malaria infection alters the expression of hepatobiliary

DMD #53983

1

Malaria Infection Alters the Expression of Hepatobiliary and

Placental Drug Transporters in Pregnant Mice

Authorship:

Alex M. Cressman, Chloe R. McDonald, Karlee Silver, Kevin C. Kain, Micheline Piquette-

Miller

Author Affiliations:

Department of Pharmaceutical Sciences, Leslie Dan Faculty of Pharmacy, University of

Toronto (AMC, MPM); Sandra Rotman Centre for Global Health, University Health Network-

Toronto General Hospital, University of Toronto (CRM, KS, KCK)

DMD Fast Forward. Published on November 26, 2013 as doi:10.1124/dmd.113.053983

Copyright 2013 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on November 26, 2013 as DOI: 10.1124/dmd.113.053983

at ASPE

T Journals on January 3, 2022

dmd.aspetjournals.org

Dow

nloaded from

http://dmd.aspetjournals.org/

DMD #53983

2

Running Title: Altered Expression of Transporters in Placental Malaria Corresponding Author: Dr. Micheline Piquette-Miller, PhD Leslie Dan Faculty of Pharmacy University of Toronto 144 College St. Toronto, Ontario, Canada, M5S 3M2 Telephone: 1-416-946-3057 Fax: 1-416-978-8511 E-mail: [email protected]

Number of Text Pages: 16 (28 in document)

Number of Tables: 1

Number of Figures: 6

Number of References: 58

Number of Words in Abstract: 249

Number of Words in Introduction: 740

Number of Words in Discussion: 1493

List of Nonstandard abbreviations:

ABC, ATP-binding cassette; Pgp, P-glycoprotein; Mdr, multidrug resistance; Mrp, multidrug resistance-associated protein; Bcrp, breast cancer resistance protein; Oatp, organic anion-transporting polypeptide; TNF, tumor necrosis factor; IL, interleukin.


at ASPE



Dow

nloaded from


DMD #53983

3

Abstract:

Preventing and treating malaria in pregnancy is a global health priority. However little

is known regarding the impact of malaria infection on the maternal and fetal disposition of

pharmaceuticals and other xenobiotics. Our objective was to characterize expression of key

determinants of drug-disposition in maternal and fetal tissues in a validated murine model of

experimental placental malaria. Balb/c mice were infected with Plasmodium berghei at mid

gestation [gestational day (GD) 13] and maternal, placental, and fetal tissues were

collected at GD19. Expression of key ABC drug transporters and Cyp3a11 was examined

by qRT-PCR. Western blotting was used to examine the protein expression of Multidrug

resistance protein 1 (Mdr1, Abcb1). As compared to controls, placental mRNA expression

of Abcb1a, Abcb1b, Abcc1, Abcc2, Abcc3, and Abcg2 were significantly down-regulated in

the malaria-infected group (p < 0.05), as was placental Mdr1 protein (p < 0.05). Significantly

decreased hepatic expression of Abcc2, Abcg2 and Abcb11 and significantly increased

expression of Abcb1b, Abcc1, and Abcc3 were seen in malaria-infected dams (p < 0.05) in

comparison to uninfected controls. The expression of Abcb1a and Abcg2 was significantly

decreased in fetal liver of infected dams while levels of Abcb1b were increased (p < 0.05).

Maternal and fetal hepatic expression of Cyp3a11 was significantly down-regulated in the

malaria group (p < 0.05). Together, malaria- induced alterations in the expression of

transporters and drug-metabolizing enzymes in maternal and fetal tissues may alter the

disposition of endogenous and therapeutic substrates, potentially impacting maternal and

fetal outcomes.


at ASPE



Dow

nloaded from


DMD #53983

4

Introduction:

Each year over 125 million women are at risk of malaria infection during pregnancy.

In Sub-Saharan Africa an estimated 25% of all pregnancies are complicated by placental

malaria (PM) infection (Dellicour et al., 2010). PM is associated with increased risk of

adverse outcomes for both mother and fetus, including an increased risk of anemia,

preterm birth, stillbirth and delivery of low birth weight infants. During pregnancy malaria-

infected red blood cells accumulate in the placental intervillous blood spaces, resulting in

altered placental angiogenesis and vascular flow, reduced nutrient and waste transfer,

placental insufficiency, and a chronic localized pro-inflammatory environment (Fried and

Duffy, 1996; Matteelli et al., 1997; Miller et al., 2002; Conroy et al., 2013). As such,

optimization of pharmacological treatment of malaria in pregnancy is a global health priority.

However, little research has been conducted to investigate the determinants of drug-

disposition in malaria-infected pregnant populations.

Studies in humans and experimental rodent models have reported malaria-induced

alterations in the hepatic metabolism and clearance of numerous drugs, including many that

are used in the treatment of malaria (Mihaly et al., 1987; Mansor et al., 1990; Murdoch et

al., 1991; Pukrittayakamee et al., 1997). In mice, malaria infection is associated with

decreases in the hepatic expression of Cyp3a11 and other drug metabolizing enzymes

(DMEs) (De-Oliveira et al., 2006; Carvalho et al., 2009). Cyp3a11 is the murine ortholog of

human CYP3A4, which is involved in the metabolism of many antimalarials including

quinine (Zhang et al., 1997), chloroquine (Kim et al., 2003), halofantrine (Baune et al.,

1999), mefloquine (Fontaine et al., 2000), piperaquine (Lee et al., 2012), artemesinin and

artemisinin derivatives (Svensson and Ashton, 1999). Although many of these drugs are


at ASPE



Dow

nloaded from


DMD #53983

5

used to treat malaria in pregnant populations, little is known about the impact of malaria

infection on CYP3A expression in maternal and fetal tissues.

In addition to DMEs, the ATP-Binding Cassette (ABC) drug transporters act as major

determinants of maternal and fetal exposure to endogenous and exogenous compounds

during pregnancy. The multidrug resistance protein (MDR) 1 (P-glycoprotein; encoded by

ABCB1 in humans and Abcb1a and Abcb1b in the mouse), multidrug resistance associated

proteins (MRP; encoded by ABCC genes) and the breast cancer resistance protein (BCRP;

encoded by ABCG2) are transporters that mediate the ATP-driven efflux of substrates from

liver and kidney and limit drug exposure of highly sensitive sites such as the brain and fetal

compartment. Within the placenta, these transporters reduce the materno-fetal transfer of

their substrates via ATP-driven efflux from the fetal-to-maternal circulation (Figure 1). Their

importance in determining fetal xenobiotic exposure has been well established in vivo in

knockout mouse and ex vivo in human placental perfusion models (Vahakangas and

Myllynen, 2009; Aye and Keelan, 2013). With regards to therapeutics, MDR1 (Pgp, ABCB1)

plays an important role in the pharmacokinetics of quinine (Pussard et al., 2007; Mukonzo

et al., 2010), and could transport other antimalarials as the Mdr homologue of P.

falciparum , PfMDR1, has been shown to extrude a wide variety of antimalarials including

amodiaquine, mefloquine, lumefantrine, and artemisinin; thereby contributing to drug

resistance (Foote et al., 1989; Wilson et al., 1989; Price et al., 2004; Sisowath et al., 2007;

Sa et al., 2009; Chavchich et al., 2010).

The expression of several drug transporters as well as CYP3A are altered in both

pregnant and non-pregnant rodent models of bacterial and viral infection and these

changes have been associated with altered disposition of their substrates (Cressman et al.,

2012). Administration of bacterial endotoxin also impacts the expression of Cyp3a11 in fetal


at ASPE



Dow

nloaded from


DMD #53983

6

liver (Xu et al., 2005). Whether these findings extend to malaria infection is unknown. As

many clinically important drugs are substrates of the ABC transporters and DMEs, disease-

induced changes could have important implications on drug efficacy and toxicity; thereby

impacting maternal and fetal outcomes. Hence further investigation on the impact of

malaria infection on drug transporters and metabolic enzymes is warranted.

We hypothesized that malaria infection would induce changes in the maternal and

fetal expression of drug transporters and Cyp3a11. The impact of malaria was examined in

a Plasmodium berghei ANKA (PbA) murine model of PM that mimics the pathophysiology

and clinical features of human PM (Hviid et al., 2010). To our knowledge, this is the first

study to examine the impact of malaria on drug transporters in maternal and fetal tissue.

Materials and Methods:

Plasmodium berghei ANKA Placental Malaria Model:

Animal protocols were approved by the Toronto University Health Network Animal Care

Committee and performed in accordance with the Canadian Council on Animal Care

Guidelines. We used a previously validated mouse model of PM that replicates key

pathogenic features of human PM, including placental parasite sequestration, placental

inflammation, spontaneous abortion and fetal growth restriction(Silver et al., 2010). Eight to

ten week old Balb/c female mice were obtained from Jackson Laboratories Inc. (Bar

Harbor, Maine, USA) and maintained on a 12-hour dark and 12-hour light cycle with ad

libitum access to standard rodent chow and water. Females were mated and checked for

the presence of a vaginal plug (GD1). Cryopreserved PbA strain malaria (MR4; Manassas,

VA, USA) was passaged through a male Balb/c mouse as previously described (Silver et

al., 2010). On GD13 dams were inoculated with 106 PbA-infected erythrocytes in RPMI


at ASPE



Dow

nloaded from


DMD #53983

7

(Sigma-Aldrich, Oakville, ON, Canada) via tail-vein injection. Control dams were injected

with an equivalent volume of RPMI alone. Maternal peripheral parasitemia was monitored

daily over the course of infection (GD13-GD19) by thin blood smear with modified Giemsa

stain (Protocol Hema3 Stain Set, Sigma, Oakville, ON, Canada) and is reported as %

infected red blood cells. Dams were euthanized by CO2 on GD19. Maternal blood was

collected by cardiac puncture, centrifuged at 13,000 rpm for 5 minutes, and plasma was

stored at -80°C until further use. Maternal tissues were removed immediately after sacrifice

and snap frozen in liquid nitrogen. Uteri were removed and examined for evidence of

reabsorptions. Yolk sacs were dissected from uteri and fetuses were removed and

weighed. Fetal viability was determined by the pedal withdrawal reflex and placentae and

fetal tissue from viable fetuses were removed immediately and snap frozen in liquid

nitrogen. Placentae and fetuses were obtained from 5-6 dams per group. Samples were

subsequently stored at -80°C until further use.

Total RNA Extraction and qPCR:

Methods for RNA isolation, cDNA synthesis, and qRT-PCR have been described

previously(Anger et al., 2012). Briefly, RNA was extracted from ~75 mg of snap-frozen

tissue using TriZol® reagent (Invitrogen, Carlsbad, CA) and cDNA was synthesized from

2µg of DNAse I treated RNA using the High-Capacity cDNA Reverse Transcription Kit

(Applied Biosystems, Burlington, ON) according to manufacturer’s instructions. mRNA

expression of drug transporters and Cyp3a11 were determined by qPCR using LightCycler®

technology with SYBR detection (Roche Diagnostics, Montreal, QC, Canada). qPCR

oligonucleotides were synthesized at The Hospital for Sick Children (DNA Synthesis

Centre, Toronto, ON, Canada) and reconstituted in nuclease-free DEPC H2O (Table 1).

Amplicon sequences were amplified as described elsewhere(Anger et al., 2012). Melt-curve


at ASPE



Dow

nloaded from


DMD #53983

8

analysis was used to ensure primer-specificity. Expression levels of each gene were

determined using the Roche LightCycler® II software (Ver. 3.5) configured with the Roche

LightCycler® II Real-Time qPCR instrument (Roche Diagnostics GmbH, Hamburg,

Germany). Gene-of-interest expression in each sample was normalized to cyclophilin A

mRNA expression. Data are presented as percentage of expression as compared to control

± SEM.

Detection of Mdr1 Protein Expression by Western Blot:

Given the dissimilar changes seen in the expression of the Abcb1a and Abcb1b mRNA in

several tissues and the fact that both of these mRNA encode for the Mdr1 protein in mice,

we further investigated the impact of malaria on the protein expression of Mdr1. Methods

for protein isolation and Western blotting have been described previously (Anger et al.,

2012). Briefly, protein samples were isolated from 300 mg of snap-frozen tissue

homogenized in lysis buffer containing dithiothrietol (1 mM; DTT; Sigma-Aldrich, Oakville,

ON), phenylmethylsulfonyl fluoride (0.5 mM; PMSF; BioShop Canada Inc., Burlington, ON,)

and 1X protease-inhibitor cocktail (Sigma-Aldrich, Oakville, ON,) at 4°C. Homogenates

were centrifuged at 18,000 x g for 15 minutes at 4°C and the supernatant isolated. Protein

concentrations were measured using the Bradford assay. Protein samples containing 50 g

of isolated protein were separated via 10% SDS polyacrylamide gel electrophoresis and

transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad Laboratories Canada,

Ltd., Mississauga, ON). PVDF membranes were then blocked in 5% non-fat dry milk in Tris-

Buffered Saline + 0.1% Tween 20 (TBST) and incubated with an anti-Mdr1 (C219) mouse

monoclonal antibody (1:500, 1mg/mL mC219 clone, ID Labs Biotechnology, Inc., London,

ON) overnight at 4°C. After a series of washes with TBST, membranes were incubated with

an anti-mouse horseradish peroxidase-labeled secondary antibody (1:5,000; goat-anti


at ASPE



Dow

nloaded from


DMD #53983

9

mouse Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 1 hour in

2% non-fat milk TBST. Bound immunoreactive proteins were detected using an ECL Plus

chemiluminescence kit (Amersham Biosciences, Baie d’Urfé, QC, Canada) and visualized

using the Alpha Innotech FluorChem imaging system (San Leandro, CA, USA. The optical

density (OD) of each Mdr1 band was determined using ImageJ (Software version 1.44) for

Macintosh. To confirm equivalent protein loading, each blot was stained with Amido Black

(0.03% Napthol Blue Black in 3% acetic acid) (BioShop Canada Inc., Burlington, ON) and

allowed to air-dry before scanning at 600 dpi using an HP Scanjet 7400C. The optical

density (OD) of each lane was determined using ImageJ (Software version 1.44o) for

Macintosh. Unfortunately, due to low expression and limited quantity of fetal tissues, we

were unable to assess Mdr1 expression in fetal liver.

Total Cellular Antioxidant Assay:

Total cellular antioxidant capacity of hepatic lysates from infected and control dams were

measured using the Cayman antioxidant assay kit (Cayman Chemical Company, Ann

Arbor, MI) which evaluates the combined effect of all antioxidants present in tissue. The

colorimetric antioxidant assay was conducted according to the manufacturer’s protocol.

Briefly, ~150 mg of maternal liver was homogenized on ice in 1 mL of homogenization

buffer (5mM potassium phosphate, pH 7.4 containing 0.9% NaCl and 0.1% glucose) and

centrifuged at 12,000 x g for 15 minutes at 4°C and supernatant collected and stored on ice

until use. Protein concentrations were measured using the Bradford assay. Whole cell

lysate samples (5-10mg/mL) and kit reagents were added to a 96-well plate and

absorbance of sample was determined using a UV-Vis spectrophotometer at 750nm

following manufacturer’s protocol. Results were then calculated and reported as µmol of


at ASPE



Dow

nloaded from


DMD #53983

10

total antioxidant levels relative to the Trolox standard, normalized to total hepatic protein

content.

Serum Chemistry Analysis:

Total bile acid concentrations were analyzed in plasma samples obtained from infected and

control dams at a certified GLP laboratory (IDEXX laboratories, Inc., Markham, ON) using

current standard methods of the International Federation of Clinical Chemistry. Total bile

acid levels were also compared in 100 mg liver homogenate samples of infected and

control dams using the Mouse Total Bile Acids Assay Kit (Crystal Chem Inc., Downers

Grove, IL) following manufacturer’s protocol.

Statistical Analysis:

All data were analyzed with GraphPad Prism 5.0 for Macintosh (GraphPad Software, Inc.,

San Diego, CA, USA). Tests on maternal and fetal physiological parameters were

completed using Student’s unpaired two-tailed t-test. To assess for differences in gene and

protein expression between the infected and control groups, Student’s unpaired two-tailed t-

tests were conducted. Levels of significance for all statistical analyses were set at or below

α = 0.05, with the following symbols denoting statistical significance: *, p < 0.05, **, p < 0.01

and ***, p < 0.001. Performing the non-parametric Mann-Whitney U test yielded comparable

results to Student’s unpaired two-tailed t-test. Gene and protein expression results are

presented as mean % control ± SEM.

Results:

Maternal and Fetal Parameters:

Given the established impact of malaria infection on maternal and fetal weight and

splenomegaly in humans, we confirmed whether these changes were present in this study.


at ASPE



Dow

nloaded from


DMD #53983

11

Increasing peripheral parasitemia was seen from GD16 to GD19 from 2.37% ± 0.38% to

49.88% ± 2.67% at GD16 and GD19, respectively. A corresponding decrease in maternal

body weight was observed with PbA-infected dams weighing 7.53g ± 1.21g less at GD19,

relative to uninfected dams (p < 0.05). No significant differences were seen on GD13 or

GD16. Spleen weight was significantly higher in PbA-infected dams relative to uninfected

control dams (208.1mg ± 13.0mg vs. 102.2mg ± 8.9mg; p < 0.001). Fetal weight was also

significantly lower in fetuses obtained from PbA-infected dams, relative to those from

uninfected control dams (748.50mg ± 40.38mg vs. 1082.00mg ± 44.71mg, respectively; p <

0.001).

Increased Hepatic Inflammation and Oxidative Stress:

We examined mRNA expression of hepatic inducible Nitric Oxide Synthase (iNOS) and

Heme Oxygenase-1 (HO-1) as these enzymes are both induced by hepatic inflammation

and have been shown to play a protective role in host-response to malaria infection (Taylor

et al., 1998; Seixas et al., 2009; Sass et al., 2012). As depicted in Figure 2A, we identified

pronounced increases in the hepatic expression of both iNOS and HO-1 in the maternal

liver of PbA-infected dams, relative to uninfected control dams (p < 0.001). We also

observed a significant decrease in the total cellular antioxidant capacity of the livers of

infected dams relative to uninfected control dams (p < 0.001) (Figure 2B).

Hepatic Cyp3a11 and Drug Transporters in Maternal Liver:

Given that hepatic metabolism and transport processes influence the pharmacokinetics of

xenobiotics and their metabolites within the maternal circulation and that these processes

are known to be modulated by infection and inflammation, we examined whether malaria

infection would alter their expression. Expression of Cyp3a11 was significantly decreased

(p < 0.001) in the livers of infected dams relative to uninfected control dams (Figure 3A).


at ASPE



Dow

nloaded from


DMD #53983

12

Significant decreases in the expression of the canalicular transporters Abcc2, Abcg2,

Abcb11 were seen in the livers of infected dams, where expression levels ranged from 11%

- 54% compared to controls (Figure 3A). A dramatic increase in mRNA expression of

Abcb1b (p < 0.001) was seen in the infected group while Abcb1a was unaffected. Hepatic

protein expression of the gene product of Abcb1a and Abcb1b, Multidrug resistance protein

1 (Mdr1), was not significantly different between infected and control dams (Figure 4).

Dramatic increases in the expression of the basolateral transporters Abcc1 and Abcc3 were

observed in the livers of infected dams (p < 0.001) (Figure 3A). We also found a significant

decrease in the expression of the organic anion transporter Slco2b1 (40% ± 33%; p < 0.01),

whereas the expression of Slco10a1 (also known as the Na+-dependent taurocholate

transporter, NTCP), an important transporter involved in hepatic bile salt uptake was not

significantly changed relative to control dams (80% ± 30%; p > 0.05).

Malaria Infection Alters Total Plasma Bile Acid Levels:

Since jaundice, hyperbilirubinemia and hepatic cholestasis are seen in severe malaria and

as bilirubin and bile acids are substrates for many of the same transporters (Treeprasertsuk

et al., 2010), we investigated the functional consequence of the observed PbA induced

changes in the maternal hepatic expression of the bile transporters by examining the levels

of endogenous serum bile acids. The Bile Salt Export Transporter (BSEP; ABCB11) is a

critical determinant of bile acid homeostasis in liver and facilitating hepatobiliary clearance

of lipophilic substrates. We hypothesized that the decreased expression of canalicular

Abcb11 would result in decreased efflux of bile salts into bile resulting in an compensatory

increased transport into the maternal circulation by Abcc1 and Abcc3 at the basolateral

domain (Figure 3A). These processes in turn would result in significantly increased serum

bile acids. As illustrated in Figure 3B, we observed a significant and dramatic increase of


at ASPE



Dow

nloaded from


DMD #53983

13

~80-fold in total serum bile acid concentrations in PbA infected dams relative to uninfected

control dams (382.0 ± 152.3 µmol/L vs. 4.833 ± 0.1667 µmol/L, respectively). Relative total

bile acid levels remained increased in the livers of PbA infected dams (195 ± 32 % of

control values, p<0.05).

Drug Transporter Expression changes in Maternal Brain:

The expression of Abcb1a, Abcb1b, and Abcg2 were assessed in whole brain

homogenates of pregnant dams due to the important protective role they play in the blood-

brain barrier. A significant increase in Abcb1b was observed in infected dams relative to

control dams (158% ± 22%; p < 0.01). We observed a corresponding significant increase in

the protein expression of Mdr1 in brain isolated from PbA infected dams as compared

controls (p < 0.05; Figure 4). No significant differences were observed in the expression of

Abcb1a or Abcg2.

Gene Expression in the Maternal Kidney:

The expression of Abcb1a and Abcb1b were assessed in whole kidney homogenate due to

their role in the extrusion of drugs and other xenobiotics from the kidney proximal tubule

into the tubule lumen. We observed significant 2- to 3.5-fold increases in the expression of

Abcb1a (350% ± 101%; p < 0.05) and Abcb1b (226% ± 99%; p < 0.05) in infected as

compared to control dams. Likewise, malaria infection was associated with a significantly

higher renal protein expression of Mdr1 (p < 0.05, Figure 4).

Drug Transporter Expression in the Placenta:

Given the critical role of placental drug transporters in fetal drug accumulation and their

function as a protective barrier limiting fetal exposure to toxic xenobiotics, we investigated

the impact of malaria infection on the placental expression of several ABC efflux drug

transporters. As compared to controls, we observed significant decreases in the placental


at ASPE



Dow

nloaded from


DMD #53983

14

mRNA expression of Abcb1a, Abcb1b, Abcc1, Abcc2, Abcc3, and Abcg2 in malaria infected

dams (p < 0.05) (Figure 5). A significant decrease in the protein expression of Mdr1 was

seen in placenta isolated from infected dams as compared to uninfected controls (p < 0.05;

Figure 4).

Expression of Hepatic Cyp3a11 and Drug transporter expression in Fetal Liver:

Given that fetal hepatic metabolism and transport processes may influence levels of

xenobiotics and their metabolites within the fetal compartment, we examined whether

malaria infection would alter their expression. As depicted in Figure 6, we observed

significant changes in the expression of Cyp3a11 and drug transporters in the fetal liver.

Significant 40 – 70 % decreases in expression of fetal hepatic Cyp3a11, Abcb1a, Abcg2,

and Abcb11 was seen in pups isolated from infected dams as compared to uninfected

controls, whereas the expression of Abcb1b was significantly increased (p < 0.01). Contrary

to changes observed in the maternal liver, the expression of fetal liver Abcc1 (151.94% ±

62.00% of control; p = 0.097) was not altered.

Discussion:

In this study we demonstrated that malaria imposes significant changes in the

expression of Cyp3a11 and transporters including Mdr1, Mrp1, Mrp3, Bsep, and Bcrp in

maternal and fetal tissue of pregnant mice. This was associated with functional changes in

the transport of bile acid substrates as plasma bile acid concentrations were dramatically

increased in the infected dams. Evidence of inflammation and oxidative stress were also

seen in maternal liver.

A substantial decrease in the expression of Cyp3a11 was seen in livers obtained

from malaria infected dams. The down-regulation we observed likely stems from


at ASPE



Dow

nloaded from


DMD #53983

15

inflammation associated with parasitic infection. Our data demonstrating increases in HO-1

and iNOS mRNA as well as decreased antioxidant levels support this. This is in agreement

with a body of literature illustrating infection and inflammation-mediated downregulation of

hepatic CYP3A in rodents and humans (Cressman et al., 2012). Previous reports also

indicate reduced expression of Cyp3a11 in non-pregnant rodent models of malaria (De-

Oliveira et al., 2006; Carvalho et al., 2009). Inflammation-mediated suppression of

CYP3A4 activity has been shown to impart clinically important changes in patients (Morgan

et al., 2008).

Cyp3a11 was also down-regulated in fetal livers of pups from malaria infected dams.

Although little is known about the impact of maternal disease on fetal gene expression, it

was previously reported that endotoxin administration elicited a reduction in expression of

Cyp3a11 in maternal and fetal livers on GD17 (Xu et al., 2005). While expression of

Cyp3a11 in fetal liver is much lower than that of adults, levels increase rapidly from GD16

to post-gestation, therefore infection-mediated downregulation of gene expression could

impact ontogenic changes and hepatic function in the fetus and neonate. As so many of the

antimalarial drugs are metabolized by CYP3A, inflammation-mediated changes could have

important implications for metabolic capacity of both mother and developing offspring.

In the malaria-infected dams we also observed pronounced changes in the hepatic

expression of several transporters that are involved in the transport of bile and bilirubin and

this was associated with a dramatic eighty- fold increase in serum levels of bile acids. This

could have important consequences on fetal outcomes as increased levels of bilirubin and

bile acids within maternal plasma are clinical features associated with poor pregnancy

outcomes including premature birth, fetal distress and stillbirths (Uneke, 2007);(Lammert et

al., 2000). Expression of Abcb11, the key transporter responsible for secretion of bile salts


at ASPE



Dow

nloaded from


DMD #53983

16

into bile, was decreased by nearly 10-fold in the infected animals resulting in increased

hepatic accumulation of bile acids. Observed increases in basolateral expression of Abcc3

and Abcc1, likely served to shuttle excess bile acids from hepatocytes into maternal blood.

The changes in expression of these transporters and increased serum bile acids are

consistent with other animal models of inflammation-induced cholestasis (Vos et al., 1998;

McGillicuddy et al., 2009; Yang et al., 2009; Kosters and Karpen, 2010). It is believed that

increased expression of basolateral efflux transporters is a homeostatic mechanism evoked

to protect hepatocytes (Wagner et al., 2009; Keppler, 2011). Decreases in Abcb11 are also

frequently associated with downregulation of uptake transporters such as Slco10a1 (Ntcp)

in cholestasis. While we did not detect significant changes in Slco10a1, expression of

Slco2b1, which is involved in sodium-independent bile acid uptake was significantly down-

regulated.

ABCB1/ MDR1 is involved in absorption, distribution, and clearance of many

clinically important drugs. This transporter has been shown to transport quinine (Pussard et

al., 2007; Mukonzo et al., 2010), and may play a role in transport of other antimalarial drugs

as discussed earlier. In maternal liver, mRNA levels of Abcb1b but not Abcb1a were

increased; however protein levels of Mdr1 were unchanged. Previous studies in rodent

models of infection and inflammation have also shown an induction of Abcb1b mRNA.

However, the contribution of Abcb1b, relative to Abcb1a, to hepatic Mdr1 protein expression

is currently debated. To this point, decreased hepatic Mdr1 protein expression,

corresponding to decreased Abcb1a mRNA levels, has been shown in endotoxin-treated

rats, despite an observed 10-fold increase in mRNA levels of Abcb1b (Wang et al., 2005).

We observed decreased Abcb1a expression and increased Abcb1b expression in fetal

livers from infected dams. This suggests that drug transporter regulatory mechanisms occur


at ASPE



Dow

nloaded from


DMD #53983

17

in fetal tissues and that these tissues are also subject to inflammation-mediated changes in

gene expression. While expression of Abcb1a, Abcb1b is much lower in fetal liver than that

of adult levels (Sharma et al., 2013), levels are thought to increase rapidly post-gestation

(Lee et al., 2011), therefore inflammation-mediated alterations in gene expression could

impact ontogenic changes and potential function in fetal and neonatal livers.

Interestingly, we found increased expression of Abcb1b in brains of infected dams,

which was associated with increased protein expression of Mdr1. Changes in Mdr1

expression at the blood-brain barrier impact the CNS exposure and effects of its substrates.

Therefore, malaria may be associated with a reduced accumulation of Mdr1 substrates in

brain. Our findings may provide a mechanism to a previous study investigating mefloquine

brain permeation in malaria-infected rodents. Farinotti observed a 2-fold decrease in

concentrations of mefloquine (a Mdr1 substrate) in the brains of mice infected with malaria,

compared to controls (de Lagerie et al., 2009). It is plausible that malaria-induced changes

in expression of Mdr1 in brain contributed to these altered brain concentrations.

Conversely, a decreased expression of Abcb1a and Mdr1 has been reported in the brains

of endotoxin-treated rats. These divergent results may stem from potential differences in

models and chronicity of infection. Inflammatory stimuli such as endotoxin, viruses and

malaria exert effects on the immune system through unique mechanisms. Endotoxin is a

characteristic TLR4 ligand (Koga and Mor, 2010) and may down-regulate gene expression

via the activation of NF-B downstream. The viral mimetic, poly I:C activates the immune

system through TLR2 and TLR3 pathways. In contrast, P. falciparum

glycosylphosphatidylinositol and the malaria pigment, hemozoin, have been shown to

activate TLR2, TLR4, and TLR9 (Coban et al., 2005; Trinchieri and Sher, 2007; Erdman et


at ASPE



Dow

nloaded from


DMD #53983

18

al., 2008), and this broad TLR activation may result in a unique effect on gene regulation

and consequent protein expression.

Drug transporters in kidney are known to impact the pharmacokinetics and renal

clearance of numerous drugs and the expression of these transporters is mutable due to

pathophysiology (Cressman et al., 2012). Indeed, within our study, we found a significant

increase in expression of Abcb1a and Abcb1b in infected as compared to control dams.

Likewise, malaria infection was associated with a significantly higher renal protein

expression of Mdr1. Others have also reported infection or inflammation-mediated

increases in the mRNA and protein expression of Mdr1 in kidney (Hartmann et al., 2005;

Heemskerk et al., 2010). Increased renal expression of Mdr1 in endotoxin treated mice was

associated with increased renal elimination of the Mdr1 substrate, doxorubicin (Hartmann et

al., 2005). It is plausible that malaria-imposed changes could impact renal clearance of

antimalarials and other substrates.

One of our key objectives was to examine expression of transporters in placenta as

these proteins are important in fetal protection. In addition to the decreased expression of

Abcb1a and Abcb1b resulting in a corresponding reduction in immunodetectable levels of

Mdr1 levels, we observed decreased expression of several other transporters including

Abcc1-3 and Abcg2. These proteins are also important in transport of drugs, conjugated-

drug metabolites, and endogenous substrates (e.g., bile acids) (Cressman et al., 2012).

Previous studies in models of bacterial and viral infection have also reported similar

changes ( Petrovic et al., 2008; Petrovic and Piquette-Miller, 2010). In endotoxin-treated

rats, decreased placental expression of Abcg2 and Abcb1 was associated with increases in

fetal accumulation of the Abcg2 and Abcb1 substrates, glyburide and sestamibi (Petrovic et

al., 2008; Wang et al., 2005). The implications of our findings suggest that comparable


at ASPE



Dow

nloaded from


DMD #53983

19

changes in drug-disposition may occur in malaria infection and may contribute to increased

fetal exposure to endogenous and exogenous compounds.

Changes in fetal expression of transporters were similar to the changes seen in the

maternal liver. This may suggest that comparable regulatory mechanisms are occurring in

fetal and maternal liver and also suggests that transporter regulatory pathways are intact in

the fetal liver. Therefore fetal exposure to potentially toxic substances, such as the

elevated concentrations of bile acids observed in the malaria infected dams, may be further

altered due to infection-mediated changes to transporters and metabolizing enzymes in

placental and fetal tissues. Very little is known about the expression of transporters and

DMEs in fetal tissues, and even less about how disease-states impact the expression of

these proteins. Nevertheless, this field is currently evolving and it will be important to

investigate how these alterations impact the in vivo disposition of their substrates. Whether

these changes persist in the developing fetus and offspring and the consequences is an

important question and currently being examined in ongoing studies.

Conclusions:

Herein we demonstrate that malaria infection alters expression of a number of drug

transporters and Cyp3a11 in maternal and fetal tissues during pregnancy. If these findings

translate to malaria infection in human pregnancy, altered maternofetal disposition and

clearance of endogenous and exogenous substrates may have important clinical

consequences.


at ASPE



Dow

nloaded from


DMD #53983

20

Authorship Contributions: Participated in research design: Cressman, Piquette-Miller, Silver, McDonald, Kain,

Conducted experiments: Cressman, Silver, McDonald

Performed data analysis: Cressman, Piquette-Miller

Wrote or contributed to the writing of the manuscript: Cressman, Piquette-Miller, Silver,

McDonald, Kain,


at ASPE



Dow

nloaded from


DMD #53983

21

References:

Anger GJ, Cressman AM, and Piquette-Miller M (2012) Expression of ABC Efflux Transporters in Placenta from Women with Insulin-Managed Diabetes. PLoS One 7:e35027.

Aye IL and Keelan JA (2013) Placental ABC transporters, cellular toxicity and stress in pregnancy. Chem Biol Interact 203:456-466.

Baune B, Furlan V, Taburet AM, and Farinotti R (1999) Effect of selected antimalarial drugs and inhibitors of cytochrome P-450 3A4 on halofantrine metabolism by human liver microsomes. Drug Metab Dispos 27:565-568.

Carvalho RS, Friedrich K, De-Oliveira AC, Suarez-Kurtz G, and Paumgartten FJ (2009) Malaria downmodulates mRNA expression and catalytic activities of CYP1A2, 2E1 and 3A11 in mouse liver. Eur J Pharmacol 616:265-269.

Chavchich M, Gerena L, Peters J, Chen N, Cheng Q, and Kyle DE (2010) Role of pfmdr1 amplification and expression in induction of resistance to artemisinin derivatives in Plasmodium falciparum. Antimicrob Agents Chemother 54:2455-2464.

Coban C, Ishii KJ, Kawai T, Hemmi H, Sato S, Uematsu S, Yamamoto M, Takeuchi O, Itagaki S, Kumar N, Horii T, and Akira S (2005) Toll-like receptor 9 mediates innate immune activation by the malaria pigment hemozoin. J Exp Med 201:19-25.

Conroy AL, Silver KL, Zhong K, Rennie M, Ward P, Sarma JV, Molyneux ME, Sled J, Fletcher JF, Rogerson S, and Kain KC (2013) Complement activation and the resulting placental vascular insufficiency drives fetal growth restriction associated with placental malaria. Cell Host Microbe 13:215-226.

Cressman AM, Petrovic V, and Piquette-Miller M (2012) Inflammation-mediated changes in drug transporter expression/activity: implications for therapeutic drug response. Expert Rev Clin Pharmacol 5:69-89.

de Lagerie SB, Fernandez C, German-Fattal M, Gantier JC, Gimenez F, and Farinotti R (2009) Impact of cerebral malaria on brain distribution of mefloquine. Drug Metab Lett 3:15-17.

De-Oliveira AC, Da-Matta AC, and Paumgartten FJ (2006) Plasmodium berghei (ANKA): infection induces CYP2A5 and 2E1 while depressing other CYP isoforms in the mouse liver. Exp Parasitol 113:256-261.

Dellicour S, Tatem AJ, Guerra CA, Snow RW, and ter Kuile FO (2010) Quantifying the number of pregnancies at risk of malaria in 2007: a demographic study. PLoS Med 7:e1000221.

Erdman LK, Finney CA, Liles WC, and Kain KC (2008) Inflammatory pathways in malaria infection: TLRs share the stage with other components of innate immunity. Mol Biochem Parasitol 162:105-111.

Fontaine F, de Sousa G, Burcham PC, Duchene P, and Rahmani R (2000) Role of cytochrome P450 3A in the metabolism of mefloquine in human and animal hepatocytes. Life Sci 66:2193-2212.


at ASPE



Dow

nloaded from


DMD #53983

22

Foote SJ, Thompson JK, Cowman AF, and Kemp DJ (1989) Amplification of the multidrug resistance gene in some chloroquine-resistant isolates of P. falciparum. Cell 57:921-930.

Fried M and Duffy PE (1996) Adherence of Plasmodium falciparum to chondroitin sulfate A in the human placenta. Science 272:1502-1504.

Hartmann G, Vassileva V, and Piquette-Miller M (2005) Impact of endotoxin-induced changes in P-glycoprotein expression on disposition of doxorubicin in mice. Drug Metab Dispos 33:820-828.

Heemskerk S, Peters JG, Louisse J, Sagar S, Russel FG, and Masereeuw R (2010) Regulation of P-glycoprotein in renal proximal tubule epithelial cells by LPS and TNF-alpha. J Biomed Biotechnol 2010:525180.

Hviid L, Marinho CR, Staalsoe T, and Penha-Goncalves C (2010) Of mice and women: rodent models of placental malaria. Trends Parasitol 26:412-419.

Keppler D (2011) Cholestasis and the role of basolateral efflux pumps. Z Gastroenterol 49:1553-1557.

Kim KA, Park JY, Lee JS, and Lim S (2003) Cytochrome P450 2C8 and CYP3A4/5 are involved in chloroquine metabolism in human liver microsomes. Arch Pharm Res 26:631-637.

Koga K and Mor G (2010) Toll-like receptors at the maternal-fetal interface in normal pregnancy and pregnancy disorders. Am J Reprod Immunol 63:587-600.

Kosters A and Karpen SJ (2010) The role of inflammation in cholestasis: clinical and basic aspects. Semin Liver Dis 30:186-194.

Lammert F, Marschall HU, Glantz A, and Matern S (2000) Intrahepatic cholestasis of pregnancy: molecular pathogenesis, diagnosis and management. J Hepatol 33:1012-1021.

Lee JS, Ward WO, Liu J, Ren H, Vallanat B, Delker D, and Corton JC (2011) Hepatic xenobiotic metabolizing enzyme and transporter gene expression through the life stages of the mouse. PLoS One 6:e24381.

Lee TM, Huang L, Johnson MK, Lizak P, Kroetz D, Aweeka F, and Parikh S (2012) In vitro metabolism of piperaquine is primarily mediated by CYP3A4. Xenobiotica 42:1088-1095.

Mansor SM, Ward SA, Edwards G, Hoaksey PE, and Breckenridge AM (1990) The effect of malaria infection on the disposition of quinine and quinidine in the rat isolated perfused liver preparation. J Pharm Pharmacol 42:428-432.

Matteelli A, Caligaris S, Castelli F, and Carosi G (1997) The placenta and malaria. Ann Trop Med Parasitol 91:803-810.

McGillicuddy FC, de la Llera Moya M, Hinkle CC, Joshi MR, Chiquoine EH, Billheimer JT, Rothblat GH, and Reilly MP (2009) Inflammation impairs reverse cholesterol transport in vivo. Circulation 119:1135-1145.

Mihaly GW, Date NM, Veenendaal JR, Newman KT, and Smallwood RA (1987) Decreased hepatic elimination of pyrimethamine during malaria infection. Studies in the isolated perfused rat liver. Biochem Pharmacol 36:2827-2829.


at ASPE



Dow

nloaded from


DMD #53983

23

Miller LH, Baruch DI, Marsh K, and Doumbo OK (2002) The pathogenic basis of malaria. Nature 415:673-679.

Morgan ET, Goralski KB, Piquette-Miller M, Renton KW, Robertson GR, Chaluvadi MR, Charles KA, Clarke SJ, Kacevska M, Liddle C, Richardson TA, Sharma R, and Sinal CJ (2008) Regulation of drug-metabolizing enzymes and transporters in infection, inflammation, and cancer. Drug Metab Dispos 36:205-216.

Mukonzo JK, Waako P, Ogwal-Okeng J, Gustafsson LL, and Aklillu E (2010) Genetic variations in ABCB1 and CYP3A5 as well as sex influence quinine disposition among Ugandans. Ther Drug Monit 32:346-352.

Murdoch RT, Ghabrial H, Mihaly GW, Morgan DJ, and Smallwood RA (1991) Malaria infection impairs glucuronidation and biliary excretion by the isolated perfused rat liver. Xenobiotica 21:1571-1582.

Petrovic V and Piquette-Miller M (2010) Impact of polyinosinic/polycytidylic acid on placental and hepatobiliary drug transporters in pregnant rats. Drug Metab Dispos 38:1760-1766.

Petrovic V, Wang JH, and Piquette-Miller M (2008) Effect of endotoxin on the expression of placental drug transporters and glyburide disposition in pregnant rats. Drug Metab Dispos 36:1944-1950.

Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, Patel R, Laing K, Looareesuwan S, White NJ, Nosten F, and Krishna S (2004) Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet 364:438-447.

Pukrittayakamee S, Looareesuwan S, Keeratithakul D, Davis TM, Teja-Isavadharm P, Nagachinta B, Weber A, Smith AL, Kyle D, and White NJ (1997) A study of the factors affecting the metabolic clearance of quinine in malaria. Eur J Clin Pharmacol 52:487-493.

Pussard E, Merzouk M, and Barennes H (2007) Increased uptake of quinine into the brain by inhibition of P-glycoprotein. Eur J Pharm Sci 32:123-127.

Sa JM, Twu O, Hayton K, Reyes S, Fay MP, Ringwald P, and Wellems TE (2009) Geographic patterns of Plasmodium falciparum drug resistance distinguished by differential responses to amodiaquine and chloroquine. Proc Natl Acad Sci U S A 106:18883-18889.

Sass G, Barikbin R, and Tiegs G (2012) The multiple functions of heme oxygenase-1 in the liver. Z Gastroenterol 50:34-40.

Seixas E, Gozzelino R, Chora A, Ferreira A, Silva G, Larsen R, Rebelo S, Penido C, Smith NR, Coutinho A, and Soares MP (2009) Heme oxygenase-1 affords protection against noncerebral forms of severe malaria. Proc Natl Acad Sci U S A 106:15837-15842.

Sharma S, Ellis EC, Gramignoli R, Dorko K, Tahan V, Hansel M, Mattison DR, Caritis SN, Hines RN, Venkataramanan R, and Strom SC (2013) Hepatobiliary disposition of 17-OHPC and taurocholate in fetal human hepatocytes: a comparison with adult human hepatocytes. Drug Metab Dispos 41:296-304.

Silver KL, Zhong K, Leke RG, Taylor DW, and Kain KC (2010) Dysregulation of angiopoietins is associated with placental malaria and low birth weight. PLoS One 5:e9481.


at ASPE



Dow

nloaded from


DMD #53983

24

Sisowath C, Ferreira PE, Bustamante LY, Dahlstrom S, Martensson A, Bjorkman A, Krishna S, and Gil JP (2007) The role of pfmdr1 in Plasmodium falciparum tolerance to artemether-lumefantrine in Africa. Trop Med Int Health 12:736-742.

Svensson US and Ashton M (1999) Identification of the human cytochrome P450 enzymes involved in the in vitro metabolism of artemisinin. Br J Clin Pharmacol 48:528-535.

Taylor BS, Alarcon LH, and Billiar TR (1998) Inducible nitric oxide synthase in the liver: regulation and function. Biochemistry (Mosc) 63:766-781.

Treeprasertsuk S, Silachamroon U, Krudsood S, Huntrup A, Suwannakudt P, Vannaphan S, and Wilairatana P (2010) Ursodeoxycholic acid and artesunate in the treatment of severe falciparum malaria patients with jaundice. J. Gastroenterol. Hepatol. 25:362-368.

Trinchieri G and Sher A (2007) Cooperation of Toll-like receptor signals in innate immune defence. Nat Rev Immunol 7:179-190.

Uneke CJ (2007) Impact of placental Plasmodium falciparum malaria on pregnancy and perinatal outcome in sub-Saharan Africa: II: effects of placental malaria on perinatal outcome; malaria and HIV. Yale J Biol Med 80:95-103.

Vahakangas K and Myllynen P (2009) Drug transporters in the human blood-placental barrier. Br J Pharmacol 158:665-678.

Vos TA, Hooiveld GJ, Koning H, Childs S, Meijer DK, Moshage H, Jansen PL, and Muller M (1998) Up-regulation of the multidrug resistance genes, Mrp1 and Mdr1b, and down-regulation of the organic anion transporter, Mrp2, and the bile salt transporter, Spgp, in endotoxemic rat liver. Hepatology 28:1637-1644.

Wagner M, Zollner G, and Trauner M (2009) New molecular insights into the mechanisms of cholestasis. J Hepatol 51:565-580.

Wang JH, Scollard DA, Teng S, Reilly RM, and Piquette-Miller M (2005) Detection of P-glycoprotein activity in endotoxemic rats by 99mTc-sestamibi imaging. J Nucl Med 46:1537-1545.

Wilson CM, Serrano AE, Wasley A, Bogenschutz MP, Shankar AH, and Wirth DF (1989) Amplification of a gene related to mammalian mdr genes in drug-resistant Plasmodium falciparum. Science 244:1184-1186.

Xu DX, Chen YH, Wang JP, Sun MF, Wang H, Wei LZ, and Wei W (2005) Perinatal lipopolysaccharide exposure downregulates pregnane X receptor and Cyp3a11 expression in fetal mouse liver. Toxicol Sci 87:38-45.

Yang H, Plosch T, Lisman T, Gouw AS, Porte RJ, Verkade HJ, and Hulscher JB (2009) Inflammation mediated down-regulation of hepatobiliary transporters contributes to intrahepatic cholestasis and liver damage in murine biliary atresia. Pediatr Res 66:380-385.

Zhang H, Coville PF, Walker RJ, Miners JO, Birkett DJ, and Wanwimolruk S (1997) Evidence for involvement of human CYP3A in the 3-hydroxylation of quinine. Br J Clin Pharmacol 43:245-252.


at ASPE



Dow

nloaded from


DMD #53983

25

Footnotes:

This work was supported by Grand Challenges in Global Health: Preventing Preterm Birth

Initiative [Grant No. 12003]; the Canadian Institutes of Health Research (CIHR) [Grants No.

MOP-115160, 13721 and 57688 ]; Canada Research Chair and the Natural Science and

Engineering Research Council (NSERC) and Ontario Graduate Scholarships.

Contributed equally to this manuscript: Co-first authors: Cressman and McDonald Co-senior authors: Piquette-Miller and Kain

Author e-mail addresses:

Alex Cressman, MSc: [email protected]

Chloe McDonald, MSc: [email protected]

Dr. Karlee Silver, PhD: [email protected]

Dr. Kevin Kain, MD, FRCPC: [email protected]

Dr. Micheline Piquette-Miller, PhD: [email protected]


at ASPE



Dow

nloaded from


DMD #53983

26

Legends for Figures:

FIGURE 1: Schematic depiction of ABC Drug Transporters in Liver and Placenta. (A)

The basolateral (sinusoidal) membranes of hepatocyes express the multidrug resistance-

associated proteins MRP1 (ABCC1) and MRP3 (ABCC3). The canalicular membranes

express the multidrug resistance protein (MDR1, ABCB1), the breast cancer resistance

protein (BCRP, ABCG2), MRP2 (ABCC2) and the bile salt export pump (BSEP, ABCB11).

(B), the syncytiotrophoblast layer of the placenta is comprised of multinucleated (N) cells

that express MDR1, BCRP and MRP2 on the apical membrane and MRP1 and MRP3 on

the basolateral membrane. The apical membranes of fetal capillary endothelial cells

express MRP1 and MRP3.

FIGURE 2: Effect of malaria (PbA infected) on (A) Hepatic mRNA expression of iNOS and

HO-1 in maternal liver. Expression was normalized to cyclophilin A and are presented as a

percentage of controls ± SEM and (B) Total hepatic cellular antioxidant capacity in

maternal liver. Antioxidant activity was normalized to total hepatic protein as described in

methods. N = 6 dams/group. * p < 0.05; ** p < 0.01; *** p <0.001

FIGURE 3: Effect of malaria (PbA infected) on (A) Hepatic mRNA expression in maternal

liver. Expression was normalized to cyclophilin A and are presented as a percentage of

controls ± SEM. (B) Total bile acid levels in maternal serum. N = 6 dams/group.

* p < 0.05; ** p < 0.01; *** p <0.001

FIGURE 4: Effect of malaria (PbA infected) on the protein expression of Mdr1 (ABCB1) in

maternal tissues. Protein levels were determined by Western blotting and normalized to

total protein staining as described in Methods. Results are presented as a percentage of

control ± SEM. N = 4 dams/group . * p < 0.05

FIGURE 5: Effect of malaria (PbA infected) on the mRNA expression of transporters in

placenta on GD19. Placental mRNA expression was normalized to cyclophilin A and are

presented as a percentage of controls ± SEM N = 10 placentae from 5 dams/group.

* p < 0.05; ** p < 0.01; *** p <0.001


at ASPE



Dow

nloaded from


DMD #53983

27

FIGURE 6: Effect of malaria (PbA infected) in pregnant dams on hepatic mRNA

expression in fetal liver. Expression was normalized to cyclophilin A and are presented as

a percentage of controls ± SEM. N = 6 fetuses isolated from 6 dams/group.

* p < 0.05; ** p < 0.01; *** p <0.001


at ASPE



Dow

nloaded from


DMD #53983

28

TABLE 1: Sequences of oligonucleotide primers used for qRT-PCR analysis.

Gene Nomenclature

NLM Target mRNA Sequence

Forward Primer Sequence (5’ 3’)

Reverse Primer Sequence (5’ 3’)

Normalizing Gene

CycA

NM_008907.1

GGAGATGGCACAGGAGGAA GCCCGTAGTGCTTCAGCTT

ATP-Binding Cassette Transporters

Abcb1a

NM_011076.2

GGAGCTGCTGGTCCCATCTTCCA

GACCTCACGTGTCTCTACCTCCCG

Abcb1b

NM_011075.2

AGGCCGCTGCTTCCATCTTCTGA CATCACCACCTCACGTGCCACCT

Abcc1

NM_008576.3

TGAGTGTGCAGAAGGTGGAG

ACCCGCGTGTAGTCCATTAT

Abcc2

NM_013806.2

GGATAATGAGGCGCCGTGGGT

CCGGCCGATACCGCACTTGA

Abcc3

NM_029600.3

CCCACAGCTGCTCAGTATACT GATCAATGTCTGCATGGTGG

Abcg2

NM_011920.3

ATGGAGCACCTCAACCTGCCCA

GTCAGGGTGCCCATCACAACGT

Abcb11

NM_021022.3

CCCCTGCGAAGGCATGGTGA

ACCAAGGCGGATGTTTTCTGCGA

Cytochrome P450 Enzymes

Cyp3a11

NM_007818.3

AGGGAAGCATTGAGGAGGATCACA TGCTAGGAGCACCCAGGTTTCCA

Solute Carrier Transporters

Slco10a1

NM_001177561.1

CCCTACGTCCTCAAGGCAGGCA

GGCATCAGGGAGGAGGTAGCCA

Slco2b1

NM_001252530.1

CCTTAAAGCCAACGCAAGAC ACTCCTGCACAGACCAAAA

Disease-Relevant Genes

HO-1

NM_010442.2

CTCGAGCATAGCCCGGAGCCT

AGACAAATCCTGGGGCATGCTGT

iNOS

NM_010927.3

CACCTTGGAGTTCACCCAGT

ACCACTCGTACTTGGGATGC


at ASPE



Dow

nloaded from


Figure 1

ABCC1 ABCC3

ABCG2 ABCB1

ABCB11 ABCC2

ABCB1 ABCC2 ABCG2

ABCC1 ABCC3

ABCC3 ABCC1

(B)

(A)

Syncytiotrophoblast

Fetal Mesenchyme

Maternal Blood

Hepatic Sinusoid


at ASPE



Dow

nloaded from



at ASPE



Dow

nloaded from


malaria infection alters the expression of hepatobiliary

Documents