marinona mediterranea research

8/21/2019 Marinona Mediterranea Research

http://slidepdf.com/reader/full/marinona-mediterranea-research 1/7

JOURNAL OF B ACTERIOLOGY,0021-9193/00/$04.000

July 2000, p. 3754–3760 Vol. 182, No. 13

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Marinomonas mediterranea MMB-1 Transposon Mutagenesis:Isolation of a Multipotent Polyphenol Oxidase Mutant

FRANCISCO SOLANO,1 PATRICIA LUCAS-ELIO,2 EVA FERNA ´ NDEZ,1

AND ANTONIO SANCHEZ-AMAT2*

Department of Biochemistry and Molecular Biology B1 and Department of Genetics and Microbiology,2

University of Murcia, 30100 Murcia, Spain

Received 5 January 2000/Accepted 18 April 2000

Marinomonas mediterranea is a melanogenic marine bacterium expressing a multifunctional polyphenol oxi-dase (PPO) able to oxidize substrates characteristic for laccases and tyrosinases, as well as produce a classicaltyrosinase. A new and quick method has been developed for screening laccase activity in culture plates to detectmutants differentially affected in this PPO activity. Transposon mutagenesis has been applied for the first timeto M. mediterranea by using different minitransposons loaded in R6K-based suicide delivery vectors mobilizableby conjugation. Higher frequencies of insertions were obtained by using mini-Tn10 derivatives encodingkanamycin or gentamycin resistance. After applying this protocol, a multifunctional PPO-negative mutant wasobtained. By using the antibiotic resistance cassette as a marker, flanking regions were cloned. Then the

wild-type gene was amplified by PCR and was cloned and sequenced. This is the first report on cloning andsequencing of a gene encoding a prokaryotic enzyme with laccase activity. The deduced amino acid sequenceshows the characteristic copper-binding sites of other blue copper proteins, including fungal laccases. Inaddition, it shows some extra copper-binding sites that might be related to its multipotent enzymatic capability.

Melanins are dark-colored polyphenolic pigments synthe-sized by different organisms through the entire phylogeneticscale, from bacteria to mammals. In higher organisms andsome bacteria, such as Streptomyces and Rhizobium, melanin ismade by using L -tyrosine as a precursor and tyrosinase as thekey enzyme (EC 1.14.18.1). This enzyme catalyzes two reac-tions (31): ortho hydroxylation of L -tyrosine (cresolase activity)into L -dopa and its subsequent oxidation to yield L -dopaqui-none (catecholase activity). After formation of this o-quinone,

the pathway can proceed spontaneously since that quinoniccompound is very reactive, and it undergoes a series of reac-tions involving oxidation, isomerization, and polymerizationthat lead to the final melanin pigment.

Tyrosinases are polyphenol oxidases (PPOs) that belong tothe group of nonblue copper proteins. The other importantgroup of PPOs are the blue-copper proteins named laccases(EC 1.10.3.2) since their first description was in the lacquertree (42). Laccases are multicopper proteins characterized bythe presence in the molecule of three different types of copper(28), whereas tyrosinases only have a pair of type III coppers.Experimentally, tyrosinases and laccases have been classicallydifferentiated on the basis of substrate specificity and sensitiv-ity to inhibitors, although they are able to oxidize an overlap-

ping range of diphenolic compounds. The most important dif-ference is that only tyrosinases show cresolase activity and onlylaccases are able to oxidize methoxy-activated phenols such assyringaldazine (40).

In fact, laccases have been found abundantly distributed inplants and numerous fungi, where its involvement in melaninformation and a variety of different, and sometimes contradic-tory, physiological functions has been frequently proposed(40). In bacteria, laccase activity has been rarely described. It was described for the first time in Azospirillum lipoferum (19)

and more recently in two marine bacteria, Marinomonas medi-terranea and strain 2-40 (37). Strikingly, laccase activity in thesemarine strains is due to a unique multifunctional PPO thatshows not only laccase but also tyrosinase activity.

M. mediterranea is a melanogenic bacterium recently isolatedfrom the Mediterranean Sea (36, 37). It is the first prokaryoticcell found to show tyrosinase and laccase activities, since itcontains two different PPOs. One of them appears to be aclassical sodium dodecyl sulfate (SDS)-activated tyrosinase,similar to some eukaryotic tyrosinases (29, 41). The other PPOis a multipotent enzyme able to oxidize a wide range of sub-strates characteristic for both tyrosinases and laccases (34).This enzyme has been partially purified and characterized as ablue multicopper membrane-bound protein (18).

It has also been found that tyrosinase and laccase are simul-taneously expressed in some fungi (23), and different isozymesof these PPOs are present in numerous species (16, 25). It isassumed that tyrosinase is involved in melanin synthesis andlaccase is involved in other cellular processes such as formationof fruiting bodies, sexual differentiation, and lignolysis. How-ever, the functions of each enzyme have never been well de-limited.

The unique characteristics of M. mediterranea PPOs made us

think that it would be an interesting model with which to gainknowledge on the physiological roles of tyrosinases and lacca-ses. Due to the overlapping substrate specificities and a seriesof common features (enzymatic copper proteins, etc.), the clas-sical methods for protein purification are not enough to un-ambiguously distinguish the function and properties of eachenzyme; therefore, molecular techniques are necessary. Unlikechemical mutagenesis, transposon-generated mutations deter-mine gene disruption, being very powerful tools for the geneticanalysis of bacteria (7, 13). So far, those molecular techniqueshave been rarely applied to marine bacteria. To our knowl-edge, transposon mutagenesis has been applied to members of the genus Vibrio (6) and to a Pseudomonas strain (1, 39), butthere is no report on its application to the genus Alteromonasor Marinomonas. In this paper, we describe the development of

* Corresponding author. Mailing address: Department of Geneticsand Microbiology, Faculty of Biology, University of Murcia, Murcia30100, Spain. Phone: 34 968 364955. Fax: 34 968 363963. E-mail:[email protected].

3754



transposon mutagenesis for M. mediterranea. This techniquehas allowed us to obtain a mutant strain affected in the mul-

tipotent PPO and to clone the gene encoding this enzyme.

MATERIALS AND METHODS

Strains, plasmids, and media. The bacterial strains and plasmids used in thisstudy are listed in Table 1. Inorganic salts to prepare buffers and culture media were obtained from Merck (Darmstadt, Germany). Peptones and yeast extract were from Oxoid Ltd. (Basingstoke, England). All substrates for the enzymaticassays and the antibiotics were from Sigma Chemical Co. (St. Louis, Mo.), except2,6-dimethoxyphenol (DMP), which was from Fluka Chemie (Bucks, Switzer-land). Escherichia coli strains were grown in Luria-Bertani (LB) medium (33).When required, this medium was supplemented with the appropriate antibiotic.

M. mediterranea was usually grown in marine broth, Agar 2216 (Difco), orseveral marine media (complex MMC, DIC, and minimal MMM). MMC hasbeen previously described (18). DIC is a modification of MMC in which no Mg2

was added to allow detection of tetracycline resistance. This medium containedper liter: 30 g of NaCl, 4 g of Na2SO4, 0.7 g of KCl, 1.25 g of CaCl2, 75 mg of K 2HPO4, 100 mg of iron citrate, 5 g of peptone, and 1 g of yeast extract. MMM

is a chemically defined medium containing, per liter, 20 g of NaCl, 7 g of MgSO47H2O, 5.3 g of MgCl2 5H2O, 0.7 g of KCl, 1.25 g of CaCl2, 25 mg of FeSO4 7H2O,5 mg of CuSO4 5H2O, 75 mg of K 2HPO4, 2 g of sodium glutamate, and 6.1 g of Tris base. The media were adjusted to pH 7.4.

Conjugation and transposon mutagenesis. Plasmids containing different trans-posons were mobilized from donor E. coli S17-1 (pir) into M. mediterranea byconjugation. Usually, the spontaneous rifampicin-resistant (Rif r) M. mediterranea MMB-1R was used, so that antibiotic was added to MMC to counterselect E. coli. It was also possible to counterselect E. coli by growing the cells in MMM.Donor and recipient strains were grown overnight in LB and MMC media,respectively, with appropriate antibiotics for plasmid and transposon resistancemarkers. Then, both strains were reinoculated into fresh media without antibi-otics and were allowed to reach the exponential phase of growth. Conjugation was performed on the surface of an agar plate. Several media were assayed: LB with 15 g of NaCl per liter, marine agar 2216, and LB2216, obtained by mixingequal amounts of the previous two media. A 40- l sample of the exponentiallygrowing recipient cells was spotted on the surface of the plate and allowed to drybefore 40 l of the donor E. coli was added onto the previous spot. Controls withonly M. mediterranea or E. coli were also carried out. The plates were incubated

overnight and then cells were collected by scraping and were suspended in 1 mlof MMC. Appropriate dilutions were plated on selective media. A second anti-biotic to which the transposon or plasmid encoded resistance was also included.

A series of preliminary experiments were performed to establish optimal anti-biotic concentrations for M. mediterranea.

Total numbers of recipient cells were calculated by plating the conjugationsuspension in MMC with rifampicin (50 g/ml). Transposition frequencies werecalculated as the ratio of recipient cells expressing transposon-encoded antibioticresistance versus the total number of cells. In order to check the stability of thedelivery vector in the recipient cell, cellular suspensions were also plated inmedia containing the plasmid marker.

Southern blot analysis and probe labeling. Chromosomal DNA was extractedfrom several independent transconjugants: Rif r, ampicillin-sensitive (Amps),gentamycin-resistant (Gmr), or kanamycin-resistant (Kmr) M. mediterranea ob-tained after the E. coli S17-1 (pir) (pBSL182) or (pLBT) M. mediterraneaMMB-1R matings. Southern blot analysis was carried out after digesting thesesamples with different restriction enzymes. A 0.9-kb SacI fragment of pBSL182or a NotI fragment of pLBT encompassing the genes coding for antibioticresistances was used as a digoxigenin-labeled probe.

Probes encoding tyrosinases from Rhizobium meliloti (27) or Streptomyces (21)or PM1 laccase (9) were labeled with [-32P]ATP by using random primers

(Boehringer radiolabeling kit) to explore possible homologue genes. ppoA wasalso labeled in the same way for use as a probe in Northern blotting. RNA wasisolated from M. mediterranea cultures in exponential and early stationary phaseby centrifugation in CsCl.

Screening for mutants affected in PPO activity. M. mediterranea mutantsaffected in melanization were detected by visually inspecting the pigmentation of the surviving colonies in complex medium (MMC). Mutants in laccase activity were detected in 0.5% agarose plates containing 2 mM DMP in 0.1 M sodiumphosphate buffer, pH 5. Surviving microorganisms were allowed to grow for 3 or4 days and were then replicated by using a toothpick in DMP and MMC plates.Laccase activity was detected by the quick appearance of a bright orange color inthe DMP plate.

Cloning of the transposon-interrupted and complete ppoA genes from M.

mediterranea. Isolated genomic DNA of M. mediterranea Tn101 was digested withSphI and ligated to pUC19 digested with the same enzyme. The ligation mixture was transformed in E. coli DH5, and transformants were selected for ampicillinand gentamycin resistance. The plasmid obtained (LB1) was subcloned in pBlue-script KS II by using the SacI restriction sites that the transposon has close to

TABLE 1. Bacterial strains and plasmids used in this study

Strain Description and/or relevant genotype a Source or reference

Strains M. mediterranea

MMB-1 Wild type, Rif s Gms 36MMB-1R MMB-1, spontaneously Rif r This workng56 MMB-1, ng mutant, amelanotic 36

ngd67 MMB-1, ng mutant, DMPO () This workTn101 MMB-1R, ppoA::Tn10(Gm) This work

E. coli S17-1 ( pir ) Tpr Smr, recA thi hsdRM , pir phage lysogen RP4::Mu::Km Tn7 13 E. coli DH5 Commercially available E. coli ED 8654 Commercially available

PlasmidspUX1Lac pUEX1 2.8-kb laccase gene from basidiomycete PM1 9pMELD pGEM-T 1.5-kb tyrosinase gene from R. meliloti GR4 27pABOR70 Apr, Tn10-based mel delv. vt. 21pCOS5 Apr Cmr, cosmid vector 10pSUP102-Gm Tn 5-B21 ori p15A, mob RP4, Cmr Gmr; Tn 5: LacZ Tcr, delv. vt. 35pBSL299 ori R6K, mob RP4, Apr; mini-Tn 5 Smr, delv. vt. 4pUT Tc ori R6K, mob RP4, Apr; mini-Tn 5 Tcr, delv. vt. 12pUT Km ori R6K, mob RP4, Apr; mini-Tn 5 Kmr, delv. vt. 12pLOFKm ori R6K, mob RP4, Apr; mini-Tn10 Kmr, delv. vt. 21pLBT ori R6K, mob RP4, Apr; mini-Tn10: lac: kan, delv. vt. 1

pBSL181 ori R6K, mob RP4, Apr

; mini-Tn10 Cmr

, delv. vt. 3pBSL182 ori R6K, mob RP4, Apr; mini-Tn10 Gmr, delv. vt. 3pKT230 Double replicon, ori p15A, IncQ/P4 incompatibility group, mob RP4, Smr Kmr 5pUC19 Commercially availablepLB1 Apr Gmr; pUC19 12.7-kb SphI fragment of chromosomal DNA from strain Tn101 This workpPPO Apr, pUC19 2.2-kb HindIII- EcoRI PCR-generated fragment containing ppoA This workpBluescriptKSII Commercially availablepK Apr, pBKSII 1.5-kb SacI- XhoI fragment of chromosomal DNA from strain Tn101 This workpK Apr, pBKSII 3.7-kb SacI- XhoI fragment of chromosomal DNA from strain Tn101 This workpKK Apr, pBKSII 2.4-kb SacI- KpnI fragment subcloned from pK This work

a delv. vt., delivery vector; ng, nitrosoguanidine.

VOL . 182, 2000 ISOLATION OF M. MEDITERRANEA PPO TRANSPOSON MUTANT 3755



both IS10 sequence edges and XhoI or KpnI restriction sites in the M. mediterranea chromosomic DNA. The DNA adjacent to the insertion point was se-quenced by using the forward and reverse M13 universal primers.

The complete ppoA gene was amplified from the chromosome of wild-type M.

mediterranea by PCR by using the proofreading Pfu DNA polymerase (Strat-agene) and the primers MFEF (forward), TTGAAGCTTCCATAGACAGCAA TCTAAC, and MFER (reverse), TTTGAATTCATGCACCAGTCTGCTT, de-signed from the LB1 plasmid sequence. These oligonucleotides respectivelyincorporated cloning HindIII and EcoRI restriction sites. PCR consisted of 25cycles of 95°C for 45 s, 61°C for 1 min, and 72°C for 6 min 15 s. The mixturecontained 5% dimethylsulfoxide, 1 g of each primer, and 100 ng of templateDNA. After digestion of the amplified product with the mentioned enzymes, it was cloned in pUC19, yielding a plasmid with an insert of approximately 2.2 kb.

Enzymatic determinations in cell extracts and gel electrophoresis. Total cellextracts, membrane, and soluble fractions were prepared as previously described(18). Tyrosine hydroxylase and dopa oxidase activities were determined by mon-itoring the respective oxidations of 2 mM L -tyrosine and L -dopa at 475 nm in 0.1M phosphate buffer, pH 5.0. For tyrosine hydroxylase activity, 25 M L -dopa wasadded to the assay mixture to eliminate the lag period (37). When required, theactivities were also assayed in the presence of 0.02% SDS. Dimethoxyphenoloxidase and syringaldazine oxidase activities were respectively determined bymonitoring the oxidation of 2 mM DMP at 468 nm in 0.1 M sodium phosphatebuffer, pH 5.0, or the oxidation of 50 M syringaldazine at 525 nm, pH 6.5 (36).Reference cuvettes always had the same composition except for the enzymaticextract. In all cases, 1 U was defined as the amount of enzyme that catalyzes theappearance of 1 mol of product per min at 37°C. Specific activities werenormalized by milligram of protein, measured by using the bicinchoninic acid kit(Pierce Europe). Polyacrylamide electrophoresis under nondissociating condi-tions and subsequent specific PPO gel staining using L -dopa in the presence orabsence of SDS were performed as previously described (36).

Nucleotide sequence accession number. The nucleotide sequence of the ppoAgene of M. mediterranea reported in this paper has been submitted to GenBankand assigned accession number AF184209.

RESULTS

Laccase activity detection and transposon mutagenesis in M. mediterranea. In a previous report, we communicated thatamelanotic M. mediterranea mutants selected after nitrosogua-

nidine treatment were specifically affected in the SDS-activated tyrosinase activities (36). We were also interested inobtaining complementary mutants affected in the multipotentlaccase-like PPO, the second PPO that this microorganismseemed to contain. Different methods were assayed in order tosimplify the detection of this enzymatic activity. The additionto the culture plates of laccase substrates, such as guaiacol, didnot allow the detection of this activity, mainly because theappearance of dark bacterial melanin hindered the observationof the expected yellowish-colored product resulting from lac-case action on that substrate. However, laccase activity couldbe easily detected by taking part of a colony with a toothpickand picking it in a 0.5% agarose plate containing 2 mM DMP.Under these conditions, the wild-type M. mediterranea, as wellas the amelanotic mutant strain ng56 (36), yielded a bright

orange color. The applicability of this method to detect null-laccase mutants was checked by submitting M. mediterranea tonitrosoguanidine mutagenesis. It was observed that it could be

possible to isolate mutants, such as ngd67, with a phenotypecomplementary to strain ng56. That is, they produced melaninsbut did not show laccase activity.

We approached the problem of cloning the gene by trans-poson mutagenesis. As this technique has not been previouslyreported for study of the genus Marinomonas, different trans-posons and delivery vectors were assayed. The conditions of conjugation between E. coli S-17 and M. mediterranea wereoptimized by using plasmids pKT230 and pSUP102Gm. Theseplasmids contain the mob region from plasmid RP4 and thep15 origin of replication. They could be mobilized at highfrequencies and were able to replicate in M. mediterranea (Ta-ble 2). At 25°C, the mixed LB2216 medium yielded higherconjugation frequencies than cultures at 37°C or other media,so these conditions were selected for conjugation experiments.

Plasmids containing the ori R6K behaved as true suicidal vectors in M. mediterranea. Thus, several plasmid derivativescontaining mini-Tn 5 (4, 13) and mini-Tn10 (3, 21) were tested(Table 2). Mini-Tn10 derivatives yielded higher exconjugantfrequencies than mini-Tn 5, although the antibiotic marker alsoaffected that parameter. The best transposition results wereobtained with kanamycin and gentamycin as resistance mark-ers.

Chromosomal DNA was extracted from several independenttransconjugants of M. mediterranea obtained after the E. coliS17-1 (pir) (pBSL182) or (pLBT) M. mediterranea MMB-1R matings. Southern blot analyses were carried out by usingthe genes coding for antibiotic resistance as probes. A singleband of different sizes was observed in each one, indicating

that a single, random insertion event took place (data notshown).Several thousand exconjugants obtained by using plasmid

pBSL182, pLOFKm, or pLBT were inspected for the forma-tion of dark-pigmented melanized colonies and for their ca-pacity to oxidize DMP. One mini-Tn10 mutant affected in theoxidation of DMP was detected, although we were unable todetect any amelanotic mutants. This mutant was obtained byusing plasmid pBSL182, and hence, it was Gmr. It was denom-inated M. mediterranea Tn101, and it was phenotypically verysimilar to nitrosoguanidine mutant ngd67. Consistent with thequalitative tests used for mutant detection, the enzymatic ox-idase assays indicated that both strains retained soluble SDS-activated tyrosinase activities, but they were affected in mem-brane-bound multipotent PPO activity (Table 3). In addition,

TABLE 2. Exconjugant frequencies obtained by conjugation between M. mediterranea and E. coli S17-1 ( pir )

Vector Transposon Selection medium and

marker (g/ml) aResistancefrequency

Spontaneousresistance

Plasmidreplication b

Transpositionevent

pKT230 None MMC Rif Km (50) 1 102 108 pKT230 None MMM Km (50) 2 102 108 pSUP102-Gm Tn 5-B21 DIC Rif Tc (10) 5.8 104 108 (Cmr Gmr) pUT Tc mini-Tn 5 Tc DIC Rif Tc (10) 108 108 pBSL299 mini-Tn 5 2216 Rif Sm (10) 8 106 5.6 106 pUT Km mini-Tn 5 MMC Rif Km (50) 3.1 106 108 pBSL181 mini-Tn10 MMC Rif Cm (10) 108 108 pBSL182 mini-Tn10 MMC Rif Gm (10) 9.5 105 3 107 c pLOF Km mini-Tn10 MMC Rif Km (50) 6.6 104 108 pLBT mini-Tn10: lac: km MMC Rif Km (50) 1.1 104 108

a Rif, rifampicin; Km, kanamycin; Tc, tetracycline; Cm, chloramphenicol; Gm, gentamycin; Sm, streptomycin. b Estimated by determining growth in the presence of the antibiotic whose resistance is plasmid encoded. c Spontaneous Gmr mutants resulted in very small colonies that were easily differentiated from true transpositions.

3756 SOLANO ET AL. J. B ACTERIOL .



when cellular extracts of wild-type M. mediterranea and mutantstrain Tn101 were subject to polyacrylamide gel electrophore-sis under nondissociating conditions (36), it was observed thatthe mutant strain retained the SDS-activated tyrosinase whilethe broad band corresponding to the membrane-bound PPO was lost (Fig. 1).

ppoA sequencing and analysis. The chromosomal regionflanking the mini-Tn10 insertion in M. mediterranea Tn101 wascloned by a marker rescue experiment. Chromosomal DNA from this strain was digested with the restriction enzyme SphIand was ligated to pUC19. The transformants in E. coli DH5 were selected for gentamycin and ampicillin resistance. A plas-mid (pLB1) was obtained with an insert containing the mini-Tn10 transposon and two flanking regions of M. mediterranea

chromosomal DNA of approximately 8.1 and 3.8 kb (Fig. 2).The two SacI restriction sites close to both IS10 sequences of the transposon were used for subcloning the flanking regionsto the insertion point. SacI/ XhoI digestions of pLB1 were li-gated to the corresponding site of plasmid pBluescript KS II

obtaining plasmids pK and pK comprising, respectively, thesequences downstream and upstream of the transposon inser-tion site. Finally, a SacI/ KpnI fragment of plasmid pK wassubcloned into pUC19, generating the plasmid pKK (Fig. 2).The sequencing of the plasmids pK and pKK indicated thatthe transposon was inserted in an open reading frame 1(ORF1), designated ppoA for PPO, of 2,091 bp (GenBankaccession no. AF184209). The accuracy of the sequence waschecked by PCR amplification from wild-type M. mediterraneaand sequencing this ppoA. The analysis of this sequence revealed that the transposon had inserted in the chromosome,generating a 9-bp direct duplication that is a characteristicfeature of Tn10 (7).

ORF1 starts with two codons, TTG and ATG, that mightencode the initial methionine. However, no putative ribosomebinding site could be detected upstream of them. Thus, the

methionine situated at position 22 in this ORF1 seems to bethe most likely candidate for the transductional start of ppoA,as it is preceded by a region resembling the promoter consen-sus, as well as by a putative Shine-Dalgarno sequence. In con-sequence, a protein of 675 amino acids showing a signal pep-tide seems to be codified by the ppoA gene. Another feature of this gene is that 21 nucleotides downstream of the TAA stopcodon, a palindromic sequence was found (AAAAGCGAGCCAAAGGCTCGCTTTT) that is a putative intrinsic transcrip-tion terminal signal.

ppoA is preceded by a small ORF2 of 309 bp, not showinghomology to any other gene. The sequencing of the approxi-mately 400 bp upstream of the ORF2 to complete the insert inpKK revealed what seemed to be the 3 end of another gene.

Preliminary experiments studying regulation reveal that the

ppoA gene seems to be transcriptionally regulated and that theproposed promoter is controlling its expression. Northernanalysis with 32P-labeled ppoA probe reveals a significant in-crease in the mRNA content of M. mediterranea culturesreaching the early stationary phase. However, the increase inmRNA is not comparable to the large increase in the enzy-matic activity observed at that stage (18).

The sequence deduced for PpoA shows all four character-istic copper-binding sites of blue copper proteins. Table 4shows an alignment among the different prokaryotic blue cop-per proteins and the deduced sequence from the cloned ORF1,illustrating that the four copper-binding sites are very wellconserved. Moreover, ORF1 has other additional histidineclusters (29HQTDHASH and 167HHNH) that might also beinvolved in additional copper binding and might be related to

TABLE 3. Specific activities (milliunits per milligram) in thesoluble and membrane fractions of cell extracts from

wild-type and mutant M. mediterranea strains

Activity a Wild type Tn101 ngd67

SolubleTH 20.1 14.1 17.6

THSDS

243.8 683.7 420.0DO 106.0 74.2 80.2DO

SDS 916.2 954.0 916.0

DMPO 226.5 ND b NDSO 51.3 ND ND

Membrane boundTH 88.5 ND NDDO 839.0 ND NDDMPO 3,572.3 ND NDSO 895.5 ND ND

a TH, tyrosine hydroxylase; DO, dopa oxidase; DMPO, dimethoxyphenol ox-idase; SO, syringaldazine oxidase; THSDS, TH in the presence of 0.02% SDS;DOSDS, DO in the presence of 0.02% SDS.

b ND, not detectable.

FIG. 1. Electrophoretic analysis of the PPO activity in wild-type (wt) M. mediterranea and mutant strain Tn101. Polyacrylamide gels (10%) were rununder nondissociating conditions and were stained for dopa oxidase activity inthe absence and presence of 0.02% SDS. Upper arrow points to the multipotentPPO that can be stained with either laccase or tyrosinase substrates. Lower arrowpoints to the SDS-activated tyrosinase.

FIG. 2. Genetic map of the chromosomal region around ppoA cloned inplasmid LB1, by marker rescue. The site of Tn10 insertion is marked by atriangle. Relevant restriction sites are marked. The fragments subcloned indifferent plasmids are indicated at the bottom. Bar 1 kb.




the multifunctional activity of this enzyme, sharing laccase andtyrosinase capabilities (34).

Regarding the ppoA gene in mutant strains, the site of the

Tn10 insertion in the mutant Tn101 was located relatively closeto the 3 extreme of the gene, truncating the ORF1 at 529M.Furthermore, the ppoA gene from mutant strain ngd67 wasalso amplified and sequenced, revealing a nonsense mutationin which the codon 328 (TGG) coding for W changed to stopcodon TGA. In both cases, copper-binding motifs C and D aresuppressed, supporting the complete lost of enzymatic activity.On the other hand, no mutation was detected in the ppoA geneof the amelanotic mutant ng56.

DISCUSSION

Based on kinetic data and cellular localization studies, wehad proposed that M. mediterranea is a melanogenic bacteriumcontaining two different PPOs (36): an unusual multipotent

PPO able to oxidize substrates characteristics of both tyrosi-nase and laccase (18, 34) and an SDS-activated tyrosinase. Toexplore their respective cellular functions and the structures of these enzymes, we needed to develop methods for detectingmutants affected differentially in both PPOs.

The detection of the SDS-activated tyrosinase can be easilydone by checking the melanization of the colony (36). Usingthat method, we have already detected ng56 and some otheramelanotic mutants lacking that activity but still expressing themultifunctional PPO. We now present a rapid test for thisactivity in agar plates containing DMP. According to this test,the wild-type and the mutant ng56 strains showed no differ-ences, indicating that tyrosinase is not involved in the DMPoxidation. However, the test has proven to be an effectivemethod for the detection of the laccase-lacking mutants, such

as ngd67 and others, that had lost multipotent PPO activity but which were still able to synthesize melanins.

A systematic transposon mutagenesis of M. mediterranea with the mini-Tn10 transposons encoding gentamycin resis-tance allowed us to clone the multipotent PPO gene. Thistechnique has already been used in the study of other marinebacteria (1, 39). Southern blot analysis of genomic DNA revealed that the transposition was a single event on the bacterialchromosome. However, the randomness of the insertion isuncertain, since after screening thousands of mutant strains,only one (Tn101) affected in the multifunctional PPO wasfound, and no amelanotic mutants phenotypically similar tong56 and presumably affected in the SDS-activated tyrosinasegene have been so far detected. Further rounds of mutagenesisare underway to assess this point.

M. mediterranea Tn101 was obtained by using pBSL182.Marker rescue experiments allowed the cloning and character-ization of the gene in which the gentamycin resistance marker was inserted. These data support the existence of two differentPPOs encoded at different loci. The strains Tn101 and ngd67are specifically affected in the multipotent membrane-boundPPO as shown by direct enzymatic activity measurements (Ta-

ble 3) and polyacrylamide gel electrophoresis staining (Fig. 1).The site of the transposon insertion easily accounts for thisphenotype, as two characteristic copper centers of laccases(Table 4, columns C and D) are lost either by transposoninsertion (Tn101) or by a premature stop codon (ngd67). Incontrast, their cellular extracts maintained the SDS-activatedoxidation of tyrosine and dopa. These strains are pigmented,indicating that the SDS-activated tyrosinase is the only PPOactivity required for pigmentation. This point is important,since laccase activity has been involved in the melanizationof A. lipoferum (17) and in the formation of fungal dihy-droxynaphthalene-melanins (15). In contrast, our data supportmost of the bacterial strains so far studied, where L -tyrosine isthe most common substrate for melanization and tyrosinasehas been linked to this process (27, 32).

The protein sequence of PpoA revealed a signal peptide thatit is very likely involved in its transport to the membrane (30).The mature protein remains bound to the membrane ratherthan released to the periplasmic space, and it is released bylipase treatment of membrane preparations (18), supportingthe existence of a covalent link. Although the position for thehydrolysis site of the signal peptide will remain uncertain untildirect sequencing of the N terminus of the purified matureprotein, cleavage after 25A would permit the preservation of 26C in the N terminus, which would also allow for the anchor-ing of the protein to the membrane through a thioester bond,as a prokaryotic membrane lipid attachment protein (prositePDOC00013 [20]).

The ppoA gene from M. mediterranea shows the four char-

acteristic copper centers for laccases and other blue-copperproteins, but the similarity scores of ppoA from M. mediterranea with fungal laccases are quite low (around 40) (38). Thisfact accounts for the negative results obtained in all of ourprevious attempts to clone the multipotent laccase-like PPOgene by using genes from related PPO, such as prokaryotictyrosinases or fungal laccases, to probe genomic digested DNA (10). In turn, PpoA differs from typical laccases in that it hascresolase activity, oxidizing L -tyrosine and other related mono-phenols that are specific substrates of tyrosinase. Further stud-ies will be necessary in order to clarify the relationship betweenthe presence of additional copper-binding domains and therange of substrates for this PPO. The histidine-containing mo-tifs (HQTDHASH) occurring in the amino termini of ppoA orthe HHNH cluster sited between amino acids 167 and 170

could be involved in its unique multifunctional catalytic prop-erties. Directed mutagenesis studies are planned in the nearfuture to correlate the presence of those binding copper sites with the enzymatic activities.

The prokaryotic blue-multicopper proteins constitute a groupof proteins with different functions whose putative PPO activ-ities have not been profoundly studied. Streptomyces phenox-azinone synthase is involved in antibiotic synthesis (22), CotA is expressed during the sporulation of Bacillus (14), the pro-teins from Pseudomonas syringae and Xanthomonas campestrisare involved in copper resistance (24, 26), and there are otherhypothetical proteins proposed from the systematic genomicsequencing of strains such as E. coli (8) and Aquifex aoelicus(11) without known function. Other, still uncloned, laccaseshave been found to be involved in other functions, as is the

TABLE 4. Alignment of the four characteristic copper-bindingsites (A, B, C, and D) in some prokaryotic blue multicopper

proteins and a fungal laccase included for comparison

Protein aCopper-binding site

A B C D

M. mediterranea, PpoA (AF184209) H TH H AH H PY HI H H CH IL DH

P. syringae, Cu resistance (P12374) H WH H SH H PI HL H H CH LL YH

X. campestris, Cu resistance (L19222) H WH H SH H PI HL H H CH LL YH

E. coli, hypothetical protein (AAC73234) HW H H PH H PF HI H H CH LL EH

Streptomyces antibioticus, phenoxazinonesynthase (Q53692)

H LH H DH H PM HI H H CH LL EH

A. aoelicus, hypothetical protein(AAC07157.1)

H WH H PH H PM HI H H CH IL EH

Bacillus subtilis, CotA (P07788) HLH HDH HILIHLH HCHILEH

Basidiomycete PM1 laccase (Z12156) H WH HS H H PF HL H H CH ID FH

a Protein accession numbers appear in parentheses.




laccase from A. lipoferum, which is under the same control asthe synthesis of components of the respiratory chain (2). Atthis point, the physiological role of the PpoA protein from M. mediterranea is unclear. The comparison of PpoA with

other bacterial blue-multicopper proteins using the BLAST 2Sequences (38) shows that the alignment score is significant,but low (Table 5). It is tempting to speculate that PpoA may beinvolved in some kind of response to stress conditions, since itsexpression is induced during the stationary phase of growth(18). This work has shown that M. mediterranea is amenableto genetic manipulation. The characterization of the mutantstrain Tn101 in comparison with the wild type is in progress,but it has not yet revealed any phenotypic alteration except theloss of the multipotent PPO activity. Hopefully, the combina-tion of different approaches will help to clarify the physiolog-ical role of this unique PPO, as well as its possible relationship with the SDS-activated tyrosinase responsible for melanin pig-mentation.

ACKNOWLEDGMENTS

This work was supported by grant PB97-1060 from the CICYT,Spain. P. Lucas-Elı o and E. Fernandez were recipients of predoctoralfellowships from, respectively, Seneca Foundation (Comunidad Au-tonoma de Murcia) and Ministerio de Educacion y Ciencia, Spain.

We are grateful to R. Santamarı a, J. Olivares, M. Alexeyev, V. deLorenzo, S. Kjelleberg, and T. D. Connell for providing bacterialstrains and plasmids and to J. C. Garcıa-Borron for helpful sugges-tions. We also thank the DNA sequencing service of CIB, Madrid,Spain, for their excellent and rapid work.

REFERENCES

1. Albertson, N. A., S. Stretton, S. Pongpattanakitshote, J. Ostling, K. C.Marshall, A. E. Goodman, and S. Kjelleberg. 1996. Construction and use of a new vector/transposon, pLBT::mini-Tn10 :lac:kan, to identify environmen-

tally responsive genes in a marine bacterium. FEMS Microbiol. Lett. 140:287–294.2. Alexandre, G., R. Bally, B. L. Taylor, and I. B. Zhulin. 1999. Loss of cyto-

chrome c oxidase activity and acquisition of resistance to quinone analogs ina laccase-positive variant of Azospirillum lipoferum. J. Bacteriol. 181:6730–6738.

3. Alexeyev, M. F., and I. N. Shokolenko. 1995. Mini-Tn10 transposon deriva-tives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene 160:59–62.

4. Alexeyev, M. F., I. N. Shokolenko, and T. P. Croughan. 1995. New mini-Tn5derivatives for insertion mutagenesis and genetic engineering in Gram-neg-ative bacteria. Can. J. Microbiol. 41:1053–1055.

5. Bagdasarian, M., R. Lurz, B. Ruckert, F. C. H. Franklin, M. M. Bagdasar-ian, J. Frey, and K. N. Timmis. 1981. Specific purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors,and a host-vector system for gene cloning in Pseudomonas. Gene 16:237–247.

6. Belas, R., A. Mileham, M. Simon, and M. Silverman. 1984. Transposonmutagenesis of marine Vibrio sp. J. Bacteriol. 158:890–896.

7. Berg, C. M., D. E. Berg, and E. A. Groisman. 1989. Transposable elements

and the genetic engineering of bacteria, p. 879–925. In D. E. Berg and M. M.Howe (ed.), Mobile DNA. American Society for Microbiology, Washington,D.C.

8. Blattner, F. R., G. Plunkett III, C. A. Bloch, N. T. Perna, V. Burland, M.Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J. Gregor,N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B. Mau, and Y.Shao. 1997. The complete genome sequence of Escherichia coli K-12. Sci-ence 277:1453–1474.

9. Coll, P. M., C. Tabernero, R. Santamarı a, and P. Perez. 1993. Character-

ization and structural analysis of the laccase I gene from the newly isolatedlignolytic basidiomycete PM1 (CECT 2971). Appl. Environ. Microbiol. 59:4129–4135.

10. Connell, T. D., A. J. Matone, and R. K. Holmes. 1995. A new mobilizablecosmid vector for use in Vibrio cholerae and other Gram bacteria. Gene153:85–87.

11. Deckert, G., P. V. Warren, T. Gaasterland, W. G. Young, A. L. Lenox, D. E.Graham, R. Overbeek, M. A. Snead, M. Keller, M. Aujay, R. Huber, R. A.Feldman, J. M. Short, G. J. Olson, and R. V. Swanson. 1998. The completegenome of the hyperthermophilic bacterium Aquifex aeolicus. Nature 392:353–358.

12. de Lorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5transposon derivatives for insertion mutagenesis, promoter probing, andchromosomal insertion of cloned DNA in Gram-negative eubacteria. J. Bac-teriol. 172:6568–6572.

13. de Lorenzo, V. M., and K. N. Timmis. 1994. Analysis and construction of stable phenotypes in Gram-negative bacteria with Tn-5 and Tn-10-derivedmini-transposons. Methods Enzymol. 235:386–405.

14. Donovan, W., L. B. Zheng, K. Sandman, and R. Losick. 1987. Genes encod-ing spore coat polypeptides from Bacillus subtilis. J. Mol. Biol. 196:1–10.

15. Edens, W. E., T. G. Goings, D. Dooley, and J. M. Henson. 1999. Purificationand characterization of a secreted laccase of Gaeumannomyces graminis var.tritici. Appl. Environ. Microbiol. 65:3071–3074.

16. Eggert, C., U. Temp, and K. E. L. Eriksson. 1996. The ligninolytic system of the white rot fungus Pycnoporus cinnabarinus: purification and characteriza-tion of the laccase. Appl. Environ. Microbiol. 62:1151–1158.

17. Faure, D., M. L. Bouillant, and R. Bally. 1994. Isolation of Azospirillum lipoferum 4T Tn5 mutants affected in melanization and laccase activity. Appl.Environ. Microbiol. 60:3413–3415.

18. F ernandez, E., A . Sanchez-A mat, and F. Solano. 1999. Location and catalyticcharacteristics of a multipotent bacterial polyphenol oxidase. Pigm. Cell Res.12:331–339.

19. Givaudan, A., A. Effosse, D. Faure, P. Potier, M. L. Bouillant, and R. Bally.1993. Polyphenol oxidase from Azospirillum lipoferum isolated from ricerhizosphere: evidence for laccase activity in non-motile strains of Azospiril- lum lipoferum. FEMS Microbiol. Lett. 108:205–210.

20. Hayashi, S., and H. C. Wu. 1990. Lipoproteins in bacteria. J. Bioenerg.Biomembr. 22:451–471.21. Herrero, M., V. de Lorenzo, and K. N. Timmis. 1990. Transposon vectors

containing non-antibiotic resistance selection markers for cloning and stablechromosomal insertion of foreign genes in Gram-negative bacteria. J. Bac-teriol. 172:6557–6567.

22. Hsieh, C. J., and G. H. Jones. 1995. Nucleotide sequence, transcriptionalanalysis, and glucose regulation of the phenoxazinone synthase gene ( phsA)from Streptomyces antibioticus. J. Bacteriol. 177:5740–5747.

23. Huber, M., and K. Lerch. 1987. The influence of copper on the induction of tyrosinase and laccase in Neurospora crassa. FEBS Lett. 219:335–338.

24. Lee, Y. A., M. Hendson, N. J. Panopoulos, and M. N. Schroth. 1994. Mo-lecular cloning, chromosomal mapping, and sequence analysis of copperresistance genes from Xanthomonas campestris pv. juglandis: homology withsmall blue copper proteins and multicopper oxidase. J. Bacteriol. 176:173–188.

25. Mansur, M., T. Suarez, J. B. Fernandez-Larrea, M. A. Brizuela, and A. E.Gonzalez. 1997. Identification of a laccase gene family in the new lignin-degrading basiodiomycete CECT 210197. Appl. Environ. Microbiol. 63:2637–2646.

26. Mellano, M. A., and D. A. Cooksey. 1988. Nucleotide sequence and organi-zation of copper resistance genes from Pseudomonas syringae pv. tomato. J.Bacteriol. 170:2879–2883.

27. Mercado-Blanco, J., F. Garcia, M. Fernandez-Lopez, and J. Olivares. 1993.Melanin production by Rhizobium meliloti GR4 is linked to nonsymbioticplasmid pRmeGR4b: cloning, sequencing and expression of the tyrosinasegene mepA. J. Bacteriol. 175:5403–5410.

28. Messerschmidt, A., and R. Huber. 1990. The blue oxidases, ascorbate oxi-dase, laccase and ceruloplasmin. Modelling and structural relationships. Eur.J. Biochem. 187:341–352.

29. Moore, B. M., and W. H. Flurkey. 1990. Sodium dodecyl sulfate activation of a plant polyphenoloxidase. J. Biol. Chem. 265:4982–4988.

30. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identifica-tion of prokaryotic and eukaryotic signal peptides and prediction of theircleavage sites. Protein Eng. 10:1–6.

31. Pomerantz, S. H. 1966. The tyrosine hydroxylase activity of mammaliantyrosinase. J. Biol. Chem. 241:161–168.

TABLE 5. Comparison of bacterial multicopper proteins a

Protein Alignment score with

ECH AAH PSS BCotA PCR XCR

PpoA 79.6 55.8 49.6 44.9 34 32.8ECH 179 109 122 79.2 55.4

AAH 116 161 52.7 42.2

PSS 267 36 33.2BCotA 41.8 46.9PCR 774

a Alignment scores obtained for the different prokaryotic blue multicopperproteins using the program BLAST 2 Sequences (38). PCR, copper resistancefactor from P. syringae; XCR, copper resistance, X. campestris; ECH, hypothet-ical protein, E. coli; PSS, phenoxazinone synthase, S. antibioticus; AAH, hypo-thetical protein, A. aoelicus; BCotA, sporulation protein, B. subtilis; PpoA, mul-tipotent PPO, M. mediterranea.




32. Pomerantz, S. H., and V. V. Murthy. 1974. Purification and properties of tyrosinases from Vibrio tyrosinaticus. Arch. Biochem. Biophys. 160:73–82.

33. Sambrook, J., E. J. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

34. Sanchez-Amat, A., and F. Solano. 1997. A pluripotent polyphenol oxidasefrom the melanogenic marine Alteromonas sp. shares catalytic capabilities of tyrosinases and laccases. Biochem. Biophys. Res. Commun. 240:787–792.

35. Simon, R., J. Quandt, and W. Klipp. 1989. New derivatives of transposon

Tn5 suitable for mobilization of replicons, generation of operon fusions andinduction of genes in Gram-negative bacteria. Gene 80:161–169.

36. Solano, F., E. Garcı a, E. Perez de Egea, and A. Sanchez-Amat. 1997. Isola-tion and characterization of strain MMB-1 a novel melanogenic marinebacterium. Appl. Environ. Microbiol. 63:3499–3506.

37. Solano, F., and A. Sanchez-Amat. 1999. Studies on the phylogenetic rela-tionships of melanogenic marine bacteria. Proposal of Marinomonas medi-

terranea sp. nov. Int. J. Syst. Bacteriol. 49:1241–1246.38. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new tool for

comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174:

247–250.39. Techkarnjanaruk, S., S. Pongpattanakitshote, and A. E. Goodman. 1997.

Use of a promoterless lacZ gene insertion to investigate chitinase geneexpression in the marine bacterium ( Pseudoalteromonas sp. strain S). Appl.Environ. Microbiol. 63:2989–2999.

40. Thurston, C. F. 1994. The structure and function of fungal laccases. Micro-biology 140:19–26.41. Wittenberg, C., and E. L. Triplett. 1985. A detergent-activated tyrosinase

from Xenopus laevis. I. Purification and partial characterization. J. Biol.Chem. 260:12535–12541.

42. Yoshida, H. 1883. Chemistry of lacquer (Urushi) part I. J. Chem. Soc. 43:

231–237.


marinona mediterranea research

Documents