macroporous interpenetrating network of polyethylene
TRANSCRIPT
This content has been downloaded from IOPscience. Please scroll down to see the full text.
Download details:
IP Address: 162.105.25.44
This content was downloaded on 12/07/2016 at 03:44
Please note that terms and conditions apply.
Macroporous interpenetrating network of polyethylene glycol (PEG) and gelatin for cartilage
regeneration
View the table of contents for this issue, or go to the journal homepage for more
2016 Biomed. Mater. 11 035014
(http://iopscience.iop.org/1748-605X/11/3/035014)
Home Search Collections Journals About Contact us My IOPscience
© 2016 IOP Publishing Ltd
1. Introduction
Articular cartilage is a highly specialized connective tissue that can dissipate energy and facilitate load transfer. Once damaged, it loses mechanical function and leads to progressive osteoarthritis, which results in great pain and disability. Creating mechanically strong scaffold materials is critical for the success of regenerated cartilage, as the implanted scaffolds must have the ability to support physiologic joint loading (Li et al 2012a). Hydrogels are one of the most widely used scaffolds as cell carriers, or as tissue replacements for cartilage regeneration, as they provide a similar environment to articular cartilage. However, most synthetic hydrogels such as poly (ethylene glycol) (PEG) typically exhibit minimal biological activity
with relatively low mechanical properties, which hinder their application in cartilage tissue engineering (Zhang et al 2013).
The utilization of interpenetrating networks (IPN) in hydrogels is an effective method to improve mechanical properties and has achieved great success (Cai et al 2014). Interpenetrating networks are hydro-gel networks composed of two or more physically or chemically interlocking macromolecules (Daniele et al 2014). Improved mechanical properties can be easily achieved due to the highly entangled structure of IPNs (Qiu and Park 2003). Several studies have reported their use of IPN hydrogels in cartilage tissue engineering due to their mechanical advantages. Three dimensional woven IPN hydrogel scaffolds made of alginate and polyacrylamide have enhanced mechanical properties
J Zhang et al
Printed in the UK
035014
BMBUCS
© 2016 IOP Publishing Ltd
2016
11
Biomed. Mater.
BMM
1748-6041
10.1088/1748-6041/11/3/035014
3
1
12
Biomedical Materials
IOP
10
June
2016
Macroporous interpenetrating network of polyethylene glycol (PEG) and gelatin for cartilage regeneration
Jingjing Zhang1,2, Justin Wang3, Hui Zhang2, Jianhao Lin4, Zigang Ge2,4,6 and Xuenong Zou5,6
1 Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, Beijing 100700, People’s Republic of China2 Department of Biomedical Engineering, College of Engineering, Peking University, Beijing 100871, People’s Republic of China3 Department of Bioengineering, Henry Samueli School of Engineering and Applied Science, University of California, Los Angeles,
Los Angeles, CA 90024, USA4 Arthritis Clinic and Research Center, Peking University People’s Hospital, Beijing, People’s Republic of China5 Department of Spinal Surgery/Orthopaedic Research Institute, The First Affiliated Hospital of Sun Yat-sen University,
510080 Guangzhou, People’s Republic of China6 Author to whom any correspondence should be addressed
E-mail: [email protected], [email protected], [email protected], [email protected], [email protected] and [email protected]
Keywords: articular cartilage, tissue engineering, interpenetrating network, mechanical property, macroporous hydrogel
AbstractPoor mechanical properties hinder the application of hydrogels in cartilage tissue engineering. In this study, macroporous interpenetrating network (IPN) hydrogels of gelatin and polyethylene glycol (PEG) were fabricated for use as a functional biomaterial to support chondrocyte culture. The IPN structure enhanced mechanical properties, while the macroporous structure facilitated cell–cell interactions. The hydrogels had pore sizes around 80 μm with favorable interconnectivity, reduced volume swelling ratios, and nearly unchanged weight swelling ratios with increasing gelatin ratios. More significantly, the Young’s modulus increased with increasing gelatin ratio, reaching a 5.3-fold increase (p < 0.01) in IPN-10% over that of the PEG group. Chondrocytes developed elongated and fibroblast morphologies with extensive cell–cell interaction throughout IPN hydrogels, compared with round, isolated aggregates in PEG hydrogels. The glycosaminoglycan (GAG) accumulation was significantly higher in IPN hydrogels than in PEG hydrogels at day 21 and day 28. Additionally, significantly higher gene expressions of collagen II (p < 0.01) and sox-9 (p < 0.01) were found in IPN-10% when compared with other groups. Overall, the macroporous IPN hydrogels showed strong tissue formation abilities and enhanced mechanical properties, demonstrating high potential as scaffolds for cartilage regeneration.
PaPer
received 5 March 2016
revised
10 May 2016
accePted for Publication
26 May 2016
Published 10 June 2016
doi:10.1088/1748-6041/11/3/035014Biomed. Mater. 11 (2016) 035014
2
J Zhang et al
and reduced coefficients of friction that were similar to native cartilage (Liao et al 2013). In addition, an IPN hydrogel of PEG and agarose was reported to have enhanced mechanical properties with high viability of chondrocytes (DeKosky et al 2010, Ingavle et al 2014), and further incorporation of arginine-glycine-aspartic acid (RGD) and aggrecan improved GAG and collagen synthesis (Ingavle et al 2014). In vivo, an IPN hydrogel composed of poly(2-acrylamido-2-methylpropane-sulfonic acid) and poly(N,N-dimethylacrylamide) was shown to facilitate the healing process of osteochondral defects (Yasuda et al 2008). Therefore, using IPN struc-ture in hydrogels has large potential for cartilage tissue engineering.
Although the IPN structure improves mechanical properties, it often results in a dense structure (Liao et al 2013) that restricts cell–cell interaction, tissue for-mation, and nutritional exchange (DeKosky et al 2010, Liao et al 2013). Thus, challenges arise in how to main-tain enhanced mechanical properties and improve cell functionality in IPN hydrogels at the same time. Recent studies show that the pore structure and intercon-nectivity of scaffolds are vital in dictating cell growth (Nehrer et al 1997, Murphy et al 2010), tissue forma-tion and infiltration (Lien et al 2009, Rnjak-Kovacina et al 2014), and nutrient transport (Zhang et al 2013). Macroporous hydrogels are used to allow for better cell–cell interaction and nutrition transport when compared to traditional hydrogel systems (Nicodemus et al 2011, Zhang et al 2014). For example, the 3D dif-ferentiation of neural stem-progenitor cells (NSPCs) was effectively improved by the macroporous structure in chitosan hydrogels (Li et al 2012). In another study, the intercellular signalling of human mesenchymal stem cells was also improved in macroporous hydro-gels (Betz et al 2010). Therefore, there is potential to utilize macroporous hydrogels to facilitate cartilage regeneration.
A well-designed scaffold should not only offer excel-lent mechanical support but also provide a bioactive and interactive environment to nurture the encapsu-lated cells. Gelatin, a partial hydrolysis product of colla-gen, has been widely used in cartilage tissue engineering and has obtained promising results due to its relatively low antigenicity and bioactivity signals, such as the Arg–Gly–Asp (RGD) sequence (Lien et al 2009, Lim et al 2013). Recent research demonstrated increasing gelatin levels to as high as 70% in poly ε-caprolactone (PCL) electrospun membranes increases homogeneous and continuous cartilage regeneration (Daniele et al 2014). Additionally, modifying poly (ethylene glycol) (PEG) with gelatin allows for chondrocyte-mediated remod-eling and increases articular cartilage matrix produc-tion (Sridhar et al 2015). Furthermore, interpenetrating networks of gelatin methacrylamide (GelMA) and PEG have been used for endothelial cell encapsulation and showed sustained viability and proliferation (Daniele et al 2014). In another research study, mechanically strong constructs of poly (ethylene glycol) dimeth-
acrylate, gelatin methacrylate, and human MSCs were created with a unique inkjet bioprinting approach for bone and cartilage tissue regeneration. These PEG-GelMA hydrogel scaffolds demonstrated an improve-ment of mechanical properties and osteogenic and chondrogenic differentiation (Gao et al 2015). In this study, macroporous IPN hydrogels of gelatin and PEG were fabricated to both fulfill the mechanical require-ments of scaffolds and improve cell function for carti-lage tissue engineering. The interpenetrating network can enhance the mechanical properties of the scaffold while the macroporous structure can ensure sufficient nutritional supply and increased cell–cell interaction. The effect of macroporous IPN hydrogels was evalu-ated for their effect on the phenotype of chondrocytes, including cell distribution, morphology, aggregation, gene expression, and cartilage ECM accumulation. The aim of this study is to create a hydrogel with improved mechanical properties and enhanced bioactivity to facilitate cartilage formation in vitro.
2. Materials and methods
2.1. Preparation of macroporous IPN HydrogelsPoly (ethylene glycol) diacrylate oligomer (PEGDA) was synthesized with Poly (ethylene glycol) (PEG) (4000 Da, Sigma, USA) according to a previous report (Moon et al 2009). PEG powder dissolved in anhydrous dichloromethane (DCM) (Beijing Tongguang Fine Chemicals, China) with a concentration of 0.0625 g ml−1 was mixed with Acryloyl chloride (96%, Aladdin, China) and tri-ethylamine (99.7%, Acros Organics, USA) in a drop-wise manner and left overnight in a nitrogenous environment. The liquid was then separated into two phases after the addition of K2CO3 (2M, Beijing Shiji, China) solution. The organic phase was mixed with diethyl ether (Beijing Tongguang Fine Chemicals, China). Finally, the PEGDA powder was harvested by freeze-drying the precipitate.
The precursor solution (containing 0.1 g ml−1 PEGDA) was prepared by dissolving PEGDA with saturated NaCl solution and then adding NaCl par-ticles (400 mg, diameter < 80 μm). N,N,N′,N′-tetramethylethylenediamine (TEMED, Sigma, People’s Republic of China, 0.2 w/v, 25 μl) and ammonium per-sulfate (APS, Ameresco, People’s Republic of China, 0.1 w/v, 25 μl) was used to crosslink the precursor solu-tion to create the PEG scaffold (Zhang et al 2015). As for the IPN scaffolds, gelatin (G9382, Sigma, People’s Republic of China) was added into the precursor solu-tion to obtain gelatin concentrations of 0%, 1%, 2.5%, 5%, and 10% (g ml−1, w/v) to create scaffolds of PEG, IPN-1%, IPN-2.5%, IPN5%, and IPN-10% scaffolds, respectively. For example, IPN-1% was composed of 0.1 g PEGDA and 0.01 g gelatin dissolved in 1 ml NaCl-saturated water containing APS and TEMED, and NaCl particles. Each scaffold was allowed to crosslink for ten minutes before deionized water (DIW) was added to remove the NaCl particles and excess precursor. The
Biomed. Mater. 11 (2016) 035014
3
J Zhang et al
scaffolds were incubated with DIW for 48 h, with the water replaced every eight hours. Glutaraldehyde (0.5% w/v) was then added to crosslink the gelatin at 4 °C for 24 h. Finally, the scaffolds were washed with DIW to remove excess glutaraldehyde.
2.2. Scanning electron microscopy and swelling ratioLyophilized hydrogels were mounted and sputter coated with gold for 80 s at 18 mA using EM SCD 500 (LEICA, Germany) before observation. Quanta 200 SEM (FEI, USA) was used to observe the freeze-dried macroporous hydrogels at an accelerating voltage of 5 kV.
The weight swelling ratio and volume swelling ratio were measured according to the following steps. For the volume swelling ratio, the height, width, and length of lyophilized hydrogels were measured with a caliper ruler. After incubation with phosphate buffered saline (PBS) for an hour, the height, width, and length of the swollen hydrogels were measured again. The volume swelling ratio was calculated using the following formula: Volume swelling ratio (ERv): ERv = (Vs − Vd)/Vd, where Vd and Vs were the weights of the dried and swollen hydrogels, respec-tively. For the weight swelling ratio, lyophilized hydro-gels were soaked in PBS for an hour and the weights of the lyophilized hydrogels and swollen hydrogels were measured. The weight swelling ratio was calcu-lated using the following formula: Weight swelling ratio (ERw): ER = (Ws − Wd)/Wd, where Wd and Ws were the weights of the dried and swollen hydrogels, respectively.
2.3. Fluorescence labeling of gelatin in hydrogels and mechanical propertyThe IPN hydrogels were incubated with sothiocyanate rhodamine B (RBITC, Sigma R1755) solution (0.1 mg ml−1) for 24 h at 4 °C to stain the gelatin in the hydrogels (Simonsson et al 2011). Excess RBITC was removed by incubating the hydrogels with PBS for 24 h at 4 °C. The RBITC-labeled scaffolds were imaged by confocal laser scanning microscopy (CLSM, LSM510, Zeiss, Germany). The maximum emission wavelength and excitation wavelength of RBITC-labeled scaffolds were 580 nm and 543 nm, respectively.
The Instron 5843 (Instron Corporation) was used to test the mechanical property of the lyophilized hydrogels and hydrogels swollen with PBS buffer. The scaffolds were loaded to 20% of the strain at 0.1 mm min−1, before preloading the scaffolds to 10% of the strain for three times. The thickness was con-verted to the strain of the scaffolds using the follow-ing formula: strain (ε) = 1 − L/L0, where L, L0 repre-sent the thickness before and after compression. The Young’s modulus was calculated using the following the formula: Young’s modulus (E ) = σ/ε, where σ and ε were the stress and strain of the scaffold, respectively. Experiments were carried out in triplicate.
2.4. Isolation and culture of primary chondrocytesArticular cartilage was excised from knee joints of pigs (Yorkshire, 10–12 months). Chondrocytes were harvested by digesting cartilage with 0.15% collagenase II (Sigma) for 12 h, rotating regularly. The obtained chondrocytes were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (12800017 Gibco-Invitrogen, China) containing 100 μg ml−1 streptomycin, 100 μg ml−1 penicillin, and 10% fetal bovine serum in a humidified environment with 5% CO2 at 37 °C. The IPN hydrogels (5*6*1 mm3) were seeded with 10 μl culture medium with suspended chondrocytes (3 × 105 cells per hydrogel). The culture medium was changed every 3 d.
2.5. Seeding efficiency, distribution and morphologies of chondrocytesChondrocytes at passage 2 with a cell density of 106 cells were prepared, and 3 × 105 chondrocytes per scaffold (5*6*1 mm3) was loaded into each scaffold. The cell-laden scaffolds were left under static cell culture conditions for 12 h to allow cells to adhere and adapt themselves in various scaffolds. The scaffolds were then removed and the cells remaining in the wells were counted using a blood cell counting chamber. At least 3 specimens were used for calculation for cell seeding efficiency for each scaffold. The cell seeding efficiency of scaffolds was calculated using the following formula: Seeding efficiency = (1 − number of cells remaining in plate/cell seeding number) × 100%. The cell distribution was analyzed after the seeding of 3 × 105 chondrocytes per scaffold (5*6*1 mm3) under the optical microscope at 24 h and 48 h. After three days’ culture, the cell-scaffold constructs were used for F-actin staining. After being fixed with 4% paraformaldehyde and permeabilized in 0.1% Triton X-100, the sample was stained with rhodamine phalloidin (PHDR1, cytoskeleton) for 30 min, and the nuclei were then counterstained with 4, 6-diamidino-2-phenylindole (DAPI Sigma, USA) for 2 min. Finally, the stained samples were observed under the confocal laser scanning microscope (CLSM, LSM510 Zeiss, Germany).
2.6. Viability and proliferation of chondrocytesViability of chondrocytes in hydrogels was determined by 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2Htetrazolium bromide (MTT, M 2128, Sigma) assay. Briefly, 50 000 chondrocytes were seeded in each scaffold in 24-well plates before one milliliter of culture medium was added. After 1 and 3 d, 200 μl of MTT (5 mg ml−1) was added into each well and allowed to incubate at 37 °C for 3 h. One milliliter of DMSO was added and the absorbance of each culture well was measured with a microplate reader (Molecular Devices, USA) at 570 nm. Absorbance was detected with a plate reader at 570 nm at 1 and 3 d. Viability assays were performed in triplicate.
Biomed. Mater. 11 (2016) 035014
4
J Zhang et al
Chondrocytes at passage 2 were seeded into IPN hydrogels (5*6*1 mm3) with 3 × 105 cells for each scaffold. Fluorescein diacetate (FDA) staining (F7378 Sigma, China) and propidium iodide (PI, P4170, Sigma) were used to stain live cells and dead cells in hydrogels at day 7. FDA was used to observe cell prolif-eration and distribution at day 7 and day 10. The sam-ples were incubated with FDA (100 μl, 2 μg ml−1) for 15 min in an incubator at 37 °C and then washed with PBS three times. Then PI staining with a concentration of 5 mg ml−1 was added to incubate for 5 min before being viewed under the confocal laser scanning micro-scope (CLSM, LSM510 Zeiss, Germany) at an excitation wavelength of 488 nm (green) and an emission wave-length from 550 to 670 nm.
Hoechst 33258 dye (H6024 Sigma, People’s Repub-lic of China) was used to assess cell numbers at day 14 after cell seeding. Each sample was mixed with 100 μl sterile distilled water to lyse chondrocytes. H33258 solu-tion (100 μl, 0.1 μg ml−1) was added to the lysed solution and the fluorescence was recorded using a microplate reader (CEMINI XS, Molecular Devices) at an excita-tion wavelength of 360 nm and emission wavelength of 465 nm (The assay was performed in triplicate).
2.7. DMMB assay for glycosaminoglycan quantificationProteinase K (50 μg ml−1) was used to digest the cell-laden scaffolds at 56 °C overnight after 7, 14, 21, and 28 d in culture. The digested solution was then quantified by the 1, 9-dimethylmethylene blue (DMMB, 341088, Sigma) colorimetric method. The GAG content was obtained by measuring the absorbance at 630 nm (GAG quantification assays were performed in triplicate).
2.8. Quantitative gene expression by real-time PCROne milliliter of Trizol (15596-026, Invitrogen) was added to cleave cells after being cultured in hydrogels for 14 d, and the extraction process of RNA was then performed according to the manufacturer’s instructions. The cDNA was synthesized by following the instruction of the iScript™cDNA synthesis kit (Bio-Rad, CA) after detecting the RNA concentration with the Nano-Drop (Nano-Drop Technologies, DE). Power SYBR Green PCR Master Mix (Applied Biosystem, CA) was used in this PCR system and the experiment was done on the Applied Biosystems 7500 RT-PCR System (Applied Biosystem) at 95 °C for 15 min, followed by 40 cycles of denaturation for 15 s at 94 °C, 30 s of annealing at 55 °C, and 30 s of elongation at 72 °C. The target genes were normalized by the reference gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH). The primers used in this experiment are
listed in table 1.
2.9. Statistical analysisSPSS V17.0 (one-way ANOVA, LSD, p < 0.05) was applied to analyze the data. The statistical significance was set at a 95% confidence interval, with a significance
level of *p < 0.05, **p < 0.01, ***p < 0.001, and the data are expressed as mean ± standard deviation.
3. Results
3.1. Characterization of IPN hydrogelsSEM photographs revealed that the IPN scaffolds had highly interconnected structures with pore sizes around 80 μm in diameter (figure 1). The weight swelling ratio of the hydrogels was about 16 and remained nearly unchanged with an increase in gelatin concentration (figure 2(a)), while the volume swelling ratio decreased from 2.5 to 0.72 (figure 2(b)). The gelatin distribution was observed under a confocal microscope by fluorescence-labeling with isothiocyanate rhodamine B (figure 3). The gelatin was distributed irregularly in IPN-1% and IPN-2.5% groups, but was distributed regularly and formed complete pore structures in IPN-5% and IPN-10% groups. The walls of the pore structures in IPN-10% were thicker than in the IPN-5% group, which indicated more gelatin in the IPN-10% group. The Young’s modulus of both lyophilized and swollen IPN hydrogels increased with increasing amounts of gelatin. Additionally, the Young’s modulus of lyophilized IPN-10% increased significantly and was nearly 6.3-fold of the PEG group (p < 0.001), while swollen IPN-10% was 6.5-fold of the PEG hydrogel (figures 3(f ) and (g)).
3.2. Seeding efficiency, viability, and proliferation of chondrocytesA macroscopic view of the hydrogels indicated that IPN-10% hydrogels became yellow, while PEG hydrogels stayed transparent (figure 4(a)). There was no significant difference in the cell seeding efficiencies of IPN-1% and IPN-2.5% when compared with PEG group. However, the cell seeding efficiency in IPN-10% hydrogels increased significantly, reaching 97% (figure 4(d)). At day 7, nearly all the cells were viable in PEG and IPN-10% scaffolds (figures 4(e) and (f )). To study cell survival, cell viability was monitored by MTT assay, and further tested by live and dead staining at day 7. The cell survival rate maintained a rate of more than 80% in the
Table 1. Primer sequences used in real-time PCR analysis.
Target primer
Sequence forward and reverse
(from 5′ to 3′)
GAPDH ATGGTGAAGGTCGGAGTGAA;
AATGAAGGGGTCATTGATGG
Collagen I CAGAACGGCCTCAGGTACCA;
CAGATCACGTCATCGCACAAC
Collagen II TGAGAGGTCTTCCTGGCAAA;
GAAGTCCCTGGAAGCCAGAT
Collagen X TGCTGCTGCTATTGTCCTTG;
TGAAGAACTGTGCCTTGGTG;
SOX-9 ATCAGTACCCGCACCTGCAC;
CTTGTAATCCGGGTGGTCCTT
Aggrecan CATCACCGAGGGTGAAGC;
CCAGGGGCAAATGTAAAGG
Biomed. Mater. 11 (2016) 035014
5
J Zhang et al
IPN hydrogel scaffolds and reached 86% in IPN-10% group, which was higher than the viability of the PEG group. Further fluorescence micrographs showed that live cells were stained green, whereas dead cells were stained red at day 7 (figures 4(d) and (e))
Cell distribution and morphology were assessed by optical microscopy at 24 h and 72 h after seeding cells into scaffolds. Chondrocytes developed into round cell aggregates and remained suspended in PEG hydrogels after 24 h and maintained round morphologies after 72 h (figures 5(a), (f ) and (k)). However, in gelatin-incorporated IPN hydrogels, chondrocytes were dis-tributed homogeneously and flattened to adhere to hydrogels as shown in figure 5. Further F-actin stain-ing also revealed that cells aggregated in PEG hydrogels (figure 5(k)), but developed fibroblast morphologies in IPN hydrogels (figures 5(p)–(t)).
As indicated by figure 6, cell distribution and pro-liferation were evaluated by FDA staining and Hoechst
33258, respectively. After 7 d culture, green staining was found extensively on both the top and bottom sides of IPN scaffolds, compared to only small green dots in PEG (figures 6(a)–(e)). Additionally, the cross-sections of the cell-laden constructs showed that chondrocytes in PEG scaffolds remained only in the top part of the scaffolds (figure 6(k)). However, in both IPN-5% and IPN-10% groups, cells gradually moved to the bottom of the scaffolds and became distributed throughout the cross-sections of the scaffolds (figures 6(n)–(o)). Further observations of the 3D distribution of cells within scaffolds were conducted at day 10 under con-focal microscope (figure 7). Chondrocytes became extended, proliferated, and merged with neighboring cells to form cell constructs in IPN-2.5% and IPN-10%, but remained scattered in PEG scaffolds, as seen by the small green dots (figure 7(a)). These results demon-strated that in IPN scaffolds, chondrocytes prolifer-ated quickly and gradually moved to occupy the entire
Figure 1. Characterization of macroporous IPN hydrogels. PEG ((a), (f ), (k) and (l)); IPN-1% ((b) and (g)); IPN-2.5% ((c) and (h)); IPN-5% ((d) and (i)) and IPN-10% ((e), (j), (m), (n) and (o)); top surface SEM images ((a)–(j)) and cross-sectional SEM images ((k)–(o)); cross-sectional SEM images of PEG (k) and magnified images (l); cross-sectional SEM images of IPN-10% (m) and magnified images ((n) and (o)).
Figure 2. Swelling ratios of macroporous IPN hydrogels, weight swelling ratio (a) and volume swelling ratio (b). Data expressed as mean ± SD, where n = 3, *p < 0.05, **p < 0.01.
Biomed. Mater. 11 (2016) 035014
6
J Zhang et al
scaffold, while cells remained scattered in PEG scaf-folds, as shown by the small green dots. The cell number analysis at day 14 also confirmed that cells in IPN scaf-folds had high proliferation rates, and cell numbers in IPN-5% and IPN-10% were significantly higher than in the other three groups (figure 7(d)). The GAG content produced by single cell decreased in IPN-5% and IPN-10% at day 14 (figure 7(e)).
3.3. GAG analysisThe analysis of GAG content indicated an increase in GAG production in all hydrogels with time (figure 8). Although the GAG content was comparable between all groups at day 7, GAG production of IPN hydrogels became higher than that of the PEG group at day 14. Additionally, a significant increase in GAG accumulation was found in IPN hydrogels at day 21 (p < 0.05) and day 28 (p < 0.001) when compared with the PEG group.
3.4. Gene expressionGene expressions of Sox 9 increased with increasing concentrations of gelatin and a significant difference was observed in IPN-10% when compared with PEG, IPN-1%, and IPN-2.5% (p < 0.05) (figure 9). Similarly, gene expression of collagen II was enhanced in gelatin-incorporated IPN hydrogels and was about 8-fold higher in IPN-10% (p < 0.05) than in PEG. However, there was no significant difference in collagen II expression between PEG, IPN-1%, IPN-2.5%, and IPN-5%. Low levels of gene expressions of collagen X and collagen I were observed in all groups.
4. Discussion
It is vital to create a proper scaffold for cartilage engineering with both the necessary mechanical properties and a bioactive environment for the encapsulated cells. A wide
Figure 3. Gelatin distribution and mechanical property of IPN hydrogels. Gelatin was fluorescence-labeled with isothiocyanate rhodamine B (red); (a) PEG; (b) IPN-1%; (c) IPN-2.5%; (d) IPN-5%; (e) IPN-10%; Young’s modulus of (f ) lyophilized hydrogels and (g) hydrogels swollen with PBS buffer. Scale bars = 100 μm data expressed as mean ± SD, where n = 3, *p < 0.05, **p < 0.01, ***p < 0.001.
Biomed. Mater. 11 (2016) 035014
7
J Zhang et al
variety of biomaterials have been produced for cartilage tissue engineering, including synthetic materials and natural biomaterials. Among them, IPN hydrogels have been identified as promising materials for encapsulating chondrocytes with the potential to yield functional cartilage tissues (Rennerfeldt et al 2013, Cai et al 2014). In this study, macroporous PEG-gelatin IPN hydrogels with enhanced mechanical properties have been created to improve chondrocyte function. It has been demonstrated that the incorporation of the interpenetrating network and large pore structure into PEG hydrogels can improve mechanical properties and promote cell survivability and cartilage-specific ECM formation. The double networks
in the IPN significantly enhanced mechanical properties, while the large pores promoted cell–cell contact and facilitated nutrition exchange (figure 10).
Mechanical property and swelling ratios of the scaffold are strongly related with the structures of the scaffolds. When gelatin concentration was low in IPN hydrogels, such as IPN-1% and IPN-2.5%, the construct did not form continuous porous structures. The formation of the second network of gelatin only occurred when the gelatin content was high enough, such as in IPN-5% and IPN-10% (figure 3). The sec-ond network of gelatin caused increased crosslinking due to more gelatin amount and restricted the swelling
Figure 4. Macroscopic appearance, cell seeding efficiency and cell viability of the hydrogels. (a) macroscopic appearance of PEG without cells (left), IPN-10% without cells (middle) and IPN-10% seeded with cells at day 1(right); (b) cell seeding efficiency; (c) cell viability at day 1 and day 3 detected by MTT assay, data were normalized as the percentage of tissue culture plate surface (TCPS). Data expressed as mean ± SD, where n = 3, *p < 0.05, **p < 0.01, ***p < 0.001 compared with TCPS group; cell-laden hydrogels with viable cells (in green) and dead cells (in red) were present inside the gel-matrices for (d) PEG and (e) IPN-10% at day 7. Scale bar = 100 μm.
Biomed. Mater. 11 (2016) 035014
8
J Zhang et al
of the PEG network, as shown by the decreased vol-ume swelling ratio of IPN hydrogels (figure 2). This restricted volume swelling ratio allowed for greater macromer concentrations of PEG in hydrogels of the same size; combined with the second network of gela-tin, the mechanical properties were enhanced in IPN hydrogels. However, the exact mechanism of synergis-tic enhancement of the IPN structure through a dou-ble network remains unclear, although much research has been performed. One theory is that the increase in mechanical properties in IPN hydrogels is caused by the inhibition of crack propagation by ductile poly-
mers in the early stages of brittle fracture (Webber et al 2007).
In addition to enhanced mechanical properties, gel-atin incorporation also facilitated cell-matrix interac-tion. As indicated by figure 5, fibroblast morphologies were found in gelatin-incorporated scaffolds. When encapsulated inside PEG hydrogels, chondrocytes aggregated and displayed an isolated, round morph-ology, and had delayed proliferation, migration, and matrix production, due to the lack of bioactive attach-ment points. In contrast to the round cell aggregates found in PEG hydrogels, chondrocytes in IPN hydrogels
Figure 5. Cell distribution and morphologies of chondrocytes within hydrogels; (a)–(o) cell distribution observed at 24 h and 72 h after cell seeding observed by optical microscope. (p)–(t) F-actin staining using rhodamine phalloidin with DAPI of chondrocytes embedded in macroporous IPN hydrogels after 72 h in culture. Actin was stained red, while the cell nucleus was blue. Scale bar = 100 μm.
Figure 6. Cell viability and distribution; chondrocytes within hydrogels cultured for 7 d were observed under a confocal microscope on the top ((a)–(e)), bottom ((f )–(j)), and cross-section ((k)–(o)) of cell-laden constructs; a large number of viable cells (in green) were present inside the gel-matrices for PEG ((a), (f ), and (k)); IPN-1% ((b), (g), and (l)); IPN-2.5% ((c), (h), and (m)); IPN-5% ((d), (i), and (n)); IPN-10% ((e), (j), and (o)). The side of the scaffolds that cells were seeded on is represented by A, while B represents the opposite side of the scaffolds; scale bar = 200 μm.
Biomed. Mater. 11 (2016) 035014
9
J Zhang et al
Figure 7. Cell proliferation and 3D distribution of chondrocytes in hydrogels. 3D distribution of chondrocytes at day 10 was observed under a confocal microscope: PEG (a); IPN-2.5% (b); IPN-10% (c). Total cell numbers (d) and GAG/cell number (e) of cell-laden constructs at day 14. Data expressed as mean ± SD, where n = 3, **p < 0.01, ***p < 0.001. Scale bar = 500 μm.
Figure 8. Total GAG content of chondrocytes after 7, 14, 21, and 28 d in culture. Data expressed as mean ± SD, where n = 3, *p < 0.05.
Figure 9. Gene expression levels of collagen I, II, X, aggrecan, and sox-9, measured at day 14 in culture. Data expressed as mean ± SD, where n = 3, *p < 0.05, ***p < 0.001.
Biomed. Mater. 11 (2016) 035014
10
J Zhang et al
were elongated and had fibroblast morphologies. This may be due to the gelatin incorporation. Gelatin, which is the partial hydrolysis product of collagen and has the same cell binding motifs as native collagen, can induce cell adhesion and has been proven to enhance cell func-tion (Peppas et al 2006, Zhang et al 2012). Cell adhe-sion receptors on chondrocytes can recognize binding motifs in gelatin and bind to form extensive cytoskel-etons.
The stiffness caused by gelatin incorporation also improved cell elongation, F-actin organization, and cell functions. At the cellular level, increasing matrix stiffness facilitates cell spreading (Schuh et al 2010), disrupts cell morphology, and leads to increased cell proliferation (Paszek et al 2005, Ulrich et al 2009, Schuh et al 2010). It is hypothesized that cells tend to maintain a homeostatic balance by adapting their cytoskeletal tension to the stiffness of the substrate (Ingber 2003). When seeded into a stiffer IPN scaffold, chondrocytes increased their cellular stiffness to match the stiffness of the scaffold, resulting in elongated and flattened morphologies. The elongated morphology and F-actin stress fibers were proven to promote entry into the cell cycle (Margadant et al 2007). This is consistent with our finding that chondrocytes that displayed flattened morphologies in IPN-5% and IPN-10% had higher proliferation rates. In previous studies, the fibroblast morphology of chondrocytes was usually associated with dedifferentiation (Schuh et al 2010, Zhang et al 2013). On the contrary, dedifferentiation did not occur in our IPN hydrogels, as evidenced by low collagen I expression. Weak mechanical properties is one of the most significant drawbacks that restricts the applica-tion of hydrogels; increasing crosslinking can improve mechanical properties but also hinders cell functions (Nicodemus et al 2011). The Young’s modulus of IPN-10% (126.9 KPa) was significantly higher than that of PEG (20.1 Kpa) and was much closer to a suitable
Young’s modulus (0.4–0.8 MPa) (Moutos et al 2007, Little et al 2011) for neo-cartilage development.
In this study, extensive cell–cell interaction occurred due to the macroporous structure of the hydrogels. Cell aggregation has been shown to maintain the phenotypes of chondrocytes (Wolf et al 2008) and initiate a conden-sation process for chondrogenic differentiation of stem cells during both embryonic development and carti-lage regeneration (Erickson et al 2009, Bian et al 2013). In vivo, chondrocytes in suspension naturally aggregate into clusters of 6–10 cells, and are surrounded by carti-lage ECM such as collagen II and GAG to maintain cell phenotypes (Gigout et al 2008). However, many hydro-gels inherently limit cell–cell contact (Zhang et al 2013), and usually are dependent upon increased cell seeding density to improve the quality of the cartilage construct (Huang et al 2008, Erickson et al 2012). Even with this strategy, limited cell–cell interaction has been observed (Erickson et al 2009, Zhang et al 2014). Another method is to pre-aggregate the chondrocytes before seeding into a hydrogel scaffold, which can significantly enhance the quality of the resulting tissue formation (Moreira Teix-eira et al 2012). This enhanced cell–cell interaction of chondrocytes can reduce dedifferentiation (Wolf et al 2008), which explains why collagen I expression was low in all hydrogels in this study. Additionally, cartilage formation ability was improved in IPN hydrogels as evi-denced by significantly higher GAG accumulation and up-regulated gene expressions of collagen II and sox-9, when compared with PEG hydrogels. Overall, this IPN hydrogel was able to combine high mechanical strength with the ability to enhance cell proliferation and carti-lage-specific ECM accumulation.
5. Conclusion
Most hydrogels inherently have poor mechanical properties and allow for limited cell–cell interaction,
Figure 10. Schematic representation showing characterization of macroporous IPN hydrogels compared with most hydrogels and IPN hydrogels. In macroporous IPN hydrogels, the interpenetrating network improved mechanical properties while the macroporous structure enhanced cell–cell interaction and nutrition exchange.
Biomed. Mater. 11 (2016) 035014
11
J Zhang et al
which significantly restricts their application in cartilage tissue engineering. Increasing crosslinking can enhance their mechanical properties at the cost of decreased nutritional exchange. Therefore, in this study, a macroporous structure and interpenetrating network were introduced into a hydrogel system to improve both mechanical properties and cell–cell interaction. Our results demonstrate that macroporous PEG-gelatin IPN hydrogels, especially the IPN-10% group, can not only enhance the mechanical properties of the hydrogel, but can also facilitate cell–cell interaction and improve cell attachment, cell proliferation, cartilage-specific gene expression, and ECM accumulation. Additional research should focus on creating hydrogels with time-dependent elastic moduli or stiffness for cartilage regeneration, due to dynamic changes in the mechanical properties of tissues during cartilage development.
Acknowledgments
The authors would like to acknowledge the support from the National Basic Research Program of China grant (973 Program 2012CB619100) and the National Natural Science Foundation of China grant (81471800).
References
Betz M W, Yeatts A B, Richbourg W J, Caccamese J F, Coletti D P, Falco E E and Fisher J P 2010 Macroporous hydrogels upregulate osteogenic signal expression and promote bone regeneration Biomacromolecules 11 1160–8
Bian L, Guvendiren M, Mauck R L and Burdick J A 2013 Hydrogels that mimic developmentally relevant matrix and N-cadherin interactions enhance MSC chondrogenesis Proc. Natl Acad. Sci. USA 110 10117–22
Cai W, Lu L L and Li X S 2014 Mechanically robust gelatin-alginate IPN hydrogels by a combination of enzymatic and ionic crosslinking approaches Macromol. Mater. Eng. 299 504–13
Daniele M A, Adams A A, Naciri J, North S H and Ligler F S 2014 Interpenetrating networks based on gelatin methacrylamide and PEG formed using concurrent thiol click chemistries for hydrogel tissue engineering scaffolds Biomaterials 35 1845–56
DeKosky B J, Dormer N H, Ingavle G C, Roatch C H, Lomakin J, Detamore M S and Gehrke S H 2010 Hierarchically designed agarose and poly(ethylene glycol) interpenetrating network hydrogels for cartilage tissue engineering Tissue Eng. C 16 1533–42
Erickson I E, Huang A H, Chung C, Li R T, Burdick J A and Mauck R L 2009 Differential maturation and structure-function relationships in mesenchymal stem cell and chondrocyte-seeded hydrogels Tissue Eng. A 15 1041–52
Erickson I E, Kestle S R, Zellars K H, Farrell M J, Kim M, Burdick J A and Mauck R L 2012 High mesenchymal stem cell seeding densities in hyaluronic acid hydrogels produce engineered cartilage with native tissue properties Acta Biomater. 8 3027–34
Gao G, Schilling A F, Hubbell K, Yonezawa T, Truong D, Hong Y, Dai G and Cui X 2015 Improved properties of bone and cartilage tissue from 3D inkjet-bioprinted human mesenchymal stem cells by simultaneous deposition and photocrosslinking in PEG-GelMA Biotechnol. Lett. 37 2349–55
Gigout A, Jolicoeur M, Nelea M, Raynal N, Farndale R and Buschmann M D 2008 Chondrocyte aggregation in suspension culture is GFOGER-GPP- and beta1 integrin-dependent J. Biol. Chem. 283 31522–30
Huang A H, Yeger-McKeever M, Stein A and Mauck R L 2008 Tensile properties of engineered cartilage formed from chondrocyte- and MSC-laden hydrogels. Osteoarthritis and cartilage/OARS Osteoarth. Res. Soc. 16 1074–82
Ingavle G C, Gehrke S H and Detamore M S 2014 The bioactivity of agarose-PEGDA interpenetrating network hydrogels with covalently immobilized RGD peptides and physically entrapped aggrecan Biomaterials 35 3558–70
Ingber D E 2003 Tensegrity II. How structural networks influence cellular information processing networks J. Cell Sci. 116 1397–408
Li C, Wang L L, Yang Z, Kim G, Chen H and Ge Z G 2012a A viscoelastic chitosan-modified three-dimensional porous poly(L-Lactide-co-ε-Caprolactone) scaffold for cartilage tissue engineering J. Biomater. Sci. Polym. Ed. 23 405–24
Li H, Wijekoon A and Leipzig N D 2012 3D differentiation of neural stem cells in macroporous photopolymerizable hydrogel scaffolds Plos One 7 e48824
Liao I C, Moutos F T, Estes B T, Zhao X and Guilak F 2013 Composite three-dimensional woven scaffolds with interpenetrating network hydrogels to create functional synthetic articular cartilage Adv. Funct. Mater. 23 5833–9
Lien S M, Ko L Y and Huang T J 2009 Effect of pore size on ECM secretion and cell growth in gelatin scaffold for articular cartilage tissue engineering Acta Biomater. 5 670–9
Lim K S, Alves M H, Poole-Warren L A and Martens P J 2013 Covalent incorporation of non-chemically modified gelatin into degradable PVA-tyramine hydrogels Biomaterials 34 7097–105
Little C J, Bawolin N K and Chen X 2011 Mechanical properties of natural cartilage and tissue-engineered constructs Tissue Eng. B 17 213–27
Margadant C, van Opstal A and Boonstra J 2007 Focal adhesion signaling and actin stress fibers are dispensable for progression through the ongoing cell cycle J. Cell Sci. 120 66–76
Moon J J, Hahn M S, Kim I, Nsiah B A and West J L 2009 Micropatterning of Poly(Ethylene Glycol) Diacrylate Hydrogels with biomolecules to regulate and guide endothelial morphogenesis Tissue Eng. A 15 579–85
Moreira Teixeira L S, Leijten J C, Sobral J, Jin R, van Apeldoorn A A, Feijen J, van Blitterswijk C, Dijkstra P J, Karperien M 2012 High throughput generated micro-aggregates of chondrocytes stimulate cartialge formation in vitro and in vivo. Eur. Cell Mater. 23 387–99
Moutos F T, Freed L E and Guilak F 2007 A biomimetic three-dimensional woven composite scaffold for functional tissue engineering of cartilage Nat. Mater. 6 162–7
Murphy C M, Haugh M G and O’Brien F J 2010 The effect of mean pore size on cell attachment, proliferation and migration in collagen-glycosaminoglycan scaffolds for bone tissue engineering Biomaterials 31 461–6
Nehrer S, Breinan H A, Ramappa A, Young G, Shortkroff S, Louie L K, Sledge C B, Yannas I V and Spector M 1997 Matrix collagen type and pore size influence behaviour of seeded canine chondrocytes Biomaterials 18 769–76
Nicodemus G D, Skaalure S C and Bryant S J 2011 Gel structure has an impact on pericellular and extracellular matrix deposition, which subsequently alters metabolic activities in chondrocyte-laden PEG hydrogels Acta Biomater. 7 492–504
Paszek M J et al 2005 Tensional homeostasis and the malignant phenotype Cancer Cell 8 241–54
Peppas N A, Hilt J Z, Khademhosseini A and Langer R 2006 Hydrogels in biology and medicine: from molecular principles to bionanotechnology Adv. Mater. 18 1345–60
Qiu Y and Park K 2003 Superporous IPN hydrogels having enhanced mechanical properties AAPS PharmSciTech 4 406–12
Rennerfeldt D A, Renth A N, Talata Z, Gehrke S H and Detamore M S 2013 Tuning mechanical performance of poly(ethylene glycol) and agarose interpenetrating network hydrogels for cartilage tissue engineering Biomaterials 34 8241–57
Rnjak-Kovacina J, Wray L S, Golinski J M and Kaplan D L 2014 Arrayed hollow channels in silk-Based scaffolds provide
Biomed. Mater. 11 (2016) 035014
12
J Zhang et al
functional outcomes for engineering critically sized tissue constructs Adv. Funct. Mater. 24 2188–96
Schuh E, Kramer J, Rohwedel J, Notbohm H, Müller R, Gutsmann T and Rotter N 2010 Effect of matrix elasticity on the maintenance of the chondrogenic phenotype Tissue Eng. 16 1281–90
Simonsson C, Madsen J T, Graneli A, Andersen K E, Karlberg A T, Jonsson C A and Ericson M B 2011 A study of the enhanced sensitizing capacity of a contact allergen in lipid vesicle formulations Toxicol. Appl. Pharmacol. 252 221–7
Sridhar B V, Dailing E A, Brock J L, Stansbury J W, Randolph M A and Anseth K S 2015 A biosynthetic scaffold that facilitates chondrocyte-mediated degradation and promotes articular cartilage extracellular matrix deposition Regen. Eng. Transl. Med. 1 11–21
Ulrich T A, de Juan Pardo E M and Kumar S 2009 The mechanical rigidity of the extracellular matrix regulates the structure, motility, and proliferation of glioma cells Cancer Res. 69 4167–74
Webber R E, Creton C, Brown H R and Gong J P 2007 Large strain hysteresis and mullins effect of tough double-network hydrogels Macromolecules 40 2919–27
Wolf F, Candrain C, Wendt D, Farhadi J, Heberer M, Martin I and Barbero A 2008 Cartilage tissue engineering using pre-aggregated human articular chondrocytes Eur. Cell Mater. 16 92–9
Yasuda K et al 2008 A novel double-network hydrogel induces spontaneous articular cartilage regeneration in vivo in a large osteochondral defect Macromol. Biosci. 9 307–16
Zhang J, Mujeeb A, Du Y, Lin J H and Ge Z 2015 Probing cell-matrix interactions in RGD-decorated macroporous poly (ethylene glycol) hydrogels for 3D chondrocyte culture Biomed. Mater. 10 035016
Zhang J, Wu Y, Thote T, Lee E H, Ge Z and Yang Z 2014 The influence of scaffold microstructure on chondrogenic differentiation of mesenchymal stem cells Biomed. Mater. 9 035011
Zhang J J, Yang Z, Li C, Dou Y, Li Y J, Thote T, Wang D and Ge Z G 2013 Cells behave distinctly within sponges and hydrogels due to differences of internal structure Tissue Eng. A 19 2166–75
Zhang Y, Choi S W and Xia Y 2012 Modifying the pores of an inverse opal scaffold with chitosan microstructures for truly three-dimensional cell culture Macromol. Rapid Commun. 33 296–301
Biomed. Mater. 11 (2016) 035014