The Mechanism of Discoidin Domain Receptor 1 Mediated Vascular Calcification 

 

By  

Mark H. Wan   

A thesis submitted in conformity with the requirements  for the degree of Master of Science 

Graduate Department of Laboratory Medicine and Pathobiology University of Toronto 

                 

© Copyrighted by Mark H. Wan 2013  

 

ii 

 

The Mechanism of Discoidin Domain Receptor 1 Mediated Vascular Calcification  

Mark H. Wan  

Master of Science  

Graduate Department of Laboratory Medicine and Pathobiology University of Toronto 

 2013 

 ABSTRACT 

Introduction:  Activation  of  Runt  Related  Transcription  Factor  2  (RUNX2)  is  required  for 

transdifferentiation of Vascular Smooth Muscle Cells  (VSMCs)  into a  calcifying osteoblast‐like 

phenotype. Our  lab  showed  that deletion of Discoidin Domain Receptor 1  (Ddr1), decreased 

atherosclerotic vascular calcification in the Ldlr‐/‐ mouse.   

Hypothesis: DDR1 regulates RUNX2 activity by affecting microtubule organization during VSMC 

mediated calcification. 

Results:    Ddr1‐/‐  VSMCs  show  reduced  RUNX2  activity  when  compared  to  Ddr1+/+  VSMCs.  

Addition of the microtubule‐destabilizing agent nocodazole  inhibited both RUNX2 activity and 

nuclear  localization  in  Ddr1+/+  VSMCs.  Addition  of  the  microtubule‐stabilizing  agent  taxol 

rescued RUNX2 nuclear  localization  in Ddr1‐/‐ VSMCs. Despite this, Taxol was unable to rescue 

RUNX2 activity as it eliminated activity in both genotypes.  

Conclusion: These  findings  indicate  that under osteogenic  conditions, Ddr1 deletion  impedes 

the dynamic instability required for the maintenance of microtubule architecture. This prevents 

RUNX2 nuclear localization and transcriptional activation in VSMCs. 

 

iii 

 

DEDICATIONS 

“Affection without  sentiment, authority without  cruelty, discipline without aggression, humor without ridicule, sacrifice without obligation, companionship without possessiveness." 

 ‐ William E. Blatz 

 For my mother Lily and my father Jeremy, who truly embody everything it means to be 

great parents. Since the very beginning they poured their hearts and souls  into me, and their only wish is to see me happy. I could not have asked for better parents. They have always been my biggest fans and most fervent supporters. It is to both of them that I dedicate my thesis.                                

 

iv 

 

ACKNOWLEDGEMENTS    The accomplishment of this thesis was not my work alone, but only possible through the mentorship, support and help  from many good people.  In this section  I will try to adequately express gratitude to each of them.    Firstly,  my  work  and  this  thesis  would  not  be  possible  without  my  supervisor,  Dr. Michelle Bendeck.   Not only has she provided me with great  ideas to drive my work, but has always  driven  me  to  accomplish  my  best  with  much  enthusiasm  and  patience.  Michelle mentored me with utmost dedication and often going above and beyond what was expected of a supervisor to ensure I received the most out of my training.  I could not thank her enough for all  the  opportunities,  countless  documents  she  has  edited  and  the  protocols  she  has  read through.     Many thanks go out to Dr. James Eubanks who decided to take on the incredibly difficult task  of mentoring  an  enthusiastic  second  year  undergrad with  no  research  experience.  His tutelage has set the foundation for every subsequent research project I have taken on.    I am also  truly  thankful  to Dr. Scott Heximer  for  first providing me  the opportunity  to work in his lab as a summer student and a project student. He has always welcomed my many visits and chats and later served on my committee and provided much excellent advice crucial to this project.    Another  person who  deserves  thanks  is  Dr.  Steffen‐Sebastian  Bolz. While  I’ve  never been his  student  in any official capacity, he has often  taken an altruistic  interest both  in my career and development as a person. His constant advice and encouragement are much to be thankful for.    I  am  grateful  for  the  advice  I  have  received  from my  committee members Drs.  Rita Kandel and Craig Simmons  to  complete  this project. Dr. Simmons also helped  to provide me with  the many opportunities  in  the MATCH program which has certainly helped my graduate training.    This work also would not have been possible without my  friends and colleagues both past and present from the Bendeck lab. I cannot thank all of you enough for making this journey fun and for all the hours you all put in to help shape my training. Particular thanks go out to Dr. Guangpei  Hou,  whose  experimental  advice  and  technical  prowess  has  been  crucial  to  the completion of this project. Thanks also go out to Dr. Antonio Rocca, whose job was not to give any experimental help, answers to questions or mentorship, but gave them often and selflessly.     Finally,  this work would not have been possible without Drs. Cecilia Giachelli and Mei Speer  who  helped  to  troubleshoot  this  project  and  provide  us  with  our  platform  of investigation.  Thanks  also  go  out  to Dr. Renny  Franceschi who  provided  us with  the RUNX2 activity vector for my project. 

 

v 

 

TABLE OF CONTENTS  

ABSTRACT  DEDICATIONS 

ACKNOWLEDGEMENTS  iv 

TABLE OF CONTENTS  v 

LIST OF ABBREVIATIONS  viii 

LIST OF FIGURES  x 

INTRODUCTION  1 

ATHEROSCLEROSIS  1 

i Atherosclerosis 

ii The Role of Collagens in Atherosclerosis  2 

TYPE I COLLAGEN RECEPTORS  3 

i Integrins  4 

ii Discoidin Domain Receptors  4 

iii DDR Signalling  5 iv DDR Function In Smooth Muscle Cells  7 v DDR1 in Atherosclerosis and Calcification iv DDR2 in Bone Mineralization and Arthritis  10  VASCULAR CALCIFICATION  11 

i Types of Vascular Calcification  11 

ii Models of Vascular Calcification  13 

iii Mechanism of Vascular Calcification  15 

iv The Role of Phosphate in Vascular Calcification  18 

RUNX2  20 

i RUNX2 Structure and Function  20 

ii RUNX2 Transcriptional Targets  21 

iii Regulation of RUNX2  22 

iv RUNX2 in Vascular Calcification  23 

   

8 

iii 

ii 

 

vi 

 

MICROTUBULES  24 

i Structure and Organization of Microtubules  24 

ii Regulation of Microtubule Dynamics  25 

iii Microtubules and Nuclear Transport  26 

RATIONALE AND HYPOTHESIS  28 

MATERIALS AND METHODS  29 

Chemical and Reagents  29 

Smooth Muscle Cell Isolation and Culturing  29 

In Vitro Calcification Assay  30 

Calcium Quantification  31 

Reverse Transcription and Quantitative Real Time PCR  33 

Immunoblotting  34 

Immunocytochemistry  36 

Immunofluorescent Quantification  37 

Plasmid Preparation and Transformation  37 

Transfection  38 

Luciferase Assay  39 

Statistical Analyses  39 

RESULTS  40 

i DDR1 Deficiency Attenuates Calcification Potential of Vascular Smooth Muscle Cells  40 ii DDR1 Deficiency Alters Expression of Phosphate Handling Genes in Vascular Smooth Muscle Cells at an Early, but not Late Stage of Calcification  40 iii DDR1 Deficiency Alters the Expression of TenC at Late Stage Calcification, but not αSMA and Atf4  42 iv DDR1 Deficiency Results in Reduced RUNX2 Activity and Osteocalcin Expression  in Vascular Smooth Muscle Cells  43 v P38 Inhibition Reduces RUNX2 Activity and Osteocalcin mRNA Expression, but not RUNX2 Nuclear Localization in DDR1 Expressing Vascular Smooth Muscle Cells  45 

vi DDR1 Deficiency Impairs phosphoP38 Nuclear Localization  46 DDR1 Regulates RUNX2 Nuclear Localization and Activity by Modulating a Dynamically Unstable Microtubule Network in Vascular Smooth Muscle Cells  46 

 

vii 

 

DISCUSSION  49 

i DDR1 in Matrix Calcification  49 

ii Phosphate Handling in DDR1 Mediated Calcification  50 

iii Smooth Muscle Cell Phenotype in DDR1 Mediated Calcification  51 

iv DDR1 Mediated RUNX2 Activation  54 

v Microtubules in DDR1 Mediated RUNX2 Activity  55 

vi Future Directions  58 

vii Conclusions  61  

FIGURES  REFERENCES 

  86 

 

                        

62 

 

viii 

 

LIST OF ABBREVIATIONS  αSMA – Alpha Smooth Muscle Actin ADP – Adenosine Diphosphosphate ALP – Alkaline Phosphatase AMP – Adenosine Monophosphate APOE – Apolipoprotein E ARP – Acidic Ribsomal Protein ATP – Adenosine Triphosphate ATF4 – Activated Transcription Factor 4 BMP2 – Bone Morphogenic Protein 2 BSA – Bovine Serum Albumin CD40 – Clusters of Differentiation 40 cDNA – Complementary DNA CKD – Chronic Kidney Disease COL1A1 – Type 1 Collagen Alpha 1 COL1A2 – Type 1 Collagen Alpha 2 COX ‐ Cyclooxygenase Ct – Cycle Threshold DDR – Discoidin Domain Receptor DMSO – Dimethyl Sulfoxide DNA – Deoxyribo Nucleic Acid EC – Endothelial Cells ESRD – End Stage Renal Disease ER – Endoplasmic Reticulum ERK‐ Extracellular Related Kinase FAK – Focal Adhesion Kinase FGFR1 – Fibroblast Growth Factor Receptor 1 GDP – Guanosine Diphosphate GTP – Guanosine Triphosphate HDAC – Histone Deacetylase HIF1α – Hypoxia Inducible Factor 1 Alpha IBSP – Integrin Binding Bone Sialoprotein IGF‐1 – Insulin‐like Growth Factor 1 IL – Interleukin  LDL – Low Density Lipoprotein LDLR – Low Density Lipoprotein Receptor Mθ – Macrophage MAP – Non Motor Microtubule Associated Protein MAPK – Mitogen Activated Protein Kinase MEKi – MEK Inhibition MGP – Matrix GLA Protein MMP – Metallomatrix Proteases MTOC – Microtubule Organizing Center 

 

ix 

 

NFκB – Nuclear Factor Kappa B NO – Nitric Oxide iNOS – Inflammatory Nitric Oxide Synthase NPP1 ‐ Neuroecto Pyrophosphatase 1 OCN – Osteocalcin OCT4 – Octamer Binding Transcription Factor 4 ON ‐ Osteonectin OPN – Osteopontin OSE – Osteoblast Sensitive Element OxLDL – Oxidized Low Density Lipoprotein P38i – P38 Inhibition PBS – Phosphate Buffered Saline PBST – Phosphate Buffered Saline Tween 20 PCR – Polymerase Chain Reaction PFAv‐ Paraformaldehyde Pi – Inogranic Phosphate PiT – Sodium Dependant Phosphate Co‐Transporter PPi – Pyrophosphate PTH – Parathyroid Hormone qRT‐PCR – Quantitative Real Time PCR RBP – Retinoblastoma Protein RNA – Ribo Nucleic Acid  RLU – Relative Luminescence Unit ROS – Reactive Oxidative Species RTK – Receptor Tyrosine Kinase RUNX – Runt Related Transcription Factor  SHCA – Src Homology 2 Domain Containing A SMED ‐ Spondylo‐Meta‐Epiphyseal Dysplasia SOX9 – Sry Box 9 SSEA1 – Stage Specific Embryonic Antigen 1 STAT1‐ Signal Transducer and Activator of Transcription 1 TBST – Tris Buffered Saline Tween 20 TENC – Tenascin C TGFβ – Transforming Growth Factor Beta TNFα – Tumour Necrosis Factor Alpha VSMC – Vascular Smooth Muscle Cell VCAM – Vascular Cell Adhesion Molecule VEGF – Vascular Endothelial Growth Factor       

 

x 

 

LIST OF FIGURES  Figure 1: Diagram of Normal Artery and Artery Affected by Atherosclerosis 

Figure 2: Diagram of DDR1 Isoforms in Humans and Mice 

Figure 3: Diagram of Molecules Which Regulate Pi and PPi Levels 

Figure 4: Diagram of RUNX2 Isoforms in Humans and Mice 

Figure 5: Diagram of RUNX2 Stimulatory and Inhibitory Phosphoserine Residues  Figure 6: Diagram of Microtubule Dynamics  Figure 7: Ddr1‐/‐ VSMCs Show Decreased Calcifying Potential  Figure 8: Ddr1‐/‐ VSMCs Show Increased Pit‐1 mRNA Expression and Decreased Alp and Npp1 mRNA Expression at Early but not Late Stage Calcification  Figure 9: Ddr1‐/‐ VSMC Show no Change in αSMA Protein and Atf4 mRNA Expression, but Show Increased TenC mRNA Expression at Late but Not Early Stage Calcification  Figure 10: Ddr1‐/‐ VSMCs Show No Changes in RUNX2 Protein and mRNA Expression  Figure 11: Ddr1‐/‐ VSMCs Show Reduced RUNX2 Activity and Ocn mRNA Expression  Figure 12: Ddr1‐/‐ VSMCs Show Reduced RUNX2 Nuclear Localization  Figure 13: RUNX2 Activity and mRNA Levels of Osteocalcin are Sensitive to P38i in Ddr1+/+ 

VSMCs  Figure 14: Nuclear Localization of RUNX2 in Ddr1+/+ and Ddr1‐/‐ VSMCs Was Not Affected by MEKi or P38i  Figure 15: Phospho ERK1/2 Signalling is Decreased in Ddr1‐/‐ VSMCs at Late but Not Early Stage Calcification  Figure 16: PhosphoP38 Signalling is Decreased in Ddr1‐/‐ VSMCs at Late but Not Early Stage Calcification  Figure 17: Ddr1‐/‐ VSMCs Show Reduced PhosphoP38 Nuclear Localization   Figure 18: Ddr1‐/‐ VSMCs Show Increased Cell Spreading and Reduced α Tubulin Polymerization  

 

xi 

 

Figure 19: Ddr1‐/‐ VSMCs Show Reduced RUNX2 Co‐Localization with Microtubules  Figure 20: Taxol Increased RUNX2 Nuclear Localization in Ddr1+/+ and Ddr1‐/‐ VSMCs While Nocodazole, Prevented RUNX2 Nuclear Localization in Ddr1+/+ VSMCs  Figure 21: Nocodazole or Taxol Attenuated RUNX2 Activity in Ddr1+/+ and Ddr1‐/‐ VSMCs but Increased Ocn mRNA Expression   Figure 22: Proposed model of DDR1  regulation of RUNX2 activity  in VSMC

1 

 

 

INTRODUCTION 

ATHEROSCLEROSIS 

Atherosclerosis  begins with  dysfunction  of  the  endothelial  layer, which  leads  to  the 

increased  permeability of  the  endothelial  cells  (EC)1.    This  leads  to  the  accumulation  of  low 

density  lipoprotein  (LDL)  underneath  the  EC monolayer  of  the  arterial wall,  forming  a  fatty 

streak2.  This  results  in  activation  of  the  endothelial  layer, which  recruits monocytes3. Upon 

egression, monocytes, differentiate into macrophages (Mθs)4.  After the Mθs have entered the 

subendothelial  space,  they  phagocytose  low  density  lipoprotein  (LDL)  and  oxidize  LDL  to 

produce Oxidized LDLs (oxLDLs) 5. These cells thus become Mθ derived foam cells.  In addition, 

they also promote Vascular Smooth Muscle Cells (VSMCs) to migrate and proliferate from the 

medial wall  into the subendothelial space6(Figure 1). During this process, Mθs and VSMCs will 

actively synthesize matrix proteins such as fibrillar collagens7. These extracellular proteins serve 

many roles in atherosclerosis such as migratory lattices for the cells and also forming a fibrous 

cap which prevents plaque from rupturing7.  

As  the  lesion  grows  in  size,  the  vessel  lumen  attempts  to  accommodate  the  bulging 

plaque through eccentric grow,  if the  lesion growth exceeds that of vessel growth, the vessel 

becomes  increasingly  stenosed  or  occluded  at which  point  the  blood  can  no  longer  perfuse 

tissues distal to the blockage8. In a vulnerable plaque, matrix degrading enzymes along with the 

hemodynamic stresses from systole and diastole increasing the probability of rupture9.  

The  probability  of  rupture  is  increased  with  the  development  of  atherosclerotic  or 

intimal  calcification10,  which  develops  in  advanced  plaques.  This  process  begins  with  the 

development of a necrotic core as result of dead cell accumulation which  is susceptible to the 

2 

 

 

initiation of calcification11. As calcification occurs, the plaque is  destabilized from the increased 

focal  stress  points10.  Once  rupture  occurs,  the  clotting  cascade  initiates12.  The  result  is  a 

thrombus  overlaying  the  lesion  and  occluding  the  vessel12.  If  the  clot  travels  downstream  it 

becomes an embolus which can block  the blood  supply  to other  tissues12. Depending on  the 

location of the block, this can either lead to an infarction, stroke or a myocardial infarction12.  

 

The Role of Collagens in Atherosclerosis:  

Collagens  are  expressed  by  both VSMCs  and Mθs  during  atherosclerosis  and  are  the 

main  protein  constituent  of  atherosclerotic  plaques,  comprising  ~60%  of  the  total  protein13. 

These molecules are composed of three alpha helical chains containing Gly‐X‐Y repeats, where 

X and Y are usually proline or hydroxyproline residues14. Type  IV collagens  line  the basement 

membrane of ECs and VSMCs in normal vessels15. Upon plaque development, the expression of 

Type IV collagen increases and it serves as an attachment and migration substrate for both Mθs 

and VSMCs15. Other collagens such as types I and III fibrillar collagens, provide tensile strength 

to  the  plaque15.  They  are  expressed  in  low  amounts  in  the  early  plaque,  but  dramatically 

increase  in expression driving the advanced stages of plaque development15. Likewise Types V 

and VI  collagens  also  increase  in  expression with  plaque  age,  however  their  role within  the 

plaque is largely unknown15. Type VIII collagen is also highly upregulated during atherosclerotic 

development16. This was later found to responsible for the growth and migration of VSMCS and 

thus is a critical component of the injury process16. 

The  importance of  collagens  to atherosclerosis was  first hinted  in  the diverse  roles  it 

played in VSMCs and Mθs. Studies showed that inhibitors of collagen synthesis attenuate VSMC 

3 

 

 

migration,  which  indicated  that  VSMC  required  collagen  for  migration17.  Indeed  migration 

assays  which  were  later  performed  on  VSMCs  and Mθs  revealed  that  Types  I18  and  VIII19 

collagens are able to induce migration. While adherence to collagens by VSMCs is required for 

migration,  collagenase  activity  is  also  required  for  the process. Collagenases  are  required  to 

release focal adhesion matrix contacts and allow cell translocation17. Degraded type I collagen 

serves as a chemoattractant  for migrating VSMCs and Mθs20.  In addition,  type  I collagen also 

induces  monocyte  maturation.  Experiments  which  plated  monocytes  on  type  I  collagen 

increased cell spreading and increased expression of cell adhesion molecules21. Together these 

studies underscore the importance of collagens, and in particular type I collagen in the biology 

of VSMCs and Mθs, which are major cell types in atherosclerosis.  

Type  I  collagen  is  also  critical  to  the maintenance  of  the  structural  integrity  of  an 

atherosclerotic plaque. Type  I collagen, along with  type  III collagen,  form a  fibrous cap which 

provides plaque rupture20. As a result, plaque instability is induced by degrading type I collagen 

fibers at the shoulder regions of the atherosclerotic plaque22‐24. While type I collagen plays an 

essential role in stabilizing the plaque, studies on the type I collagenase MMP1 showed that its 

expression reduced atherosclerotic burden25. Furthermore, type I collagen may also contribute 

to plaque rupture, as it likely plays a major role in atherosclerotic calcification.   

 

TYPE I COLLAGEN RECEPTORS: 

Cell  signalling by  type  I  collagen  is mediated by  cell  surface  receptors. There are  two 

main  families  of  type  I  collagen  receptors,  the  integrins:  α1,  α2  and  β1  and  the  Discoidin 

Domain Receptors (DDRs).  

4 

 

 

Integrins: 

Integrins are a family of glycoproteins which form heterodimers consisting of one α and 

one β subunit.  In addition to binding type  I collagen,  integrins are also  involved  in assembling 

secreted  type  I  collagen monomers  into  fibrils26. Upon binding  to  type  I  collagen molecules, 

integrins are able to signal using intracellular signalling pathways. Since integrins do not contain 

any  kinase  activity,  they will  either  interact with  intracellular  kinases  such  as  SRC,  Integrin 

Linked Kinases (ILK) or Focal Adhesion Kinase (FAK)27. Crosstalk with Receptor Tyrosine Kinases 

(RTKs)  is  also  another method  integrins  use  to  elicit  signalling27.  Type  I  collagen  signalling 

through  integrins  has  been  linked  to  many  atherosclerotic  processes  such  as  mediating 

leukocyte adhesions, foam cell formation and smooth muscle cell proliferation28.  

 

Discoidin Domain Receptors:  

  In atherosclerosis, VSMCs and Mθs express DDRs, a class of collagen receptors29. DDRs 

are a group of RTKs characterized by an extracellular discoidin domain, which mediates binding 

to triple helical collagens30. The discoidin domain was first sequenced on the protein discoidin 

1, which is a lectin found on the slime mold Dictostelium Discoidium31. Since its first discovery, 

the discoidin domain has  later been  identified  in blood coagulation factors V and VIII and also 

neuropilins 1 and 2 which are involved in axonal guidance and angiogenesis32.  

DDRs  were  first  discovered  during  a  search  for  RTKs  that  were  highly  expressed  in 

malignant cancer cell lines30. To date two DDR genes have been identified in humans and mice, 

DDR1 and DDR230. DDR1 contains  five splice variants which are widely expressed named a‐e, 

5 

 

 

and an additional splice variant found in rat testes30 (Figure 2). Conversely, DDR2 has only one 

form30.  

Although there is considerable overlap between the ligands of the DDRs, each receptor 

is  able  to  bind  its  own  repertoire  of  triple  helical  collagens.  DDR1  binds  types  I‐V  and  VIII 

collagens, while DDR2 binds types I‐III and X collagen30.  

 

DDR Signalling: 

DDR1  phosphorylation  leads  to  downstream  signalling  and  activation  of  cellular 

pathways. The DDR proteins facilitate binding through an N terminal discoidin domain which is 

attached  to  the  extracellular  stalk  domain,  a  transmembrane  domain  and  a  cytoplasmic 

tyrosine  kinase  domain  at  the  C  Terminus30.    Upon  binding  triple  helical  collagen  and 

dimerization,  the  intracellular kinase domains autotransphosphorylate each other and  initiate 

signalling30.  In  comparison  to  most  RTKs,  DDR1  have  delayed  phosphorylation  kinetics. 

Depending on the cell type, maximum phosphorylation can occur at an hour to several hours 

after initial stimulation with collagen33. This is a process that is dependent on cell adherence, as 

cells grown in suspension typically show peak phosphorylation at much earlier time point than 

cells grown on a monolayer34. Similarly, DDR2 receptor phosphorylation kinetics are also slow 

and occur in a process which is not well understood35.  

Studies also show that DDR1 crosstalks with  integrin, G‐protein coupled receptors and 

WNT signalling pathways in order to fine tune specific cell responses to ligand activation36, 37.  A 

recent proteomic  study determined  that DDR2 may cross  talk with  Insulin Receptor38. Ligand 

6 

 

 

activation  of  DDRs  are  also  cell  type  dependent  and  is  likely  the  result  of  differences  in 

intracellular adaptors.  

DDR1 has been shown to interact with several adaptor proteins such as Src homology 2 

containing  protein  A  (SHCA)39,  NCK2,  and  CAS  which  are  recruited  to  DDR1  upon 

phosphorylation  to  facilitate  signalling40. However, not all adaptors are  recruited upon DDR1 

activation.  Adaptors  such  as WW‐domain  containing  protein  141  and  Protein  phosphatase  1 

regulatory  subunit42  dissociate  from  DDR1  upon  activation,  followed  by  the  activation  of 

Mitogen  Activated  Protein  Kinase  (MAPK)  ERK  signalling  pathways  in  HEK  293  cells  upon 

stimulation with  type  IV collagen.   DDR1  regulation of  the MAPK Extracellular Related Kinase 

1/2  (ERK1/2) has been  identified with many DDR1 processes. DDR1  signalling  is  important  in 

regulation of mouse embryonic stem cells  in an undifferentiated state by type  I collagen43.  In 

this  study,  the presence of DDR1 was  responsible  for maintaining  the expression of NANOG, 

Octamer Binding Transciption Factor 4(OCT4) and Stage Specific Embryonic Antigen 1 (SSEA‐1). 

This process  is dependent on DDR1 signalling through ERK1/2. DDR1 –ERK1/2 signalling  is also 

required for the upregulation of MMP10 expression  induced by type  I collagen  in human  lung 

fibroblasts44.  Furthermore, our own  laboratory discovered  that DDR1 phosphorylates ERK1/2 

upon stimulation with type I collagen in VSMCs18. ERK1/2 has also been linked as a downstream 

component  of DDR2  signalling  in  RUNX2  activation45.  In  a  study  on mouse  osteoblasts,  the 

authors  showed  that  DDR2  null  cells  showed  decreased  calcification,  Ocn  expression  and 

RUNX2 activity46. P38  another MAPK has also been  linked  to DDR1  signalling  in  various  cells 

types. In mouse microglia, type I collagen  induced DDR1 signalling through P38  is required for 

inflammatory induction of Clusters of Differentiaation 40 (CD40), Cyclooxygenase 2 (COX2) and 

7 

 

 

MMP947. DDR1 is also important in the P38 induction of Nitric Oxide (NO) production in murine 

macrophages  through  the  upregulation  of  Inflammatory Nitric Oxide  Synthase  (iNOS)48.  The 

inflammatory role of DDR1‐P38 signalling is further explored in a study demonstrating that it is 

crucial for the activation of Nuclear Factor Kappa B (NFκB)  in mouse monocytes49. As ERK and 

P38 signalling are fundamentally important to functioning of many different pathways in many 

different  cell  types, DDR1  signalling may  contribute  to a number of  key processes  in normal 

function and in pathology.  

 

DDR Function in Smooth Muscle Cells 

  Our  laboratory  discovered  that,  denudation  of  DDR  deficient mice  showed  reduced 

intimal thickening compared to WT mice50. This suggests an important role of DDR1 in vascular 

injury. Later it was found that both DDR1 and DDR2 are present in the atherosclerotic plaques 

of humans and primates51. These studies implied an important role of DDR1 in VSMCs. Indeed, 

VSMCs were later found to express a high level of DDR1 in vivo and in vitro. In DDR1 KO VSMCs, 

migration,  proliferation  and  adhesion were  significantly  decreased52.  In  addition,  KO  VSMCs 

also showed decreased expression of proatherogenic MMPs 2 and 952. These deficiencies in the 

DDR1  KO  cells  were  later  found  to  be  rescued  with  DDR1  transfection.  These  studies  all 

suggested that DDR1 played an important role in VSMCs during atherosclerosis. 

  Studies on DDR2  in VSMCs by others have demonstrated that hypoxia  induces the P38 

signalling pathway to promote MYC and Myc Associated factor X binding to DDR2 promoter53. 

The process  increases the expression of DDR2 and  increases the migration of VSMCs. Another 

study  furthering  the understanding of  this mechanism  showed  that TNFα also  contributes  to 

8 

 

 

DDR2 upregulation during VSMC migration54. The process by which DDR2 facilitates migration 

in VSMCs  is revealed to be dependent on MMP2 activity.  In support of DDR2s migratory role, 

another  study  also  showed  that DDR2  functions  to  reduce  Focal Adhesion  Kinase  activity  in 

VSMCs55.  Despite  these  identified  migratory  roles  of  DDR2,  similar  studies  carried  out  to 

investigate the role of DDR2 in VSMCs by our laboratory showed that deletion of Ddr2 did not 

affect  cell migration,  proliferation  or  migration  in  VSMCs56.  These  studies  may  reflect  the 

differences of the model system used to study DDR2 function. Our  lab studied DDR2 function 

through  the  use  of  carotid  VSMCs  from  DDR2  KO mice, while  the mentioned  studied  used 

VSMCs  from  rat  aorta.  Furthermore,  the  aforementioned  studies  performed  migratory 

experiments in hypoxia whilst our study was carried out under normoxia.  

 

DDR1 in Atherosclerosis and Calcification:  

Studies by our  laboratory have demonstrated  that DDR1 has  important  and different 

functions  in  VSMCs  and  monocytes  in  atherosclerosis.  DDR1  expression  and  function  was 

investigated  in  the  Ldlr‐/‐ model  of  atherosclerosis  57.  Ddr1‐/‐;  Ldlr‐/‐ mice  exhibited  smaller 

plaques that were rich  in fibrous proteins such as fibrillar collagen and elastin compared with 

Ddr1+/+; Ldlr‐/‐ mice 29. These studies also revealed that the increase in fibrous proteins was due 

to  increased synthesis of matrix molecules such as  type  I collagen by VSMCs.  It was  revealed 

that Ddr1‐/‐;  Ldlr‐/‐ mice had decreased decrease  in  the expression of Monocyte Chemotactic 

Protein 1  (MCP‐1) and Vascular Cell Adhesion Molecule 1  (VCAM‐1). Furthermore,  this  study 

also indicated that Ddr1‐/‐; Ldlr‐/‐ Mθs showed decreased mRNA expression of MMP2, 8, 13 and 

14. These results suggested that DDR1 deficiency in Mθs prevented plaque invasion. 

9 

 

 

A  later  study  by  our  laboratory  confirmed  that Mθs  deficient  in DDR1  have  reduced 

invasion into the plaque as a result of decreased attachment to type IV collagen and response 

to Monocyte  Chemoattractant  Protein  1  (MCP‐1)58. Overall  these  experiments  showed  that 

Mθs  deficient  in DDR1  reduced  atherogenesis. While  the  function  of DDR1  indicates  that  it 

functions  to  increase attachment and plaque  invasion  in Mθs,  studies  carried out by our  lab 

demonstrate other functions in VSMCs. A later study carried out by our lab demonstrated that 

DDR1  deficiency  in  the  vessel  increases  both  matrix  production  and  plaque  size29.  This  is 

presumed to be carried out by VSMCs which show  increased synthesis of procollagen  I mRNA 

and also had a net  increase of MMP and net decrease of TIMP mRNA production  in the DDR1 

deficient VSMCs, which allowed for increased matrix production and remodelling in the plaque.  

Taken  together  these  studies  indicate  that  DDR1  plays  important  roles  in  modulating  the 

infiltration  and  inflammation  of  Mθs  and  suppressing  matrix  remodelling  and  synthesis  in 

VSMCs. 

Another hallmark of atherosclerosis which was discovered  in  the course of  studies on 

DDR1  in atherosclerosis showed that Ddr1+/+; Ldlr‐/‐ mice had  indications of  increased markers 

of  chondrogenic  differentiation,  Sry Box  9  (SOX9)  and  type  X  collagen,  along with  increased 

propensity  to  calcification  of  the  atherosclerotic  plaques.  By  contrast,  Ddr1‐/‐;  Ldlr‐/‐  mice 

showed decreased plaque calcification59. Together, these studies indicated that DDR1 plays an 

important functional role in atherogenesis and the development of atherosclerotic calcification. 

 

 

10 

 

 

DDR2 in Bone Mineralization and Arthritis: 

  DDR2  has  been  implicated  in  several  studies  related  to  bone  development  and 

osteoarthritis.  The  role  of DDR2  in  bone  biology was  first  hinted when  a  screen  of  RTKs  of 

human  osteoarthritis  chondrocytes  which  showed  an  upregulation  of  the  DDR2  mRNA 

transcript when  compared  to  un‐diseased  chondrocytes60.  Indeed  later  studies  showed  that 

DDR2  expression  is  increased  in  the  cartilage  joints  of  the  collagen  type  IX  and  XI  deficient 

mouse models of osteoarthritis61. It was also found in these studies that DDR2 when bound to 

type  II  collagen  acted  to  induce  the  expression  of MMP13  in  these  chondrocytes, which  is 

hypothesized  to  contribute  to  the  mechanism  of  osteoarthritis62.  Further  evidence 

demonstrating  the  importance  of  DDR2  in  chondrocyte  biology  is  revealed  that  upon 

stimulation with  type  II  collagen, DDR2 was  able  to upregulate  the mRNA expression of  the 

proinflammatory cytokine IL‐660. This process was dependant on DDR2 signalling through ERK, 

P38 and Nuclear Factor κ B (NFκB). 

  The consequence of DDR2 mutation was also  identified with a clinical manifestation  in 

calcification  abnormalities.  Spondylo‐meta‐epiphyseal  dysplasia  (SMED)  is  a  autosomal 

recessive disease characterized by short limbs and a host of skeletal abnormalities. This disease 

was  recently mapped  to mutations within  the Ddr2  gene which  affected  the  tyrosine  kinase 

domain of  the  receptor63. Although  the mechanisms have not been  identified,  it  is  likely  that 

these mutations affect DDR2 signalling. The role of DDR2 in calcification was solidified in a study 

demonstrating  that DDR2 signals  to activate RUNX2  through ERK signalling  in chondrocytes45. 

Together, these studies indicate an important role for DDR2 in calcification. Although DDR1 has 

11 

 

 

not  been  studied  as  extensively  in  the  context  of  calcification,  the  similarities  between 

receptors suggest a probable role of DDR1 in calcification. 

 

VASCULAR CALCIFICATION 

Types of Vascular Calcification: 

There are three main types of vascular calcification: 1) intimal calcification which is seen 

in  patients  with  atherosclerosis,  2)  medial  calcification,  also  known  as  Monckeberg’s 

arteriosclerosis and 3)  calciphylaxis, a  systemic  calcification of  the vascular  system. Although 

these are separate and distinct forms of vascular calcification, there is frequent overlap of these 

diseases in pathology where several forms of calcification can be found together64. Such is the 

case when medial calcification occurs with atherosclerotic calcification.  

Atherosclerotic  calcification  is  a  feature  of  advanced  atherosclerotic  plaques,  and 

manifests as calcification in the intimal layer65. Although there is limited evidence showing that 

calcification may occur as a result of circulating progenitors with a calcifying phenotype, most 

evidence  suggests  that mineralization  in  atherosclerosis  is  affected  by  two major  cell  types, 

VSMCs66 and Mθs67. Although both cell types are found adjacent to the calcified region, there is 

no evidence that Mθs transdifferentiate  into an osteoblast phenotype under these conditions. 

VSMCs are the main candidate for driving mineralization as they are phenotypically plastic and 

derive from the same mesenchymal precursor cells as osteoblasts68, 69. Evidence suggests that 

the expression of RUNX2 promotes VSMC conversion to an osteochondrogenic phenotype70. In 

mature  atherosclerotic  calcifications,  the  tissue  can  appear  as bone71.  In extreme  cases,  this 

tissue is complete with vascularisation and a hematopoietically active marrow71. 

12 

 

 

Medial  calcification of  the arteries can happen as an entity by  itself, or as a  result of 

intimal  calcification  in  advanced  atherosclerosis72.  When  medial  calcification  occurs  in 

association  with  atherosclerosis,  it  usually  lies  in  the  medial  layer  adjacent  to  the 

atherosclerotic calcification. Histologically, hydroxyl apatite crystals depositions occur along the 

internal elastic lamina. While the mechanism of medial calcification is not as well defined as in 

atherosclerotic calcification, current work suggests that RUNX2 plays a role.  The consequences 

of  the  medial  calcification  result  in  the  hardening  of  the  arterial  wall  known  as 

arteriosclerosis10.  As  a  result,  pulse  pressure  is  increased  and  therefore  chronic  stress  can 

further exacerbate kidney failure in addition to heart failure10. 

Calciphylaxis  is  another  form of  vascular  calcification  that occurs  in  the medial  layer. 

Similar to medial calcification, calciphylaxis may also arise as result of End Stage Renal Disease 

(ESRD)10.  In addition to ESRD, calciphylaxis may also arise from non‐uremic disease conditions 

such as hyperthyroidism, liver cirrhosis, inflammatory diseases such as rheumatoid arthritis and 

Crohn’s disease or as a secondary complication of chemotherapy10.   Despite their similarities, 

calciphylaxis and medial calcification represent vastly different pathologies. Calciphylaxis refers 

to the systemic calcification of all blood vessels at the medial layer and non‐bone extravascular 

tissues, whereas medial calcification occurs primarily in the major arteries10. As the calcification 

is systemic,  this  leads  to poor perfusion of  the  tissues  resulting  in  tissue necrosis10. Also,  the 

hardened blood vessels which can also lead to thrombosis and increased blood pressure, which 

ultimately  results  as  increased  pressure  on  cardiac  pulmonary  system  and  ultimately  heart 

failure.  

 

13 

 

 

Models of Vascular Calcification: 

Calcification  is studied using models which emulate the pathophysiologic perturbations 

which occur that ultimately  lead to calcification. The  factors which result  in calcification stem 

from  a  hormonal  imbalance  such  as  high  levels  of  Parathyroid  Hormone  (PTH), 

hyperphosphatemia, loss of calcification inhibitors, drug usage and as a secondary complication 

of a disease; because of this most models of calcification perturb either one or more of these 

factors.  In  vivo  studies  have  largely  been  carried  out  in  rabbit,  rat  and mice, while  in  vitro 

studies have been carried out on VSMCs, and organ cultures of varying species origin73. As it is 

relatively easy to genetically manipulate a mouse, various genes which inhibit calcification such 

as Fetuin A74, Matrix GLA Protein  (MGP)75 or Osteopontin  (OPN)76 have been knocked out  in 

order to produce models of calcification. However, because some of these genes are expressed 

in most  tissues, extraskeletal mineralization  is not  limited  to vascular  tissue, but  is extensive 

throughout the soft tissues of the animal. This can be addressed by using a smooth muscle cell 

specific  gene  such  as  SM22α  to  drive  the  cre  lox  recombinase  system77.  Genes  with  high 

penetrance  such  as  Feutin  A  KO  animals  can  produce  vascular  calcification without  further 

manipulation78. However animal models making use of genes with  lower penetrance  such as 

OPN  knockout mice,  need  to  be  combined with  other  perturbations  in  order  to  produce  a 

vascular calcification model78.  

A  commonly  used  disease  model  to  study  calcification  is  atherosclerosis.  Most 

atherosclerotic calcification studies are performed by feeding animals a high fat and cholesterol 

diet to develop atherosclerosis. As such there have been many studies on atherosclerosis using 

this model with  rabbits,  rats, and mice. Mice however, are  inherently  resistant  to developing 

14 

 

 

atherosclerosis  even  with  an  atherogenic  diet  79.    As  a  result,  an  atherogenic  diet  is 

accompanied with genetic manipulation   deleting either the LDL receptor or Apolipoprotein E 

(APOE), by deleting the LDL receptor or APOE you are able to increase the circulating levels of 

cholesterol  to  promote  atherosclerosis79.  As  the  animals  develop  atherosclerosis  and  the 

complications  that  come with  it,  calcific deposition will occur  in  the  intima of  the plaque.  In 

addition, various factors can also be studied while the animals are undergoing calcification.  In 

mice, genes can be manipulated to study their affects on atherosclerotic calcification.  

Medial calcification commonly occurs in association with ESRD, because this is the case, 

animals models  of  Chronic  Kidney  Disease  (CKD)  combined with  a  high  phosphate  diet  are 

commonly used  to study medial calcification. Renal  failure  is most commonly  induced by  the 

5/6 nephorectomy, which  involves  the  surgical  removal of one  kidney along with  the partial 

ablation of  the  remaining  kidney either by partial nephorectomy, posterior or  anterior  renal 

artery ligation or by electrocauterization on the cortex of the remaining kidney80. As a result of 

the reduced nephron number combined with the high phosphate diet, the animals will develop 

severe hyperphosphatemia80. Thus, the resulting process promotes calcification of the arteries. 

Due to the complexity of this surgery it is usually done in larger animals such as rabbits and rats, 

but there has been some success using this technique with mice81. 

The effects of high phosphate can also be studied in VSMCs82 and aortic ring sections83 

in tissue culture. Prior to studies on calcification of vascular tissues these cultures were used to 

stimulate mineralization in long bones, calvaria, and cells of the osteoblast lineage84. The major 

benefit of  this  technique  is  the  relatively  fast endpoint  in which you can acquire data. These 

cultures typically  involve supplementation of phosphate either  in the  inorganic form as Pi85 or 

15 

 

 

as β Glycerol Phosphate86. In addition the process can be accelerated with supplementation of 

ascorbic acid  to  induce matrix synthesis  to provide  the calcifying cells with an osteoid87. Also 

dexamethsone  can be added which helps  to  inhibit  the VSMC proliferation and promote  the 

ossifying phenotype88. As a result,  in vitro assays provide the potential to study the effects of 

cytokines, various ligands, extracellular matrix and other extracellular forces such as shear and 

tension which can provide mechanistic cues for vascular calcification. 

 

Mechanisms of Vascular Calcification: 

The mechanism for vascular calcification was long thought to be the passive deposition 

of hydroxy apatite crystals in the blood vessel walls; while this may hold true for calciphylaxis, 

more  recent  evidence  shows  that  both  atherosclerotic  and medial  calcification  is  an  active 

cellular osteogenic process10.  This process is regulated by the osteochondrogenic transcription 

factor RUNX2 and regulation of its activity89.  

During atherosclerotic calcification, the VSMCs respond to many different stimuli which 

can  promote  osteochondrogenic  differentiation. Oxidized  LDL  particles  (OxLDL) which  are  in 

abundance within  the  atherosclerotic  plaque  are  known  to  activate  Toll  Like  Receptor  2  to 

activate  the  osteogenic  process90.  In  addition,  because  atherosclerosis  is  an  inflammatory 

vascular disease, many  inflammatory  cells  such  as macrophages  and other  leukocytes which 

secrete  cytokines  such  as  IL691  and  TGFβ92  are  a  part  of  the  inflammatory  process.  These 

molecules  have  shown  to  elevate  the  activity  of  RUNX2  and  ultimately  calcification.  Other 

factors  such  as  cell death  from  apoptosis  and necrosis  also  contribute  to  calcification. Upon 

death  these  cells  leave  behind  apoptotic  bodies, which  can  provide  the  seeding  points  for 

16 

 

 

amorphous  calcium  phosphate  deposition11.  Not  only  do  amorphous  crystals  provide  the 

primary  seed  sites  for  apatite  crystals,  but  the  crystals  themselves  are  able  to  promote 

osteochondrogenic  transdifferentiation  through an unknown process93. Furthermore, physical 

factors such as shear stress are able to regulate calcification as both regions of  low shear and 

low  shear  in  vitro  environments  promote  osteogenic  conversion  in  cells94.   Ultimately  these 

factors result  in VSMCs transdifferentiation  into an osteochondrogenic phenotype. These cells 

which are the precursors to chondrocyte and osteoblast‐like cells synthesize a matrix which  is 

permissive  to  calcification  called  the  osteoid95.  This matrix  is  rich with  type  I  collagen  and 

calcium  binding  proteins  such  as  Osteocalcin  (OCN),  Osteonectin  (ON)  and  OPN96.  At  later 

stages  it  is hypothesized  to mirror endochondral ossification,  in which  the  chondrogenic‐like 

cells  die  while  the  osteoblast‐like  cells  predominate97.  The  osteoblast‐like  cells  cause 

mineralization of  the osteoid by  secretion of  calcium phosphate  containing matrix  vesicles98. 

During this period, osteoblast‐like cells produce proteins such as ALP99 and PiT‐1100 in order to 

increase  intracellular  Pi  levels  and  mineralize  the  matrix.  Initially  this  matrix  is  largely 

amorphous calcium phosphate, over time the amorphous calcium phosphate  is replaced with 

hydroxyl apatite and later develops into bone‐like tissue101.  

In contrast to atherosclerotic plaque calcification, medial calcification largely stems as a 

secondary  complication  from  a  pathological  state.  These  states  include  atherosclerosis, 

parathyroidism, diabetes mellitus and hyperphosphatemia  from ESRD   caused by CKD  10. The 

most  common  cause  of medial  calcification  is  CKD102.  In  CKD,  the  function  of  the  kidney  is 

compromised  and  it  is  unable  to  secrete  phosphate  leading  to  elevation  of  phosphate 

concentration  in  the  serum,  the  resulting hyperphosphatemia  leads  to medial calcification103. 

17 

 

 

While  it  was  previously  thought  that  medial  calcification  occured  through  an  osteogenic 

independent  process,  recent  studies  by  Giachelli  and  colleagues  have  demonstrated  that 

activation of the RUNX2 osteogenic gene program occurs in medial calcification81. 

 Medial  calcification  can  also  arise  as  a  result  of  deficiency  of  tissue  inhibitors  of 

calcification.  Genetic  deletion  of  tissue  inhibitors  of  calcification  such  as  Neuroecto 

Pyrophosphatase 1  (NPP1)104, and MGP105  results  in ectopic calcification  in both humans and 

mice. Furthermore, studies show that deficiency of circulating inhibitors such as Feutin A74 and 

Klotho106 also promote medial calcification. The use of drugs which prevent inhibiting function 

may also be the cause of medial calcification. Warfarin is a drug that is commonly used to treat 

anticoagulation  in  patients  with  cardiovascular  problems.  It  works  by  preventing  the  γ 

carboxylation of several clotting  factors. As MGP also requires γ carboxylation, this process  is 

hindered as well107.  

Although  atherosclerotic  and  medial  calcifications  are  initiated  through  separate 

pathways,  both  ultimately  converge  upon  the  expression  of  RUNX2. With  respect  to medial 

calcification,  whether  RUNX2  contributes  to  the  calcification  process  or  is  the  result  of 

activation  by  calcium  phosphate  depositions  is  unclear.  As  in  medial  calcification,  calcium 

deposition occurs in association with degraded elastin fibers in the internal elastic lamina, and 

not  reminiscent  of  the  osteoid  synthesis  in  atherosclerotic  calcification108.  However,  in 

atherosclerotic  calcification,  studies  have  demonstrated  that  the  activation  of  RUNX2  is 

indispensible for osteochondrogenic differentiation109.  

 

 

18 

 

 

The Role of Phosphate in Vascular Calcification: 

Hyperphosphatemia  leads  to medial calcification and calciphylaxis and can exacerbate 

atherosclerotic  calcification10.  Previously,  it  was  thought  that  hyperphosphatemia  causes 

calcification  primarily  due  to  the  increased  inorganic  phosphate  (Pi)  available  for  calcium 

phosphate  formation. While  this  is  the case  for calciphylaxis,  later  studies,  revealed a crucial 

role for Pi110. Furthermore, culturing VSMCs in high Pi resulted in a VSMC phenotypic change to 

an osteoblastic/chondrogenic phenotype which was accompanied by the expression of RUNX2 

and markers of calcification such as OCN, OPN and Alkaline Phosphatase (ALP)69. Despite this, 

the precise mechanism by which Pi is able to activate the osteogenic gene program is unknown. 

Current evidence demonstrates that the propensity of vascular calcification is dependent upon 

the careful balance of Pi and pyrophosphate (PPi)111 (Figure 3). 

PPi is an inhibitor of calcification that acts by inhibiting the nucleation and propagation 

of hydroxy apatite crystals111. The intracellular levels of PPi in VSMCs are determined largely by 

the expression of NPP1112. The primary function of NPPs is to catabolise ATP to produce PPi104. 

In healthy vascular  tissue NPP1  is highly expressed and  its  levels are  reduced during vascular 

calcification113.  In VSMCs, NPP1  is  the major protein  that  carries out  the  reaction  converting 

ATP  to AMP and PPi114. NPP1 deficiencies  in mice have manifested  themselves  in severe soft 

tissue  calcification,  arterial  calcification  and  spontaneous  aortic  calcification104.  In  humans, 

NPP1 deficiency has been  linked to  infantile medial arterial calcification115. As NPP1 competes 

with Alkaline  Phosphatase  (ALP)  for  the ATP  substrate,  it was  thought  that NPP1  prevented 

calcification by competing for ATP. However, studies showed that PPi alone was able to prevent 

nucleation of calcium phosphate crystals in cell culture116. These studies revealed that balance 

19 

 

 

of  PPi  and  Pi  levels  are  important  in  ultimately  regulating  calcification  and  not  substrate 

competition between NPP1 and ALP. Furthermore, the PPi which  is produced by NPP1 can be 

hydrolyzed  into  two  free  Pi  molecules  by  ALP,  negating  the  competition  hypothesis117.  In 

addition to   ATP and PPi, ALP  is also able to generate free Pi by the hydrolysis of ADP, AMP118 

and phosphate groups on phosphoproteins119. Unsurprisingly, ALP has been observed  in many 

studies to be  indispensible  in VSMC mediated calcification120, 121.   ALP  in normal physiology  is 

required  for  osteoblasts  to  create  bone  tissue122. High  serum  concentration  of  ALP  is  often 

indicative  of  rapid  bone  development,  such  as  in  childhood123.  ALP  deficiency  in  human 

osteoblasts causes hypophosphatasia often with fatal results124. If a patient with ALP deficiency 

survives to early childhood, they will have a severe form of rickets and early loss of deciduous 

teeth.  

Another major determinant of intracellular Pi levels is the transport of Pi into the VSMC. 

Intracellular  phosphate  transport  is mediated  primarily  by  the  family  of  Sodium  Dependant 

Phosphate  Co‐Transporters  (PiTs)125.  Type  I  and  type  II  PiTs  are  expressed  primarily  in  the 

kidney and  intestinal epithelium126, while type  III PiTs are  less tissue specific and play a major 

role  in Pi transport within VSMCs127. There are two transporters within the type  III class; they 

are PiT‐1 and PiT‐2128. PiT‐1 is highly expressed in VSMCs, but PiT‐2 is expressed to a far lesser 

degree128.  The  importance  of  PiT‐1  to  vascular  calcification was  first  revealed when  it was 

discovered  that  PiT‐1  is  necessary  for  VSMC  to  osteochondrogenic  conversion  in  high  Pi 

treatment129. 

Together these studies on NPP1, ALP and PiT‐1 underscore the importance of Pi in VSMC 

mediated calcification (Figure 3). 

20 

 

 

RUNX2 

RUNX2 Structure and Function: 

The Runx2 gene contains two promoters which give rise to two isoforms, named type I 

and  type  II130.    These  isoforms  contain  an  identical  DNA  binding  domain130  ,an  α  helical 

structure  for microtubule binding and  translocation and a nuclear  targeting matrix  (NTM)  131.  

Both RUNX2 isoforms also contain a 200 amino acid sequence called a PEST domain (Figure 4) 

131.  The  PEST  domain  is  destabilizing  and  is  hypothesized  to  facilitate  degradation  through 

either the proteosome132 or calpain pathways133.   

These  isoforms differ  in the N‐terminus134. The type  I N‐terminus   contains the MRIPV 

amino acid sequence131, 135.  In type  II RUNX2, the N‐terminus contains the MASNS amino acid 

sequence  instead,  133. How  the N  terminus affects  isoform differences  is unknown.  136 During 

early  calcification  the  type  I  isoform  is  favoured,  but  as  calcification  progresses,  type  II 

expression  predominates134.  It  is  not  known  how  or why  this  process  occurs,  but  both  are 

important for bone development. 

RUNX2  functions  in  the ossification process by committing mesenchymal stem cells  to 

become  osteochondrogenic  cells137.  Although  RUNX2  can  bind  DNA  as  a monomer,  RUNX2 

must bind DNA with Osterix in a heterodimeric complex for osteoblast differentiation138. It can 

also function in the chondrocyte lineage pathway, bound with SOX 9 instead139. The importance 

of RUNX2  in bone development can be seen as Runx2 null mice are embryonic  lethal due to a 

failure  in  skeletal  tissue  ossification  and  Runx2+/‐  mice  develop  cranial  and  collarbone 

malformations  termed  cledocranial  dysplasia140.  Although  RUNX2  is  indispensible  for 

calcification, overexpression of RUNX2 in mice did not show the opposite phenotype of RUNX2 

21 

 

 

deficiency. While  the number of osteoblasts  increased  in RUNX2  transgenic  animals, osteoid 

development  and proper mineralization was  impaired  resulting  in osteopenia141.  From  these 

studies  it can be concluded  that precise  regulation RUNX2 activity  is  required  for osteoblasts 

and chondrocytes during bone development. 

 

RUNX2 Transcriptional Targets: 

RUNX2  binds  to  a  DNA  consensus  sequence  5’CCACA3’  called  Osteoblast  Sensitive 

Elements  (OSE)142,  in  the promoter  regions of  target  genes,  such  as  Type  I Collagen  alpha 1 

(Col1a1)143,  Type  I  Collagen  alpha  2  (Col1a2)143,  Opn144,  Integrin  Binding  Bone  Sialoprotein 

(Ibsp)145, Ocn143  and Vascular  Endothelial Growth  Factor  (Vegf)146. As  the  binding  of OSE  by 

RUNX2  represents  a  clear  indication  of  RUNX2  activity,  OSEs  have  been  used  in  promoter 

reporter constructs to demonstrate RUNX2 activity147. Most of the  identified genes which are 

activated  by  RUNX2  are major  constituents  of  the  bone  osteoid  or  play  functional  roles  in 

calcification.  For example,  type  I  collagen  is  an  important  structural  component of  the bone 

osteoid148. Additionally, type I collagen is also ligand for pro‐osteogenic signalling149. Other gene 

products such as OPN, IBSP and OCN contain calcium phosphate binding sites, are hypothesized 

for facilitating calcium phosphate nucleation and provide the physical means for osteoclasts to 

attach and remodel bone150. Another RUNX2  target, VEGF  is promotes angiogenesis, which  is 

important  for  the  vascularisation  of  bone151.  As  such, many  of  the mRNAs  of  these  RUNX2 

target genes have been used as a measure of its activity in studies on osteogenic development 

and in vascular calcification. However it is also important to note that the expressions of these 

genes are likely influenced as well by other transcriptional activators. Vegf mRNA expression for 

22 

 

 

example  can  be  induced  by  Hypoxia  Inducible  Factor  1  alpha  (HIF1α),  which  is  RUNX2 

independent152.  

 

Regulation of RUNX2: 

RUNX2  is regulated by transcription of the gene to produce mRNA. Bone Morphogenic 

Protein 2  (BMP2), which  is  an  important pathway  to osteogenic development,  regulates  the 

transcription  of  Runx2  mRNA153.  Other  molecules  which  regulate  the  expression  of  Runx2 

mRNA include Retinoblastoma Protein (RBP)154, and Insulin‐like Growth Factor 1 (IGF1)155.  

In addition  to  regulating  the expression  levels of RUNX2,  the activity of RUNX2  is also 

regulated  by many  signalling  pathways.  Signalling  pathways  which  have  been  identified  to 

positively regulate RUNX2 activity include BMP2, Fibroblast Growth Factor Receptor 1 (FGFR1), 

Interleukin 1 β (IL‐1β) and Transforming Growth Factor β (TGFβ)156. These pathways ultimately 

lead  to  the  phosphorylation  and  activation  of  RUNX2.  Regulation  of  RUNX2  activity  occurs 

through phosphorylation of serine sites, the  identified sites all follow the sequence of proline‐

serine‐theronine (Figure 5).  Recent work showed that RUNX2 contains three clearly identified 

phosphoserine sites (S14, S104 and S451), which have  inhibitory and stimulatory effects, both 

S104  and  S451  are  inhibitory while  S14  is  stimulatory70  (Figure 5). While many  kinases have 

been  identified as  crucial  to RUNX2 phosphorylation, only  the MAPKs, ERK1/2 and P38 have 

been identified as direct kinases for S14147. ERK1/2 and P38 have also been identified as  direct 

RUNX2 binding partners147.   Furthermore, ERK1/2 and P38 have also been  identified as crucial 

MAPKs for the maturation of osteoblasts further solidifying their roles  in calcification82. While 

the exact subcellular  location where phosphorylation of RUNX2 occurs has not been studied, 

23 

 

 

P38  and  ERK1/2  typically  phosphorylate  transcription  factors  after  they  have  entered  the 

nucleus.  

To elicit its effects on calcification, RUNX2 is directed to the nucleus from the cytoplasm 

70. From there RUNX2 is able to bind to DNA elements and induce gene expression. To enter the 

nucleus RUNX2 interacts with the microtubule network via its N terminus for transport131. Upon 

entry  to  the  nucleus,  RUNX2  activate  genes  in  the  osteogenic  process.  These  processes 

demonstrate  the complexity and  redundancy of mechanisms by which RUNX2 activity can be 

regulated. 

 

RUNX2 in Vascular Calcification: 

RUNX2  is  required  for  osteogenic  modulated  vascular  calcification109,  and 

osteochondrogenic transdifferentiation in VSMCs157.  Many of the factors which activate RUNX2 

in  osteochondrogenic  development  in  bone  tissue  also  activate  RUNX2  in  VSMCs.  In most 

vascular  calcification  studies,  RUNX2  activity  is  detected  by  phosphorylated  serine  residues, 

promoter‐report construct or transcriptional activation of RUNX2 targets. Such targets  include 

Col1a1, Col1a2, Opn, and Ocn. As  the vascularisation of advanced vascular calcification, Vegf 

has  become  the marker  for  late  stage  vascular  calcification10. Although  RUNX2  activation  in 

VSMCs  promotes  the  expression  of  osteochondrogenic  genes  and  ossification, 

transdifferentiated VSMCs still maintain many smooth muscle markers such as αSMA, SM22α, 

myocardin and smooth muscle myosin heavy chain69, 158. 

 

 

24 

 

 

MICROTUBULES 

As  previously  discussed,  microtubules  are  key  components  which  regulate  the 

translocation  of  RUNX2  into  the  nucleus.  Because  the  association  between  RUNX2  and 

microtubules is a relatively novel finding and sparsely defined, this latter part of the review will 

be dedicated to fully exploring microtubules. 

 

Structure and Organization of Microtubules: 

Microtubules along with actin and  intermediate  filaments are a part of  the eukaryotic 

cellular  cytoskeleton.  Microtubules  are  typically  organized  at  the  Microtubule  Organizing 

Center  (MTOC), which  is  composed  of  γ‐tubulin,  and  situated  at  the  centriole159.  Typically, 

nucleation  of  microtubules  occurs  at  the  MTOC.  However  in  cells  which  lack  MTOC, 

microtubules  nucleate  at  discrete  points  in  the  cytoplasm  through  a  poorly  understood 

process159.  

The microtubule network  is made up of repeating subunits of α and β‐tubulin dimers, 

and  forms  an  imperfect  helical  orientation  of  13  tubulin  dimers  per  turn  (Figure  6). Overall 

these form the microtubule structure which is a hollow cylinder. This cylinder has a diameter of 

25 nm and can grow up to 25 µm in length160.  Microtubule filaments have polarity with + or – 

ends which have β‐tubulin or α‐tubulin exposed respectively160. This orientation is essential for 

the biological  function of microtubules. The orientation of microtubules  is such  that subunits 

are added from the + end160.  Typically, the + end refers to the end at the MTOC and the – end 

refers to the end extending to the cell periphery.  This orientation is particularly important for 

the motor proteins dyenin and kinesin which shuttle cargo from + to – and – to + respectively. 

25 

 

 

Microtubules polymerize when α and β‐tubulin dimers are bound  to GTP  to  form a stabilized 

GTP cap at the – end (Figure 6)161. Hydrolysis of GTP to GDP within β‐tubulin, promotes a bent 

conformation of  the proteins hence promoting depolymerisation161. This active assembly and 

disassembly of microtubules is termed dynamic instability. 

 

Regulation of Microtubule Dynamics: 

The stability of microtubules can be regulated by  interactions with other proteins such 

as motor proteins and non motor microtubule associated proteins. These proteins may or may 

not  influence  the  GTPase  activity  of  β‐tubulin. Motor  proteins which  affect  the  stability  of 

microtubule are the kinesins. Kinesins from the kinesin 13 family play major roles in regulating 

microtubules.  Their  primary  function  is  to  catalyze  the  intrinsic  property  of microtubules  to 

depolymerize162. They are able to accomplish this by binding to the curved ends of microtubule 

filaments to promote instability in an ATP dependant process163.  

Microtubules dynamics are also  regulated by post  transcriptional modifications which 

are  catalyzed  by  various  microtubule  associated  proteins.  The  major  ones  include 

detyrosination, Δ2‐tubulin generation and acetylation. Detyrosination of α‐tubulin refers to the 

removal of the terminal Tyr residue at the C‐Terminus of α‐tubulin, thus rendering Glu the new 

terminal  residue164.  This  process  is  mediated  by  an  as  of  yet  unidentified  detyrosinase. 

Detyrosinated α‐tubulin favours the polymerized state in microtubules. However this process is 

reversible, as Tubulin Tyr ligase can re‐add Tyr to the Glu residue164. In order to make α‐tubulin 

permanently  favour  polymerization,  detyrosinated  α‐tubulin  is  processed  by  cytosolic 

carboxypeptidase.  This  removes  the  Glu  residue  in  α‐tubulin  giving  rise  to  Δ2‐tubulin164. 

26 

 

 

Detyrosinated tubulin and Δ2‐tubulin are commonly found in terminally differentiated neuronal 

cells where the dynamic cycling of microtubules is not required164‐166.  

Another microtubule modification that is associated with stability is the acetylation of α‐

tubulin. Acetylation  is a process where an acetyl group  is conjugated to K40 on α‐tubulin by a 

currently  unknown  acetyl  transferase.  HDAC6  is  the  only  deacetylase  known  to  regulate  α‐

tubulin  acetylation167.    Evidence  to  support  this  comes  from  HDAC6  overexpression  which 

resulted in a global decrease in tubulin acetylation and increased susceptibility to destabilizing 

agents  such  as  nocodazole168.  It  is  hypothesized  that  acetylation  of  K40  site  induces  a 

conformational  change,  which  affects  the  α‐tubulin‐β‐tubulin  dimer  binding  to  prevent 

polymerization of microtubules164. The  regulation of microtubule polymerization  is crucial  for 

biological function. 

 

Microtubules and Nuclear Transport: 

  Though  it  was  previously  thought  that  nuclear  localization  occurred  via  Brownian 

motion,  recent  work  shows  that  nuclear  translocation  for  a  variety  of  different molecules 

requires the use of microtubules. For examples signal transduction kinases such as P38 use the 

microtubule  network  in  order  to  translocate  into  the  nucleus169.  Recent  work  on  steroid 

hormone  receptors  has  demonstrated  that  they  also  require  microtubules  for  nuclear 

transport170. 

Microtubules are also  required  for  the  translocation  for  transcription  factors  including 

RUNX2131  and  HIF1α171.    RUNX2  is  only  able  to  bind  to  polymerized microtubules,  but  not 

monomeric  tubulin131.  The  study  also  showed  that  RUNX2  associates with  the microtubule 

27 

 

 

network  via  the N  terminal  amino  acid  residues 1 – 361. However,  it  is not  known whether 

RUNX2 associates directly with the microtubule network or through a protein complex. A study 

on HIF1α and steroid hormone receptor translocation to the nucleus by microtubules showed 

that both molecules bind to Dynamitin, which  is a part of the dynein activator complex170, 171. 

This complex is able to bind both dynein and kinesin and thus is used for bidirectional transport 

of organelles and vesicles on microtubules within the cell172. RUNX2 may also bind to Dynamitin 

for transport. 

Interestingly,  although  transcription  factors  require microtubules, purely polymerizing 

microtubules is not sufficient for nuclear translocation for most transcription factors131, 171. For 

most  nuclear  transcription  factors,  a  state  of  dynamic  instability  is  required  for  nuclear 

translocation.  Why  dynamic  instability  is  required  for  the  translocation  of  proteins  is  not 

known.  

 Mitochondrial  translocation  also  requires  dynamic  instability  for  translocation within 

the cell. Mitochondria  interact with positive end proteins which  latch on and carry them  into 

the microtubule network160. A similar latching process may be required for transcription factors 

as well. Upon arrival at  the nuclear pore complex,  the protein  is recognized and  translocated 

within by a poorly understood process.  

In  meschenchymal  stem  cells,  DDR1  is  crucial  for  forming  dendritic  extensions  by 

microtubules173. As transcription factors such as RUNX2, HIF1α and signalling molecules such as 

ERK,  P38  and  STATs  all  require  microtubule  translocation;  this  might  represent  a  master 

regulatory network for controlling nuclear activity of transcription factors by DDR1. 

 

28 

 

 

RATIONALE AND HYPOTHESIS 

Type  I  collagen has been  associated with both osteochondrogenic differentiation  and 

vascular  calcification149,  174.  The  alpha  1  integrin  receptor  has  been  implicated  in  regulating 

collagen  induced osteochondrogenic differentiation  in bone, however,  the  receptor by which 

type  I  collagen  elicits  its  osteochondrogenic  effects  in VSMCs  has  not  been  identified.    In  a 

published  study,  our  group  observed  that  Ddr1‐/‐;  Ldlr‐/‐  mice  had  reduced  atherosclerotic 

calcification59. As  type  I  collagen  is  a  ligand  for DDR1,  this  suggested  a novel mechanism by 

which type I collagen can promote osteochondrogenic transdifferentiation. Our laboratory also 

reported  that Ddr1‐/‐ VSMCs  showed  attenuated  calcifying potential, with  some  indication of 

decreased osteochondrogenic transdifferentition, such as decreased ALP activity59. This led me 

to perform a screen on Ddr1+/+ and Ddr1‐/‐ VSMCs to identify genes which might be involved in 

osteochondrogenic  transdifferentiation. My  screens  revealed  that Ocn,  showed  a  significant 

reduction  in  Ddr1‐/‐  cells.  This  result  led me  to  investigate  the mechanism  by which  DDR1 

influenced Ocn expression. Ocn  is a target gene of the osteochondrogenic transcription factor 

RUNX2, and RUNX2 activity is regulated by MAPKs such as ERK1/2 and P38147, 175‐177. DDR1 has 

been  shown  to  signal  through  those MAPKs18,  43,  44,  48.  As  this  represented  a  possible  link 

between DDR1 and RUNX2 I hypothesized that:   DDR1 activates RUNX2 by signalling through 

MAPKs  in VSMCs during calcification. However  later  in the course of my studies  I discovered 

that the absence of DDR1 diminished RUNX2 activity at early stage calcification  in spite of no 

DDR1 dependant differences  in ERK1/2 and P38 signalling at that time point.  In addition, P38 

inhibition reduced Ocn expression and RUNX2 activity in DDR1 expressing cells. My studies also 

revealed  that  Ddr1‐/‐  VSMCs  show  reduced  RUNX2  and  phosphoP38  nuclear  localization. 

29 

 

 

Furthermore,  close observations of my Ddr1‐/‐ VSMCs  showed  increased  cell  spreading which 

was  absent  in  Ddr1+/+  VSMCs.  As  nuclear  translocation  of  RUNX2  and  phosphoP38  and 

maintenance of cell morphology require a microtubule network131, 171,  I postulated that there 

were differences  in microtubule structure between the Ddr1+/+ and Ddr1‐/‐ VSMCs. Supporting 

this,  an  article published by  Lund  et. al.  showed  that mescenchymal  stem  cells  sense  type  I 

collagen using a DDR1 stabilized microtubule network173.  A prior study also demonstrates that 

RUNX2  requires  a microtubule  network  for  nuclear  translocation131.  Together  these  studies 

suggest that DDR1 may able to regulate the translocation and thus the activity of RUNX2. Thus I 

later hypothesized that: DDR1 regulates RUNX2 activity by microtubule organization in VSMCs 

during calcification. 

 

MATERIALS AND METHODS 

Chemicals and Reagents 

All  chemicals and  reagents were purchased  from Sigma‐Aldrich  (St.  Louis, MO) unless 

otherwise stated. 

 

Smooth Muscle Cell Isolation and Culturing 

Mouse  VSMCs  were  isolated  using  elastase  type  III  digest  from  Ddr1+/+  and  Ddr1‐/‐ 

C57BL6  mice  carotid  arteries  as  described  in  Hou  et.  al.50    and  propagated  in  a  medium 

composed of high glucose Dulbecco’s modified Eagle’s Medium (Gibco) and supplemented with 

10% heat  inactivated  fetal bovine  serum, 1% antibiotic‐antimycotic  (culturing media) at 37°C 

30 

 

 

with 5% CO2  in 75 cm2 culture flasks. Cells were passaged upon growth to approximately 90% 

confluency.  To  passage  the  cells,  culture media was  aspirated  and  the  cells were washed  3 

times using Dulbeco’s phosphate buffered saline with MgCl2 and CaCl2 (PBS). After washing, the 

cells were passaged through enzymatic digest by incubating the cells with 2mL of 0.02% trypsin 

for 1 min at 37°C to detach cells from the culture flask. The cell suspension was removed and 

placed  in 50 mL  falcon  tubes  (BD Falcon) containing culture media  that has been warmed  to 

37°C.  This  cell  suspension  was  centrifuged  at  1,000  rpm  for  5 mins.  The  supernatant  was 

aspirated and the cell pellet was redistributed into 3 new culture flasks, each containing 10 mL 

of culture media. The periodicity by which the cells were passaged was approximately 4 days 

after each passage. Experiments were performed  from  these  isolated VSMCs  from passage 6 

through to passage 10. 

 

In Vitro Calcification Assay  

VSMCs from passages 6 to 10 were seeded at 1563 cells/cm2 and cultured  in culturing 

media. After 72 hours the culturing media was washed out using PBS and replaced with media 

consisting of high glucose Dulbecco’s modified Eagle’s Medium (Gibco) supplemented with 3% 

heat  inactivated  fetal  bovine  serum  (Hyclone),  1%  antibiotic‐antimycotic  (Penicillin‐

Streptomycin/Amphotericin  B)  (Gibco)  and  2.4  mM  Pi  (osteogenic  media).    In  parallel 

experiments  involving MAPK pathway  inhibition, 10 mM  stocks of PD098059  (MEK  inhibitor) 

and SB203580 (P38  inhibitor) were made  in Dimethyl Sulfoxide (DMSO) and diluted at 1:1,000 

to  create  a  final  concentration  of  10 µM within  the  osteogenic media.  Controls  to  inhibitor 

experiments were prepared by adding DMSO at a 1:1,000 dilution in the media. In experiments 

31 

 

 

involving microtubule  destabilization,  10 mM  stock  of  nocodazole was made  in  DMSO  and 

diluted at 1:1,000 to create a final concentration of 10 µM. To stabilize microtubules, a 10 mM 

stock of taxol was made  in DMSO and diluted at 1:1,000 to create a final concentration of 10 

µM. These cells were incubated for 0, 2, 4 or 12 days after the addition of the osteogenic media 

and then used for calcium quantification, RT‐PCR, immunoblotting, immunohistochemistry and 

luciferase activity assays. 

 

Calcium Quantification 

  The  calcium  content  of  calcified  VSMCs  was  determined  using  the  o‐cresophthalein 

complexone colorimetric assay (Clinotech Diagnostics). The assay was performed according to 

manufacturer protocols. Initially, the assayed cells were incubated with 500 µL of 0.6 N HCl per 

well  in a 6 well culture plate  (BD Falcon) at 4°C overnight. The HCl was added  to release  the 

calcium  phosphate  crystals.  The  resultant  HCl  solution  was  diluted  50  fold  with  0.6N  HCl. 

Following this, the diluted sample was added in triplicate, 10 µL each in a clear 96 well plate (BD 

Falcon). To quantify  the amount of  calcium within each  sample, a  standard  curve generated 

using the calcium standard solution with O‐cresopthalein contained within the assay kit ranging 

from 0 to 7.5 mg/ml. 100 µL of the prepared calcium quantification reagent was pipetted  into 

each well  containing  experimental  and  standard  curve  samples  and  incubated  for  5 mins  at 

room temperature. O‐cresopthalein functions by binding calcium within the solution and forms 

a purple coloured complex. As a result, the amount of calcium was determined by measuring 

intensity of purple colour at 540 nm. The measured values were calculated by interpolating the 

absorbance values to the calculated standard curve formula. 

32 

 

 

Measured calcium content was normalized to total cellular protein. Protein content was 

measured using a microBCA assay according to manufacturer protocols (Pierce). To obtain total 

cellular protein, decalcified cells were washed 3 times with PBS and incubated with 0.1 N NaOH 

at  room  temperature  for  1  hour  to  solubilise  the  protein.    To  prepare  the  protein  samples 

collected  in NaOH  for  quantification,  the  samples were  diluted  1:200 with  0.1 N NaOH.  To 

correlate  absorbance  values  to  protein  concentration  a  BSA  standard  ranging  from  0  to  40 

µg/mL was  prepared  according  to manufacturer  protocol  by  diluting  the  supplied BSA  stock 

with 0.1 NaOH. The BSA reaction was performed by pipetting 100 µL samples and the prepared 

BSA  standard  in  triplicate  on  a  96 well  plate.  To  visualize  the  protein  content with  in  each 

sample 100 µL of prepared BCA  reagent was pipetted  into each of  the  sample and  standard 

containing wells and incubated for 1.5 hours at 37°C. In a BCA reaction Cu2+ ions are reduced by 

peptide bonds to Cu+  in a concentration dependant manner. The Cu+  is bound by bicinchronic 

acid  to a  form a purple  complex, which absorbs  light at 562 nm. The measured values were 

calculated by interpolating the absorbance values to the calculated standard curve formula. 

In  addition,  calcium  content  was  also  normalized  to  total  cellular  DNA  using  the 

Fluoreporter  dsDNA  quantification  kit  (Molecular  Probes).  Following  calcium  extraction with 

0.6N HCl and washed with PBS, cells are incubated with 500 µL of ddH2O per well and incubated 

at ‐80°C for 1 hour. Following this the samples were thawed and incubated at 37°C for 1 hour. 

To quantify  the  amount of DNA  a  standard  curve  ranging  from 0  to 10 ng/µL was prepared 

according  to manufacture protocol using  the supplied salmon sperm DNA stock.   Each of  the 

samples  and DNA  standards were  pipetted  in  triplicate  on  a  black walled  96 well  plate  (BD 

falcon). To visualize the DNA content 100 µL of Hoechst TNE buffer was pipette into each well 

33 

 

 

containing a sample or standard and  incubated at room temperature for 5 mins. The Hoechst 

dye within the solution is able to bind dsDNA and thus providing a means to visualize the DNA. 

After  incubation,  the  plate was  read  on  a HTS  fluorescent microplate  reader  (PherSTAR)  by 

setting excitation and emission filters at 360 nm and 460 nm respectively. The measured values 

were  calculated  by  interpolating  the  absorbance  values  to  the  calculated  standard  curve 

formula. 

 

Reverse Transcription and Quantitative Real Time‐PCR 

RNA was  isolated  from VSMCs using  the RNeasy RNA  isolation  kit  (Qiagen). RNA was 

later quantified using the NanoDrop 2000c (Thermo Scientific). To prepare the RNA for reverse 

transcription, 1 µg of RNA was treated with DNase I (Fermentas) for 30 mins at 37°C in supplied 

buffer  (10 mM Tris‐HCl pH 7.5, 2.5 mM MgCl2 and 0.1 mM CaCl2)  to  remove  genomic DNA. 

DNase  I was  inactivated by the addition of 1 µg of EDTA and heat  inactivation  for 10 mins at 

65°C.  This  solution  was  reverse  transcribed  into  cDNA  using  the  Superscript  First  Strand 

Synthesis Kit  (Invitrogen) with 100  ng of random hexamers, 200 nM dNTP, 10 mM DTT, 40 u of 

RNaseOUT and 50 u  of Superscript II in a buffer containing 50 mM Tris‐HCl, pH 8.3, 75 mM KCl 

and 3 mM MgCl2.  qRT‐PCR reactions were performed using SYBR advantage qRT‐PCR premix 

kit (Clonetech) on the Quantitative Real Time (qRT)‐PCR using the ABI 7900 HT Fast Real‐Time 

PCR  System  (Applied Biosystems).  Individual  reactions were performed  in 10 µL with 4 ng of 

cDNA  and  450  nM  of  the  following  forward  and  reverse  primers  DDR1  (FWD  5’‐

CTGCTCTTTACTGAAGGCTC‐3’,  REV  5’‐CAGGCCATAGCGGCACTTGG‐3’),  PIT‐1  (FWD  5’‐

GCGCCCTTCCGCGGGCTTT‐3’,  REV  5’  GTCTCCGGCCCGGCCGCTTGCCCGC‐3’),  NPP1  (FWD  5’‐

34 

 

 

CTCGGTTGAGACCCACTGATG‐3’,  REV  5’‐GCTCCCGGCAAGAAAGATTT‐3’),  ALP  (FWD  5’‐

AGACACAAGCATTCCCACTAT‐3’,  REV  5’‐CACCATCTCGGAGAGCG‐3’),  RUNX2  (FWD 

5’‐GATGCTCTGTTTCTTTCTTTCAGG‐3’,  REV  5’‐CTCCAGCATTTCATGCTAGT‐3’),  ATF4  (FWD 

5’‐TTGACCACGTTGGATGACAC‐3’,  REV  5’‐CAGAGATATCAACTTCACTGCCTA‐3’),  OCN  (FWD 

5’‐GTAGTGAACAGACTCCGGC‐3’,  REV  5’‐AGTGATACCGTAGATGCGT‐3’)  TENC  (FWD 

5’‐ACCGCAGAGAAGAATTTTGG‐3’,  REV  5’‐TCCCCATGGTCTTGTAGGTC‐3’)  and  Acidic  Ribsomal 

Protein  (ARP)  (FWD  5’‐AGACCTCCTTCTTCCAGGCTTT‐3’),  (REV  5’‐

CCCACCTTGTCTCCAGTCTTTATC‐3’).  The conditions for the PCR reaction were 95°C for 10 mins 

followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 min. Following PCR, a dissociation 

step was performed by heating the samples to 95°C for 15 secs and then cooling them to 60°C 

for 15 secs and then heating again to 95°C for 15 secs. The data collected was used to generate 

the  dissociation  curve  from  which  the  cycle  threshold  (Ct)  was  determined  using  SDS  2.3 

software  (Applied  Biosystems).  To  determine  relative  expression  levels  the  comparative  Ct 

method (2‐ΔΔCt) was used as previously described59. 

 

Immunoblotting 

  Protein was  isolated  from  smooth muscle cells  incubated  in osteogenic conditions  for 

either 2 or 12 days using the cell  lysis buffer  (20 mM Tris‐HCl,  (pH 7.5), 150 mM NaCl, 1 mM 

Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM betaglycerophosphate, 

1 mM Na3VO4,  1 µg/ml  leupeptin)  (Cell  Signalling  Technology). Using  the microBCA  assay  as 

described above, appropriate sample volumes of sample were added to 2X sample buffer (0.1 

M  Tris  pH  6.8,  2%  SDS,  20%  glycerol,  0.4%  bromophenol  blue,  5%  β‐mercaptoethanol)  and 

35 

 

 

boiled for 5 mins. Samples were loaded on and separated with a 10% TGX separating gel (Bio‐

Rad) and were subsequently transferred to a nitrocellulose membrane (Bio‐Rad) at 100 V for 1 

hour at 4°C. Membranes were  incubated  in blocking buffer  (5% non‐fat dry skim milk,  in Tris 

Buffered Saline‐Tween 20 (TBST)) for 1 hour at room temperature, followed by washing in TBST 

and  incubated  in  the appropriate primary and secondary antibodies  in 2.5% non‐fat dry skim 

milk  in  TBST.  The  antibodies were  diluted  at  the  following  concentrations:  rabbit  polyclonal 

anti‐ERK1/2 (Cell Signalling Technology) (1:1000), rabbit polyclonal anti‐pERK1/2(Cell Signalling 

Technology)  (1:250),  rabbit  polyclonal  anti‐P38(Cell  Signalling  Technology)  (1:250),  rabbit 

polyclonal  anti‐pP38  (Cell  Signalling  Technology)  (1:250),  mouse  monoclonal  anti‐RUNX2 

(Abcam)  (1:250),  rabbit  polyclonal  anti‐β  actin(Abcam)  (1:1000),  HRP  conjugated  goat  anti‐

rabbit  (Cell  Signalling  Technology)  (1:1000)  and  HRP  conjugated  horse  anti‐mouse  (Cell 

Signalling  Technology)  (1:1,000).  Membranes  probed  with  antibodies  was  incubated  with 

western blot chemiluminescence reagent Plus  (Perkin Elmer),  the membrane was stripped by 

incubating Restore Plus western blot stripping buffer (Pierce) for 30 mins at 37°C, Washed with 

TBST  and  re‐probed  for  next  protein  of  interest.  Immunoblots were  imaged  using  an  Image 

Station  4000MM  Pro  (Kodak)  and  quantified  using  Image  J  software  (NIH).  To  normalize, 

densitometry values obtained were divided by the β‐actin loading control densitometry values. 

pERK1/2 and pP38 expression values were obtained by dividing the β‐actin normalized values of 

the phospho forms to the β‐actin normalized values of total forms. 

 

 

 

36 

 

 

Immunocytochemistry 

VSMCs were  grown  using  the  calcification  assay  conditions  on  8  chambered  culture 

slides  (BD  Falcon)  to  visualize  cells  after  immunocytochemistry  staining.  The  cells  were 

subsequently washed with PBS and fixed with 5% PFA (Paraformaldehyde) for 10 mins at room 

temperature followed by a PBS wash and permeablized with PBS containing 0.25% Triton X‐100 

for 10 mins. After permeabilization the cells were washed again and blocked with 1% BSA with 

PBS and 0.1% Tween (PBST). The cells were later incubated with mouse monoclonal anti‐RUNX2 

(Abcam)  (1:100),  rabbit  polyclonal  anti‐pP38  (Cell  Signalling  Technology)  (1:100)  and  rabbit 

polyclonal  anti‐α  tubulin  (Abcam)  (1:100)    in  1%  BSA  PBST  overnight  at  4°C.  The  primary 

antibody solution was decanted and the cells were washed with PBS after overnight incubation. 

Secondary anti‐mouse Alexa 488 conjugated goat antibody (Invitrogen) (1:100), secondary anti‐

rabbit Alexa 488 conjugated donkey antibody (Invitrogen) (1:100), secondary anti‐mouse Alexa 

568  conjugated  goat  antibody  (Invitrogen)  (1:100),  and  secondary  anti‐rabbit  Alexa  568 

conjugated donkey antibody (Invitrogen) (1:100) in 1% BSA PBST were added and incubated for 

1  hour  at  room  temperature  in  the  dark.  Alternatively,  VSMC membrane was  visualized  by 

incubating Alexa 647 Wheat Germ Agglutinin (WGA) (Invitrogen) (1:1,000) in 1% BSA PBST was 

added and incubated for 1 hour at room temperature in the dark. 

Following secondary antibody or WGA incubation the cells were washed again with PBS 

and then incubated for 5 mins with Hoechst in PBS (1:1,000) to stain the nucleus. After Hoechst 

incubation the cells are washed with PBS and fixed with CC mount (Invitrogen) and sealed with 

a #1 thickness glass cover slide (VWR) and clear nail polish. The cells were visualized by confocal 

fluorescence microscopy using the Nikon AR1 laser scanning confocal microscope (Nikon). 

37 

 

 

Immunofluorescence Quantification 

  To  quantify  the  extent  of  nuclear  localization  of  RUNX2  in  the  immunofluorescence 

images,  Image  J was used  to measure  the  intensity of  the  fluorescent  signals. First using  the 

free form tools, the cytoplasm of the cell was traced out, and the average intensity of the signal 

is measured and tabulated. Next, using free form tools the nucleus was also selected and the 

average intensity of the signal is measured and tabulated. The average intensity of the nucleus 

is  then  divided  by  the  average  intensity  of  the  cytoplasm  to  obtain  the  nuclear:cytoplasmic 

ratio. For each experiment, one field of view was captured at 400X magnification from each of 3 

separate wells.  For each  field of  view 3  cells were  chosen at  random  for quantification. The 

images  were  quantified  in  a  fashion  blinded  to  both  genotype  and  treatment.  The  values 

obtained for each individual experiment were averaged and treated as one replicate. To obtain 

data for statistical analysis a total of 3 separate experiments were analyzed.  

 

Plasmid Preparation and Transformation 

  The  6OSE2  Luc  plasmid  to  assess  RUNX2  activity  was  a  kind  gift  from  Dr.  Renny 

Franceschi  from  University  of  Michigan  Ann  Arbor  147.  To  prepare  6OSE2  plasmid  for 

experiments, the plasmid was transformed into E‐coli. To perform the transformation, a 100 µL 

aliquot of XL‐1 Blue Competent E‐Coli Cells (Strategene) was thawed on ice. After thawing, 1.7 

µL of β‐mercaptoethanol was added to thawed cells and swirled gently. The cells were allowed 

to incubate on ice for an additional 10 mins. To propagate the plasmid 20 ng of 6OSE2 Luc was 

added to the thawed cell mixture and  incubated on  ice for 30 mins. A heat pulse of 42°C was 

applied to the cell mixture for 45 secs. Following the heat pulse, the cells were incubated on ice 

38 

 

 

for 2 mins. 37°C Pre‐warmed 0.9 mL of SOC media (Invitrogen) was added to the cell mixture. 

The cell containing SOC (Invitrogen) mixture was  incubated at 37°C for 1 hour with shaking at 

250 rpm.   The  transformed cells were plated on LB‐ampicillin agar plates prepared  from a LB 

stock containing 100 mg/mL of ampicillin to select for cells containing the plasmid. Cells were 

grown overnight at 37 °C to allow growth. After growth period a single colony was selected and 

subsequently  cultured  in  a  starter  culture  of  40 mL  of  LB‐ampicillin  at  37  °C with  constant 

shaking  at  100  rpm  for  4  hours.  After which,  the  starter  culture was  placed  in  a  larger  LB‐

ampicillin culture containing 1 L of media at 37 °C with constant shaking at 100 rpm overnight. 

Plasmid DNA was  extracted  from  the  overnight  culture  using  a Maxi  Prep DNA  isolation  kit 

(Invitrogen) according to manufacturer instructions. Isolated Plasmid DNA was quantified using 

the NanoDrop 2000c spectrophotometer (Thermo Scientific) for future preparations. 

 

Transfection 

  VSMCs were grown in culturing media in 24 well plates (BD Falcon) for 2 days. Following 

the incubation, calcifying media was removed and cells were washed with PBS. For each well of 

cells the following mixture was prepared: 5 µg of 6OSE2 Luc plasmid was diluted  in 100 µL of 

Opti‐MEM  (Gibo),  then  0.5  µL  of  Plus  Reagent  (Invitrogen) was  added  to  the mixture  and 

allowed to incubate at room temperature for 15 mins. For each volume of the above prepared 

mixture, 2.5 µL of Lipofectamine LTX (Invitrogen) was added and incubated for 30 mins at room 

temperature. Following  incubation, the subsequent mixture was added to 500 µL of antibiotic 

free DMEM with 10% FBS and cultured for an additional 24 hours to complete the transfection.  

After transfection, cells were cultured according to the calcification assay conditions. 

39 

 

 

Luciferase Activity Assay 

  Following calcification assay culturing, transfected cells were assayed for RUNX2 activity 

with  reagents provided with  the Dual  Luciferase Assay Kit  (Promega). Each well of  cells was 

lysed by incubating 100 µL of passive lysis buffer (Promega) for 30 mins with gentle shaking. To 

measure the activity of the  lysate samples, 20 µL of the obtained  lysate was pre‐dispensed  in 

triplicate  on  to  a  black  walled  96  well  plate.  The  Luminat  LB9507  luminometer  (Berthold 

Technologies)  added  the  following  reagents  automatically:    First,  100 µL  of  Luciferase Assay 

Reagent  II (Promega) to measure the activity of firefly  luciferase. After a 2 second delay, Stop 

and Glo Reagent  (Promega) was added to quench the  firefly  luciferase signal and provide the 

substrate for the renilla luciferase signal. Relative Luminescence Units (RLUs) were obtained by 

normalizing the firefly luciferase signal driven by the activity of RUNX2 to the renilla luciferase 

signal generated by the CMV promoter on each plasmid. 

 

Statistical Analyses 

  Statistics were performed using Sigma Stat (SysStat Software). Data was presented as ± 

SEM.  To  test  for  statistical  significance,  in  vitro  calcification  assays  and  densitometry  on 

immunoblots  were  analyzed  using  a  paired  Student’s  t‐test.  qRT‐PCR,  nuclear  localization 

quantification  and  luciferase  assays  were  analyzed  using  Two  way  ANOVA.  Pairwise 

comparisons between groups were made following the Two way ANOVA using Tukey’s posthoc 

test. Statistical significance was set at P<0.05 for all tests. 

 

 

40 

 

 

RESULTS 

DDR1 Deficiency Attenuates Vascular Smooth Muscle Cell Calcification of Matrix 

  To study  the  role of DDR1  in VSMC mediated calcification,  I utilized a high phosphate 

osteogenic model of in vitro calcification adapted from Speer et. al.69. After 12 days of culture, 

total calcium content  in  the extracellular matrix  in Ddr1‐/‐ VSMCs was  reduced by 43% when 

compared with Ddr1+/+ VSMCs after normalizing to total protein level (Figure 7A). Ddr1‐/‐ VSMCs 

showed a 38%  reduction  in calcium content compared  to Ddr1+/+ VSMCs after normalizing  to 

total DNA  level  (Figure 7B).  It  is  clear  that VSMC mediated  calcification  is diminished  in  the 

absence of DDR1.  

 

DDR1 Deficiency Alters Expression of Phosphate Handling Genes  in Vascular Smooth Muscle 

Cells at an Early, but not at a Late Stage of Calcification 

  Previous research has suggested that vascular calcification results from an imbalance of 

the Pi to PPi levels in VSMCs10, which is in turn due to an imbalance of phosphate regulators. I 

therefore  hypothesized  that  the  blunted  calcification  observed  in Ddr1‐/‐ VSMCs was  due  to 

altered expression of genes  involved  in phosphate handling. The mRNA expression of various 

phosphate  regulatory molecules was measured using qRT‐PCR.  I  first  looked at Pit‐1 and Alp, 

which  are  involved  in  increasing  intracellular phosphate  levels. Pit‐1 mRNA was  increased  in 

Ddr1‐/‐ VSMCs after 2 days  in osteogenic culture, but by 12 days Pit‐1 mRNA expression was 

decreased and there were comparable levels in both genotypes (Figure 8A).  I saw a significant 

decrease in the mRNA expression of Alp at 2 days in Ddr1‐/‐ VSMCs but by 12 days, both Ddr1‐/‐ 

and Ddr1+/+ VSMCs  increased their expression and there were no differences when comparing 

41 

 

 

the two cell types (Figure 8B). This data shows that deficiency of DDR1 affects expression of Pit‐

1 and Alp at an early stage, but by late stage calcification the gene expression of Pit‐1 and Alp 

mRNA in Ddr1‐/‐ VSMCs catches up to Ddr1+/+ VSMC levels.  

Next I looked at mRNA levels of the pyrophosphatase, Npp1, which inhibits calcification 

by promoting the accumulation of PPi. I saw a significant decrease in Npp1 mRNA expression in 

Ddr1‐/‐  VSMCs  at  the  2  day  time  point,  but  expression  levels  in  Ddr1‐/‐  and  Ddr1+/+  VSMCs 

increased and there were no significant differences between the cell types at 12 days  (Figure 

8C).  This  indicated  to me  that  loss of DDR1  affects  the mRNA expression of npp1  in VSMCs 

during early stage calcification, but not at late stage calcification.  

Together my results  indicate  that  loss of DDR1  impacts  the mRNA expression of Pit‐1, 

Alp, Npp1 at an early point of  calcification, but not at a  late  stage. This  indicates  that DDR1 

delays the gene expression of phosphate handling genes in response to high phosphate. If these 

changes  in mRNA  expression  carry  forward  to  protein  expression  changes,  they  will  likely 

impact phosphate handling, nucleation of calcium apatite and thus vascular calcification. 

In my experiments I saw a decrease  in Alp expression  in Ddr1‐/‐ VSMCs. This could  lead 

to decreased Pi production by these VSMCs and thus less calcium phosphate crystal deposition. 

I also observed a decrease of Npp1 expression  in Ddr1‐/‐ VSMCs, which seems counterintuitive 

as these cells clearly show decreased calcification. However PPi produced by NPP1 can also be a 

substrate  for ALP, producing  two Pi molecules178.   Therefore decreased NPP1  levels  in Ddr1‐/‐ 

VSMCs may also  lead  indirectly  to  less vascular calcification. With  respect  to Pit‐1 expression 

levels,  Pit‐1  mRNA  expression  is  likely  increased  in  the  Ddr1‐/‐  VSMCs  in  response  to  the 

decrease  in  available  Pi.  Over  time,  these  gene  expression  differences  as  a  result  of  DDR1 

42 

 

 

absence are overcome. Nevertheless, the early expression of phosphate handling proteins may 

provide a quick  start  to calcium phosphate nucleation  in Ddr1+/+ VSMCs. Therefore while  the 

Ddr1‐/‐  VSMCs  may  eventually  match  the  Ddr1+/+  VSMCs  in  phosphate  handling,  they  are 

unlikely to reach the same extent of matrix calcification.  

 

DDR1 Deficiency  Increases the Expression of TenC at Late Stage Calcification, but not αSMA 

and Atf4 

During vascular calcification,  there  is VSMC  transdifferentiation  into an osteoblast‐like 

phenotype with the gradual loss of the VSMC phenotype69. I wanted to determine whether loss 

of  DDR1  attenuated  VSMC  phenotypic  transition  whereas  DDR1  is  permissive  to 

transdifferentiation. To address  this  I  first examined  the protein  levels of  the  smooth muscle 

cell marker Alpha Smooth Muscle Actin (αSMA).  Immunoblotting to detect αSMA revealed no 

significant differences  comparing Ddr1‐/‐  and Ddr1+/+ VSMCs  at  the  12  day  timepoint  (Figure 

9A). This  indicated to me that deficiency of DDR1 did not alter the expression of αSMA under 

osteogenic conditions.  

During  vascular  calcification,  VSMC  proliferation  is  inhibited  to  promote 

osteochondrogenic  transdifferentiation179.  I  therefore  hypothesized  that  Ddr1  deletion may 

increase VSMC proliferation, thus preventing transdifferentiation. To determine this I examined 

two markers  of  smooth muscle  proliferation,  Activated  Transcription  Factor  4  (Atf4)180  and 

Tenascin  C  (TenC)181.  qRT‐PCR  of  Ddr1‐/‐  and  Ddr1+/+  VSMCs  showed  no  differences  in  the 

expression of Atf4 between the genotypes at either time point (Figure 9B). However there was 

43 

 

 

a decrease  in the mRNA expression of Atf4 from 2 days to 12 days  in both Ddr1‐/‐ and Ddr1+/+ 

VSMCs.  

Following  this,  I  examined  the mRNA  expression of  TenC  under  the  same osteogenic 

conditions and saw no differences between Ddr1‐/‐ and Ddr1+/+ VSMCs at 2 days  in osteogenic 

culture. However, by 12 days the Ddr1‐/‐ VSMCs showed a significant increase in the expression 

of TenC  (Figure 9C). Taken  together  these  results  imply  that  loss of DDR1 does not alter  the 

expression of αSMA or Atf4. However, the loss of DDR1 does increase the expression of TenC at 

late  stage  calcification.  In previous  literature,  it has been  shown  that  TENC promotes VSMC 

proliferation  through  an  autocrine  and  paracrine  process181.  As  the  calcification  of  VSMCs 

requires proliferation to be halted  in order for transdifferentiation  into an osteochondrogenic 

phenotype, the high expression of TenC mRNA  in Ddr1‐/‐ VSMCs may result  in  increased TENC 

protein expression, thus restricting transdifferentiation by promoting proliferation.  

 

DDR1 Deficiency Results  in Reduced RUNX2 Activity and Osteocalcin Expression  in Vascular 

Smooth Muscle Cells   

The  transcription  factor  RUNX2  mediates  the  transdifferentiation  of  VSMCs  to  an 

osteoblast‐like  phenotype69,  173.  Therefore,  I  was  interested  in  determining  whether  DDR1 

regulates  either  RUNX2  expression  or  its  activity.  The mRNA  expression  of  Runx2  increased 

after  culturing  in  osteogenic  media  and  peaked  at  2  days  in  both  Ddr1‐/‐  and  Ddr1+/+ 

VSMCs(Figure 10A). By 12 days however the Runx2 mRNA diminished back to pre osteogenic 

culturing  levels. Despite the upregulation  in Runx2 mRNA expression with osteogenic culture, 

the  levels  of  Runx2 mRNA  in Ddr1‐/‐  and Ddr1+/+ VSMCs  showed  no  differences  at  any  time 

44 

 

 

point.    Immunoblotting  revealed  that RUNX2 protein expression  increased  from 2 days  to 12 

days in VSMCs. However, similar to mRNA levels there were no significant differences in RUNX2 

protein expression between Ddr1‐/‐ or Ddr1+/+ VSMCs at either the 2 day (Figure 10B), or the 12 

day  (Figure  10C)  time  points.  Overall,  this  indicated  to me  that  DDR1  did  not  change  the 

expression of RUNX2.  

To determine whether RUNX2 activity was altered between Ddr1‐/‐ and Ddr1+/+ VSMCs, a 

luciferase  activity  assay  was  performed  on  cells  that  were  transfected  with  6OSE2‐LUC 

construct. The 6OSE2‐LUC construct measures RUNX2 activity using a firefly luciferase reporter. 

Ddr1‐/‐ VSMCs showed a decrease  in RUNX2 activity compared to Ddr1+/+ VSMCs even prior to 

the  addition  of  osteogenic media  (Figure  11A).  The  RUNX2  activity  remained  unchanged  in 

Ddr1‐/‐ VSMCs after 2 days of osteogenic treatment, whereas RUNX2 activity  in Ddr1+/+ VSMCs 

drastically  increased  (Figure 11A). These experiments  indicated  that Ddr1 deletion prevented 

RUNX2 activation under osteogenic conditions.  

Next,  I  wanted  to  determine  whether  the  expression  of  Ocn,  a  gene  regulated  by 

RUNX2,  would  reflect  the  results  observed  with  the  activity  assay.  Ocn  mRNA  expression 

showed a decrease  in expression  in Ddr1‐/‐ VMSCs at 0, 2 and 12 days  in osteogenic  culture 

when compared to Ddr1+/+ VSMCs (Figure 11B). In addition I saw an increase in Ocn expression 

in Ddr1+/+ VSMCs after osteogenic treatment. This increase was absent in Ddr1‐/‐ VMSCs. Taken 

together these results suggest that VSMCs were undergoing osteogenic transdifferentiation and 

the absence of DDR1 attenuated the process. 

 

 

45 

 

 

P38  inhibition  Reduces  RUNX2 Activity  and Osteocalcin mRNA  Expression,  but  not  RUNX2 

Nuclear Localization in DDR1 Expressing Vascular Smooth Muscle Cells 

  The effective nuclear transport of RUNX2  is  important  in regulating  its activity. To test 

whether DDR1 affects  the nuclear  transport of RUNX2  I  immunostained  for RUNX2  in Ddr1‐/‐ 

and Ddr1+/+ VSMCs  in osteogenic culture. There was a  significant decrease  in RUNX2 nuclear 

localization in Ddr1‐/‐ VSMCs compared with Ddr1+/+ VSMCs at both 2 and 12 days (Figures 12A, 

B  and C). Next,  since  ERK1/2  and P38  are  activated downstream of DDR1  signalling  and  are 

activators of RUNX2  5,  9,  17,  18,  I determined whether  inhibiting MEK or P38 would alter DDR1 

dependant RUNX2 activity  (Figure 13A) and Ocn mRNA expression.   Treatment with MEKi did 

not alter RUNX2 activity or Ocn mRNA levels (Figure 13B) in Ddr1‐/‐ or Ddr1+/+ VSMCs compared 

to  their  respective  DMSO  controls.  However,  treatment  with  P38i  significantly  decreased 

RUNX2 activity  in  the Ddr1‐/‐ and Ddr1+/+ VSMCs  (Figure 13A). P38i  significantly  reduced Ocn 

expression  levels  in Ddr1+/+ VSMCs, but did not alter  levels  in Ddr1‐/‐ VSMCs (Figure 13B). The 

differences  in  RUNX2  activity  and Ocn mRNA  expression were  not  due  to  change  in  Runx2 

mRNA expression, as P38  inhibition  treatment  failed  to alter RUNX2 mRNA  (Figure 13C) This 

shows that P38 inhibition decreased RUNX2 activity and not expression of mRNA.  

Next I determined whether the decrease in RUNX2 activity after P38 inhibition was due 

to altered RUNX2 nuclear  localization.  I found that neither MEKi (Figure 14B) nor P38i (Figure 

14C)  affected  RUNX2  nuclear  localization  in  Ddr1‐/‐  and  Ddr1+/+  VSMCs.  Thus,  although  P38 

signalling may play a role in the activation of RUNX2, it does not affect the nuclear localization 

of RUNX2 under osteogenic conditions in VSMCs. This suggested to me that DDR1 regulates the 

nuclear localization of RUNX2 by another mechanism. 

46 

 

 

DDR1 Deficiency Impairs phosphoP38 Nuclear Localization 

  I wanted  to understand ERK and P38  signalling  in DDR1 modulation of osteogenically 

cultured VSMCs, because DDR1 was previously  shown  to  activate ERK1/2  and P389,  17,  18.  To 

address  this,  I  performed  immunoblotting  of  ERK1/2  and  P38  in  Ddr1‐/‐  and  Ddr1+/+  VSMC.  

There were  no  differences  in  ERK1/2  or  P38  phosphorylation  comparing Ddr1‐/‐  and Ddr1+/+ 

VSMCs after 2 days of culture (Figures 15A and 16A). However, by 12 days Ddr1‐/‐ VSMCs had 

significant decreases  in ERK1/2 and P38 phosphorylation compared to Ddr1+/+ VSMCs (Figures 

15B and 16B).  

Although I did not see an alteration in P38 phoshorylation at 2 days between Ddr1‐/‐ and 

Ddr1+/+ VSMCs (Figure 15A), I saw a decrease  in RUNX2 activity  in Ddr1‐/‐ VSMCs compared to 

Ddr1+/+  VSMCs  (Figure  11A).  In  addition,  I  saw  that  RUNX2  activity  in  Ddr1+/+  VSMCs  was 

sensitive to P38  inhibition (Figure 13A). Therefore I hypothesized that  in the absence of DDR1 

the delivery of phosphoP38 to RUNX2 in the nucleus might be hindered. Indeed, phospho P38 

failed  to  localize  to  the nucleus  in Ddr1‐/‐ VSMCs, but was present  in  the nucleus of Ddr1+/+ 

VSMCs (Figure 17 A and B).  

 

DDR1  Regulates  RUNX2  Nuclear  Localization  and  Activity  by  Modulating  a  Dynamically 

Unstable Microtubule Network in Vascular Smooth Muscle Cells 

  The loss of DDR1 disrupts both phosphoP38 and RUNX2 nuclear localization, Therefore, 

DDR1  likely  regulates  a mechanism  common  to  both  proteins.  Previously,  the  expression  of 

DDR1  was  shown  to  regulate  the  microtubule  network  in  mesenchymal  stem  cells15.  As 

microtubules  regulate  the nuclear  localization of phosphoP38 and RUNX2131,  182,  I wanted  to 

47 

 

 

determine  whether  the  microtubule  network  was  disrupted  in  DDR1‐deficient  VSMCs  in 

osteogenic culture. I first analyzed cell morphology by examining Ddr1‐/‐ and Ddr1+/+ VSMCs  in 

osteogenic media using differential interference contrast microscopy. I saw that Ddr1+/+ VSMCs 

cultured  in osteogenic media  for 2 days had a more  slender  cell  shape,  compared  to Ddr1‐/‐ 

VSMCs of  the  same  cohort, which exhibited  a more  spread  cell  shape  (Figure 18A). Also,  α‐

tubulin staining of Ddr1‐/‐ VSMCs after 2 (Figure 18B) and 12 days (Figure 18C) showed diffuse 

cytoplasmic  staining,  while  Ddr1+/+  VSMCs  showed  strong  staining  of  well  organized 

microtubules.   Since  I observed differences  in microtubule organization between Ddr1+/+ and 

Ddr1‐/‐ VSMCs, I next wanted to determine whether RUNX2 binding to the microtubule network 

was affected.  Immunostaining revealed  that RUNX2 shows relatively  little co‐localization with 

the diffuse cytoplasmic tubulin in Ddr1‐/‐ VSMCs, whereas RUNX2 strongly co‐localizes with the 

well defined microtubules in the Ddr1+/+ VSMCs (Figure 19). This indicates that RUNX2 does not 

bind to diffuse cytoplasmic tubulin.  

I  next  hypothesized  that  experimental  disruption  of  microtubules  to  prevent 

microtubule  polymerization would  prevent  the  nuclear  localization  and  activity  of  RUNX2  in 

Ddr1+/+  VSMCs.  I  chose  to  use  nocodazole,  as  it  binds  to  α  and  β‐tublin  heterodimers  to 

accelerate GTPase  activity  in  β‐tubulin  to  prevent  polymerization  into microtubules183. After 

depolymerisation of microtubules with nocodazole there was a significant reduction in nuclear 

localization of RUNX2  in the Ddr1+/+ VSMCs (Figure 20B ) compared to DMSO treated controls 

(Figure 20A).  I then analyzed RUNX2 activity and Ocn mRNA expression  in Ddr1‐/‐ and Ddr1+/+ 

VSMCs  treated with nocodazole. Treatment with nocodazole did not affect RUNX2 activity  in 

Ddr1‐/‐ VSMCs, but significantly decreased RUNX2 activity  in Ddr1+/+ VSMCs  (Figure 21A). This 

48 

 

 

indicated  that  DDR1 mediated  RUNX2  activity  is  sensitive  to microtubule  depolymerization. 

However Ocn mRNA  expression  under  nocodazole  treatment  did  not  follow  that  of  RUNX2 

activity.  Instead nocodazole  significantly  increased Ocn mRNA expression  in both Ddr1‐/‐ and 

Ddr1+/+ VSMCs  (Figure 21B).   Thus Ocn mRNA expression may be  influenced by  factors other 

than RUNX2 after microtubule destabilization. 

I next hypothesized that stabilizing microtubules with the microtubule stabilizing agent 

would affect RUNX2 localization and activity in a DDR1 dependant manner in VSMCs. Taxol, the 

microtubule  stabilizing  agent  binds  a  hydrophobic  pocket  in  β‐tubulin  to  promote 

polymerization  in  absence  of  GTP184.  The  addition  of  taxol was  able  to  rescue  the  nuclear 

localization  of  RUNX2  in  Ddr1‐/‐  VSMCs,  (Figure  20C).  I  therefore  hypothesized  that  RUNX2 

activity and Ocn mRNA  in Ddr1‐/‐ VSMCs would be  similarly  rescued by  the addition of  taxol. 

However, treatment with taxol did not affect RUNX2 activity in Ddr1‐/‐ VSMCs, but significantly 

decreased  RUNX2  activity  in  Ddr1+/+  VSMCs  (Figure  21A).  By  contrast,  taxol  significantly 

increased Ocn mRNA expression  in both Ddr1‐/‐ and Ddr1+/+ VSMCs (Figure 21B). These results 

suggest that Ocn mRNA expression  is subject to other  factors related to microtubule kinetics, 

which  are  independent  of  RUNX2  activity  in  VSMCs.  I  then  wanted  to  demonstrate  that 

treatments  with  nocodazole  and  taxol  decreased  RUNX2  activity  by  altering  microtubule 

stability but not by decreasing RUNX2 expression. Runx2 mRNA levels showed that nocodazole 

or taxol treatment did not diminish levels, but rather increased expression (Figure 21C). Taken 

together  the  results  suggest  that  DDR1 mediated  RUNX2  activity  by  stabilizing microtubule 

translocation. Hindrance of RUNX2 activity by microtubule depolymerizing or stabilizing agents 

49 

 

 

indicates  the  DDR1  mediated  activation  of  RUNX2  requires  the  dynamic  instability  of 

microtubules.  

 

DISCUSSION 

DDR1 in matrix calcification 

In  the current  study,  I examined  the  role of DDR1  in VSMC mediated calcification. To 

begin,  I  utilized  an  in  vitro  osteogenic model  and  examined  the  functional  consequences  of 

Ddr1  deletion  in  VSMCs  on matrix  calcification.  I  found  that Ddr1  deletion  blunts  calcifying 

potential  in VSMCs cultured  in osteogenic media  for 12 days. Previous work has  linked type  I 

collagen  to  VSMC  transdifferentiation  into  an  osteoblast‐like  calcifying  phenotype  20,  149,  185. 

However,  work  on  another  type  I  collagen  receptor,  integrin  β1  demonstrated  that  it 

functioned to prevent calcification instead149. While the exact mechanism by which integrin β1 

is able to inhibit calcification is not entirely clear, the pro‐ or anti‐calcifying properties of type I 

collagen  are  likely  to be  receptor‐specific. DDR1  represents  a  receptor  through which  type  I 

collagen may be able to promote a calcifying phenotype. Although DDR1  interacts with type  I 

collagen,  it  also  interacts with  types  II‐VI  and VIII  collagens,  all  of which  are  present  in  the 

atherosclerotic plaque30. I therefore could not clearly identify which collagen type(s) interacted 

with DDR1 to promote osteochondrogenic differentiation in my study. Although it has not been 

implicated  in  VSMCs  transdifferentiation  or  calcification,  type  II  collagen  is  able  to  induce 

chondrogenesis  in mesenchymal  stem  cells186  and  adipocytes187.  Other  studies,  including  a 

previous  study  from  our  laboratory,  have  demonstrated  that  Type  II  collagen  is  deposited 

50 

 

 

within calcified regions the atheroscleroslerotic plaque59, 188. This represents another collagen 

which may regulate the osteochondrogenic transdifferentiation process  in VSMCs. My study  is 

the first to demonstrate that DDR1  is able to accelerate the calcifying potential of VSMCs and 

provides a receptor through which collagens may be able to regulate vascular calcification. 

 

Phosphate Handling in DDR1 Mediated Calcification 

I observed alterations  in the expression of Pit‐1, Alp and Npp1  in Ddr1‐/‐ VSMCs during 

early but not  late  stage  calcification. My  results  showed  that during early  stage  calcification 

both Alp and Npp1 expression were decreased in the Ddr1‐/‐ VSMCs while the expression of Pit‐

1 was  increased. While  the decrease and  increase  in Npp1 and Pit‐1 expression  in  the Ddr1‐/‐ 

VSMCs respectively did not seem  to be  in  line with  the decreased calcification observed,  it  is 

likely the decrease in Alp expression was able to overcome the Npp1 and Pit‐1 expression levels 

to decrease calcification  in the Ddr1‐/‐ VSMCs. Furthermore, the  increase  in Pit‐1 expression  in 

the  Ddr1‐/‐  VSMCs maybe  a  compensatory mechanism  in  response  to  the  decrease  in  Alp 

expression  in order to  increase  intracellular Pi  levels. Although at  late stage calcification both 

Ddr1+/+   and Ddr1‐/‐ VSMCs had no significant changes  in expression of these genes, the early 

changes  in  phosphate  handling  genes  were  likely  sufficient  to  create  the  differences  in 

calcification between Ddr1+/+ and Ddr1‐/‐ VSMCs.  

I also observed in the course of this study, changes in the mRNA levels of Pit‐1, Alp and 

Npp1 from early to late stage calcification. As Alp is a marker for osteogenic transdifferentiation 

it was  not  surprising  to  see  its  levels  increase  as  calcification  progresses  as  is  reported  in 

51 

 

 

literature121.  Conversely, Pit‐1 mRNA expression was reduced as calcification progressed. While 

the  change  of  expression  in  Pit‐1  through  the  progression  of  calcification  has  not  been 

described  in  literature,  it  is possible  that  there  are  sufficient  intracellular  levels of Pi  at  late 

stage  calcification  and  hence  the  reduction  in  Pit‐1  mRNA  expression  at  that  time  point. 

Another possibility for the reduction of Pit‐1 expression is to compensate for the increased Alp 

expression at that time. 

 Finally, the decrease in Npp1 mRNA levels over the course of vascular calcification has 

been described  in  literature.  In most studies the decrease of NPP1 expression  is the cause of 

vascular  calcification104,  189.  As  a  result  NPP1  expression  decreases with  the  progression  of 

calcification. While  it  has  been  determined  this  is  the  cause  of  vascular  calcification,  it  is 

unknown whether  this  also  occurs  as  a  result  of  calcification. While my  results may  seem 

contradictory to current literature, it may also be possible that Npp1 increases in expression as 

a negative feedback mechanism to prevent calcification. Opn is an example of a gene which is 

associated with the development of vascular calcification and is commonly used as a marker of 

the osteochondrogenic phenotype93. However it was discovered that OPN expression inhibited 

vascular calcification82, 190. Together it appears that DDR1 alters the expression of Pit‐1, Alp and 

NPP1 mRNA levels during calcifying conditions, which likely affects vascular calcification. 

 

Smooth Muscle Phenotype in DDR1 Mediated Calcification 

  VSMCs  are  the primary  cell  type which  transdifferentiates  into  an osteoblast  like  cell 

type  to promote calcification of  the vascular  tissue69. As  the VSMCs  transdifferentiates  into a 

52 

 

 

osteoblast  like cell,  its  smooth muscle characteristics are  lost69.  I determined whether or not 

DDR1 affects the smooth muscle phenotype by examining the expression of smooth muscle cell 

markers. I determined in my studies that absence of DDR1 does not increase the expression of 

the smooth muscle marker αSMA. While it is generally accepted that VSMC markers decrease in 

expression as vascular calcification progresses, most documented  studies  show  that  they will 

continue to express VSMC markers69, 158. Another explanation would be that DDR1 has no affect 

on the VSMC phenotype during calcification. Despite this, I have not performed an exhaustive 

screen of all VSMC markers. Validated markers of the VSMC phenotype are SM22α, Myocardin 

and SM‐MHC69,  158. Although useful as a gauge  to determine VSMC phenotype, many  studies 

have misidentified cells as being VSMC on the basis of an  inadequate screen of markers191‐193. 

Furthermore, VSMCs have also been misidentified as other cell types due to a temporary loss of 

markers  during  injury  or migration194,  195. Despite  this,  experimental  evidence  from Giachelli 

and colleagues showed that expression of VSMC markers does not  impact osteochondrogenic 

pathways or hinder calcification158. Thus,  the expression  level of VSMC markers  likely has no 

impact the calcifying potential in my study.   

I  have  also  observed  a  significant  increase  in  the  expression  of  TenC mRNA,  but  no 

change  in  the  expression  of  Atf4  in  Ddr1‐/‐  VSMCs.  As  TENC  acts  to  promote  VSMC 

proliferation181, Ddr1‐/‐ VSMCs might have higher rates of proliferation under my experimental 

conditions,  however  I  did  not measure  proliferation  in my  studies ATF4  is  also  a marker  of 

proliferation180, but unlike TenC, I did not see any significant differences between Ddr1+/+  and 

Ddr1‐/‐ VSMCs. Despite  this,  the  increased  TenC  levels  in Ddr1‐/‐ VSMCs may be  sufficient  to 

promote  a  higher  rate  of  proliferation  in Ddr1‐/‐ VSMCs.  In  line with my  study,  Curat  et.  al. 

53 

 

 

previously reported that Ddr1‐/‐ mesangial cells show higher rates of proliferation than Ddr1+/+  

cells196.  As  osteochondrogenic  transdifferentiation  occurs,  VSMC  proliferation  needs  to  be 

suppressed179. This continued signal for proliferation  in the Ddr1‐/‐ VSMCs may serve to  inhibit 

calcification  in  these VSMCs. Together;  these  results  indicate  that DDR1 does not alter VSMC 

phenotype  under  calcifying  conditions,  but  may  suppress  VSMC  proliferation  to  allow  for 

osteochondrogenic conversion.  However I have not yet measured proliferation. 

During  endochondral  ossification,  the  osteoid  is  synthesized  by  chondrocytes,and  is  later 

calcified by osteoblasts97. While there  is  limited evidence that chondrocytes transdifferentiate 

into  osteoblasts197,  it  is  believed  that  osteoblasts  stem  largely  from  the  common 

osteochondrogenic progenitor198. As VSMCs  in atherosclerotic calcification  frequently express 

both osteoblast and chondrocyte markers, the predominately held view  is that atherosclerotic 

calcification mirrors  endochondral  ossification.    Indeed,  a  previous  study  by  our  laboratory 

showed that chondrocyte markers such as SOX9, Type II and Type X collagens were expressed in 

atherosclerotic plaques59.  In  this present  study  I also observed  that DDR1 deletion decreases 

osteoblast markers such as Ocn and Alp expression.   However I did not screen for chondrocyte 

markers. During arterial calcification,  it  is not clear whether  the expression of osteoblast and 

chondrocyte markers represents one homogenous population of cells performing both roles, or 

two  separate  populations  of  cells  each  with  separate  roles.  Futhermore,  prior  work  on 

ossification  suggests  that  the chondrogenic phenotype antagonizes  the osteoblast phenotype 

through the expression of SOX9199. Therefore,  if DDR1  is able to alter the expression of SOX9, 

this represents a mechanism by which DDR1 can regulate the osteoblast phenotype and thus 

calcification.   Despite  the  incomplete  information  regarding VSMC  transdifferentiation during 

54 

 

 

atherosclerotic  calcification,  it  is  clear  that  during  atherosclerotic  calcification  VSMCs  lose 

smooth  muscle  characteristics,  and  have  transdifferentiated  into  cells  which  have 

characteristics of chondrocytes and or osteoblasts. 

 

DDR1 Mediated RUNX2 activation 

In  this  study  I  did  not  observe  any DDR1  dependant  differences  of  RUNX2 mRNA  or 

protein expression. However I did see an increase in Runx2 mRNA expression which peaked at 

day 2 and declined back to baseline  levels by day 12. RUNX2 protein  levels  increased steadily 

from 2 to 12 days. The increase in RUNX2 protein over the course of vascular calcification is well 

documented and is consistent with my findings109, 157. It is possible that Runx2 mRNA expression 

is decreased as a  result of negative  feedback  from  the RUNX2 protein  that accumulates.  It  is 

noted that RUNX2 changes isoforms from the long lived type I to the rapidly degraded type II at 

late  stage  calcification  in  bone  development134.  It would  therefore  be  expected  that  Runx2 

mRNA  levels would  be  increased  in  order  to  replenish  the  rapidly  degraded  type  II  RUNX2 

molecules at  late  stage calcification. However,  this was not observed  in my  study. While  the 

conversion of type I to type II RUNX2 has been established in bone development134, this process 

may not occur  in VSMCs undergoing osteochondrogenic trandifferentiation. Furthermore, the 

RUNX2 isoform switch may occur at a much later time point in VSMCs which this study has not 

analyzed.  

 There were no genotype‐dependent differences in RUNX2 mRNA or protein levels, but I 

did  see  a  significant  decrease  in  RUNX2  activity  in  Ddr1‐/‐  VSMCs.  Paradoxically  I  saw  that 

55 

 

 

RUNX2 activity was sensitive to P38i treatment despite not showing any differences in activated 

phosphoP38 levels at that stage of calcification. I attributed this to the regulation of RUNX2 by 

microtubules, which will be discussed in depth later. Even though P38 activation may not play a 

role in activating RUNX2 in a DDR1 dependant manner at this stage, it cannot be discounted as 

having an effect in DDR1 regulation of RUNX2. I observed a significant decrease in phosphoP38 

levels  at  the  12  day  time  point.  It  is  conceivable  that  while  VSMCs  are  in  culture  they 

synthesized much more matrix  by  day  12  and  hence  there  is  an  increase  in DDR1  receptor 

activation  by  day  12  due  to  increased  number  of  DDR1  ligands  in  the  cell  culture.  As  P38 

signalling has been demonstrated as an important activator of RUNX2147, 177, it would likely alter 

RUNX2 activity at this stage. Unfortunately the effect of P38 inhibition on RUNX2 activity at late 

stage calcification could not be assessed due the sensitivity of Ddr1‐/‐ VSMCs to cell death under 

P38 inhibition. 

I also found that  inhibition of ERK1/2 signalling did not affect RUNX2 activity  in VSMCs 

Previous  literature  reported  that  ERK1/2  is  an  activator  of RUNX2,  and  a  even more  potent 

activator of RUNX2 than P38147 in mesenchymal stem cells and osteoblasts.. Taken together, my 

results demonstrate for the first time that DDR1 is able to regulate the activity RUNX2; however 

this is not dependent upon ERK1/2 or P38 activity at early stages of calcification.  

 

Microtubles in DDR1 Mediated RUNX2 activity 

Previously there have been no works linking DDR1 to the modulation of microtubules or 

the nuclear translocation of proteins. My study provides evidence that DDR1 is able to regulate 

56 

 

 

the  microtubule  network  which  controls  RUNX2  nuclear  localization  and  activity.  As  the 

regulation  of  vascular  calcification  by  any  component  of  the  cytoskeleton  has  never  been 

explored, my work  on  the  regulation  of  RUNX2  by DDR1  via microtubules may  represent  a 

paradigm shift for further investigations on vascular calcification. 

My  study  also  showed  that  phosphoP38,  another  protein  requiring microtubules  for 

nuclear  transport,  also  showed  reduced  nuclear  localization  in  Ddr1‐/‐  VSMCs. While  it was 

previously thought that most proteins translocate  into the nucleus through Brownian motion, 

there  is  a  growing  body  of  literature  that  shows many  proteins  such  as  steroid  hormone 

receptors200,  transcription  factors131,  131,  171 and  signalling kinases182 which  require  the use of 

microtubules.   

I  have  shown  that  RUNX2  co‐localizes  with  the microtubule  network  in  the  Ddr1+/+ 

VSMCs,  but  not  in  Ddr1‐/‐  VSMCs.  This  is  consistent with  studies  by  Pockwinse  et.  al. who 

showed  that  RUNX2  binds  to  microtubules131.  Thus,  it  was  not  surprising  to  see  that 

depolymerizing microtubules  by  treatment with  nocodazole  prevented  both  RUNX2  nuclear 

localization  and  activity  in  Ddr1+/+  VSMCs.   Many  previous  studies  have  shown  that  either 

stabilizing or preventing the polymerization of microtubules alters transport of protein cargoes.  

In  contrast,      I  found  that  stabilizing microtubules  by  treatment with  taxol  rescues  RUNX2 

nuclear localization in Ddr1‐/‐ VSMCs. This finding was consistent with the results of a study by 

Pockwinse et. al who showed that taxol treatment increased nuclear population of RUNX2 and 

decreased  its  cytoplasmic  population  131.  As  microtubule  facilitated  nuclear  transport  is  a 

relatively  new  area  of  investigation,  there may  be  other  proteins whose  transport  into  the 

57 

 

 

nucleus depends solely on stabilization. Despite rescuing nuclear  localization  in Ddr1‐/‐ VSMCs, 

the stabilization of microtubules by taxol was unable to restore RUNX2 activity. Since taxol acts 

to  lock microtubules  in a stable but static state,  it prevents dynamic  instability. Therefore my 

results suggest that activation of RUNX2 may require the dynamic  instability of microtubules. 

Although we have not tested this, a possible explanation for this  is that phosphoP38 requires 

dynamic  instability as previously demonstrated182. As RUNX2 phosphorylation by phosphoP38 

likely occurs  in  the nucleus,  restriction of phosphoP38  in  the  cytosol will effectively prevent 

RUNX2 activation. Another possibility  is that the  incubation time with taxol used  in this assay 

was not sufficient to allow the newly translocated RUNX2 to act upon the reporter construct. 

Unfortunately,  longer term treatments with taxol result  in cell death and detachment so  I am 

not able to assess the long term effects on RUNX2 activity and in vitro calcification.  

  In my  studies  I  found  that Ocn mRNA  expression was  increased with  either  taxol  or 

nocodazole  treatment  in  both  genotypes.  Thus  Ocn  expression  was  induced  even  in  the 

absence  of  RUNX2  activation.  A  possible  explanation  lies with  the  differences  between  the 

reporter promoter construct  I used and the Ocn promoter. Although both 6OSE2‐LUC and the 

Ocn  promoter  contain  six  OSEs,  the  Ocn  promoter  may  contain  binding  sites  for  other 

transcriptional  elements.    Although  numerous  pathways  have  been  shown  to  activate  Ocn 

expression,  they  all  converge  on  RUNX2  activation201‐204.  It  is  entirely  possible  that  when 

manipulating microtubules, factors which have not yet been  identified act on Ocn expression. 

Vegf is another gene which contains OSEs, it however also contains HIF1α Responsive Elements 

which  are  activated  by  HIF1α  and  entirely  independent  of  RUNX2205.  Since  the  6OSE2‐Luc 

construct is only activated by RUNX2; its measured activity it is likely more accurate. 

58 

 

 

  DDR1 regulation of microtubules, although poorly explored,  it  is not unprecedented131. 

There  have  also  been many  documented  cases where DDR1  is  shown  to  regulate  processes 

related to microtubule function. Cell spreading for example  is a process that  is regulated by a 

dynamic microtubule network206. In this study, I observed Ddr1‐/‐ VSMCs also showed more cell 

spreading than Ddr1+/+ VSMCs. This finding  is consistent   with a previous study which showed 

that DDR1 suppressed the  spreading of HEK293 cells 207. Studies on VSMCs have also hinted at 

DDR1  regulation  of microtubules.  Cell migration  is  a  process  that  depends  on microtubule 

action208. As previously discussed in the introduction, Ddr1‐/‐ VSMCs show significantly reduced 

cell migration52,  131.  Taken  together,  previous  literature  and my  results  suggest  that  DDR1 

regulates dynamic instability in microtubules which is required for RUNX2 nuclear translocation 

and activity during VSMC calcification. 

 

Future Directions 

  In  the  current  study  I  identified  a mechanism  by which DDR1  is  able  to  control  the 

osteogenic process, determining that DDR1 mediate the nuclear translocation of RUNX2 via the 

microtubule  network.  Also  of  interest  is  whether  kinase  activity  of  DDR1  is  required  to 

modulate the microtubule network and RUNX2 nuclear translocation. Although there are many 

functions of DDR1 which require the phosphorylation, other functions such VSMC attachment 

to matrix and controlling the collective migration of cells does not require its kinase activity209. 

Therefore  it may be possible that DDR1 regulates microtubules through a kinase  independent 

pathway.  This  can  easily  be  tested  by  adding  the  RTK  phosphorylation  inhibitor,  Imatinib  in 

59 

 

 

VSMCs during osteogenic culture. Although  Imatinib  inhibits all RTKs,  it most strongly  inhibits 

the phosphorylation of DDR1210. This method  can be used  to determine whether or not  the 

translocation  of  RUNX2  requires  the  phosphorylation  of  DDR1.  To  further  validate  this 

mechanism, a kinase dead construct of DDR1 can be transfected into Ddr1‐/‐ VSMCs cultured in 

osteogenic conditions in order to determine if it affects RUNX2 translocation. 

  Work  on  osteogenic  development  shows  that  type  I  collagen  is  a  pro‐osteogenic 

molecule10, 93, 209. While my work implies that DDR1 represents a functional link between type I 

collagen and RUNX2 activity, further work is need to determine this. Although DDR1 is a Type I 

collagen receptor, it is also able to bind other collagen ligands185. Although studies have shown 

that VSMCs synthesize type I collagen in vitro, VSMCs also synthesize other collagens which are 

DDR1  ligands185,  211.  In  order  to  fully  demonstrate which  collagen  is  able  to  elicit  the  pro‐

osteogenic  effects  through DDR1,  VSMCs  can  be  cultured  in  osteogenic  conditions with  the 

addition of separate collagen ligands for DDR1. This will help determine which DDR1 ligand(s) if 

any affect the microtubule network which impacts RUNX2 translocation. 

Furthermore,  despite  numerous  lines  of  evidence  suggesting  that  DDR1  impacts 

microtubule related functions such as cell migration, invasion and proliferation 18, 29, 57, 58, 131, 212, 

the  mechanism  by  which  DDR1  regulates  microtubules,  during  osteogenic  conditions  or 

otherwise  remains  unknown.   My  study  suggests  that  there  is  a  difference  in  the  dynamic 

instability between microtubules in Ddr1‐/‐ and Ddr1+/+ VSMCs. However, in my study I was only 

able  to  examine  microtubule  structure  at  the  endpoints  of  calcification  due  to  available 

materials and reagents. Further studies can be carried out to examine  image the microtubule 

60 

 

 

network throughout the calcification process with Tubulin Tracker (Life Technologies) which  is 

flurophore conjugated to a microtubule binding compound which does not hinder microtubule 

formation. This compound will allow me to determine microtubule growth rates and cycling as 

modulated  by  DDR1  through  live  cell  microscopy.  In  addition,  the  dynamic  instability  of 

microtubules  is  regulated  by  two  main  factors,  acetylation  of  tubulin  and  the  binding  of 

microtubule  associated  proteins  to  tubulin213.  Hypothetically  DDR1  could  regulate  either  or 

both  of  these  factors  to  regulate  dynamic  instability  of microtubules.    This  can  further  be 

investigated by using an acetyled tubulin antibody for immunofluoresce and immunoblotting in 

the  cultured  cells. Candidate microtubule  associated  proteins  can  also  be  identified  through 

mass spectrometry. 

It  is  interesting to note that under circumstances where there are  large concentrations 

of the transcription factor in question, the requirement for microtubules in nuclear localization 

is  uncoupled171,  214.  Since  RUNX2  expression  in  both  DDR1  expressing  and  Ddr1‐/‐  VSMCs 

increases  over  time  in  osteogenic  culture,  it  would  be  interesting  to  investigate  whether 

microtubule requirement for nuclear localization is lost over time. This can also be determined 

by  overexpressing  RUNX2  in  DDR1  expressing  and  Ddr1‐/‐  VSMCs  in  osteogenic  culture  and 

determining if RUNX2 overexpression eliminates the need for DDR1 regulation of microtubules 

for nuclear translocation. 

 

 

 

61 

 

 

Conclusions 

My  study  is  the  first  to  identify  the mechanistic  ability  of  DDR1  to  regulate  VSMC 

calcification.  DDR1  is  crucial  in  the  regulation  of  osteochondrogenic  transcriptional  activity 

through  its  regulation of RUNX2 activity  in VSMCs.  I have demonstrated  that DDR1  regulates 

the  dynamic  instability  of  microtubules  in  VSMCs.  In  absence  of  DDR1,  microtubule 

polymerization  is  hindered  and  thus  RUNX2  is  unable  to  bind  to  unpolymerized  tubulin 

molecules,  thus  unable  to  enter  the  nucleus.  I  have  also  demonstrated  that  inducing 

microtubule  polymerization  in  DDR1  KO  VSMCs,  rescues  nuclear  localization.  Although  the 

finding  that  polymerized  microtubules  results  in  RUNX2  nuclear  translocation  is  not 

unprecedented131, this study is the first to show that rescuing RUNX2 nuclear localization does 

not  rescue  activity.  Although  the  mechanism  has  not  been  thoroughly  investigated  the 

cytoplasmic abundance of phosphoP38 during the absence of DDR1, hints that DDR1 regulation 

of microtubule has an effect on phosphoP38 localization as well. The effect of DDR1 regulation 

of microtubules  in  VSMCs  does  not  seem  to  be  limited  to  nuclear  translocation  alone.  Cell 

spreading  a  common  phenomenon  in  cells with  hindered microtubule  regulation215,  is  also 

prevalent in the absence of DDR1 in VSMCs in my study. In conclusion my study demonstrates 

that  DDR1  a  novel  collagen  receptor  regulates  VSMC  calcification  through  microtubule 

moderation of RUNX2  activity.  The proposed model of DDR1  regulation of RUNX2  activity  is 

illustrated (Figure 22). 

 

 

62 

 

 

FIGURES 

 

Figure 1: Diagram of Normal Artery and Artery Affected by Atherosclerosis 

This diagram depicts a normal artery (left) and an artery affected by Atherosclerosis. Diagram 

was taken from http://www.pharmaceutical‐networking.com. 

 

63 

 

 

 

 

Figure 2: Diagram of DDR1 Isoforms in Humans and Mice 

This diagram depicts the five different DDR1 isoforms in humans and mice. Disocoidin Domain 

(DD), Transmembrane (TM), Juxatamembrane (JM), Tyrosine Kinase (TK). Green represents 37 

AA insert in the juxtamembrane region and red represents the six AA insert in the tyrosine 

kinase region. 

 

 

 

 

 

64 

 

 

 

Figure 3: Diagram of Molecules Which Regulate Pi and PPi Levels  

This diagram depicts molecules which regulate Pi and PPi levels within a cell and how they 

ultimately give rise or inhibit calcification.  

 

 

 

 

 

 

 

 

 

 

 

65 

 

 

 

 

Figure 4: Diagram of RUNX2 Isoforms in Humans and Mice 

This diagram depicts the two different RUNX2 isoforms in humans and mice. Amino Terminus 

(NT), RUNT DNA binding domain, Nuclear Translocation Matrix (NTM) and Destabilizing PEST 

domain. Red represents the region which contains the microtubule binding site. 

 

 

 

 

 

 

 

 

 

66 

 

 

 

Figure 5: Diagram of RUNX2 Stimulatory and Inhibitory Phosphoserine Residues 

This diagram depicts the known stimulatory and inhibitory phosphoserine residues on RUNX2 

and how they are activated by P38 and ERK1/2.  

 

 

 

 

67 

 

 

 

Figure 6: Diagram of Microtubule Dynamics 

This diagram depicts the dynamic instability of microtubules. GTP bound tubulin promotes 

polymerization, while GDP bound tubulin promotes disassembly. Diagram taken from Nature 

Reviews Cancer 4, 253‐265 (April 2004) 

 

 

68 

 

 

    

Figure 7: Ddr1‐/‐ VSMCs Show Decreased Calcifying Potential:  (A) Calcium content of Ddr1+/+ 

(black  bars)  and  Ddr1‐/‐  (gray  bars)  VSMC  cultures  measured  by  O‐cresophathelein  based 

colourimetric  assay  after  12  days  and  normalized  to  total  cellular  protein  using  a  BCA 

colourimetic  assay.  (B)  Calcium  content  of Ddr1+/+  (black  bars)  and Ddr1‐/‐  (gray  bars)  VSMC 

cultures  measured  by  O‐cresophathelein  based  colourimetric  assay  after  12  days  

andnormalized to total cellular DNA using a Hoechst nuclear dye based assay. Data shown are 

means ± SEM; n=3 

 

 

 

 

 

A  B

69 

 

 

           

 

Figure 8: Ddr1‐/‐ VSMCs Show Increased Pit‐1 mRNA Expression and Decreased Alp and Npp1 

mRNA Expression at Early but not Late Stage Calcification: (A) Ddr1+/+ (black bars) and Ddr1‐/‐ 

(gray bars) VSMC Pit‐1 mRNA levels at 2 and 12 days measured using qRT‐PCR. (B) Ddr1+/+ (black 

bars) and Ddr1‐/‐ (gray bars) VSMC Alp mRNA levels at 2 and 12 days measured using qRT‐PCR. 

(C)  Ddr1+/+  (black  bars)  and  Ddr1‐/‐  (gray  bars)  VSMC  Npp1 mRNA  levels  at  2  and  12  days 

measured  using  qRT‐PCR.  *  indicates  a  significant  difference  between  groups  (P<0.05). Data 

shown are means ± SEM; n=3. 

A  B

C 

Pit‐1  Alp

Npp1

70 

 

 

            

 

Figure  9: Ddr1‐/‐ VSMC  Show  no  Change  in  αSMA  Protein  and Atf4 mRNA  Expression,  but 

Show  Increased TenC mRNA Expression at Late but Not Early Stage Calcification:  (A) Ddr1+/+ 

(black  bars)  and  Ddr1‐/‐  (gray  bars)  VSMC  αSMA  protein  levels  at  12  days measured  using 

immunoblotting. (B) Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC Atf4 mRNA levels at 2 and 

12 days measured using qRT‐PCR.  (C) Ddr1+/+  (black bars) and Ddr1‐/‐  (gray bars) VSMC TenC 

mRNA  levels  at  2  and  12  days measured  using  qRT‐PCR.  *  indicates  a  significant  difference 

between groups (P<0.05). Data shown are means ± SEM; n=3. 

 

A 

B

C

αSMA 

Atf4

TenC 

71 

 

 

 

 

        

Figure  10:  Ddr1‐/‐  VSMCs  Show  No  Changes  in  RUNX2  Protein  and mRNA  Expression:  (A) 

Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC cultures from 2, 0 and 12 days was measured 

for Runx2 mRNA using qRT‐PCR. (B) RUNX2 protein levels from Ddr1+/+ (black bars) and Ddr1‐/‐ 

(gray  bars)  VSMC measured with  immunoblotting  at  2  days.  (C)  RUNX2  protein  levels  from 

Ddr1+/+  (black bars) and Ddr1‐/‐  (gray bars) VSMC were measured with  immunoblotting at 12 

days. *  indicates  a  significant difference between  groups  (P<0.05). Data  shown  are means ± 

SEM; n=3. 

A 

B C

Runx2 mRNA 

2 Days RUNX2 Protein  12 Days RUNX2 Protein 

72 

 

 

          

Figure 11: Ddr1‐/‐ VSMCs Show Reduced RUNX2 Activity and Ocn mRNA Expression: (A) RUNX2 

activity of Ddr1+/+  (black bars) and Ddr1‐/‐ (gray bars) VSMCs was measured using a  luciferase 

assay of 0 and 12 day cultures (B) mRNA levels of Ocn in Ddr1+/+ (black bars) and Ddr1‐/‐ (gray 

bars) VSMCs was measured using qRT‐PCR 0, 2 and 12 day  cultures. *  indicates a  significant 

difference between groups (P<0.05). Data shown are means ± SEM; n=3. 

 

 

 

 

 

 

BA  Osteocalcin mRNA RUNX2 Activity 

73 

 

 

        

 

Figure 12: Ddr1‐/‐ VSMCs Show Reduced RUNX2 Nuclear Localization:  (A) Ddr1+/+ and Ddr1‐/‐ 

cells from 2 days were 4% PFA fixed and stained for RUNX2 (Green) Nuclei were stained with 

Hoechst (blue). Scale bars = 20 µm. (B) Ddr1+/+ and Ddr1‐/‐  cells from 12 days were 4% PFA fixed 

and stained  for RUNX2  (Green) Nuclei were stained with Hoechst  (blue). Scale bars = 20 µm. 

(C)Quantification  of  RUNX2  nuclear  and  cytoplasmic  amounts  from  VSMC  in  2  and  12  days 

under osteogenic conditions Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars). * indicates a significant 

difference between groups (P<0.05). Data shown are means ± SEM; n=3.  

 

 

A  B

C 

2 Days  12 Days 

74 

 

 

 

     

   

Figure 13: RUNX2 Activity and mRNA  Levels of Osteocalcin are Sensitive  to P38i  in Ddr1+/+ 

VSMCs: (A) RUNX2 activity of Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC cultures treated 

with  DMSO,  10  µM  PD098059  (MEK  inhibitor)  or  SB203580  (P38  inhibitor) measured  using 

luciferase  activity  assay.  (B) Ocn mRNA  of Ddr1+/+  (black  bars)  and Ddr1‐/‐  (gray  bars)  VSMC 

cultures  treated with  DMSO,  10  µM  PD098059  (MEK  inhibitor)  or  SB203580  (P38  inhibitor) 

measured using qRT‐PCR. (C) Runx2 mRNA of Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC 

cultures  treated with  DMSO,  10  µM  PD098059  (MEK  inhibitor)  or  SB203580  (P38  inhibitor) 

measured  using  qRT‐PCR.  *  indicates  a  significant  difference  between  groups  (P<0.05). Data 

shown are means ± SEM; n=3.  

A  B

C 

RUNX2 Activity  Ocn mRNA 

Runx2 mRNA 

75 

 

 

     

           

Figure 14: Nuclear Localization of RUNX2  in Ddr1+/+ and Ddr1‐/‐ VSMCs Was Not Affected by 

MEKi or P38i: (A) Ddr1+/+ and Ddr1‐/‐ cells treated with DMSO were 4% PFA fixed and stained for 

RUNX2  (Green) Nuclei were  stained with Hoechst  (blue). Scale bars = 20 µm.  (B) Ddr1+/+ and 

Ddr1‐/‐ cells treated with 10 µM PD098059  (MEK  inhibitor) were 4% PFA  fixed and stained  for 

RUNX2  (Green) Nuclei were  stained with Hoechst  (blue). Scale bars = 20 µm.  (C) Ddr1+/+ and 

Ddr1‐/‐ cells  treated with 10 µM SB203580  (P38  inhibitor) were 4% PFA  fixed and  stained  for 

RUNX2 (Green) Nuclei were stained with Hoechst (blue). Scale bars = 20 µm. (D) Quantification 

of RUNX2 nuclear and cytoplasmic amounts of Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC 

A  B

C  D

DMSO MEKi 

P38i 

76 

 

 

cultures  in  2  and  12  days  under  osteogenic  conditions.  *  indicates  a  significant  difference 

between groups (P<0.05). Data shown are means ± SEM; n=3. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

77 

 

 

   

   

Figure  15:  Phospho  ERK1/2  Signalling  is Decreased  in Ddr1‐/‐ VSMCs  at  Late  but Not  Early 

Stage Calcification: (A) PhosphoERK1/2 protein levels from Ddr1+/+ (black bars) and Ddr1‐/‐ (gray 

bars) VSMC measured with  immunoblotting at 2 days. (B) PhosphoERK1/2 protein  levels from 

Ddr1+/+  (black bars) and Ddr1‐/‐  (gray bars) VSMC were measured with  immunoblotting at 12 

days. *  indicates  a  significant difference between  groups  (P<0.05). Data  shown  are means ± 

SEM; n=3. 

 

 

A 

B 

2 Days 

12 Days 

78 

 

 

   

   

 

Figure 16:   PhosphoP38 Signalling  is Decreased  in Ddr1‐/‐ VSMCs at Late but Not Early Stage 

Calcification:  (A) PhosphoP38 protein  levels  from Ddr1+/+  (black bars)  and Ddr1‐/‐  (gray bars) 

VSMC measured with  immunoblotting at 2 days.  (B) PhosphoP38 protein  levels  from Ddr1+/+ 

(black bars) and Ddr1‐/‐  (gray bars) VSMC were measured with  immunoblotting at 12 days. * 

indicates a significant difference between groups (P<0.05). Data shown are means ± SEM; n=3. 

 

A 

B  12 Days 

2 Days 

79 

 

 

     

   

Figure  17: Ddr1‐/‐  VSMCs  Show  Reduced  PhosphoP38 Nuclear  Localization:  (A) Ddr1+/+  and 

Ddr1‐/‐ cells  from 2 days were 4% PFA  fixed and stained  for phosphoP38  (Green) Nuclei were 

stained with Hoechst (blue). Scale bars = 20 µm. (B) Ddr1+/+ and Ddr1‐/‐  cells from 12 days were 

4%  PFA  fixed  and  stained  for  phosphoP38  (Green) Nuclei were  stained with Hoechst  (blue). 

Scale bars = 20 µm.  (C)Quantification of phosphoP38 nuclear and cytoplasmic amounts  from 

VSMC in 2 and 12 days under osteogenic conditions Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars). 

*  indicates  a  significant difference between  groups  (P<0.05). Data  shown  are means ±  SEM; 

n=3.  

A  B

C 

2 Days  12 Days 

80 

 

 

      

  

 

Figure  18:  Ddr1‐/‐  VSMCs  Show  Increased  Cell  Spreading  and  Reduced  α  Tubulin 

Polymerization: (A) Ddr1+/+ and Ddr1‐/‐ cells from 2 days were 4% PFA fixed and  imaged using 

DIC microscopy. Scale bars = 20 µm. (B) Ddr1+/+ and Ddr1‐/‐ cells from 2 days were 4% PFA fixed 

and stained for α Tubulin (Green) Nuclei were stained with Hoechst (blue). Scale bars = 20 µm. 

(C) Ddr1+/+ and Ddr1‐/‐  cells from 12 days were 4% PFA fixed and stained for α Tubulin (Green) 

Nuclei were stained with Hoechst (blue). Scale bars = 20 µm. 

 

A  B

C 12 Days 

2 Days 

81 

 

 

 

Figure 19: Ddr1‐/‐ VSMCs  Show Reduced RUNX2 Co‐Localization With Microtubules: Ddr1+/+ 

and Ddr1‐/‐ VSMC cultures in 2 days under osteogenic conditions (2.4 mM Pi) were 4% PFA fixed 

and stained for α Tubulin (Green) and RUNX2 (Red). Scale bars = 40 µm. 

 

 

 

82 

 

 

     

         

 

Figure  20:  Taxol  Increased RUNX2 Nuclear  Localization  in Ddr1+/+  and Ddr1‐/‐ VSMCs While 

Nocodazole, Prevented RUNX2 Nuclear Localization  in Ddr1+/+ VSMCs: (A) Ddr1+/+ and Ddr1‐/‐ 

cells treated with DMSO were 4% PFA fixed and stained for RUNX2 (Green) Nuclei were stained 

with  Hoechst  (blue).  Scale  bars  =  20  µm.  (B)  Ddr1+/+  and  Ddr1‐/‐  cells  treated with  10  µM 

nocodazole  (microtubule  destabilizing  agent)    were  4%  PFA  fixed  and  stained  for  RUNX2 

(Green) Nuclei were stained with Hoechst (blue). Scale bars = 20 µm. (C) Ddr1+/+ and Ddr1‐/‐ cells 

treated with  10 µM  taxol  (microtubule  stabilizing  agent) were  4% PFA  fixed  and  stained  for 

RUNX2 (Green) Nuclei were stained with Hoechst (blue). Scale bars = 20 µm. (D) Quantification 

A  B

C  D

DMSO  Nocodazole

Taxol 

83 

 

 

of RUNX2 nuclear and cytoplasmic amounts of Ddr1+/+ (black bars) and Ddr1‐/‐ (gray bars) VSMC 

cultures  in  2  and  12  days  under  osteogenic  conditions.  *  indicates  a  significant  difference 

between groups (P<0.05). Data shown are means ± SEM; n=3. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

84 

 

 

     

  

 

Figure 21: Nocodazole or Taxol Attenuated RUNX2 Activity  in Ddr1+/+ and Ddr1‐/‐ VSMCs but 

Increased Ocn mRNA Expression:  (A) RUNX2 activity of Ddr1+/+  (black bars) and Ddr1‐/‐  (gray 

bars) VSMC cultures treated with DMSO, 10 µM nocodazole or taxol measured using luciferase 

activity  assay.  (B)  Ocn mRNA  of  Ddr1+/+  (black  bars)  and  Ddr1‐/‐  (gray  bars)  VSMC  cultures 

treated with DMSO, 10 µM nocodazole or taxol measured using qRT‐PCR. (C) Runx2 mRNA of 

Ddr1+/+  (black  bars)  and  Ddr1‐/‐  (gray  bars)  VSMC  cultures  treated  with  DMSO,  10  µM 

nocodazole  or  taxol measured  using  qRT‐PCR.  *  indicates  a  significant  difference  between 

groups (P<0.05). Data shown are means ± SEM; n=3.  

A  B

C 

RUNX2 Activity  Ocn mRNA 

Runx2 mRNA 

85 

 

 

 

Figure  22:  Proposed  model  of  DDR1  regulation  of  RUNX2  activity  in  VSMCs:  The 

schematic highlights the possible pathway by which DDR1 acts  to  regulate RUNX2  in VSMCs. 

DDR1 is essential for organizing a microtubule network for the nuclear localization of RUNX2. 

 

 

 

 

 

 

 

86 

 

 

REFERENCES 

  (1)   Davignon J, Ganz P. Role of endothelial dysfunction in atherosclerosis. Circulation 2004 June 15;109(23 Suppl 1):III27‐III32. 

  (2)   Stary HC, Chandler AB, Dinsmore RE, Fuster V, Glagov S, Insull W, Jr., Rosenfeld ME, Schwartz CJ, Wagner WD, Wissler RW. A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Arterioscler Thromb Vasc Biol 1995 September;15(9):1512‐31. 

  (3)   Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R. Upregulation of VCAM‐1 and ICAM‐1 at atherosclerosis‐prone sites on the endothelium in the ApoE‐deficient mouse. Arterioscler Thromb Vasc Biol 1998 May;18(5):842‐51. 

  (4)   Boyle JJ. Macrophage activation in atherosclerosis: pathogenesis and pharmacology of plaque rupture. Curr Vasc Pharmacol 2005 January;3(1):63‐8. 

  (5)   Boullier A, Bird DA, Chang MK, Dennis EA, Friedman P, Gillotre‐Taylor K, Horkko S, Palinski W, Quehenberger O, Shaw P, Steinberg D, Terpstra V, Witztum JL. Scavenger receptors, oxidized LDL, and atherosclerosis. Ann N Y Acad Sci 2001 December;947:214‐22. 

  (6)   Galkina E, Ley K. Immune and inflammatory mechanisms of atherosclerosis (*). Annu Rev Immunol 2009;27:165‐97. 

  (7)   Newby AC, Zaltsman AB. Fibrous cap formation or destruction‐‐the critical importance of vascular smooth muscle cell proliferation, migration and matrix formation. Cardiovasc Res 1999 February;41(2):345‐60. 

  (8)   Varnava AM, Mills PG, Davies MJ. Relationship between coronary artery remodeling and plaque vulnerability. Circulation 2002 February 26;105(8):939‐43. 

  (9)   Katritsis DG, Pantos J, Efstathopoulos E. Hemodynamic factors and atheromatic plaque rupture in the coronary arteries: from vulnerable plaque to vulnerable coronary segment. Coron Artery Dis 2007 May;18(3):229‐37. 

  (10)   Sage AP, Tintut Y, Demer LL. Regulatory mechanisms in vascular calcification. Nat Rev Cardiol 2010 September;7(9):528‐36. 

  (11)   Proudfoot D, Skepper JN, Hegyi L, Bennett MR, Shanahan CM, Weissberg PL. Apoptosis regulates human vascular calcification in vitro: evidence for initiation of vascular calcification by apoptotic bodies. Circ Res 2000 November 24;87(11):1055‐62. 

87 

 

 

  (12)   Fernandez‐Ortiz A, Badimon JJ, Falk E, Fuster V, Meyer B, Mailhac A, Weng D, Shah PK, Badimon L. Characterization of the relative thrombogenicity of atherosclerotic plaque components: implications for consequences of plaque rupture. J Am Coll Cardiol 1994 June;23(7):1562‐9. 

  (13)   Smith EB. THE INFLUENCE OF AGE AND ATHEROSCLEROSIS ON THE CHEMISTRY OF AORTIC INTIMA.2. COLLAGEN AND MUCOPOLYSACCHARIDES. J Atheroscler Res 1965 March;5:241‐8. 

  (14)   Shoulders MD, Raines RT. Collagen structure and stability. Annu Rev Biochem 2009;78:929‐58. 

  (15)   Voss B, Rauterberg J. Localization of collagen types I, III, IV and V, fibronectin and laminin in human arteries by the indirect immunofluorescence method. Pathol Res Pract 1986 October;181(5):568‐75. 

  (16)   Adiguzel E, Hou G, Mulholland D, Hopfer U, Fukai N, Olsen B, Bendeck M. Migration and growth are attenuated in vascular smooth muscle cells with type VIII collagen‐null alleles. Arterioscler Thromb Vasc Biol 2006 January;26(1):56‐61. 

  (17)   Rocnik EF, Chan BM, Pickering JG. Evidence for a role of collagen synthesis in arterial smooth muscle cell migration. J Clin Invest 1998 May 1;101(9):1889‐98. 

  (18)   Lu KK, Trcka D, Bendeck MP. Collagen stimulates discoidin domain receptor 1‐mediated migration of smooth muscle cells through Src. Cardiovasc Pathol 2011 March;20(2):71‐6. 

  (19)   Hou G, Mulholland D, Gronska MA, Bendeck MP. Type VIII collagen stimulates smooth muscle cell migration and matrix metalloproteinase synthesis after arterial injury. Am J Pathol 2000 February;156(2):467‐76. 

  (20)   Adiguzel E, Ahmad PJ, Franco C, Bendeck MP. Collagens in the progression and complications of atherosclerosis. Vasc Med 2009 February;14(1):73‐89. 

  (21)   Wesley RB, Meng X, Godin D, Galis ZS. Extracellular matrix modulates macrophage functions characteristic to atheroma: collagen type I enhances acquisition of resident macrophage traits by human peripheral blood monocytes in vitro. Arterioscler Thromb Vasc Biol 1998 March;18(3):432‐40. 

  (22)   Choi ET, Collins ET, Marine LA, Uberti MG, Uchida H, Leidenfrost JE, Khan MF, Boc KP, Abendschein DR, Parks WC. Matrix metalloproteinase‐9 modulation by resident arterial cells is responsible for injury‐induced accelerated atherosclerotic plaque development in apolipoprotein E‐deficient mice. Arterioscler Thromb Vasc Biol 2005 May;25(5):1020‐5. 

88 

 

 

  (23)   Kuzuya M, Nakamura K, Sasaki T, Cheng XW, Itohara S, Iguchi A. Effect of MMP‐2 deficiency on atherosclerotic lesion formation in apoE‐deficient mice. Arterioscler Thromb Vasc Biol 2006 May;26(5):1120‐5. 

  (24)   Luttun A, Lutgens E, Manderveld A, Maris K, Collen D, Carmeliet P, Moons L. Loss of matrix metalloproteinase‐9 or matrix metalloproteinase‐12 protects apolipoprotein E‐deficient mice against atherosclerotic media destruction but differentially affects plaque growth. Circulation 2004 March 23;109(11):1408‐14. 

  (25)   Lemaitre V, O'Byrne TK, Borczuk AC, Okada Y, Tall AR, D'Armiento J. ApoE knockout mice expressing human matrix metalloproteinase‐1 in macrophages have less advanced atherosclerosis. J Clin Invest 2001 May;107(10):1227‐34. 

  (26)   Li S, Van Den Diepstraten C, D'Souza SJ, Chan BM, Pickering JG. Vascular smooth muscle cells orchestrate the assembly of type I collagen via alpha2beta1 integrin, RhoA, and fibronectin polymerization. Am J Pathol 2003 September;163(3):1045‐56. 

  (27)   Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 1992 April 3;69(1):11‐25. 

  (28)   Hultgardh‐Nilsson A, Durbeej M. Role of the extracellular matrix and its receptors in smooth muscle cell function: implications in vascular development and disease. Curr Opin Lipidol 2007 October;18(5):540‐5. 

  (29)   Franco C, Ahmad PJ, Hou G, Wong E, Bendeck MP. Increased cell and matrix accumulation during atherogenesis in mice with vessel wall‐specific deletion of discoidin domain receptor 1. Circ Res 2010 June 11;106(11):1775‐83. 

  (30)   Vogel W, Gish GD, Alves F, Pawson T. The discoidin domain receptor tyrosine kinases are activated by collagen. Mol Cell 1997 December;1(1):13‐23. 

  (31)   Springer WR, Cooper DN, Barondes SH. Discoidin I is implicated in cell‐substratum attachment and ordered cell migration of Dictyostelium discoideum and resembles fibronectin. Cell 1984 December;39(3 Pt 2):557‐64. 

  (32)   Kiedzierska A, Smietana K, Czepczynska H, Otlewski J. Structural similarities and functional diversity of eukaryotic discoidin‐like domains. Biochim Biophys Acta 2007 September;1774(9):1069‐78. 

  (33)   L'hote CG, Thomas PH, Ganesan TS. Functional analysis of discoidin domain receptor 1: effect of adhesion on DDR1 phosphorylation. FASEB J 2002 February;16(2):234‐6. 

  (34)   L'Hote CG, Thomas PH, Ganesan TS. Functional analysis of discoidin domain receptor 1: effect of adhesion on DDR1 phosphorylation. FASEB J 2002 February;16(2):234‐6. 

89 

 

 

  (35)   Ikeda K, Wang LH, Torres R, Zhao H, Olaso E, Eng FJ, Labrador P, Klein R, Lovett D, Yancopoulos GD, Friedman SL, Lin HC. Discoidin domain receptor 2 interacts with Src and Shc following its activation by type I collagen. J Biol Chem 2002 May 24;277(21):19206‐12. 

  (36)   Dejmek J, Dib K, Jonsson M, Andersson T. Wnt‐5a and G‐protein signaling are required for collagen‐induced DDR1 receptor activation and normal mammary cell adhesion. Int J Cancer 2003 January 20;103(3):344‐51. 

  (37)   Wang CZ, Su HW, Hsu YC, Shen MR, Tang MJ. A discoidin domain receptor 1/SHP‐2 signaling complex inhibits alpha2beta1‐integrin‐mediated signal transducers and activators of transcription 1/3 activation and cell migration. Mol Biol Cell 2006 June;17(6):2839‐52. 

  (38)   Iwai LK, Chang F, Huang PH. Phosphoproteomic analysis identifies insulin enhancement of discoidin domain receptor 2 phosphorylation. Cell Adh Migr 2012 November 15;7(2). 

  (39)   Vogel W, Gish GD, Alves F, Pawson T. The discoidin domain receptor tyrosine kinases are activated by collagen. Mol Cell 1997 December;1(1):13‐23. 

  (40)   Koo DH, McFadden C, Huang Y, Abdulhussein R, Friese‐Hamim M, Vogel WF. Pinpointing phosphotyrosine‐dependent interactions downstream of the collagen receptor DDR1. FEBS Lett 2006 January 9;580(1):15‐22. 

  (41)   Hansen C, Greengard P, Nairn AC, Andersson T, Vogel WF. Phosphorylation of DARPP‐32 regulates breast cancer cell migration downstream of the receptor tyrosine kinase DDR1. Exp Cell Res 2006 December 10;312(20):4011‐8. 

  (42)   Hilton HN, Stanford PM, Harris J, Oakes SR, Kaplan W, Daly RJ, Ormandy CJ. KIBRA interacts with discoidin domain receptor 1 to modulate collagen‐induced signalling. Biochim Biophys Acta 2008 March;1783(3):383‐93. 

  (43)   Suh HN, Han HJ. Collagen I regulates the self‐renewal of mouse embryonic stem cells through alpha2beta1 integrin‐ and DDR1‐dependent Bmi‐1. J Cell Physiol 2011 December;226(12):3422‐32. 

  (44)   Ruiz PA, Jarai G. Collagen I induces discoidin domain receptor (DDR) 1 expression through DDR2 and a JAK2‐ERK1/2‐mediated mechanism in primary human lung fibroblasts. J Biol Chem 2011 April 15;286(15):12912‐23. 

  (45)   Zhang Y, Su J, Yu J, Bu X, Ren T, Liu X, Yao L. An essential role of discoidin domain receptor 2 (DDR2) in osteoblast differentiation and chondrocyte maturation via modulation of Runx2 activation. J Bone Miner Res 2011 March;26(3):604‐17. 

90 

 

 

  (46)   Lin KL, Chou CH, Hsieh SC, Hwa SY, Lee MT, Wang FF. Transcriptional upregulation of DDR2 by ATF4 facilitates osteoblastic differentiation through p38 MAPK‐mediated Runx2 activation. J Bone Miner Res 2010 November;25(11):2489‐503. 

  (47)   Seo MC, Kim S, Kim SH, Zheng LT, Park EK, Lee WH, Suk K. Discoidin domain receptor 1 mediates collagen‐induced inflammatory activation of microglia in culture. J Neurosci Res 2008 April;86(5):1087‐95. 

  (48)   Kim SH, Lee S, Suk K, Bark H, Jun CD, Kim DK, Choi CH, Yoshimura T. Discoidin domain receptor 1 mediates collagen‐induced nitric oxide production in J774A.1 murine macrophages. Free Radic Biol Med 2007 February 1;42(3):343‐52. 

  (49)   Matsuyama W, Watanabe M, Shirahama Y, Oonakahara K, Higashimoto I, Yoshimura T, Osame M, Arimura K. Activation of discoidin domain receptor 1 on CD14‐positive bronchoalveolar lavage fluid cells induces chemokine production in idiopathic pulmonary fibrosis. J Immunol 2005 May 15;174(10):6490‐8. 

  (50)   Hou G, Vogel W, Bendeck MP. The discoidin domain receptor tyrosine kinase DDR1 in arterial wound repair. J Clin Invest 2001 March;107(6):727‐35. 

  (51)   Ferri N, Carragher NO, Raines EW. Role of discoidin domain receptors 1 and 2 in human smooth muscle cell‐mediated collagen remodeling: potential implications in atherosclerosis and lymphangioleiomyomatosis. Am J Pathol 2004 May;164(5):1575‐85. 

  (52)   Hou G, Vogel WF, Bendeck MP. Tyrosine kinase activity of discoidin domain receptor 1 is necessary for smooth muscle cell migration and matrix metalloproteinase expression. Circ Res 2002 June 14;90(11):1147‐9. 

  (53)   Chen SC, Wang BW, Wang DL, Shyu KG. Hypoxia induces discoidin domain receptor‐2 expression via the p38 pathway in vascular smooth muscle cells to increase their migration. Biochem Biophys Res Commun 2008 October 3;374(4):662‐7. 

  (54)   Shyu KG, Wang BW, Chang H. Hyperbaric oxygen activates discoidin domain receptor 2 via tumour necrosis factor‐alpha and the p38 MAPK pathway to increase vascular smooth muscle cell migration through matrix metalloproteinase 2. Clin Sci (Lond) 2009 April;116(7):575‐83. 

  (55)   Bhadriraju K, Chung KH, Spurlin TA, Haynes RJ, Elliott JT, Plant AL. The relative roles of collagen adhesive receptor DDR2 activation and matrix stiffness on the downregulation of focal adhesion kinase in vascular smooth muscle cells. Biomaterials 2009 December;30(35):6687‐94. 

91 

 

 

  (56)   Hou G, Wang D, Bendeck MP. Deletion of discoidin domain receptor 2 does not affect smooth muscle cell adhesion, migration, or proliferation in response to type I collagen. Cardiovasc Pathol 2012 May;21(3):214‐8. 

  (57)   Franco C, Hou G, Ahmad PJ, Fu EY, Koh L, Vogel WF, Bendeck MP. Discoidin domain receptor 1 (ddr1) deletion decreases atherosclerosis by accelerating matrix accumulation and reducing inflammation in low‐density lipoprotein receptor‐deficient mice. Circ Res 2008 May 23;102(10):1202‐11. 

  (58)   Franco C, Britto K, Wong E, Hou G, Zhu SN, Chen M, Cybulsky MI, Bendeck MP. Discoidin domain receptor 1 on bone marrow‐derived cells promotes macrophage accumulation during atherogenesis. Circ Res 2009 November 20;105(11):1141‐8. 

  (59)   Ahmad PJ, Trcka D, Xue S, Franco C, Speer MY, Giachelli CM, Bendeck MP. Discoidin domain receptor‐1 deficiency attenuates atherosclerotic calcification and smooth muscle cell‐mediated mineralization. Am J Pathol 2009 December;175(6):2686‐96. 

  (60)   Klatt AR, Zech D, Kuhn G, Paul‐Klausch B, Klinger G, Renno JH, Schmidt J, Malchau G, Wielckens K. Discoidin domain receptor 2 mediates the collagen II‐dependent release of interleukin‐6 in primary human chondrocytes. J Pathol 2009 June;218(2):241‐7. 

  (61)   Lam NP, Li Y, Waldman AB, Brussiau J, Lee PL, Olsen BR, Xu L. Age‐dependent increase of discoidin domain receptor 2 and matrix metalloproteinase 13 expression in temporomandibular joint cartilage of type IX and type XI collagen‐deficient mice. Arch Oral Biol 2007 June;52(6):579‐84. 

  (62)   Xu L, Peng H, Wu D, Hu K, Goldring MB, Olsen BR, Li Y. Activation of the discoidin domain receptor 2 induces expression of matrix metalloproteinase 13 associated with osteoarthritis in mice. J Biol Chem 2005 January 7;280(1):548‐55. 

  (63)   Bargal R, Cormier‐Daire V, Ben‐Neriah Z, Le MM, Sosna J, Melki J, Zangen DH, Smithson SF, Borochowitz Z, Belostotsky R, Raas‐Rothschild A. Mutations in DDR2 gene cause SMED with short limbs and abnormal calcifications. Am J Hum Genet 2009 January;84(1):80‐4. 

  (64)   McCullough PA, Chinnaiyan KM, Agrawal V, Danielewicz E, Abela GS. Amplification of atherosclerotic calcification and Monckeberg's sclerosis: a spectrum of the same disease process. Adv Chronic Kidney Dis 2008 October;15(4):396‐412. 

  (65)   BEADENKOPF WG, DAOUD AS, LOVE BM. CALCIFICATION IN THE CORONARY ARTERIES AND ITS RELATIONSHIP TO ARTERIOSCLEROSIS AND MYOCARDIAL INFARCTION. Am J Roentgenol Radium Ther Nucl Med 1964 October;92:865‐71. 

  (66)   Wada T, McKee MD, Steitz S, Giachelli CM. Calcification of vascular smooth muscle cell cultures: inhibition by osteopontin. Circ Res 1999 February 5;84(2):166‐78. 

92 

 

 

  (67)   Tintut Y, Patel J, Territo M, Saini T, Parhami F, Demer LL. Monocyte/macrophage regulation of vascular calcification in vitro. Circulation 2002 February 5;105(5):650‐5. 

  (68)   Iyemere VP, Proudfoot D, Weissberg PL, Shanahan CM. Vascular smooth muscle cell phenotypic plasticity and the regulation of vascular calcification. J Intern Med 2006 September;260(3):192‐210. 

  (69)   Speer MY, Yang HY, Brabb T, Leaf E, Look A, Lin WL, Frutkin A, Dichek D, Giachelli CM. Smooth muscle cells give rise to osteochondrogenic precursors and chondrocytes in calcifying arteries. Circ Res 2009 March 27;104(6):733‐41. 

  (70)   Tanaka T, Sato H, Doi H, Yoshida CA, Shimizu T, Matsui H, Yamazaki M, Akiyama H, Kawai‐Kowase K, Iso T, Komori T, Arai M, Kurabayashi M. Runx2 represses myocardin‐mediated differentiation and facilitates osteogenic conversion of vascular smooth muscle cells. Mol Cell Biol 2008 February;28(3):1147‐60. 

  (71)   Schinke T, Karsenty G. Vascular calcification‐‐a passive process in need of inhibitors. Nephrol Dial Transplant 2000 September;15(9):1272‐4. 

  (72)   McCullough PA, Chinnaiyan KM, Agrawal V, Danielewicz E, Abela GS. Amplification of atherosclerotic calcification and Monckeberg's sclerosis: a spectrum of the same disease process. Adv Chronic Kidney Dis 2008 October;15(4):396‐412. 

  (73)   Smith JD, Breslow JL. The emergence of mouse models of atherosclerosis and their relevance to clinical research. J Intern Med 1997 August;242(2):99‐109. 

  (74)   Merx MW, Schafer C, Westenfeld R, Brandenburg V, Hidajat S, Weber C, Ketteler M, Jahnen‐Dechent W. Myocardial stiffness, cardiac remodeling, and diastolic dysfunction in calcification‐prone fetuin‐A‐deficient mice. J Am Soc Nephrol 2005 November;16(11):3357‐64. 

  (75)   Luo G, Ducy P, McKee MD, Pinero GJ, Loyer E, Behringer RR, Karsenty G. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature 1997 March 6;386(6620):78‐81. 

  (76)   Mazzali M, Hughes J, Dantas M, Liaw L, Steitz S, Alpers CE, Pichler RH, Lan HY, Giachelli CM, Shankland SJ, Couser WG, Johnson RJ. Effects of cyclosporine in osteopontin null mice. Kidney Int 2002 July;62(1):78‐85. 

  (77)   Sun Y, Byon CH, Yuan K, Chen J, Mao X, Heath JM, Javed A, Zhang K, Anderson PG, Chen Y. Smooth muscle cell‐specific runx2 deficiency inhibits vascular calcification. Circ Res 2012 August 17;111(5):543‐52. 

93 

 

 

  (78)   Wallin R, Wajih N, Greenwood GT, Sane DC. Arterial calcification: a review of mechanisms, animal models, and the prospects for therapy. Med Res Rev 2001 July;21(4):274‐301. 

  (79)   Smith JD, Breslow JL. The emergence of mouse models of atherosclerosis and their relevance to clinical research. J Intern Med 1997 August;242(2):99‐109. 

  (80)   Shobeiri N, Adams MA, Holden RM. Vascular calcification in animal models of CKD: A review. Am J Nephrol 2010;31(6):471‐81. 

  (81)   El‐Abbadi MM, Pai AS, Leaf EM, Yang HY, Bartley BA, Quan KK, Ingalls CM, Liao HW, Giachelli CM. Phosphate feeding induces arterial medial calcification in uremic mice: role of serum phosphorus, fibroblast growth factor‐23, and osteopontin. Kidney Int 2009 June;75(12):1297‐307. 

  (82)   Wada T, McKee MD, Steitz S, Giachelli CM. Calcification of vascular smooth muscle cell cultures: inhibition by osteopontin. Circ Res 1999 February 5;84(2):166‐78. 

  (83)   Lomashvili KA, Cobbs S, Hennigar RA, Hardcastle KI, O'Neill WC. Phosphate‐induced vascular calcification: role of pyrophosphate and osteopontin. J Am Soc Nephrol 2004 June;15(6):1392‐401. 

  (84)   Rawlinson SC, Mosley JR, Suswillo RF, Pitsillides AA, Lanyon LE. Calvarial and limb bone cells in organ and monolayer culture do not show the same early responses to dynamic mechanical strain. J Bone Miner Res 1995 August;10(8):1225‐32. 

  (85)   Jono S, McKee MD, Murry CE, Shioi A, Nishizawa Y, Mori K, Morii H, Giachelli CM. Phosphate regulation of vascular smooth muscle cell calcification. Circ Res 2000 September 29;87(7):E10‐E17. 

  (86)   Kircelli F, Peter ME, Sevinc OE, Celenk FG, Yilmaz M, Steppan S, Asci G, Ok E, Passlick‐Deetjen J. Magnesium reduces calcification in bovine vascular smooth muscle cells in a dose‐dependent manner. Nephrol Dial Transplant 2012 February;27(2):514‐21. 

  (87)   Ganta DR, McCarthy MB, Gronowicz GA. Ascorbic acid alters collagen integrins in bone culture. Endocrinology 1997 September;138(9):3606‐12. 

  (88)   Reil TD, Sarkar R, Kashyap VS, Sarkar M, Gelabert HA. Dexamethasone suppresses vascular smooth muscle cell proliferation. J Surg Res 1999 July;85(1):109‐14. 

  (89)   Enomoto H, Enomoto‐Iwamoto M, Iwamoto M, Nomura S, Himeno M, Kitamura Y, Kishimoto T, Komori T. Cbfa1 is a positive regulatory factor in chondrocyte maturation. J Biol Chem 2000 March 24;275(12):8695‐702. 

94 

 

 

  (90)   Su X, Ao L, Shi Y, Johnson TR, Fullerton DA, Meng X. Oxidized low density lipoprotein induces bone morphogenetic protein‐2 in coronary artery endothelial cells via Toll‐like receptors 2 and 4. J Biol Chem 2011 April 8;286(14):12213‐20. 

  (91)   Iwasaki K, Komaki M, Mimori K, Leon E, Izumi Y, Ishikawa I. IL‐6 induces osteoblastic differentiation of periodontal ligament cells. J Dent Res 2008 October;87(10):937‐42. 

  (92)   Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF‐beta 1 and 25‐hydroxycholesterol stimulate osteoblast‐like vascular cells to calcify. J Clin Invest 1994 May;93(5):2106‐13. 

  (93)   Sage AP, Lu J, Tintut Y, Demer LL. Hyperphosphatemia‐induced nanocrystals upregulate the expression of bone morphogenetic protein‐2 and osteopontin genes in mouse smooth muscle cells in vitro. Kidney Int 2011 February;79(4):414‐22. 

  (94)   Balachandran K, Sucosky P, Yoganathan AP. Hemodynamics and mechanobiology of aortic valve inflammation and calcification. Int J Inflam 2011;2011:263870. 

  (95)   Mori‐Akiyama Y, Akiyama H, Rowitch DH, de CB. Sox9 is required for determination of the chondrogenic cell lineage in the cranial neural crest. Proc Natl Acad Sci U S A 2003 August 5;100(16):9360‐5. 

  (96)   Yoshiki S. A simple histological method for identification of osteoid matrix in decalcified bone. Stain Technol 1973 September;48(5):233‐8. 

  (97)   Fujita T, Azuma Y, Fukuyama R, Hattori Y, Yoshida C, Koida M, Ogita K, Komori T. Runx2 induces osteoblast and chondrocyte differentiation and enhances their migration by coupling with PI3K‐Akt signaling. J Cell Biol 2004 July 5;166(1):85‐95. 

  (98)   Dean DD, Schwartz Z, Bonewald L, Muniz OE, Morales S, Gomez R, Brooks BP, Qiao M, Howell DS, Boyan BD. Matrix vesicles produced by osteoblast‐like cells in culture become significantly enriched in proteoglycan‐degrading metalloproteinases after addition of beta‐glycerophosphate and ascorbic acid. Calcif Tissue Int 1994 May;54(5):399‐408. 

  (99)   Shioi A, Katagi M, Okuno Y, Mori K, Jono S, Koyama H, Nishizawa Y. Induction of bone‐type alkaline phosphatase in human vascular smooth muscle cells: roles of tumor necrosis factor‐alpha and oncostatin M derived from macrophages. Circ Res 2002 July 12;91(1):9‐16. 

  (100)   Li X, Yang HY, Giachelli CM. Role of the sodium‐dependent phosphate cotransporter, Pit‐1, in vascular smooth muscle cell calcification. Circ Res 2006 April 14;98(7):905‐12. 

95 

 

 

  (101)   Villa‐Bellosta R, Millan A, Sorribas V. Role of calcium‐phosphate deposition in vascular smooth muscle cell calcification. Am J Physiol Cell Physiol 2011 January;300(1):C210‐C220. 

  (102)   Gipstein RM, Coburn JW, Adams DA, Lee DB, Parsa KP, Sellers A, Suki WN, Massry SG. Calciphylaxis in man. A syndrome of tissue necrosis and vascular calcification in 11 patients with chronic renal failure. Arch Intern Med 1976 November;136(11):1273‐80. 

  (103)   Fitzpatrick LA, Severson A, Edwards WD, Ingram RT. Diffuse calcification in human coronary arteries. Association of osteopontin with atherosclerosis. J Clin Invest 1994 October;94(4):1597‐604. 

  (104)   Johnson K, Polewski M, van ED, Terkeltaub R. Chondrogenesis mediated by PPi depletion promotes spontaneous aortic calcification in NPP1‐/‐ mice. Arterioscler Thromb Vasc Biol 2005 April;25(4):686‐91. 

  (105)   El‐Maadawy S, Kaartinen MT, Schinke T, Murshed M, Karsenty G, McKee MD. Cartilage formation and calcification in arteries of mice lacking matrix Gla protein. Connect Tissue Res 2003;44 Suppl 1:272‐8. 

  (106)   Ohnishi M, Nakatani T, Lanske B, Razzaque MS. Reversal of mineral ion homeostasis and soft‐tissue calcification of klotho knockout mice by deletion of vitamin D 1alpha‐hydroxylase. Kidney Int 2009 June;75(11):1166‐72. 

  (107)   Price PA, Faus SA, Williamson MK. Warfarin causes rapid calcification of the elastic lamellae in rat arteries and heart valves. Arterioscler Thromb Vasc Biol 1998 September;18(9):1400‐7. 

  (108)   Micheletti RG, Fishbein GA, Currier JS, Singer EJ, Fishbein MC. Calcification of the internal elastic lamina of coronary arteries. Mod Pathol 2008 August;21(8):1019‐28. 

  (109)   Sun Y, Byon CH, Yuan K, Chen J, Mao X, Heath JM, Javed A, Zhang K, Anderson PG, Chen Y. Smooth muscle cell‐specific runx2 deficiency inhibits vascular calcification. Circ Res 2012 August 17;111(5):543‐52. 

  (110)   Mathew S, Tustison KS, Sugatani T, Chaudhary LR, Rifas L, Hruska KA. The mechanism of phosphorus as a cardiovascular risk factor in CKD. J Am Soc Nephrol 2008 June;19(6):1092‐105. 

  (111)   Huang MS, Sage AP, Lu J, Demer LL, Tintut Y. Phosphate and pyrophosphate mediate PKA‐induced vascular cell calcification. Biochem Biophys Res Commun 2008 September 26;374(3):553‐8. 

96 

 

 

  (112)   Villa‐Bellosta R, Wang X, Millan JL, Dubyak GR, O'Neill WC. Extracellular pyrophosphate metabolism and calcification in vascular smooth muscle. Am J Physiol Heart Circ Physiol 2011 July;301(1):H61‐H68. 

  (113)   Nitschke Y, Weissen‐Plenz G, Terkeltaub R, Rutsch F. Npp1 promotes atherosclerosis in ApoE knockout mice. J Cell Mol Med 2011 November;15(11):2273‐83. 

  (114)   Terkeltaub R. Physiologic and pathologic functions of the NPP nucleotide pyrophosphatase/phosphodiesterase family focusing on NPP1 in calcification. Purinergic Signal 2006 June;2(2):371‐7. 

  (115)   Rutsch F, Ruf N, Vaingankar S, Toliat MR, Suk A, Hohne W, Schauer G, Lehmann M, Roscioli T, Schnabel D, Epplen JT, Knisely A, Superti‐Furga A, McGill J, Filippone M, Sinaiko AR, Vallance H, Hinrichs B, Smith W, Ferre M, Terkeltaub R, Nurnberg P. Mutations in ENPP1 are associated with 'idiopathic' infantile arterial calcification. Nat Genet 2003 August;34(4):379‐81. 

  (116)   Johnson K, Goding J, van ED, Sali A, Hu SI, Farley D, Krug H, Hessle L, Millan JL, Terkeltaub R. Linked deficiencies in extracellular PP(i) and osteopontin mediate pathologic calcification associated with defective PC‐1 and ANK expression. J Bone Miner Res 2003 June;18(6):994‐1004. 

  (117)   Shinozaki T, Pritzker KP. Regulation of alkaline phosphatase: implications for calcium pyrophosphate dihydrate crystal dissolution and other alkaline phosphatase functions. J Rheumatol 1996 April;23(4):677‐83. 

  (118)   Wass M, Butterworth PJ. Nucleoside pyrophosphatase activity associated with pig kidney alkaline phosphatase. Biochem J 1971 October;124(5):891‐6. 

  (119)   Chan JR, Stinson RA. Dephosphorylation of phosphoproteins of human liver plasma membranes by endogenous and purified liver alkaline phosphatases. J Biol Chem 1986 June 15;261(17):7635‐9. 

  (120)   Balcerzak M, Hamade E, Zhang L, Pikula S, Azzar G, Radisson J, Bandorowicz‐Pikula J, Buchet R. The roles of annexins and alkaline phosphatase in mineralization process. Acta Biochim Pol 2003;50(4):1019‐38. 

  (121)   Narisawa S, Harmey D, Yadav MC, O'Neill WC, Hoylaerts MF, Millan JL. Novel inhibitors of alkaline phosphatase suppress vascular smooth muscle cell calcification. J Bone Miner Res 2007 November;22(11):1700‐10. 

  (122)   Yohay DA, Zhang J, Thrailkill KM, Arthur JM, Quarles LD. Role of serum in the developmental expression of alkaline phosphatase in MC3T3‐E1 osteoblasts. J Cell Physiol 1994 March;158(3):467‐75. 

97 

 

 

  (123)   Turan S, Topcu B, Gokce I, Guran T, Atay Z, Omar A, Akcay T, Bereket A. Serum alkaline phosphatase levels in healthy children and evaluation of alkaline phosphatase z‐scores in different types of rickets. J Clin Res Pediatr Endocrinol 2011;3(1):7‐11. 

  (124)   Fallon MD, Teitelbaum SL, Weinstein RS, Goldfischer S, Brown DM, Whyte MP. Hypophosphatasia: clinicopathologic comparison of the infantile, childhood, and adult forms. Medicine (Baltimore) 1984 January;63(1):12‐24. 

  (125)   Li X, Giachelli CM. Sodium‐dependent phosphate cotransporters and vascular calcification. Curr Opin Nephrol Hypertens 2007 July;16(4):325‐8. 

  (126)   Villa‐Bellosta R, Sorribas V. Compensatory regulation of the sodium/phosphate cotransporters NaPi‐IIc (SCL34A3) and Pit‐2 (SLC20A2) during Pi deprivation and acidosis. Pflugers Arch 2010 February;459(3):499‐508. 

  (127)   Villa‐Bellosta R, Bogaert YE, Levi M, Sorribas V. Characterization of phosphate transport in rat vascular smooth muscle cells: implications for vascular calcification. Arterioscler Thromb Vasc Biol 2007 May;27(5):1030‐6. 

  (128)   Villa‐Bellosta R, Bogaert YE, Levi M, Sorribas V. Characterization of phosphate transport in rat vascular smooth muscle cells: implications for vascular calcification. Arterioscler Thromb Vasc Biol 2007 May;27(5):1030‐6. 

  (129)   Li X, Yang HY, Giachelli CM. Role of the sodium‐dependent phosphate cotransporter, Pit‐1, in vascular smooth muscle cell calcification. Circ Res 2006 April 14;98(7):905‐12. 

  (130)   Sudhakar S, Katz MS, Elango N. Analysis of type‐I and type‐II RUNX2 protein expression in osteoblasts. Biochem Biophys Res Commun 2001 August 10;286(1):74‐9. 

  (131)   Pockwinse SM, Rajgopal A, Young DW, Mujeeb KA, Nickerson J, Javed A, Redick S, Lian JB, Van Wijnen AJ, Stein JL, Stein GS, Doxsey SJ. Microtubule‐dependent nuclear‐cytoplasmic shuttling of Runx2. J Cell Physiol 2006 February;206(2):354‐62. 

  (132)   Belizario JE, Alves J, Garay‐Malpartida M, Occhiucci JM. Coupling caspase cleavage and proteasomal degradation of proteins carrying PEST motif. Curr Protein Pept Sci 2008 June;9(3):210‐20. 

  (133)   Wang N, Chen W, Linsel‐Nitschke P, Martinez LO, Agerholm‐Larsen B, Silver DL, Tall AR. A PEST sequence in ABCA1 regulates degradation by calpain protease and stabilization of ABCA1 by apoA‐I. J Clin Invest 2003 January;111(1):99‐107. 

  (134)   Sudhakar S, Katz MS, Elango N. Analysis of type‐I and type‐II RUNX2 protein expression in osteoblasts. Biochem Biophys Res Commun 2001 August 10;286(1):74‐9. 

98 

 

 

  (135)   Cohen MM, Jr. Perspectives on RUNX genes: an update. Am J Med Genet A 2009 December;149A(12):2629‐46. 

  (136)   Terry A, Kilbey A, Vaillant F, Stewart M, Jenkins A, Cameron E, Neil JC. Conservation and expression of an alternative 3' exon of Runx2 encoding a novel proline‐rich C‐terminal domain. Gene 2004 July 7;336(1):115‐25. 

  (137)   Lee KS, Kim HJ, Li QL, Chi XZ, Ueta C, Komori T, Wozney JM, Kim EG, Choi JY, Ryoo HM, Bae SC. Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast‐specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol 2000 December;20(23):8783‐92. 

  (138)   Igarashi M, Kamiya N, Hasegawa M, Kasuya T, Takahashi T, Takagi M. Inductive effects of dexamethasone on the gene expression of Cbfa1, Osterix and bone matrix proteins during differentiation of cultured primary rat osteoblasts. J Mol Histol 2004 January;35(1):3‐10. 

  (139)   Zhou G, Zheng Q, Engin F, Munivez E, Chen Y, Sebald E, Krakow D, Lee B. Dominance of SOX9 function over RUNX2 during skeletogenesis. Proc Natl Acad Sci U S A 2006 December 12;103(50):19004‐9. 

  (140)   Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997 May 30;89(5):765‐71. 

  (141)   Choi JY, Pratap J, Javed A, Zaidi SK, Xing L, Balint E, Dalamangas S, Boyce B, van Wijnen AJ, Lian JB, Stein JL, Jones SN, Stein GS. Subnuclear targeting of Runx/Cbfa/AML factors is essential for tissue‐specific differentiation during embryonic development. Proc Natl Acad Sci U S A 2001 July 17;98(15):8650‐5. 

  (142)   Porte D, Tuckermann J, Becker M, Baumann B, Teurich S, Higgins T, Owen MJ, Schorpp‐Kistner M, Angel P. Both AP‐1 and Cbfa1‐like factors are required for the induction of interstitial collagenase by parathyroid hormone. Oncogene 1999 January 21;18(3):667‐78. 

  (143)   Tsuji K, Ito Y, Noda M. Expression of the PEBP2alphaA/AML3/CBFA1 gene is regulated by BMP4/7 heterodimer and its overexpression suppresses type I collagen and osteocalcin gene expression in osteoblastic and nonosteoblastic mesenchymal cells. Bone 1998 February;22(2):87‐92. 

  (144)   Inman CK, Shore P. The osteoblast transcription factor Runx2 is expressed in mammary epithelial cells and mediates osteopontin expression. J Biol Chem 2003 December 5;278(49):48684‐9. 

99 

 

 

  (145)   Javed A, Barnes GL, Jasanya BO, Stein JL, Gerstenfeld L, Lian JB, Stein GS. runt homology domain transcription factors (Runx, Cbfa, and AML) mediate repression of the bone sialoprotein promoter: evidence for promoter context‐dependent activity of Cbfa proteins. Mol Cell Biol 2001 April;21(8):2891‐905. 

  (146)   Kwon TG, Zhao X, Yang Q, Li Y, Ge C, Zhao G, Franceschi RT. Physical and functional interactions between Runx2 and HIF‐1alpha induce vascular endothelial growth factor gene expression. J Cell Biochem 2011 December;112(12):3582‐93. 

  (147)   Ge C, Yang Q, Zhao G, Yu H, Kirkwood KL, Franceschi RT. Interactions between extracellular signal‐regulated kinase 1/2 and P38 map kinase pathways in the control of RUNX2 phosphorylation and transcriptional activity. J Bone Miner Res 2011 November 9. 

  (148)   Yoshiki S. A simple histological method for identification of osteoid matrix in decalcified bone. Stain Technol 1973 September;48(5):233‐8. 

  (149)   Watson KE, Parhami F, Shin V, Demer LL. Fibronectin and collagen I matrixes promote calcification of vascular cells in vitro, whereas collagen IV matrix is inhibitory. Arterioscler Thromb Vasc Biol 1998 December;18(12):1964‐71. 

  (150)   Chen Y, Bal BS, Gorski JP. Calcium and collagen binding properties of osteopontin, bone sialoprotein, and bone acidic glycoprotein‐75 from bone. J Biol Chem 1992 December 5;267(34):24871‐8. 

  (151)   Street J, Bao M, deGuzman L, Bunting S, Peale FV, Jr., Ferrara N, Steinmetz H, Hoeffel J, Cleland JL, Daugherty A, van BN, Redmond HP, Carano RA, Filvaroff EH. Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc Natl Acad Sci U S A 2002 July 23;99(15):9656‐61. 

  (152)   Ahluwalia A, Tarnawski AS. Critical role of hypoxia sensor‐‐HIF‐1alpha in VEGF gene activation. Implications for angiogenesis and tissue injury healing. Curr Med Chem 2012;19(1):90‐7. 

  (153)   Knippenberg M, Helder MN, Zandieh DB, Wuisman PI, Klein‐Nulend J. Osteogenesis versus chondrogenesis by BMP‐2 and BMP‐7 in adipose stem cells. Biochem Biophys Res Commun 2006 April 14;342(3):902‐8. 

  (154)   Monroe DG, Hawse JR, Subramaniam M, Spelsberg TC. Retinoblastoma binding protein‐1 (RBP1) is a Runx2 coactivator and promotes osteoblastic differentiation. BMC Musculoskelet Disord 2010;11:104. 

  (155)   Yang S, Xu H, Yu S, Cao H, Fan J, Ge C, Fransceschi RT, Dong HH, Xiao G. Foxo1 mediates insulin‐like growth factor 1 (IGF1)/insulin regulation of osteocalcin 

100 

 

 

expression by antagonizing Runx2 in osteoblasts. J Biol Chem 2011 May 27;286(21):19149‐58. 

  (156)   Long F. Building strong bones: molecular regulation of the osteoblast lineage. Nat Rev Mol Cell Biol 2012 January;13(1):27‐38. 

  (157)   Tanaka T, Sato H, Doi H, Yoshida CA, Shimizu T, Matsui H, Yamazaki M, Akiyama H, Kawai‐Kowase K, Iso T, Komori T, Arai M, Kurabayashi M. Runx2 represses myocardin‐mediated differentiation and facilitates osteogenic conversion of vascular smooth muscle cells. Mol Cell Biol 2008 February;28(3):1147‐60. 

  (158)   Speer MY, Li X, Hiremath PG, Giachelli CM. Runx2/Cbfa1, but not loss of myocardin, is required for smooth muscle cell lineage reprogramming toward osteochondrogenesis. J Cell Biochem 2010 July 1;110(4):935‐47. 

  (159)   de FH, Bouissou A, Perez F. Interplay between microtubule dynamics and intracellular organization. Int J Biochem Cell Biol 2012 February;44(2):266‐74. 

  (160)   de FH, Bouissou A, Perez F. Interplay between microtubule dynamics and intracellular organization. Int J Biochem Cell Biol 2012 February;44(2):266‐74. 

  (161)   Gebremichael Y, Chu JW, Voth GA. Intrinsic bending and structural rearrangement of tubulin dimer: molecular dynamics simulations and coarse‐grained analysis. Biophys J 2008 September;95(5):2487‐99. 

  (162)   Ghosh‐Roy A, Goncharov A, Jin Y, Chisholm AD. Kinesin‐13 and tubulin posttranslational modifications regulate microtubule growth in axon regeneration. Dev Cell 2012 October 16;23(4):716‐28. 

  (163)   Mulder AM, Glavis‐Bloom A, Moores CA, Wagenbach M, Carragher B, Wordeman L, Milligan RA. A new model for binding of kinesin 13 to curved microtubule protofilaments. J Cell Biol 2009 April 6;185(1):51‐7. 

  (164)   Janke C, Kneussel M. Tubulin post‐translational modifications: encoding functions on the neuronal microtubule cytoskeleton. Trends Neurosci 2010 August;33(8):362‐72. 

  (165)   Hammond JW, Huang CF, Kaech S, Jacobson C, Banker G, Verhey KJ. Posttranslational modifications of tubulin and the polarized transport of kinesin‐1 in neurons. Mol Biol Cell 2010 February 15;21(4):572‐83. 

  (166)   Paturle‐Lafanechere L, Manier M, Trigault N, Pirollet F, Mazarguil H, Job D. Accumulation of delta 2‐tubulin, a major tubulin variant that cannot be tyrosinated, in neuronal tissues and in stable microtubule assemblies. J Cell Sci 1994 June;107 ( Pt 6):1529‐43. 

101 

 

 

  (167)   Hubbert C, Guardiola A, Shao R, Kawaguchi Y, Ito A, Nixon A, Yoshida M, Wang XF, Yao TP. HDAC6 is a microtubule‐associated deacetylase. Nature 2002 May 23;417(6887):455‐8. 

  (168)   Matsuyama A, Shimazu T, Sumida Y, Saito A, Yoshimatsu Y, Seigneurin‐Berny D, Osada H, Komatsu Y, Nishino N, Khochbin S, Horinouchi S, Yoshida M. In vivo destabilization of dynamic microtubules by HDAC6‐mediated deacetylation. EMBO J 2002 December 16;21(24):6820‐31. 

  (169)   Gong X, Ming X, Deng P, Jiang Y. Mechanisms regulating the nuclear translocation of p38 MAP kinase. J Cell Biochem 2010 August 15;110(6):1420‐9. 

  (170)   Vafopoulou X. Ecdysteroid receptor (EcR) is associated with microtubules and with mitochondria in the cytoplasm of prothoracic gland cells of Rhodnius prolixus (Hemiptera). Arch Insect Biochem Physiol 2009 December;72(4):249‐62. 

  (171)   Carbonaro M, Escuin D, O'Brate A, Thadani‐Mulero M, Giannakakou P. Microtubules regulate hypoxia‐inducible factor‐1alpha protein trafficking and activity: implications for taxane therapy. J Biol Chem 2012 April 6;287(15):11859‐69. 

  (172)   Burkhardt JK, Echeverri CJ, Nilsson T, Vallee RB. Overexpression of the dynamitin (p50) subunit of the dynactin complex disrupts dynein‐dependent maintenance of membrane organelle distribution. J Cell Biol 1997 October 20;139(2):469‐84. 

  (173)   Lund AW, Stegemann JP, Plopper GE. Mesenchymal Stem Cells Sense Three Dimensional Type I Collagen through Discoidin Domain Receptor 1. Open Stem Cell J 2009;1:40‐53. 

  (174)   Alonso M, Claros S, Becerra J, Andrades JA. The effect of type I collagen on osteochondrogenic differentiation in adipose‐derived stromal cells in vivo. Cytotherapy 2008;10(6):597‐610. 

  (175)   Bokui N, Otani T, Igarashi K, Kaku J, Oda M, Nagaoka T, Seno M, Tatematsu K, Okajima T, Matsuzaki T, Ting K, Tanizawa K, Kuroda S. Involvement of MAPK signaling molecules and Runx2 in the NELL1‐induced osteoblastic differentiation. FEBS Lett 2008 January 23;582(2):365‐71. 

  (176)   Ge C, Xiao G, Jiang D, Franceschi RT. Critical role of the extracellular signal‐regulated kinase‐MAPK pathway in osteoblast differentiation and skeletal development. J Cell Biol 2007 February 26;176(5):709‐18. 

  (177)   Lee HW, Suh JH, Kim HN, Kim AY, Park SY, Shin CS, Choi JY, Kim JB. Berberine promotes osteoblast differentiation by Runx2 activation with p38 MAPK. J Bone Miner Res 2008 August;23(8):1227‐37. 

102 

 

 

  (178)   Shinozaki T, Pritzker KP. Regulation of alkaline phosphatase: implications for calcium pyrophosphate dihydrate crystal dissolution and other alkaline phosphatase functions. J Rheumatol 1996 April;23(4):677‐83. 

  (179)   Nakano‐Kurimoto R, Ikeda K, Uraoka M, Nakagawa Y, Yutaka K, Koide M, Takahashi T, Matoba S, Yamada H, Okigaki M, Matsubara H. Replicative senescence of vascular smooth muscle cells enhances the calcification through initiating the osteoblastic transition. Am J Physiol Heart Circ Physiol 2009 November;297(5):H1673‐H1684. 

  (180)   Malabanan KP, Kanellakis P, Bobik A, Khachigian LM. Activation transcription factor‐4 induced by fibroblast growth factor‐2 regulates vascular endothelial growth factor‐A transcription in vascular smooth muscle cells and mediates intimal thickening in rat arteries following balloon injury. Circ Res 2008 August 15;103(4):378‐87. 

  (181)   Jones PL, Crack J, Rabinovitch M. Regulation of tenascin‐C, a vascular smooth muscle cell survival factor that interacts with the alpha v beta 3 integrin to promote epidermal growth factor receptor phosphorylation and growth. J Cell Biol 1997 October 6;139(1):279‐93. 

  (182)   Gong X, Ming X, Deng P, Jiang Y. Mechanisms regulating the nuclear translocation of p38 MAP kinase. J Cell Biochem 2010 August 15;110(6):1420‐9. 

  (183)   Mejillano MR, Shivanna BD, Himes RH. Studies on the nocodazole‐induced GTPase activity of tubulin. Arch Biochem Biophys 1996 December 1;336(1):130‐8. 

  (184)   Xu K, Luduena RF. Characterization of nuclear betaII‐tubulin in tumor cells: a possible novel target for taxol. Cell Motil Cytoskeleton 2002 September;53(1):39‐52. 

  (185)   Vogel WF, Abdulhussein R, Ford CE. Sensing extracellular matrix: an update on discoidin domain receptor function. Cell Signal 2006 August;18(8):1108‐16. 

  (186)   Chen CW, Tsai YH, Deng WP, Shih SN, Fang CL, Burch JG, Chen WH, Lai WF. Type I and II collagen regulation of chondrogenic differentiation by mesenchymal progenitor cells. J Orthop Res 2005 March;23(2):446‐53. 

  (187)   Lu Z, Doulabi BZ, Huang C, Bank RA, Helder MN. Collagen type II enhances chondrogenesis in adipose tissue‐derived stem cells by affecting cell shape. Tissue Eng Part A 2010 January;16(1):81‐90. 

  (188)   Naik V, Leaf EM, Hu JH, Yang HY, Nguyen NB, Giachelli CM, Speer MY. Sources of cells that contribute to atherosclerotic intimal calcification: an in vivo genetic fate mapping study. Cardiovasc Res 2012 June 1;94(3):545‐54. 

  (189)   Rutsch F, Ruf N, Vaingankar S, Toliat MR, Suk A, Hohne W, Schauer G, Lehmann M, Roscioli T, Schnabel D, Epplen JT, Knisely A, Superti‐Furga A, McGill J, Filippone M, 

103 

 

 

Sinaiko AR, Vallance H, Hinrichs B, Smith W, Ferre M, Terkeltaub R, Nurnberg P. Mutations in ENPP1 are associated with 'idiopathic' infantile arterial calcification. Nat Genet 2003 August;34(4):379‐81. 

  (190)   Speer MY, Chien YC, Quan M, Yang HY, Vali H, McKee MD, Giachelli CM. Smooth muscle cells deficient in osteopontin have enhanced susceptibility to calcification in vitro. Cardiovasc Res 2005 May 1;66(2):324‐33. 

  (191)   Woodcock‐Mitchell J, Mitchell JJ, Low RB, Kieny M, Sengel P, Rubbia L, Skalli O, Jackson B, Gabbiani G. Alpha‐smooth muscle actin is transiently expressed in embryonic rat cardiac and skeletal muscles. Differentiation 1988 December;39(3):161‐6. 

  (192)   Cintorino M, Bellizzi de ME, Leoncini P, Tripodi SA, Xu LJ, Sappino AP, Schmitt‐Graff A, Gabbiani G. Expression of alpha‐smooth‐muscle actin in stromal cells of the uterine cervix during epithelial neoplastic changes. Int J Cancer 1991 April 1;47(6):843‐6. 

  (193)   Cintorino M, Vindigni C, Del Vecchio MT, Tosi P, Frezzotti R, Hadjistilianou T, Leoncini P, Silvestri S, Skalli O, Gabbiani G. Expression of actin isoforms and intermediate filament proteins in childhood orbital rhabdomyosarcomas. J Submicrosc Cytol Pathol 1989 July;21(3):409‐19. 

  (194)   Thyberg J, Blomgren K, Roy J, Tran PK, Hedin U. Phenotypic modulation of smooth muscle cells after arterial injury is associated with changes in the distribution of laminin and fibronectin. J Histochem Cytochem 1997 June;45(6):837‐46. 

  (195)   Thyberg J, Blomgren K, Hedin U, Dryjski M. Phenotypic modulation of smooth muscle cells during the formation of neointimal thickenings in the rat carotid artery after balloon injury: an electron‐microscopic and stereological study. Cell Tissue Res 1995 September;281(3):421‐33. 

  (196)   Curat CA, Vogel WF. Discoidin domain receptor 1 controls growth and adhesion of mesangial cells. J Am Soc Nephrol 2002 November;13(11):2648‐56. 

  (197)   Thesingh CW, Groot CG, Wassenaar AM. Transdifferentiation of hypertrophic chondrocytes into osteoblasts in murine fetal metatarsal bones, induced by co‐cultured cerebrum. Bone Miner 1991 January;12(1):25‐40. 

  (198)   Aaron RK, Ciombor DM. Acceleration of experimental endochondral ossification by biophysical stimulation of the progenitor cell pool. J Orthop Res 1996 July;14(4):582‐9. 

  (199)   Dy P, Wang W, Bhattaram P, Wang Q, Wang L, Ballock RT, Lefebvre V. Sox9 directs hypertrophic maturation and blocks osteoblast differentiation of growth plate chondrocytes. Dev Cell 2012 March 13;22(3):597‐609. 

104 

 

 

  (200)   Perrot‐Applanat M, Lescop P, Milgrom E. The cytoskeleton and the cellular traffic of the progesterone receptor. J Cell Biol 1992 October;119(2):337‐48. 

  (201)   Jang WG, Kim EJ, Kim DK, Ryoo HM, Lee KB, Kim SH, Choi HS, Koh JT. BMP2 protein regulates osteocalcin expression via Runx2‐mediated Atf6 gene transcription. J Biol Chem 2012 January 6;287(2):905‐15. 

  (202)   Yang S, Xu H, Yu S, Cao H, Fan J, Ge C, Fransceschi RT, Dong HH, Xiao G. Foxo1 mediates insulin‐like growth factor 1 (IGF1)/insulin regulation of osteocalcin expression by antagonizing Runx2 in osteoblasts. J Biol Chem 2011 May 27;286(21):19149‐58. 

  (203)   Shimoyama A, Wada M, Ikeda F, Hata K, Matsubara T, Nifuji A, Noda M, Amano K, Yamaguchi A, Nishimura R, Yoneda T. Ihh/Gli2 signaling promotes osteoblast differentiation by regulating Runx2 expression and function. Mol Biol Cell 2007 July;18(7):2411‐8. 

  (204)   Matsuguchi T, Chiba N, Bandow K, Kakimoto K, Masuda A, Ohnishi T. JNK activity is essential for Atf4 expression and late‐stage osteoblast differentiation. J Bone Miner Res 2009 March;24(3):398‐410. 

  (205)   Ahluwalia A, Tarnawski AS. Critical role of hypoxia sensor‐‐HIF‐1alpha in VEGF gene activation. Implications for angiogenesis and tissue injury healing. Curr Med Chem 2012;19(1):90‐7. 

  (206)   Rhee S, Jiang H, Ho CH, Grinnell F. Microtubule function in fibroblast spreading is modulated according to the tension state of cell‐matrix interactions. Proc Natl Acad Sci U S A 2007 March 27;104(13):5425‐30. 

  (207)   Huang Y, Arora P, McCulloch CA, Vogel WF. The collagen receptor DDR1 regulates cell spreading and motility by associating with myosin IIA. J Cell Sci 2009 May 15;122(Pt 10):1637‐46. 

  (208)   Watanabe T, Noritake J, Kaibuchi K. Regulation of microtubules in cell migration. Trends Cell Biol 2005 February;15(2):76‐83. 

  (209)   Hidalgo‐Carcedo C, Hooper S, Chaudhry SI, Williamson P, Harrington K, Leitinger B, Sahai E. Collective cell migration requires suppression of actomyosin at cell‐cell contacts mediated by DDR1 and the cell polarity regulators Par3 and Par6. Nat Cell Biol 2011 January;13(1):49‐58. 

  (210)   Day E, Waters B, Spiegel K, Alnadaf T, Manley PW, Buchdunger E, Walker C, Jarai G. Inhibition of collagen‐induced discoidin domain receptor 1 and 2 activation by imatinib, nilotinib and dasatinib. Eur J Pharmacol 2008 December 3;599(1‐3):44‐53. 

105 

 

 

  (211)   Schlumberger W, Thie M, Rauterberg J, Robenek H. Collagen synthesis in cultured aortic smooth muscle cells. Modulation by collagen lattice culture, transforming growth factor‐beta 1, and epidermal growth factor. Arterioscler Thromb 1991 November;11(6):1660‐6. 

  (212)   Janke C, Bulinski JC. Post‐translational regulation of the microtubule cytoskeleton: mechanisms and functions. Nat Rev Mol Cell Biol 2011 December;12(12):773‐86. 

  (213)   Desai A, Mitchison TJ. Microtubule polymerization dynamics. Annu Rev Cell Dev Biol 1997;13:83‐117. 

  (214)   Sablina AA, Chumakov PM, Levine AJ, Kopnin BP. p53 activation in response to microtubule disruption is mediated by integrin‐Erk signaling. Oncogene 2001 February 22;20(8):899‐909. 

  (215)   Watanabe T, Noritake J, Kaibuchi K. Regulation of microtubules in cell migration. Trends Cell Biol 2005 February;15(2):76‐83.