheng, Liaoning, China N40°31′, E123°58′ — Hlee-91 — — — JQ929967 This study

H. leechii CIB-XM2000106 Fengcheng, Liaoning, China N40°31′, E123°58′ — Hlee-91 — — — JQ929968 This study

H. leechii KUHE43287 northeastern China — — Hlee-92 — — — AB548375 Nishikawa et al., 2010

H. leechii ROM39959 Liaoyang, Liaoning, China N40°58′, E123°39′ — Hlee-92 — — — AY315818 Zeng and Fu, 2004

H. leechii CIB-2000113 Gaizhou, Liaoning, China N40°01′, E122°22′ — Hlee-92 — — — AY315817 Zeng and Fu, 2004

H. leechii ROM39961 Gaizhou, Liaoning, China N40°01′, E122°22′ — Hlee-92 — — — AY315816 Zeng and Fu, 2004

H. leechii ROM39956 Zhuanghe, Liaoning, China N40°03′, E122°51′ — Hlee-92 — — — AY315815 Zeng and Fu, 2004

H. leechii ROM39957 Donggang, Liaoning, China N40°01′, E123°28′ — Hlee-92 — — — AY315812 Zeng and Fu, 2004

H. leechii MVZHerp235012 Qianshan, Liaoning, China N41°01′, E123°08′ — Hlee-92 — — — AY300150 Fu et al., 2003; Zeng and Fu, 2004

H. leechii CIB-XM1867 Fusong, Jilin, China N42°34′, E127°56′ — Hlee-92 — — — JQ929952 This study


H. leechii CIB-XM1905 Tonghua, Jilin, China N41°25′, E126°17′ — Hlee-92 — — — JQ929954 This study

H. leechii CIB-XM2047 Huanren, Liaoning, China N41°20′, E124°55′ — Hlee-92 — — — JQ929957 This study


H. leechii CIB-XM2131 Tonghua, Jilin, China N41°25′, E126°17′ — Hlee-92 — — — JQ929959 This study


H. leechii HNUSTM1005046 Fusong, Jilin, China N42°36′, E127°56′ — Hlee-92 — — — JQ929961 This study

H. leechii HNUSTM1005047 Fusong, Jilin, China N42°36′, E127°56′ — Hlee-92 — — — JQ929962 This study



H. leechii CIB-XM200095 Qianshan, Liaoning, China N41°01′, E123°08′ — Hlee-92 — — — JQ929963 This study

H. leechii CIB-XM200099 Qianshan, Liaoning, China N41°01′, E123°08′ — Hlee-92 — — — JQ929964 This study

H. leechii CIB-XM2000100 Liaoyang, Liaoning, China N40°59′, E123°39′ — Hlee-92 — — — JQ929965 This study

H. leechii CIB-XM2000101 Liaoyang, Liaoning, China N40°59′, E123°39′ — Hlee-92 — — — JQ929966 This study

H. leechii CIB-XM2000107 Donggang, Liaoning, China N40°01′, E123°28′ — Hlee-92 — — — JQ929969 This study

H. leechii CIB-XM2000109 Donggang, Liaoning, China N40°01′, E123°28′ — Hlee-92 — — — JQ929970 This study

H. leechii CIB-XM2000111 Mt. Buyun, Liaoning, China N40°03′, E122°51′ — Hlee-92 — — — JQ929971 This study

H. leechii CIB-XM2000112 Mt. Buyun, Liaoning, China N40°03′, E122°51′ — Hlee-92 — — — JQ929972 This study

H. leechii CIB-XM2000117 Gaizhou, Liaoning, China N40°01′, E122°22′ — Hlee-92 — — — JQ929973 This study

H. leechii CIB-XM2000119 Gaizhou, Liaoning, China N40°01′, E122°22′ — Hlee-92 — — — JQ929974 This study

H. leechii — — — Hlee-Gy2 Hlee-Gy2 FJ594965a

FJ594965a

FJ594965a

FJ594965a Lee et al., 2011

H. leechii MVZHerp163727 Chung-Ju, South Chungchong Prov., Korea — Hlee-100 — — AY915976 AY915928 — Weisrock et al., 2005

H. leechii CIB-XM3133 Yangju City, Gyeonggi-do, Korea — — Hlee-3133 — — — JQ929975 This study

H. lichenatus KUHE21602 Haramachi-shi, Fukushima, Japan — — Hlic-1 — — — AB266671 Matsui et al., 2007b

H. lichenatus KUHE9404 Omagari-shi, Akita, Japan — — Hlic-2 — — — AB266670 Matsui et al., 2007b

H. lichenatus T1008 Minakami-machi, Gunma, Japan — — Hlic-3 — — — AB266669 Matsui et al., 2007b

H. lichenatus CIB-XM3138 Hirosaki City, Aomori Pref., Japan — Hlic-G Hlic-G JQ929921 JQ929921 JQ929921 JQ929921 This study

H. lichenatus J-9 — — Hic-100 — — AY915988 AY915940 — —

H. lichenatus CIB-XM3139 Hirosaki City, Aomori Pref., Japan — — Hlic-3139 — — — JQ929976 This study

H. maoershanensis CIB-XM1983 Mt. Maoer, Guangxi, China N25°54′, E110°26′ — Hmao-3 Hmao-G

— — — EF433580 Xiong et al., 2007

H. maoershanensis CIB-XM1970 Mt. Maoer, Guangxi, China N25°54′, E110°26′ — Hmao-3 Hmao-G

— — — EF433579 Xiong et al., 2007

H. maoershanensis CIB70079 Xingan, Guangxi, China — — Hmao-3 — — — AB548372 Nishikawa et al., 2010

H. maoershanensis CIB-XM2121 Mt. Maoer, Guangxi, China N25°54′, E110°26′ Hmao-G Hmao-G HM036355 HM036355 HM036355 HM036355 Zheng et al., 2011

H. maoershanensis CIB-XM2101 Mt. Maoer, Guangxi, China N25°54′, E110°26′ — Hmao-G — — — JQ929945 This study



H. naevius KUHE28584 Tara-cho, Saga Pref., Japan — Hnae-1 Hnae-1 — AB201659 — AB266672 Tominaga et al., 2006; Matsui et al., 2007b

H. naevius KUHE12984 Kitakyushu-shi, Fukuoka Pref., Japan — Hnae-100 — — AY915985 AY915937 — Tominaga et al., 2003

H. nebulosus KUHE12959 Nara-shi, Nara, Japan — — Hneb-1 — — — AB266668 Matsui et al., 2006; Matsui et al., 2007b

H. nebulosus KUHE9997 Otsu-shi, Shiga, Japan — — Hneb-2 — — — AB266667 Matsui et al., 2006; Matsui et al., 2007b

H. nebulosus KUHE34647 Shima-cho, Mie, Japan — — Hneb-3 — — — AB266666 Matsui et al., 2007b

H. nebulosus KUHE18380 Tsu-shi, Mie, Japan — — Hneb-4 — — — AB266665 Matsui et al., 2006; Matsui et al., 2007b

H. nebulosus — Nagoya-shi, Aichi, Japan — — Hneb-5 — — — AB266664 Matsui et al., 2007b

H. nebulosus KUHE24863 Tahara-cho, Aichi, Japan — — Hneb-6 — — — AB266663 Matsui et al., 2006; Matsui et al., 2007b

H. nebulosus KUHE24869 Minamichita-cho, Aichi, Japan — — Hneb-7 — — — AB266662 Matsui et al., 2006; Matsui et al., 2007b

H. nebulosus NTNUB241582 Gobo-shi, Wakayama Pref., Japan N33°53′, E135°08′ — Hneb-8 — — — DQ652232 Lai and Lue, 2008

H. nebulosus KUHE24693 Isahaya-shi, Nagasaki Pref., Japan — Hneb-9 Hneb-9 — AB201668 — AB445786 Matsui et al., 2006; Tominaga et al., 2006

H. nebulosus CIB-XM3140 Nagasaki City, Nagasaki Pref., Japan — Hneb-G Hneb-G HM036356 HM036356 HM036356 HM036356 Zheng et al., 2011

H. nebulosus CIB-XM3214 Hino Town, Shiga Pref., Japan — — Hneb-91 — — — JQ929950 This study

H. nebulosus CIB-XM3215 Hino Town, Shiga Pref., Japan — — Hneb-91 — — — JQ929951 This study

H. nebulosus KUHE24698 Isahaya-shi, Nagasaki Pref., Japan — Hneb-100 — — AY915973 AY915925 — Matsui et al., 2006

H. nigrescens KUHE17924 Kami-machi, Miyagi Pref., Japan — Hnig-100 Hnig-100 — AY915991 AY915943 AB548378 Nishikawa et al., 2010

H. nigrescens CIB-XM1431 Japan — — Hnig-91 — — — JQ929924 This study

H. nigrescens CIB-XM3142 Myoko City, Niigata Pref., Japan — Hnig-G Hnig-G JQ929922 JQ929922 JQ929922 JQ929922 This study

H. okiensis KUHE18917 Oki Island, Japan — Hoki-100 — — AY915979 AY915931 — Matusi et al., 2007a

H. quelpaertensis — southern Korean Peninsula, Korea — — Hque-1 — — — GU552631 Baek et al., 2011
























H. quelpaertensis — southern Korean Peninsula, Korea — — Hque-G2 — — — GU552607 Baek et al., 2011

H. quelpaertensis Seto940526 Cheju Island, Korea — — Hque-G2 — — — AB548377 Nishikawa et al., 2010

H. quelpaertensis — Ara-dong, Cheju Island, Korea — Hque-G2 Hque-G2 EF201847 EF201847 EF201847 EF201847 Oh et al., 2007; Baek et al., 2011

H. quelpaertensis CIB-XM3134 Okusu, Cheju Island, Korea — Hque-G1 Hque-G1 HM036352 HM036352 HM036352 HM036352 Zheng et al., 2011

H. quelpaertensis TP25095 Korea — Hque-102 — — AY915978 AY915930 — Yang et al., 1997; Yang et al., 2001

H. retardatus KUHE13034 Ebetsu, Hokkaido, Japan — — Hret-1 — — — AB363609 Matsui et al., 2008

H. retardatus CIB-XM3144 Sapporo City, Hokkaido, Japan — Hret-G Hret-G HM036351 HM036351 HM036351 HM036351 Zheng et al., 2011

H. retardatus KUHE14545 — — Hret-100 — — AY915996 AY915948 — —

H. sonani TC15 Nantou, Taiwan, China — — Hson-1 — — — DQ652215 Lai and Lue, 2008


H. sonani HH15 Nantou, Taiwan, China — — Hson-2 — — — DQ652209 Lai and Lue, 2008

H. sonani NTNUB201726 Nantou, Taiwan, China N24°11′, E121°18′ — Hson-2 — — — DQ652205 Lai and Lue, 2008







H. sonani MVZHerp197249 Nantou, Taiwan, China N24°03′, E121°16′ Hson-100 — — AY915993 AY915945 — —

Hynobius sp. 1 — southern Korean Peninsula, Korea — — Hsp1-1 — — — GU552663 Baek et al., 2011

























Hynobius sp. 2 — southern Korean Peninsula, Korea — — Hsp2-5 — — — HM132071 Baek et al., 2011


















H. stejnegeri KUHE14955 Gokase-cho, Miyazaki Pref., Japan N32°43′, E131°11′ Hste-100 — — AY915986 AY915938 — Nishikawa et al., 2007

H. takedai KUHE24764 — — Htak-100 — — AY915990 AY915942 — —

H. tokyoensis KUHE14401 Yokosuka-shi, Kanagawa, Japan — — Htok-1 — — — AB266661 Matsui et al., 2007b

H. tokyoensis KUHE14394 Yokosuka-shi, Kanagawa, Japan — — Htok-1 — — — AB266660 Matsui et al., 2007b

H. tokyoensis KUHE14618 Utsunomiya-shi, Tochigi, Japan — — Htok-3 — — — AB266659 Matsui et al., 2007b

H. tokyoensis KUHE14613 Utsunomiya-shi, Tochigi, Japan — — Htok-3 — — — AB266658 Matsui et al., 2007b

H. tokyoensis KUHE13006 Tanuma-machi, Tochigi,, Japan — — Htok-3 — — — AB266657 Matsui et al., 2007b

H. tokyoensis KUHE13005 Tanuma-machi, Tochigi,, Japan — — Htok-3 — — — AB266656 Matsui et al., 2007b

H. tokyoensis — Yokaichiba-shi, Chiba, Japan — — Htok-7 — — — AB266655 Matsui et al., 2007b

H. tokyoensis KUHE16912 Yokaichiba-shi, Chiba, Japan — — Htok-7 — — — AB266654 Matsui et al., 2007b

H. tokyoensis KUHE16929 Kamogawa-shi, Chiba, Japan — — Htok-9 — — — AB266653 Matsui et al., 2007b

H. tokyoensis KUHE16927 Kamogawa-shi, Chiba, Japan — — Htok-10 — — — AB266652 Matsui et al., 2007b

H. tokyoensis — Ichihara-shi, Chiba, Japan — — Htok-11 — — — AB266651 Matsui et al., 2007b

H. tokyoensis — Ichihara-shi, Chiba, Japan — — Htok-11 — — — AB266650 Matsui et al., 2007b

H. tokyoensis KUHE28444 Kimitsu-shi, Chiba, Japan — — Htok-13 — — — AB266649 Matsui et al., 2007b




H. tokyoensis CIB-XM1433 Japan — — Htok-15 — — — JQ929926 This study

H. tokyoensis KUHE8127 Akiruno-shi, Tokyo, Japan — — Htok-17 — — — AB266645 Matsui et al., 2007b




H. tokyoensis KUHE25837 Hachioji-shi, Tokyo, Japan — — Htok-21 — — — AB266641 Matsui et al., 2007b

H. tokyoensis KUHE25836 Hachioji-shi, Tokyo, Japan — — Htok-22 — — — AB266640 Matsui et al., 2007b

H. tokyoensis KUHE8170 Hatoyama-machi, Saitama, Japan — — Htok-23 — — — AB266639 Matsui et al., 2007b

H. tokyoensis KUHE8169 Hatoyama-machi, Saitama, Japan — — Htok-24 — — — AB266638 Matsui et al., 2007b

H. tokyoensis KUHE14622 Ranzan-machi, Saitama, Japan — — Htok-25 — — — AB266637 Matsui et al., 2007b

H. tokyoensis KUHE14621 Ranzan-machi, Saitama, Japan — — Htok-26 — — — AB266636 Matsui et al., 2007b

H. tokyoensis KUHE8124 Hitachiota-shi, Ibaraki, Japan — — Htok-27 — — — AB266635 Matsui et al., 2007b

H. tokyoensis KUHE8105 Hitachiota-shi, Ibaraki, Japan — — Htok-27 — — — AB266634 Matsui et al., 2007b

H. tokyoensis KUHE21564 Iwaki-shi, Fukushima, Japan — — Htok-29 — — — AB266633 Matsui et al., 2007b



H. tokyoensis CIB-XM3146 Tohgane City, Chiba, Japan — Htok-G Htok-G HM036357 HM036357 HM036357 HM036357 Zheng et al., 2011

H. tokyoensis KUHE16911 — — Htok-100 — — AY915989 AY915941 — —

H. tsuensis CIB-XM3148 Tsushima City, Nagasaki Pref., Japan — Htsu-G Htsu-G JQ929923 JQ929923 JQ929923 JQ929923 This study

H. tsuensis KUHE18367 — — Htsu-100 — — AY915975 AY915927 — —

H. yangi — southern Korean Peninsula, Korea — — Hyan-1 — — — GU552642 Baek et al., 2011











H. yangi — — — — Hyan-4 Hyan-6 Hyan-10 Hyan-11

— — — FJ911531 —

H. yangi NTNUB201703 Pusan, Korea N35°10′, E129°03′ — Hyan-25L — — — DQ652231a Lai and Lue, 2008

H. yangi — Ulju-gun, Korea — Hyan-G Hyan-G JN415127 JN415127 JN415127 JN415127 Lee et al., 2011

H. yangi HLc10 Korea — Hyan-101 — — AY915977 AY915929 — Li et al., 2011

H. yatsui KUHET2999 Kumakogen-cho, Ehime Pref., Japan — Hyat-1 Hyat-1 — AB201645 — AB297552 Tominaga et al., 2006; Sakamoto et al., 2009

H. yatsui KUHE21785 Uchiko-cho, Ehime Pref., Japan — Hyat-2 Hyat-2 — AB201646 — AB297551 Tominaga et al., 2006; Sakamoto et al., 2009

H. yatsui — Kobayashi-shi, Miyazaki Pref., Japan — — Hyat-3 — — — AB297550 Sakamoto et al., 2009

H. yatsui KUHE34626 Itsuki-mura, Kumamoto Pref., Japan — — Hyat-4 — — — AB297549 Sakamoto et al., 2009


H. yatsui — Kijyo-cho, Miyazaki Pref., Japan — — Hyat-6 — — — AB297547 Sakamoto et al., 2009

H. yatsui KUHE27302 Shiba-son, Miyazaki Pref., Japan — — Hyat-7 — — — AB297546 Sakamoto et al., 2009

H. yatsui — Yamato-cho, Kumamoto Pref., Japan — — Hyat-8 — — — AB297545 Sakamoto et al., 2009


H. yatsui KUHE34568 Sagara-mura, Kumamoto Pref., Japan — — Hyat-10 — — — AB297543 Sakamoto et al., 2009


H. yatsui KUHE27655 Shiiba-son, Miyazaki Pref., Japan — — Hyat-12 — — — AB297541 Sakamoto et al., 2009


H. yatsui — Yatsushiro-shi, Kumamoto Pref., Japan — — Hyat-14 — — — AB297539 Sakamoto et al., 2009






H. yatsui KUHE32100 Satsuma-cho, Kagoshima Pref., Japan — — Hyat-20 — — — AB297533 Sakamoto et al., 2009




H. yatsui KUHE30214 Miyazaki-shi, Miyazaki Pref., Japan — — Hyat-24 — — — AB297529 Sakamoto et al., 2009





H. yatsui KUHE28102 Kanoya-shi, Kagoshima Pref., Japan — Hyat-29 Hyat-29 — AB201667 — AB297524 Tominaga et al., 2006; Sakamoto et al., 2009


H. yatsui KUHE27383 Saeki-shi, Oita Pref., Japan — — Hyat-31 — — — AB297522 Sakamoto et al., 2009




H. yatsui — Yamaga-shi, Kumamoto Pref., Japan — — Hyat-35 — — — AB297518 Sakamoto et al., 2009

H. yatsui KUHE31298 Asakura-shi, Fukuoka Pref., Japan — — Hyat-36 — — — AB297517 Sakamoto et al., 2009

H. yatsui KUHE13605 Aka-mura, Fukuoka Pref., Japan — — Hyat-37 — — — AB297516 Sakamoto et al., 2009

H. yatsui — Hoshino-mura, Fukuoka Pref., Japan — — Hyat-38 — — — AB297515 Sakamoto et al., 2009

H. yatsui KUHE28489 Kitakyushu-shi, Fukuoka Pref., Japan — — Hyat-39 — — — AB297514 Sakamoto et al., 2009










H. yatsui KUHE27161 Nogata-shi, Fukuoka Pref., Japan — — Hyat-49 — — — AB297504 Sakamoto et al., 2009

H. yatsui KUHE27162 Nogata-shi, Fukuoka Pref., Japan — — Hyat-50 — — — AB297503 Sakamoto et al., 2009


H. yiwuensis CIB20070255 Ningbo, Zhejiang, China — — Hyiw-302 — — — AB548374 Nishikawa et al., 2010

H. yiwuensis CIB-JF302 Zhenhai, Zhejiang, China N29°50′, E121°53′ — Hyiw-302 — — — JQ929936 This study

H. yiwuensis MVZHerp231123 Zhoushan Island, Zhejiang, China N30°02′, E122°09′ — Hyiw-228 — — — AY300159 Fu et al., 2003

H. yiwuensis NTNUB241789 Zhejiang, China — — Hyiw-228 — — — DQ652228 Lai and Lue, 2008

H. yiwuensis CIB-JF228 Zhoushan Island, Zhejiang, China N30°02′, E122°09′ — Hyiw-228 — — — JQ929931 This study

H. yiwuensis CIB-JF227 Zhoushan Island, Zhejiang, China N30°02′, E122°09′ — Hyiw-228 — — — JQ929932 This study

H. yiwuensis MVZHerp231122 Zhoushan Island, Zhejiang, China N30°02′, E122°09′ — Hyiw-3 — — — AY300158 Fu et al., 2003

H. yiwuensis CIB-2000-JF230 Zhoushan Island, Zhejiang, China N30°02′, E122°09′ — Hyiw-4 — — — AY300157 Fu et al., 2003

H. yiwuensis ROMHerp39963 Zhenhai, Zhejiang, China N29°50′, E121°53′ — Hyiw-301 — — — AY300156 Fu et al., 2003

H. yiwuensis CIB-JF301 Zhenhai, Zhejiang, China N29°50′, E121°53′ — Hyiw-301 — — — JQ929935 This study

H. yiwuensis MVZHerp235006 Zhenhai, Zhejiang, China N29°50′, E121°53′ — Hyiw-6 — — — AY300155 Fu et al., 2003

H. yiwuensis MVZHerp231119 Xiaoshan, Zhejiang, China N29°27′, E120°18′ — Hyiw-7 — — — AY300154 Fu et al., 2003

H. yiwuensis MVZHerp231117 Xiaoshan, Zhejiang, China N29°27′, E120°18′ — Hyiw-219 — — — AY300153 Fu et al., 2003

H. yiwuensis NTNUB241796 Zhejiang, China — — Hyiw-219 — — — DQ652230 Lai and Lue, 2008

H. yiwuensis CIB-JF219 Xiaoshan, Zhejiang, China N29°27′, E120°18′ — Hyiw-219 — — — JQ929937 This study

H. yiwuensis NTNUB241795 Zhejiang, China — — Hyiw-3C — — — DQ652229 Lai and Lue, 2008

H. yiwuensis NTNUB241578 Zhoushan Island, Zhejiang, China N30°00′, E122°06′ — Hyiw-5C — — — DQ652227 Lai and Lue, 2008

H. yiwuensis CIB-XM2215 Yiwu, Zhejiang, China N29°29′, E120°06′ — Hyiw-G — — — JQ929933 This study

H. yiwuensis CIB-XM2216 Yiwu, Zhejiang, China N29°29′, E120°06′ — Hyiw-G — — — JQ929934 This study

H. yiwuensis CIB-XM2843 Yiwu, Zhejiang, China N29°29′, E120°06′ Hyiw-G Hyiw-G HM036354 HM036354 HM036354 HM036354 Zheng et al., 2011

H. yiwuensis CIB-XM2864 Xiaoshan, Zhejiang, China N29°57′, E120°19′ — Hyiw-2865 — — — JQ929938 This study

H. yiwuensis CIB-XM2865 Xiaoshan, Zhejiang, China N29°57′, E120°19′ — Hyiw-2865 — — — JQ929939 This study

H. yiwuensis CIB-XM3289 Ningbo, Zhejiang, China N29°13′, E121°56′ — Hyiw-3289 — — — JQ929940 This study

H. yiwuensis CIB-XM3290 Ningbo, Zhejiang, China N29°13′, E121°56′ — Hyiw-3289 — — — JQ929941 This study

H. yiwuensis CAS194377 Ningbo, Zhejiang, China — Hyiw-100 — — AY915981 AY915933 — —

H. yiwuensis TP24994 Zhejiang, China — Hyiw-101 — — AY915982 AY915934 — Li et al., 2011

Batrachuperus

B. londongensis — Mt. Omei, Sichuan, China — Blon-G Blon-G DQ333809 DQ333809 DQ333809 DQ333809 Zhang et al., 2006

Liua

L. tsinpaensis — Zhouzhi, Shaanxi, China — Ltsi-G Ltsi-G DQ333813 DQ333813 DQ333813 DQ333813 Zhang et al., 2006 a The scientific names for the sequences need to be revised. b Sequences from an unidentified Hynobius specimen.

Reference Baek, H.J., Lee, M.Y., Lee, H., Min, M.S., 2011. Mitochondrial DNA data unveil highly

divergent populations within the genus Hynobius (Caudata: Hynobiidae) in South Korea. Mol. Cells 31, 105–112

Fu, J., Hayes, M., Liu, Z.J., Zeng, X.M., 2003. Genetic divergence of the southeastern Chinese salamanders of the genus Hynobius. Acta Zool. Sin. 49, 585–591.

Lai, J.S., Lue, K.Y., 2008. Two new Hynobius (Caudata: Hynobiidae) salamanders from Taiwan. Herpetologica 64, 63–80.

Lee, B.H., Kim, J.Y., Song, S., Hur, J.M., Cho, J.Y., Park, Y.C., 2011. The complete mitochondrial genome sequence of the Kori salamander Hynobius yangi (Caudata: Hynobiidae). Mitochondrial DNA 22, 168–170.

Li, J., Fu, C., Lei, G., 2011. Biogeographical consequences of Cenozoic tectonic events within East Asian margins: a case study of Hynobius biogeography. PLoS One 6, e21506.

Matsui, M., Nishikawa, K., Misawa, Y., Kakegawa, M., Sugahara, T., 2002. Taxonomic relationships of an endangered Japanese salamander Hynobius hidamontanus Matsui, 1987 with H. tenuis Nambu, 1991 (Amphibia: Caudata). Curr. Herpetol. 21, 25–34.

Matsui, M., Nishikawa, K., Misawa, Y., Tanabe, S., 2007a. Systematic relationships of Hynobius okiensis among Japanese salamanders (Amphibia: Caudata). Zool. Sci. 24, 746–751.

Matsui, M., Nishikawa, K., Utsunomiya, T., Tanabe, S., 2006. Geographic allozyme variation in the Japanese clouded salamander, Hynobius nebulosus (Amphibia: Urodela). Biol. J. Linn. Soc. 89, 311–330.

Matsui, M., Tominaga, A., Hayashi, T., Misawa, Y., Tanabe, S., 2007b. Phylogenetic relationships and phylogeography of Hynobius tokyoensis (Amphibia: Caudata) using complete sequences of cytochrome b and control region genes of mitochondrial DNA. Mol. Phylogenet. Evol. 44, 204–216.

Matsui, M., Yoshikawa, N., Tominaga, A., Sato, T., Takenaka, S., Tanabe, S., Nishikawa, K., Nakabayashi, S., 2008. Phylogenetic relationships of two Salamandrella species as revealed by mitochondrial DNA and allozyme variation (Amphibia: Caudata: Hynobiidae). Mol. Phylogenet. Evol. 48, 84–93.

Nishikawa, K., Jiang, J.P., Matsui, M., Mo, Y.M., Chen, X.H., Kim, J.B., Tominaga, A., Yoshikawa, N., 2010. Invalidity of Hynobius yunanicus and molecular phylogeny of Hynobius salamander from continental China (Urodela, Hynobiidae). Zootaxa 2426, 65–67.

Nishikawa, K., Matsui, M., Tanabe, S., Sato, S., 2007. Morphological and allozymic variation in Hynobius boulengeri and H. stejnegeri (Amphibia: Urodela: Hynobiidae). Zool. Sci. 24, 752–766.

Oh, D.J., Chang, M.H., Oh, H.S., Jung, Y.H., 2007. The complete mitochondrial DNA sequence of the Jeju salamander, Hynobius quelpaertensis, and the phylogenetic relationships among the Hynobiidae. Korean J. Genet. 29, 331–341.

Poyarkov, N.A., Kuzmin, S.L., 2008. Phylogeography of the Siberian newt Salamandrella keyserlingii by mitochondrial DNA sequence analysis. Russ. J. Genet. 44, 948–958.

Sakamoto, M., Tominaga, A., Matsui, M., Sakata, K., Uchino, A., 2009. Phylogeography of

Hynobius yatsui (Amphibia: Caudata) in Kyushu, Japan. Zool. Sci. 26, 35–47. Tominaga, A., Matsui, M., Nishikawa, K., Sato, S., 2003. Occurrence of two types of

Hynobius naevius in northern Kyushu, Japan (Amphibia: Urodela). Zool. Sci. 20, 1467–1476.

Tominaga, A., Matsui, M., Nishikawa, K., Tanabe, S., 2006. Phylogenetic relationships of Hynobius naevius (Amphibia: Caudata) as revealed by mitochondrial 12S and 16S rRNA genes. Mol. Phylogenet. Evol. 38, 677–684.

Vences, M., Vieites, D.R., Glaw, F., Brinkmann, H., Kosuch, J., Veith, M., Meyer, A., 2003. Multiple overseas dispersal in amphibians. Proc. R. Soc. Lond. B 270, 2435–2442.

Weisrock, D.W., Harmon, L.J., Larson, A., 2005. Resolving deep phylogenetic relationships in salamanders: analyses of mitochondrial and nuclear genomic data. Syst. Biol. 54, 758–777.

Xiong, J.L., Chen, Q., Zeng, X.M., Zhao, E.M., Qing, L.Y., 2007. Karyotypic, morphological, and molecular evidence for Hynobius yunanicus as a synonym of Pachyhynobius shangchengensis (Urodela: Hynobiidae). J. Herpetol. 41, 664–671.

Yang, S.Y., Kim, J.B., Min, M.S., Suh, J.H., Kang, Y.J., 2001. Monograph of Korean Amphibia. Academic Press, Seoul, pp. 42–43.

Yang, S.Y., Kim, J.B., Min, M.S., Suh, J.H., Suk, H.Y., 1997. Genetic and phonetic differentiation among three forms of Korean salamander Hynobius leechii. Korean J. Biol. Sci. 1, 247–257.

Zeng, X., Fu, J., 2004. Low genetic diversity in Chinese Hynobius leechii, with comments on the validity of Hynobius mantchuricus. Amphibia-Reptilia 25, 119–122.

Zhang, P., Chen, Y.Q., Zhou, H., Liu, Y.F., Wang, X.L., Papenfuss, T.J., Wake, D.B., Qu, L.H., 2006. Phylogeny, evolution, and biogeography of Asiatic Salamanders (Hynobiidae). Proc. Natl. Acad. Sci. USA 103, 7360–7365.

Zheng, Y., Peng, R., Kuro-o, M., Zeng, X., 2011. Exploring patterns and extent of bias in estimating divergence time from mitochondrial DNA sequence data in a particular lineage: a case study of salamanders (Order Caudata). Mol. Biol. Evol. 28, 2521–2535.

Table 2. Primers used in PCR. Fragments amplified for mitochondrial genome sequencing are labeled with an asterisk and listed in contiguous order. Fragment Primer Sequence (5′ → 3′) Reference L1* 12S-1 AAACTGGGATTAGATACCCCACTAT [1] 16S-2 GTGATTAYGCTACCTTTGCACGGT [2] L2* 12S-3 TACACACCGCCCGTCA [2] 16S-4 GACCTGGATTACTCCGGTCTGAACTC [3] A* 16S-1 GGTTTACGACCTCGATGTTGGATCA [3] Met-2 GGTATGGGCCCAARAGCTT [2] B* Ile-1 AGGRRYYACTTTGATARAGT [2] COI-2 AGGGTGCCRATRTCYTTRTGRTT [2] C* Asn-1 GACCTTTTAGTTAACAGCTAAA [4] Asp-2 ACAAGGAATTGTAATIGTTTTACTAA [4] CE* CEH TAGCAGGNATACCACGACG [5] CEL GGGGAAGCTGCATCTTGA [5] E* Ser-1 GAACCCCCITARRYTAATTTCAAGT [2] Lys-2 CACCGRTCTWYAGCTTAAAAGGC [2] EF* EFH CTTATTTCTGCAGAAGATGT [5] EFL GTAGGGGTAAATGTATATGG [5] F* Lys-1 AAGCAATAGCCTTTTAAGC [2] Arg-2 AACCRAAATTTAYTRAGTCGAAAT [2] FG* FGH TTTGACCTTGAAATTGC [5] FGL GTGCTTGCTTCACATGC [5] G* Arg-1 ATTTCGACTYAGTAAATTTYGGTT [2] Leu-2 CATTACTTTTACTTGGRNTTGCACC [2] H* His-1 AAAATWNTAGATTGTGRTTCTA [4] ND5-2 CCYATTTTTCGRATRTCYTGYTC [4] I* ND5-1 ACATCCAGYCARYTAGGIYTAATAATAGT [4] Cyb-2 GCICCTCARAATGATATTTGTCC [4] M* Glu-1 GAAAAACCAAYGTTGTATTCAACTATAA [2] 12S-2 TCGATTATAGAACAGGCTCCTCT

[6]

cyt b HND6-1 ACYCARCACCCRCAAACAGCCGC This study HND6-3 CTAACCCTAAAGCRGCAAAATAYGG This study HThr-2 GGTTTACAAGACCRRYGCTTWATTT

This study

12S–16S H12S-1 AGAGTTGGTAAATTTCGTGCCAGC This study H16S-4 TGAATTTAAGTTCATTTATTAAGTAACCAGC This study [1] Janczewski, D.N., Yuhki, N., Gilbert, D.A., Jefferson, G.T., O’Brien, S.J., 1992.

Molecular phylogenetic inference from saber-toothed cat fossils of Rancho La Brea. Proc. Natl. Acad. Sci. USA 89, 9769–9773.

[2] Zhang, P., Papenfuss, T.J., Wake, M.H., Qu, L.H., Wake, D.B., 2008. Phylogeny and biogeography of the family Salamandridae (Amphibia: Caudata) inferred from complete mitochondrial genomes. Mol. Phylogenet. Evol. 49, 586–597.

[3] Zhang, P., Zhou, H., Chen, Y.Q., Liu, Y.F., Qu, L.H., 2005. Mitogenomic perspectives on the origin and phylogeny of living amphibians. Syst. Biol. 54, 391–400.

[4] Zhang, P., Wake, D.B., 2009. Higher-level salamander relationships and divergence dates inferred from complete mitochondrial genomes. Mol. Phylogenet. Evol. 53, 492–508.

[5] Peng, R., Zhang, P., Xiong, J.L., Gu, H.J., Zeng, X.M., Zou, F.D., 2010. Rediscovery of Protohynobius puxiongensis (Caudata: Hynobiidae) and its phylogenetic position based on complete mitochondrial genomes. Mol. Phylogenet. Evol. 56, 252–258.

[6] San Mauro, D., Gower, D.J., Oommen, O.V., Wilkinson, M., Zardoya, R., 2004. Phylogeny of caecilian amphibians (Gymnophiona) based on complete mitochondrial genomes and nuclear RAG1. Mol. Phylogenet. Evol. 33, 413–427.

Supplementary Material 3. Samples for molecular clock analysis. Sequences of the species Onychodactylus japonicus sensu lato are not from a single individual.

GenBank Accession No. nemicepS noxaTCatalogue No. 12S–16S ND1–COI cyt b

ataduaC eaditamotsybmA

Ambystoma mexicanum — AJ584639 AJ584639 AJ584639 Cryptobranchidae

Andrias japonicus — AB208679 AB208679 AB208679Andrias davidianus — AJ492192 AJ492192 AJ492192 Cryptobranchus alleganiensis — GQ368662 GQ368662 GQ368662

eadiibonyHBatrachuperus londongensis — DQ333809 DQ333809 DQ333809Hynobius amjiensis — DQ333808 DQ333808 DQ333808Hynobius arisanensis — EF462213 EF462213 EF462213 Hynobius chinensis CIB-XM2853 HM036353 HM036353 HM036353Hynobius guabangshanensis — GU384690 GU384690 GU384690Hynobius hidamontanus CIB-XM3132 JQ929919 JQ929919 JQ929919 Hynobius kimurae CIB-XM3136 JQ929920 JQ929920 JQ929920 Hynobius leechii — DQ333811 DQ333811 DQ333811Hynobius lichenatus CIB-XM3138 JQ929921 JQ929921 JQ929921 Hynobius maoershanensis CIB-XM2121 HM036355 HM036355 HM036355Hynobius nebulosus CIB-XM3140 HM036356 HM036356 HM036356Hynobius nigrescens CIB-XM3142 JQ929922 JQ929922 JQ929922 Hynobius quelpaertensis CIB-XM3134 HM036352 HM036352 HM036352Hynobius retardatus CIB-XM3144 HM036351 HM036351 HM036351Hynobius tokyoensis CIB-XM3146 HM036357 HM036357 HM036357Hynobius tsuensis CIB-XM3148 JQ929923 JQ929923 JQ929923 Hynobius yangi — JN415127 JN415127 JN415127 Hynobius yiwuensis CIB-XM2843 HM036354 HM036354 HM036354Liua tsinpaensis — DQ333813 DQ333813 DQ333813Onychodactylus zhaoermii — DQ333820 DQ333820 DQ333820Onychodactylus japonicus sensu lato — AY915970 AY916032 AB452860Pachyhynobius shangchengensis — DQ333812 DQ333812 DQ333812Paradactylodon mustersi MVZHerp236807 DQ333821 DQ333821 DQ333821

eaditnodohtelPEurycea bislineata MVZHerp225074 AY728217 AY728217 AY728217

eadirdnamalaSCynops ensicauda MVZHerp238580 EU880310 EU880310 EU880310Cynops orientalis MVZHerp230345 EU880311 EU880311 EU880311Cynops orphicus MVZHerp241428 EU880312 EU880312 EU880312Cynops pyrrhogaster TP-MVZ03 EU880313 EU880313 EU880313Echinotriton andersoni MVZHerp232187 EU880314 EU880314 EU880314Euproctus platycephalus DBW-MVZ01 EU880317 EU880317 EU880317

Lyciasalamandra flavimembris MVZHerp230148 EU880318 EU880318 EU880318Salamandrina terdigitata MVZHerp178848 EU880332 EU880332 EU880332Taricha rivularis MVZHerp219804 EU880334 EU880334 EU880334Triturus cristatus MVZHerp230726 EU880336 EU880336 EU880336

Anura Ascaphidae

Ascaphus truei — AJ871087 AJ871087 AJ871087 Pipidae

Xenopus tropicalis — AY789013 AY789013 AY789013

Supplementary Material 4. The nucleotide substitution model selected for each data partition using the Bayesian information criterion (BIC) and corrected Akaike information criterion (AICc). The datasets Data-L and Data-S were used in genealogical analyses of the genus Hynobius. The dataset Data-MC was used for the molecular clock analysis.

Data-L Data-S Data-MC Partition

BIC AICc BIC AICc BIC AICc

12S TIM2+G GTR+G TPM2uf+G TVM+G TIM2+G TIM2+G

16S TIM2+I+G GTR+I+G TIM2+I+G GTR+I+G TIM2+G TIM2+G

tRNAs TVM+I+G TVM+I+G GTR+I+G GTR+I+G TIM3+G TIM3+G

2nd codon position TIM1+I+G TIM1+I+G HKY+I+G TPM2uf+I+G HKY+I+G GTR+I+G

1st codon position TIM2+I+G TIM2+I+G TIM2+I+G TIM2+I+G GTR+I+G GTR+I+G

3rd codon position GTR+I+G GTR+I+G GTR+I+G GTR+I+G TIM2+I+G TIM2+I+G

Ltsi-G Liua tsinpaensisBlon-G Batrachuperus londongensis

Hynobius retardatusHret-GHret-100

Hbou-101Hbou-1

H. boulengeri

Hkim-GHkim-100

H. kimurae

Hfor-100 H. formosanusHson-100 H. sonani

Hari-G1Hari-Gf2

H. arisanensis

Habe-100 H. abeiHtak-100 H. takedai

Hnig-100Hnig-G

H. nigrescens

Hlic-100Hlic-G

H. lichenatus

Htok-100Htok-G

H. tokyoensis

Hste-100 H. stejnegeri

Hyat-2Hyat-1

Hyat-29 H. yatsui

Hnae-100Hnae-1 H. naevius

Hhid-G H. hidamontanusHbou-100

Hgua-Gc1Hgua-G2

H. guabangshanensis

Hchi-G H. chinensisHmao-G H. maoershanensisHamj-100

Hamj-GH. amjiensis

Hyiw-100Hyiw-101

Hyiw-GH. yiwuensis

Hoki-100 H. okiensisHtsu-100

Htsu-GH. tsuensis

Hneb-GHneb-100

Hneb-9H. nebulosus

Hsp-92Hdun-100 H. dunniHque-102Hque-G1Hque-G2

H. quelpaertensis

Hyan-101Hyan-G

H. yangi

Hlee-100Hlee-Gy2Hlee-G1

H. leechii0.05 substitution/site

*

*

*

*

**

*

*

85100

*

*

*

88

**

98*

*

7393

*

80

98

7590 70

97

*

95

*

**

**

9977

*

* **

* *

*

*

*71

**

*

83

Supplementary Material 5. The genealogy of Hynobius inferred from a ML analysis of the mitochondrial dataset Data-S in which all haplotypes overlapped the fragment for 12S. Node support values of the Bayesian inference analysis using model parameters selected by the Bayesian information criterion are presented. Numbers beside nodes are ML bootstrap proportions ≥70 (above branches) and Bayesian posterior probabilities ≥70 (under branches). Nodes with ML bootstrap proportions ≥90 and Bayesian posterior probabilities ≥99 are indicated as asterisks. Vertical bars indicate species designation. The arrow indicates the node not recovered in the Bayesian inference analysis. Haplotype names correspond with names in Supplementary Material 1.

matrilineal genealogy of hynobius (caudata: hynobiidae) and a …labs.eeb.utoronto.ca/murphy/pdfs of...

Documents