matching. - mrs. kupronis - biology -...
TRANSCRIPT
FALL FINAL REVIEW Name:________________________Date:_______________Hour:_____
Short Answer.Answer the following questions by providing the correct answer in the space provided.
1. Is this cell division process Mitosis or Meiosis (circle)? Number the phases 1-10 in the order that they occur.
_______ _______ _______ _______ _______ _______ _______ _______ _______
2. Is this cell division process Mitosis or Meiosis (circle)? Number the phases 1-5 in the order that they occur.
______ ______ ______ ______ ______
3 . List the similarities and the differences between mitosis and meiosis in the Venn diagram provided
4. List some advantages and disadvantages of both sexual reproduction and asexual reproduction.
Mitosis Meiosis
Both
5. The substance that an enzyme reacts with which fits exactly into the active site is called a _________________.
6. The function of an enzyme can be lowered or altered by _________________.
7. This suffix is always found in the name of an enzyme _________________.
8. This term describes a chemical reaction which absorbs energy IN during the breakdown of an organic compound _________________.
9. This molecule is able to store potential energy in phosphate bonds that can be broken thereby releasing energy to cells for metabolism purposes _________________.
10. If a cell contains a nucleus, it must be a(n) ________________ cell.
11. Name an organism that is not composed of Eukaryotic cells __________________.
12. Name two organelles that are found in both prokaryotic and eukaryotic cells__________________.
Multiple Choice.Answer the following questions by choosing the most correct answer from the choices provided.
_________13. Which of the following statements about enzymes is true?a. Enzymes speed the reactions which occur during food digestion.b. Enzymes always slow the rate at which a chemical reaction occurs.c. Enzymes change the amount of product created during a chemical reaction.d. Only a small number of the body’s metabolic processes involve enzymes.
_________14. Look at the graph to the right. Which one of these lines is employing the use of an enzyme?a. Line Ab. Line Bc. Neither lined. Both lines are employing the use of an enzyme
Matching.Match the following definitions on the left to the words on the right.
_________15. Tiny dots or spheres that act like protein production factories
_________16. Network of narrow round tubes that detoxify poisons and produce lipids
_________17. "Packages" the cell materials for transport within or out of the cell like the Post Office, UPS, etc.
_________18. The command center of the cell where all cellular activities are coordinated.
_________19. Network of tubes that serve as a highway system for transportingproteins
A
B
a. Golgi Bodyb. Nucleolusc. Nucleusd. Ribosomese. Rough ERf. Smooth ER
Multiple Choice.Answer the following questions by choosing the most correct answer from the choices provided.
________20. What symptoms would you expect for a living organism which had major damage to all of its Lysosomes?a. Limited growth because of the cell’s inability to catch sunlight and make sugarsb. Limited growth because altered genetic instructions cause the production of nonfunctional proteinsc. Limited growth because large biomolecules are not broken down into small molecules needed by the celld. Lack of energy because the cell cannot process sugars into ATP
________21. What symptoms would you expect for a living organism which had major damage to all of its DNA?a. Limited growth because of the cell’s inability to catch sunlight and make sugarsb. Limited growth because altered genetic instructions cause the production of nonfunctional proteinsc. Limited growth because large biomolecules are not broken down into small molecules needed by the celld. Lack of energy because the cell cannot process sugars into ATP
_________22. What symptoms would you expect for a living organism which had major damage to all of its mitochondria?a. Limited growth because of the cell’s inability to catch sunlight and make sugarsb. Limited growth because altered genetic instructions cause the production of nonfunctional proteinsc. Limited growth because large biomolecules are not broken down into small molecules needed by the celld. Lack of energy because the cell cannot process sugars into ATP
__________23. Suppose a certain poison kills cells by blocking the pores in the nuclear membrane. Which of the following types of cells would NOT be affected by this type of poison?
a. plant cells b. bacteria cells c. human cells d. all types of cells would be affected __________24. Identify the main function of the nucleolus?
a. the command center that directs all cell activitiesb. manufactures the spindle used to help the cell divide into 2 cellsc. provides a storage location for digestive enzymes used by the celld. manufactures new ribosomes that are then used by the cell
___________ 25. A contagious disease causes the breakdown in a cell’s Rough ER function. As a result, which of the following biomolecules would be in a limited supply in the cell?
a. proteins b. ATP c. carbohydrates d. lipids
___________26. An inherited disease causes a person’s cells to make broken Smooth ER. As a result, which of the following cell consequences would be expected?
a. toxic byproducts will build up and there will be a shortage of new lipid moleculesb. there will be a shortage of digestive enzymes and new proteinsc. the cell will run out of ATP energyd. the cell will not be able to copy its genetic instructions
__________27. Ribosomes, the endoplasmic reticulum, and the Golgi apparatus work together to:a. convert solar energy to chemical energyb. pass on genetic informationc. break down and recycle materialsd. make and deliver proteins
Matching.For questions 28-38, tell whether the description or cell diagram best applies to Mitosis or Meiosis , BOTH or Neither
A = Mitosis B = Meiosis C = BOTH Mitosis & Meiosis D = Neither Mitosis & Meiosis
______ 28) allows for new gene combinations as paired chromosomes trade genes through “crossing over”
______ 29) functions in growth, repairing injuries, and replacing old body cells
______ 30) involves ripping “double” chromosomes into “single” chromosomes
______ 31) produces haploid sperm or eggs
______ 32) begins with a Diploid cell
______ 33) produces diploid daughter cells
______ 34) produces daughter cells with “single” chromosomes
_____ 35) produces daughter cells with “double” chromosomes
_____ 36) see diagram #12
_____ 37) see diagram #13
_____ 38) see diagram #14
_____ 39) see diagram #16
Use the NUMBERS of the terms below to answer questions #39-51 based off the cell pictures provided.
1. NUCLEUS 2. NUCLEOLUS 3. GOLGI BODY 4. SMOOTH ER5. ROUGH ER 6. RIBOSOMES 7. VACUOLE 8. CELL MEMBRANE9. CELL WALL 10. CENTRIOLES 11. LYSOSOME 12. CHLOROPLASTS13. CYTOPLASM 14. VESICLES 15. MITOCHONDRIA
48
3940 41
42
43 (little dots)
44 (whole structure)
45
47 46
12
13
14 15 16
DNA Replication
(2n)(2n)(n)
39. ___________ 40. ___________ 41. ___________ 42. ___________ 43. ___________
44. ___________ 45. ___________ 46. ___________ 47. ___________ 48. ___________
49. ___________ 50. ___________ 51. ____________
Short Answer.Answer the following questions by providing the correct answer in the space provided.
52. The term which describes a "water-loving" substance like the head end of a phospholipid molecule is ______________________.
53. This plasma membrane component is chemically "hydrophobic"________________________.
54. The term "selectively permeable" BEST describes this cell structure ______________________.
55. The process of moving a particle from high concentration to low concentration ([H][L]) through a membrane transport protein is called ______________________.
56. The diffusion of WATER across a selectively permeable membrane is ______________________.
57. When energy (ATP) is needed by the cell to move particles across a membrane it is called this type of transport ______________________.
58. What would happen to a soft-bodied slug if you placed it into a glass of pure water?______________________________________________________________________________________________________
______________________________________________________________________________________________________
___________________________________________________________________________________________________
45
43
47
4450
46
51 40
48
49
42
41
Short Answer.Study the cups of lemonade below to answer 59-61. Each glass of lemonade contains a chicken egg with the shell removed.
A B C
90 % H2O 55 % H2O 70 % H2O
10 % Solutes 45 % Solutes 30 % Solutes
75 % H2O 65 % H2O 30 % H2O
25 % Solutes 35 % Solutes 70 % Solutes
59. This cup/s of lemonade is a hypotonic solution relative to the chicken egg _______________
60. This cup/s of lemonade would result in a NET flow of water IN to the egg _______________
61. This cup of lemonade is currently in a state of Equilibrium _______________
Multiple Choice.Answer the following questions by choosing the most correct answer from the choices provided.
_________62. Identify the missing reactant for a Photosynthesis Chemical Reaction? H2O + ____ sugar + O2
a. Oxygen (O2) b. Carbon Dioxide (CO2) c. Nitrogen (N2) d. Ammonia (NH3)
_________63. Identify the missing reactant for a Cellular Respiration Chemical Reaction? Sugar + ____ CO2 + H2Oa. Oxygen (O2) b. Carbon Dioxide (CO2) c. Nitrogen (N2) d. Ammonia (NH3)
_________64. When given CO2, determine which of the following is necessary for plants to complete photosynthesis?a. Oxygen (O2) b. Ammonia (NH3) c. Glucose (C6H12O6) d. Water (H2O)
_________65. Identify which of the following is a necessary product of cellular respiration: a. Oxygen (O2) b. Ammonia (NH3) c. Glucose (C6H12O6) d. Water (H2O)
_________66. Which of these best explains the difference between the way animals and plants exchange gases with their environments?
a. Animals use only photosynthesis, while plants use both photosynthesis and respiration.b. Animals use only respiration, while plants use both photosynthesis and respiration.c. Animals use both photosynthesis and respiration, while plants use only respiration.d. Animals use both photosynthesis and respiration, while plants use only photosynthesis.
________67. Biology students are studying photosynthesis…which will cause the greatest increase in photosynthesis rate?a. increase water and oxygen c. increase carbon dioxide and sugarb. increase sugar and oxygen d. increase carbon dioxide and water
________68. Which of the following do the processes of Photosynthesis and Cellular Respiration NOT have in common?a. both involve the exchange of gases in a cell c. both require the input of energy from lightb. both use ATP molecules for temporary energy storage d. both occur in Eukaryotic cells
_________69. A student is collecting the gas given off from a plant in bright sunlight at a temperature of 27°C. The gas being collected is probably ______________________.
a. carbon dioxide b. oxygen c. hydrogen d. carbon monoxide
PO4
5-C SugarNitrogen base
_________70. Photosynthesis uses sunlight to convert water and carbon dioxide into:a. oxygen b. glucose c. ATP and oxygen d. oxygen and glucose
________71. Energy is released from ATP when:a. a phosphate group is added c. ATP is exposed to sunlightb. bonds between phosphate groups are broken d. adenine binds to ribose
_________72. Identify the molecule below which is broken down by cellular respiration to form water and carbon dioxide and release energy for the cell?
a. DNA b. oxygen c. glucose d. enzyme
________73. Photosynthesis is to chloroplasts as cellular respiration is to…a. chloroplasts b. cytoplasm c. mitochondria d. nucleus
________74. What is the correct equation for cellular respiration?a. 6O2 + C6H12O6 6CO2 + 6H2O c. 6O2 + C6H12O6 CO2 + 6H2Ob. 6CO2 + 6H2O 6O2 + C6H12O6 d. 6CO2 + 6H2O O2 + C6H12O6
________75. Which of the following is something that SPEEDS up the rate of photosynthesis?a. low water b. low temperatures c. excessive heat d. increased heat
________76. Which of the following SLOWS DOWN the rate of photosynthesis?a. increased water b. decreased glucose c. decreased light d. increased oxygen
________77. Which of the following is something that SPEEDS up the rate of cellular respiration?a. increased glucose b. decreased glucose c. extreme temperatures d. low water
________78. Which of the following SLOWS DOWN the rate of cellular respiration?a. increased water b. increased glucose c. increased light d. decreased oxygen
Short Answer.Answer the following questions by providing the correct answer in the space provided.
79. These two scientists proposed the double helix model of DNA ___________________ and ______________________.
80. Describe what happens in the final step in transcription: ________________________________________________________________________________________________________________________________________________________________________________________________________________________
81. What is the diagram of?
82. List three ways that RNA and DNA differ.
1. ___________________________________
2. ___________________________________
3. ___________________________________
#85 #86
Multiple Choice.Answer the following questions by choosing the most correct answer from the choices provided.
________83. Which of the following would NOT likely result in a mutation or change of DNA letter codes?a. replication of the DNA blueprint c. exposure to X-ray energyb listening to a loud stereo system d. exposure to strong chemicals in cigarette smoke
_________84. How many Nitrogen base letters are grouped in a CODON and an ANTICODON?a. 2 b. 20 c. 3 d. 64
_________85. The process of making an mRNA copy of a DNA gene code is called? (see diagram above #85)a. translation b. replication c. transcription d. cloning
________86. The process of converting a mRNA code into a specific protein chain? (see diagram above #86)a. translation b. replication c. transcription d. cloning
________87. What is the correct complementary DNA strand for: ACCAGTTAG?a) TGGTGATAG b) CGGCAGGTC c) TGGTCAATC d) TGGTCTTTC
________88. What is the correct complementary RNA strand for ACCAGTTAG?a) UGGUCUUUG b) UGGUCAAUC c) TGGTCAATC d) TGGTCUUTC
_________89. Which of the following is NOT part of an RNA nucleotide?a) ribose b) nitrogen bases c) phosphate group d) deoxyribose
_________90. When does DNA replication occur?a) after cell division b) before cell division c) anytime d) never
________91. Only DNA mutations in ___________ cells can be inherited by the next generation?a. brain b. sperm c. skin d. liver
________92. Which of the following is a nucleotide found in DNA?a. ribose + phosphate group + uracil b. deoxyribose + phosphate group + cytosinec. ribose + phosphate group + thymine d. deoxyribose + phosphate group + uracil
________93. What happens during the process of translation?a. transfer RNA is made from messenger RNA b. copies of DNA molecules are madec. the cell uses information from messenger RNA to make proteins d. Messenger RNA is made from DNA
Short Answer.Given the following DNA strand, answer questions 94-96: GGTACGGAGAACCTTTTACT
94. What would the complementary DNA strand be formed during replication? __________________________________________
95. What would the mRNA strand be that formed during transcription? _________________________________________________
96. What amino acid sequence would tRNA translate the mRNA into? (HINT: Don’t forget you have to find the codon that codes for “start” to begin and the codon that codes for “stop” to end) ______________________________________________________________________________________________________________________________________________________________________
97. A cell with 24 chromosomes undergoes Mitosis twice. Each daughter cell will contain ______chromosomes.
98. Two gametes, each containing 20 chromosomes, fuse during fertilization. The zygote will contain _____chromosomes.
99. A body or somatic cell (such as a skin cell) is said to be ________.