loss of rhb1, a rheb-related gtpase in fission yeast, causes

Copyright 2000 by the Genetics Society of America

Loss of Rhb1, a Rheb-Related GTPase in Fission Yeast, Causes Growth ArrestWith a Terminal Phenotype Similar to That Caused by Nitrogen Starvation

Kathleen E. Mach,1 Kyle A. Furge and Charles F. Albright

Department of Biochemistry, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-0146

Manuscript received July 8, 1999Accepted for publication March 3, 2000

ABSTRACTThe Rheb GTPase is most similar in primary sequence to the Ras, Rap, R-Ras, and Ral GTPases, which

regulate cell growth and differentiation in many cell types. A likely fission yeast homologue of mammalianRheb, which we designated Rhb1, was identified by genome sequencing. Our investigation of rhb1 showedthat rhb12 cells arrested cell growth and division with a terminal phenotype similar to that of nitrogen-starved cells. In particular, cells depleted of Rhb1 arrested as small, round cells with 1N DNA content,arrested more quickly in low-nitrogen medium, and induced expression of fnx1 and mei2 mRNA, twomRNAs that were normally induced by nitrogen starvation. Since mammalian Rheb binds and may regulateRaf-1, a Ras effector, we tested for functional overlap between Ras1 and Rhb1 in fission yeast. This analysisshowed that Ras1 overexpression did not suppress rhb12 mutant phenotypes, Rhb1 overexpression didnot suppress ras12 mutant phenotypes, and ras12 rhb12 double mutants had phenotypes equal to the sumof the corresponding single-mutant phenotypes. Hence, there is no evidence for overlapping functionsbetween Ras1 and Rhb1. On the basis of this study, we hypothesize that Rhb1 negatively regulates entryinto stationary phase when extracellular nitrogen levels are adequate for growth. If this hypothesis iscorrect, then Rhb1 and Ras1 regulate alternative responses to limiting nutrients.

THE Ras superfamily of proteins are low molecular agreed on the consequences of Rheb binding to Raf-1(Clark et al. 1997; Yee and Worely 1997). Yee andmass GTPases that cycle between an active, GTP-Worley (1997) found that Rheb binding to Raf-1 inbound form and an inactive, GDP-bound form (re-vitro stimulated Raf-1 kinase activity, Rheb potentiatedviewed in Bourne et al. 1991). Nucleotide cycling ratesthe transforming activity of Raf-1 in NIH-3T3 cells, andare increased by guanine-nucleotide exchange factorsRheb induced neurite outgrowth in PC12 cells. Thesethat catalyze production of the GTP-bound form andinvestigators also found that Raf-1 phosphorylation byGTPase-activating proteins (GAPs) that catalyze GTPprotein kinase A increased Raf-1 binding to Rheb (Yeehydrolysis (reviewed in Boguski and McCormickand Worely 1997) in contrast to Raf-1 phosphorylation1993). In mammals, the Ras superfamily of GTPasesby protein kinase A that decreased Raf-1 binding tocontains over 60 distinct proteins that regulate manyRas (Cook and McCormick 1993; Wu et al. 1993). Onbiological processes, including cell growth and differen-the basis of these results, these investigators concludedtiation, nuclear transport, vesicular transport, and mi-that Rheb, like Ras, activated Raf-1. In contrast, Clarkcrofilament structures.et al. (1997) found that Rheb did not transform NIH-The Ras superfamily can be divided into subfamilies3T3 cells, Rheb inhibited cellular transformation ofbased on primary sequence comparisons (reviewed inNIH-3T3 cells by activated H-Ras, and Rheb reducedBourne et al. 1991). One such subfamily includes iso-Raf-1 kinase activity by activated H-Ras in Xenopus oo-forms of the Ras, Rap, Ral, R-Ras, and Rheb GTPasescyte extracts (Clark et al. 1997). On the basis of thesethat regulate cell growth and differentiation of manyresults, these investigators concluded that Rheb inhib-cell types (Bos 1997; Campbell et al. 1998). While manyited Raf-1 activation.studies of Ras, Rap, Ral, and R-Ras have been conducted,

The fission yeast Schizosaccharomyces pombe is a goodrelatively few studies of Rheb are reported and somemodel system to study Ras signaling. S. pombe containsof these studies reach different conclusions. While twoa single Ras gene, ras1, that is required to respond tostudies found that Rheb, like Ras, bound the Raf-1 ki-pheromones and maintain cell polarity (Fukui et al.nase in a GTP-dependent manner, these studies dis-1986; Nadin-Davis et al. 1986). Cells without ras1 can-not conjugate, sporulate at reduced levels, and areround instead of rod shaped. Ras1 regulates these cellu-

Corresponding author: Charles F. Albright, DuPont Pharmaceuticals, lar processes by activating at least two pathways. In one500 S. Ridgeway Ave., Glenolden, PA 19036. pathway, Ras1 activates a mitogen-activated proteinE-mail: [email protected]

(MAP)-kinase cascade. In this pathway, Ras1 binds Byr2,1 Present address: Department of Developmental Biology, StanfordUniversity School of Medicine, Stanford, CA 94305. a MEKK, and this binding is required to activate Byr2

Genetics 155: 611–622 ( June 2000)

612 K. E. Mach, K. A. Furge and C. F. Albright

(Van Aelst et al. 1993; Masuda et al. 1995; Tu et al. nal phenotype and the lack of interactions between rhb1and ras1 mutants, we hypothesize that Rhb1 regulates1997). Activated Byr2 activates Byr1, a MEK, and Byr1

activates Spk1, a MAP kinase (Nadin-Davis and Nasim the entry into stationary phase while Ras1 regulates mat-ing. If this hypothesis is accurate, then Rhb1 and Ras1988; Toda et al. 1991; Wang et al. 1991). This Ras1-

activated, MAP-kinase cascade is essential for conjuga- regulate alternative responses to limiting nutrients.tion and sporulation but does not affect cell morphol-ogy. In a second pathway, Ras1 binds Scd1, an exchange

MATERIALS AND METHODSfactor for the Cdc42 GTPase (Fukui and Yamamoto1988; Chang et al. 1994). Cells without Scd1 are round Strains and growth conditions: The yeast strains used in thisand unable to conjugate but sporulate efficiently. study are listed in Table 1. S. pombe was grown at 308 in yeastHence, fission yeast Ras1, like mammalian Ras, activates extract medium (YE) or minimal medium (MM) with required

supplements at 75 mg/liter (Moreno et al. 1991). A derivativea MAP-kinase cascade, affects cell morphology, and reg-of MM, designated MMGlu, was also used, which containedulates cellular differentiation.5 mm glutamate, instead of 100 mm ammonium chloride, asS. pombe cells respond to limiting nutrients in at least the nitrogen source. S. pombe transformations were performed

three ways. First, mating can occur when nitrogen is by the LiAcetate method (Warshawsky and Miller 1994).limiting and cells of the opposite mating type are pres- nmt1 promoters were repressed by addition of 40 mm thiamine

to media (Maundrell 1993). The KGY248 3 SP870 diploident (reviewed in Davey 1998). Mating can also occurwas made by protoplast fusion (Alfa et al. 1993).when carbon is limiting although the frequency is much

To construct the rhb12 allele, a 2.27-kb DNA fragment, fromlower than in nitrogen-starved cells. Following conjuga- 1.2 kb 59 of the rhb1 start codon to 0.8 kb 39 of the rhb1tion, meiosis and sporulation usually occur, leading to stop codon was amplified using the polymerase chain reactionthe formation of four haploid spores that are much (PCR; oligonucleotides attttcgaaggttttcactcactc and aactgcagc

ttaaaacccgtatcgcagacctc). The resulting DNA fragment was di-more resistant to extracellular stresses than activelygested with KpnI and PstI and then ligated with pBSK that wasgrowing cells. Several signaling pathways coordinate thesimilarly digested to create pBSKrhb1. pBSKrhb1 was partiallymating process. In particular, nutrient deprivation digested with EcoRV and completely digested with XhoI to

causes decreased intracellular cAMP (Fukui et al. 1986; remove most of the rhb1 coding region and ligated with aMaeda et al. 1990; Mochizuki and Yamamoto 1992) DNA fragment that contained the ura41 gene that had been

digested with SmaI and XhoI to create pBSKDrhb1. pBSKDrhb1and increased Spc1 kinase activity (Shiozaki and Rus-was digested with KpnI and PstI and the linear DNA fragmentsell 1996) while pheromones activate signaling path-containing the ura41 gene was transformed into SP870 3ways that include the Ras1-activated, MAP-kinase cas- KGY248 diploids. Stable ura41 transformants were selected

cade. As an alternative to mating in response to low and diploids with one disrupted rhb1 allele, rhb12, were identi-nutrients, S. pombe can enter stationary phase. Cells de- fied by Southern blot (Ausubel et al. 1995). The resulting

rhb11/rhb12 diploid, KM249, was sporulated on MMGlu platespleted of nitrogen typically enter stationary phase withand tetrads were dissected.a 1N DNA content (Fantes and Nurse 1977; Costello

Plasmids: Plasmid manipulation and bacterial transforma-et al. 1986; Su et al. 1996). Such stationary-phase cells tion were performed by standard techniques (Sambrook etare smaller than actively growing cells, remain viable al. 1989). For expression vectors, rhb1 was amplified by PCRfor several weeks, and have increased resistance to heat with oligonucleotides (cgggatccatggctcctattaaatctcgta and

cttaaacccgtatcgcagacctc), digested with BamHI and EcoRV, andshock. In contrast, cells depleted of carbon or grownligated with pREP3XHA, pREP41X, or pREP81X (Basi et al.to saturation typically enter stationary phase with a 2N1993; Forsburg 1993; Maundrell 1993) that were digestedDNA content (Costello et al. 1986; Su et al. 1996) with BamHI and SmaI to generate p3XHArhb1, p41Xrhb1,

and a size between that of actively growing cells and and p81Xrhb1, respectively. rhb1 mutants were made by site-nitrogen-starved cells. While cAMP levels and Spc1 ki- directed mutagenesis (Kunkel 1985).

Western blot analysis: A total of 108 cells were harvested bynase activity may regulate entry into stationary phase,centrifugation, washed once in Stop buffer (150 mm NaCl, 50modulation of these pathways is not sufficient to inducemm NaF, 10 mm EDTA, 1 mm NaN3), resuspended in Stopstationary phase. In fact, relatively little is known about buffer, boiled 5 min, and pelleted (Fisher and Nurse 1996).

the presumed signaling pathways that control entry into Protein extracts were made by resuspending cells in 100 mlstationary phase. One likely component of this response HB (25 mm HEPES, 60 mm b-glycerophosphate, 15 mm MgCl2,

15 mm EGTA, 0.1 mm NaVanadate) with 1% SDS, 300 mgis the fnx1 gene; overexpression of fnx1, which encodesglass beads, and then mixing for 30 sec at high speed with aa likely proton-driven plasma membrane transporter ofbeadbeater (Biospec Products, Inc., Bartlesville, OK). Proteinsthe multidrug resistance group, causes cells to arrest were separated by SDS-PAGE (5% of extract per lane) and

growth like nitrogen-starved cells (Dimitrov and Sazer transferred to nitrocellulose membranes. HA-Rhb1 was de-1998). tected using HA.11 antibodies (Babco, Richmond, CA) diluted

1:10,000 in 100 mm Tris, pH 7.5, 0.9% NaCl, 0.1% Tween 20.The conflicting data on the effect of Rheb on Raf-1Bound antibodies were detected with a 1:10,000 dilution ofand the identification of a likely S. pombe Rheb homo-anti-mouse IgG-HRP and enhanced chemiluminescence re-logue, which we designated rhb1, prompted us to studyagents.

Rhb1. This analysis showed that cells depleted of Rhb1 Other techniques: Northern blot analysis, flow cytometricarrested growth with a terminal phenotype similar to analysis, sporulation rates, and microscopic techniques were

performed as previously described (Mach et al. 1998). mRNAthat of nitrogen-starved cells. On the basis of this termi-

613S. pombe rhb1, an Essential Gene

TABLE 1

Yeast strains used in this study

Strain Genotype Source, reference

CA5 h90 ura4-d18 leu1-32 ade6-216 ras1::ura41 Song et al. (1996)CA7 h90 ura4-d18 leu1-32 ade6-210 ras1::ura41 Song et al. (1996)KGY28 h2 K. GouldKGY246 h2 ura4-d18 leu1-32 ade6-210 K. GouldKGY248 h2 ura4-d18 leu1-32 ade6-216 K. GouldSP870 h90 ura4-d18 leu1-32 ade6-210 M. WiglerKM249 h2 ura4-d18 leu1-32 ade6-216 rhb1::ura41 This study

h90 ura4-d19 leu1-32 ade6-210KM250 h90 ura4-d18 leu1-32 ade6-210 rhb1::ura41 This studyKM251 h2 ura4-d18 leu1-32 ade6-210 rhb1::ura41 This studyKM252 h2 ura4-d18 leu1-32 ade6-210 rhb1::ura41ras1::ura41 This studyKFY60 h2 ura4-d18 leu1-32 ade6-216 rhb1::ura41cyr1::ura41 This studyKFY61 h2 ura4-d18 leu1-32 ade6-21X rhb1::ura41cgs1::ura41 This study

levels were quantitated by phosphoimager analysis and nor- Boguski and McCormick 1993). All of the Rheb-malized to the amount of cam1 mRNA that correlated well related proteins, however, have arginine at the residuewith the amount of ribosomal RNA in each sample. Yeast analogous to H-Ras codon 12, which is consistent withwere stained with 0.5 mg/ml phloxine B (Sigma, St. Louis)

the finding that RasGAPs do not stimulate Rheb GTPaseto visualize dead cells and FungoLIGHT (Molecular Probes,activity (Yamagata et al. 1994). Furthermore, Rheb-Eugene, OR) according to manufacturer’s instructions to visu-

alize live cells. related proteins differ at only one of nine residues in theeffector region while Rheb-related proteins and H-Rasdiffer at three residues in the effector region. Hence,Rheb-related GTPases may share some effectors withRESULTSRas as well as have Rheb-specific effectors. Finally, Rheb,

Rhb1 shares high sequence identity with the mamma- like Ras, is farnesylated (Clark et al. 1997). Based onlian Rheb GTPase: A hypothetical protein with high their CAAX-box sequences, other Rheb-related GTPasessequence identity to the mammalian Rheb GTPase was are likely farnesylated (Moores et al. 1991).identified by the S. pombe Sequencing Group at the San- rhb1 mRNA is constitutively expressed: Rheb was orig-ger Centre. This hypothetical protein (SPBC428.16c), inally identified as a protein whose mRNA was upregu-which we designated Rhb1, was sequenced as part of lated in hippocampal granule cells by seizures (Yama-cosmid 428 on the left arm of chromosome II. The gata et al. 1994). Rheb transcription was also inducedpredicted Rhb1 protein has high sequence identity with in Balb/c 3T3 fibroblasts by serum stimulation and PC12human Rheb (52.2%), rat Rheb (52.2%), and hypotheti- cells by epidermal-growth factor and basic fibroblast-cal proteins Caenorhabditis elegans F54C8.5 (38.9%) and growth factor (Gromov et al. 1995; Clark et al. 1997;Saccharomyces cerevisiae YCR027c (37.3%; Figure 1). We Yee and Worely 1997). To test for transcriptional regu-will refer to these five GTPases as the Rheb-related lation of rhb1, we determined the transcription levels ofGTPases since they are more similar to each other than rhb1 mRNA in actively growing cells, nitrogen-starvedto other Ras superfamily proteins. Consistent with the cells, and osmotically stressed cells. This analysis re-analysis of Rheb (Yamagata et al. 1994), Rheb-related vealed a single rhb1 mRNA transcript of z1 kb that wasGTPases have at least 30% sequence identity with H-Ras, present at similar levels in each of these samples (FigureRap1, RalA, and their close relatives, but ,25% se- 2). Since some of the nitrogen-starved cells in this exper-quence identity with other Ras superfamily GTPases, iment mated, we conclude that nitrogen starvation, mat-such as RhoA, Rab6, Arf, and Ran (Higgins et al. 1996). ing, and osmotic stress do not significantly alter theHence, Rheb-related GTPases are most similar to Ras amount of rhb1 mRNA.superfamily GTPases that control cell growth and differ- rhb1 is essential for growth: A null allele of rhb1, rhb12

entiation (Campbell et al. 1998). was created by replacing one allele of rhb1 in diploidsIn addition to overall sequence similarity, Rheb- with the ura41 gene (Figure 3A). Southern blot analysis

related proteins share similarities to each other in likely confirmed that the ura41 diploid strain contained onefunctional domains (Figure 1; Bourne et al. 1991). A rhb11 allele and one rhb12 allele (Figure 3B). The rhb11/glycine at codon 12 of H-Ras is essential for GAP-stimu- rhb12 heterozygous diploids were induced to sporulatelated GTP hydrolysis and mutations of this amino acid and the resulting tetrads were dissected. In all cases,

these tetrads segregated two ura2, viable spores andcause a constitutively active protein (Bourne et al. 1990;


Figure 1.—Sequence align-ment of S. pombe Rhb1(AL034382), human Rheb(Z29677), S. cerevisiae YCR027c, S.pombe Ras1 (X03771), and humanH-Ras (J00277). Shaded aminoacids are identical to S. pombeRhb1. H-Ras codon 12 (*), thecore effector domain (box), andlikely prenylation site (**) are in-dicated. Sequences were alignedwith the DNASTAR Lasergenealignment program.

two nonviable spores (Figure 3C). rhb12 mutants were induced to express HA-Rhb1, HA-Rhb1 protein was de-tected by Western blotting after 12 hr and increased incomplemented by plasmids expressing rhb11 (see be-

low), confirming that the lethal phenotype was due to amount for at least 6 more hr (Figure 4). Althoughthe HA-Rhb1 protein was expressed at high levels, thisthe lack of rhb1 function. While the rhb12 spores did

not form colonies, these spores germinated and divided overexpression did not alter the growth rate, morphol-ogy, or conjugation rate of these cells (data not shown).1–3 times before arresting as small, rounded cells. We

conclude that rhb1 is essential for growth. Overexpression of rhb1 without an epitope tag gave in-distinguishable results.Cells overexpressing wild-type or mutant rhb1 are in-

distinguishable from wild-type cells: To further explore To further characterize Rhb1 function, we generatedthree rhb1 mutants analogous to those with known phe-Rhb1 function, we tested the effect of Rhb1 overexpres-

sion. rhb1 containing an amino-terminal HA tag, rhb1- notypes in H-ras (Table 2). The rhb1-Q64L mutant isanalogous to the H-Ras-Q61L mutant, which is resistantHA, was expressed using the thiamine-repressible nmt11

promoter (Maundrell 1993). The HA tag did not inter- to GAP-mediated GTPase stimulation and is, therefore,constitutively active (Boguski and McCormick 1993).fere with Rhb1 function since rhb1-HA complemented

the rhb12 allele (data not shown). When rhb11 cells were The rhb1-S20N mutant is analogous to the H-Ras-S17N


Figure 4.—Expression of HA-Rhb1 and HA-Rhb1 mutants.Wild-type cells (SP870) that contained pREP3XHA (con.),p3XHArhb1 (Rhb11), p3XHArhb1-Q64L (Q64L), p3XHArhb1-S20N (S20N), or p3XHArhb1-T38M (T38M) were grown tomidlog phase in MM without thiamine for the indicated timein hours. Cellular lysates were then prepared and analyzedby Western blotting with anti-HA antibodies. HA-Rhb1 andHA-Rhb1 mutants are indicated by the arrow.Figure 2.—Expression of rhb1 mRNA. Total RNA from

SP870 cells that were actively growing (0) or nitrogen starvedfor 6 or 12 hr, as indicated, and KGY246 cells that were activelygrowing (0) or osmotically stressed with 1.2 m KCl for 6 or 4), no differences in the growth rate, cell morphology,12 hr, as indicated, was processed for Northern analysis with or mating of these cells were found relative to rhb11

a DNA fragment that contained the Rhb1 coding sequencecells (data not shown). Indistinguishable results were(top). The amount of ribosomal RNAs in each sample (bot-obtained when mutants lacked the amino-terminal HAtom) reflects the amount of mRNA in each sample.tag (data not shown). Hence, neither of the rhb1 mu-tants analogous to dominant mutants in H-Ras had dom-

mutant, which sequesters exchange factors in nonpro- inant phenotypes in fission yeast.ductive complexes resulting in a dominant-negative pro- To test if rhb1-Q64L, rhb1-S20N, and rhb1-T38M weretein (Boguski and McCormick 1993). The rhb1-T38M functional, we determined whether they complementedmutant is analogous to the H-Ras-T35M mutant, which the rhb12 allele. For this purpose, rhb1 mutant expres-fails to bind downstream effectors and is, therefore, sion plasmids were transformed into rhb11/rhb12 dip-nonfunctional (Stang et al. 1997). Each of these rhb1 loids, diploids were induced to sporulate, and sporesmutants was expressed using a thiamine-repressible pro- were germinated on plates that selected for the plasmidmoter and contained an amino-terminal HA tag. Al- and the rhb12 allele. This analysis revealed that rhb1-though these mutants were efficiently expressed (Figure Q64L, but not rhb1-S20N and rhb1-T38M, complemented

the rhb12 allele (Table 2). Therefore, Rhb1-Q64L isfunctional while Rhb1-S20N and Rhb1-T38M are notfunctional.

rhb12 mutants arrest growth with a phenotype similarto nitrogen-starved cells: Since rhb1 is an essential gene,we constructed a conditional rhb1 allele to more easilycharacterize the rhb12 phenotype. We first tested condi-tional expression of rhb1 in rhb12 mutants using thethiamine-repressible nmt1 promoter and its attenuatedderivatives (Basi et al. 1993; Forsburg 1993). This analy-sis showed that rhb1 expressed from a plasmid comple-mented the rhb12 allele even when the weakest nmt11

promoter was repressed (Figure 5A). We then testedrhb1 mutants analogous to mutants in other Ras-family

Figure 3.—rhb1 is essential for growth. (A) Partial restric-tion enzyme map of the rhb1 (top) and rhb12 (bottom) geno-mic loci. Restriction enzymes: K, KpnI; RV, EcoRV; C, ClaI; X,XhoI. Line, 500 bp. (B) Southern blot of DNA from rhb11 andrhb11/rhb12 diploids digested with ClaI and probed with theClaI-KpnI fragment indicated by the line in A. (C) Growth ofspores from rhb11/rhb12 diploids. The four spores from asingle tetrad are contained within each vertical column.


TABLE 2

Analysis of rhb1 mutants

Analogous H-Ras mutant rhb1 mutant rhb12

rhb1 allele H-Ras allele phenotype phenotype complementation

1 1 2 None 1Q64L Q61L Constitutively active None 1S20N S17N Dominant negative None 2T38M T35M Nonfunctional None 2

rhb11 or the indicated rhb1 mutants in pREP3XHA were grown in rhb11 cells (KGY246) in media withoutthiamine to induce expression and cells were examined over a several-day period. None indicates that cellsoverexpressing these mutants were indistinguishable from control cells. rhb11 or the indicated rhb1 mutantsin pREP3XHA were grown in rhb11/rhb12 diploids (KM249), diploids were induced to sporulate, and sporeswere germinated on media that selected for the plasmid and rhb12 allele. 1, complementation, where cellswere indistinguishable from control cells; 2, viable haploid cells were not recovered.

GTPases that had conditional phenotypes. One of these trogen, a direct comparison of nitrogen-starved cellswas performed. This analysis showed that rhb11 cellsmutants, rhb1-D121A, was analogous to S. cerevisiae tem1-3,

a temperature-sensitive allele (Shirayama et al. 1994). starved for nitrogen were morphologically indistinguish-able from terminally arrested rhb1-D121A mutants (Fig-Although rhb1-D121A mutants were not temperature

sensitive for growth (data not shown), repression of ure 5C).Wild-type cells starved of nitrogen enter stationarythe attenuated nmt1 promoter expressing Rhb1-D121A

caused cells to arrest growth (Figure 5A). Like Rhb1, phase with a 1N DNA content while cells starved forcarbon enter stationary phase with a 2N DNA contentexpression of Rhb1-D121A at high levels in rhb11 and

rhb12 cells caused no detectable phenotype, showing (Costello et al 1986; Su et al. 1996). Flow cytometricanalysis was used to measure the DNA content of rhb1-that rhb1-D121A had no dominant phenotypes (data not

shown). On the basis of the lack of dominant pheno- D121A mutants as they arrested growth. This analysisrevealed that the fraction of cells with 1N DNA contenttypes and the similarity of the terminal phenotype of

rhb12 and rhb1-D121A mutants, we conclude that rhb1- increased as Rhb1-D121A was depleted, eventuallyreaching a level similar to that of nitrogen-starved cellsD121A is a hypomorphic allele.

We used the conditional expression of rhb1-D121A in (Figure 5D). Hence, the morphology and DNA contentof rhb1-D121A mutants were similar to that of cellsrhb12 mutants, which we shall refer to as rhb1-D121A

mutants, to further characterize the rhb12 phenotype. starved for nitrogen and differed from that of cellsstarved for carbon.When actively growing rhb1-D121A mutants were shifted

to media that repressed rhb1-D121A expression, cells Nitrogen-starved cells induced fnx1 and mei2 mRNA(Wantanabe et al. 1988; Dimitrov and Sazer 1998).completed about two doublings (6 hr) before cell divi-

sion arrested (Figure 5B). Similar growth curves were To test if rhb1-D121A mutants also induced fnx1 andmei2 mRNA, we prepared total RNA from cells that wereobserved with cultures at starting densities from 0.5 to

3.5 3 106 cells/ml (data not shown). However, growth repressed for rhb1-D121A expression and measuredthese mRNA levels by Northern blotting. This analysisarrest occurred sooner (4.5 hr) when rhb1-D121A was

repressed in media with a poor nitrogen source (Figure revealed that fnx1 mRNA was indeed increased whenrhb1-D121A was repressed (Figure 5E). Peak levels oc-5B), indicating that rhb1-D121A mutants were hypersen-

sitive to nitrogen deprivation. While terminally arrested curred 4.5 hr after rhb1-D121A was repressed at the timejust before cell growth ceased. Quantitation of fnx1rhb1-D121A mutants remained viable, as judged by

phase-contrast microscopy, phloxine B staining, and vi- mRNA levels showed a maximal increase of fourfoldrelative to actively growing rhb11 or rhb1-D121A cells.tal dye staining (data not shown), rhb1-D121A mutants

did not resume growth when the thiamine was removed For comparison, fnx1 mRNA was induced sevenfoldwhen wild-type cells were starved for nitrogen (Dimi-from the media. Potential reasons for the irreversibility

of the rhb1-D121A arrest will be discussed later. trov and Sazer 1998). The expression of mei2 mRNAwas also induced as rhb1-D121A was repressed (FigureThe terminally arrested rhb1-D121A mutant cells were

stained with 49,6-diamidino-2-phenylindole (DAPI) and 5E). In the case of mei2 mRNA, a ninefold increase inmei2 mRNA levels was observed 8 hr after rhb1-D121ACalcofluor to visualize DNA and septal material. This

analysis showed that rhb1-D121A mutants arrested as was repressed at which time cell growth had stopped.In conclusion, rhb1-D121A mutants exhibit several fea-small, round cells without detectable defects in karyoki-

nesis or cytokinesis (Figure 5C). Since the terminal phe- tures of nitrogen-starved cells. In particular, terminallyarrested rhb1-D121A mutants stopped cell growth andnotype of these mutants resembled cells starved for ni-


division as small, round cells with a 1N DNA content In particular, cgs12 mutants fail to arrest growth prop-erly in response to nutrient deprivation leading to elon-and increased expression of two mRNAs that were in-

duced in rhb11 cells starved for nitrogen. gated cells with decreased viability upon starvation(DeVoti et al. 1991). To look for genetic interactionsRas1 and Rhb1 do not perform overlapping func-

tions: Since mammalian Rheb binds Raf-1, a Ras ef- between the cAMP pathway and Rhb1, rhb1-D121A cyr12

fector, and may influence Raf-1 function, several genetic and rhb1-D121A cgs12 double mutants were constructedexperiments were conducted to test for interactions be- and analyzed. rhb1-D121A cyr12 mutants resembled cyr12

tween Rhb1 and Ras1. We first tested for cross-suppres- mutants in that they grew slower than wild-type cellssion of mutant phenotypes. ras12 mutants cannot conju- (data not shown). When rhb1-D121A was repressed bygate, have reduced sporulation rates, and are round, thiamine addition, cell division and growth ceased andinstead of rod shaped. To determine if Rhb1 could rhb1-D121A cyr12 cells arrested with a morphology thatsuppress any of these defects, Rhb1 and Rhb1-Q64L, a was indistinguishable from rhb1-D121A mutants (datafunctional and potentially activated mutant, were over- not shown). The rhb1-D121A cyr12 mutants reproduciblyexpressed in ras12 mutants. This analysis showed that stopped exponential growth z1 hr before rhb1-D121Aoverexpression of neither Rhb1 nor Rhb1-Q64L af- mutants (Figure 7). In contrast, rhb1-D121A cgs12 mu-fected the morphology, conjugation rate, or sporulation tants were morphologically indistinguishable from rhb1-rate of ras12 mutants (Table 3; data not shown). Control D121A mutants during exponential growth and follow-experiments verified that Ras1 expression comple- ing terminal arrest (data not shown). rhb1-D121A cgs12

mented all the defects of ras12 mutants (Table 3; data mutants reproducibly stopped exponential growth z1not shown). To determine if Ras1 could suppress the hr after rhb1-D121A mutants (Figure 7). Hence, whilelethality of rhb12 mutants, Ras1 and Ras1-V12, an acti- we observed subtle interactions between rhb1-D121A mu-vated mutant, were overexpressed in rhb11/rhb12 dip- tations and cyr12 or cgs12 mutations, we did not observeloids, diploids were induced to sporulate, and spores epistasis, suppression, or dramatic synthetic phenotypeswere germinated on plates where only rhb12 mutants suggesting that Rhb1 functions on a pathway distinctcould grow. This analysis revealed that neither ras1 nor from the cAMP pathway.ras-V17 suppressed the lethality of rhb12 mutants (datanot shown). In contrast, rhb1 expression complementedrhb12 mutants (Figure 5A). We conclude that Ras1 over- DISCUSSIONexpression cannot suppress rhb12 mutant phenotypes

This study investigated the S. pombe rhb1 gene. Theand Rhb1 overexpression cannot suppress ras12 mutantpredicted Rhb1 protein is most similar to Rheb-relatedphenotypes.GTPases that are found in budding yeast, C. elegans,To further test for potential overlapping functionsrats, and humans. The sequence similarity of the Rheb-shared by ras1 and rhb1, we crossed the ras12 mutationrelated proteins, especially at residues analogous tointo the background of the conditional rhb12 mutantsH-Ras codon 12, the effector domain, and CAAX box,and analyzed the phenotype of the resulting doublesuggests that these proteins perform similar cellularmutant. The ras12 rhb1-D121A mutants were round, didfunctions. While C. elegans F54C8.5 protein is more simi-not conjugate, grew at a rate indistinguishable fromlar to the Rheb-related proteins than to other Ras super-ras11rhb11 cells, and arrested growth at a rate (Figurefamily GTPases, this C. elegans protein differs from other6) and with a DNA content that was indistinguishableRheb-related proteins at three amino acids in its effectorfrom rhb1-D121A mutants (data not shown). Hence,domain, suggesting that it may perform unique func-ras12 rhb1-D121A mutants had phenotypes that weretions. rhb1 mRNA was expressed at similar levels in ac-equal to the sum of phenotypes of the correspondingtively growing cells, nitrogen-starved cells, and osmoti-single mutants. The lack of genetic interactions betweencally stressed cells, suggesting that rhb1, unlike theras1 and rhb1 mutations suggests that Ras1 and Rhb1mammalian rheb gene, is not transcriptionally regulated.GTPases perform nonoverlapping functions.

rhb1 is essential for growth since rhb12 spores germi-rhb1-D121A mutants are only slightly affected by muta-nated but arrested growth after 1–3 divisions as small,tions in the cAMP pathway: The cAMP pathway plays arounded cells. The rhb12 terminal phenotype was fur-critical role in the response of fission yeast to changesther analyzed using the conditional expression of rhb1-in extracellular nutrients. For instance, cyr12 mutants,D121A, a hypomorphic mutant. When rhb1-D121A ex-which lack adenylate cyclase activity and consequentlypression was repressed, cells underwent approximatelycAMP, have characteristics of starved cells even whentwo cell divisions before arresting cell growth and divi-grown in plentiful nutrients. In particular, cyr12 mutantssion as small, rounded cells with a 1N DNA content.grow slower than wild-type cells and conjugate in theThe similarity of this terminal phenotype to that ofpresence of excess nutrients (Maeda et al. 1990). Innitrogen-starved cells prompted us to test for other simi-contrast, cgs12 mutants, which lack phosphodiesteraselarities. This analysis showed that rhb1-D121A mutantsactivity and consequently accumulate elevated cAMP,

do not appropriately respond to nutritional deprivation. were hypersensitive to nitrogen levels in the media and


Figure 5.—Analysis of rhb12 mutant phenotypes. (A) rhb1-D121A mutants have a conditional growth phenotype. rhb12 mutants(KM250) containing either p81Xrhb1 [p(rhb11)] or p81Xrhb1-D121A [p(rhb1-D121A)] were grown to saturation and fivefolddilutions of cells were spotted on plates without (2) or with (1) thiamine. (B) rhb1-D121A mutants arrest cell division whenrhb1-D121A expression is repressed. rhb11 cells (KGY246) or rhb12 cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)]were grown in MM or MMGlu, thiamine was added at time zero, and cell number was determined. (C) rhb1-D121A mutantsarrest cell growth with a morphology similar to that of nitrogen-starved cells. Actively growing rhb11 cells (KGY28) were starvedfor nitrogen (minus nitrogen) for 21 hr and cells were visualized with differential interference contrast microscopy (left) orDAPI and Calcofluor (right). rhb12 cells (KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown to midlog phasein MM (induced) and thiamine was added to the medium of some cultures for 21 hr (repressed). Cells were visualized as above.(D) rhb1-D121A mutants arrest cell growth with a DNA content similar to that of nitrogen-starved cells. rhb11 cells (SP870) orrhb12 cells (KM251) with p81Xrhb1-D121A [p(rhb1-D121A)] were grown to midlog phase in MM (left) or MMGlu (right),thiamine was added at time zero, and samples from the indicated times were analyzed for DNA content. The locations of 1Nand 2N DNA content are indicated. (E) rhb1-D121A mutants transcriptionally induce fnx1 and mei2 mRNA. Thiamine was addedto actively growing rhb12 cells (KM251) with p81Xrhb1-D121A at time zero, total RNA was prepared from samples taken at theindicated times in hours, and Northern blots were probed for fnx1, mei2, and cam1, as a loading control.

transcriptionally induced two genes, fnx1 and mei2, that versibility of the rhb1-D121A growth arrest. First, rhb1-D121A mutants might lose viability by lysis or anotherare induced in rhb11 cells that are nitrogen starved.

Our analysis of rbh12 mutants revealed only one differ- lethal event. While this possibility cannot be excluded,microscopic examination of the rhb1-D121A arrestedence between rhb12 cells and nitrogen-starved cells: rhb1-

D121A mutants were terminally arrested while nitrogen- cells provided no evidence of cell lysis or other abnor-malities. Second, rhb1-D121A arrested cells may havestarved cells resumed growth when nitrogen levels were

increased. Several mechanisms could explain the irre- entered an aberrant stationary state. Entry into station-


Figure 5.—Continued.

ary phase in yeast is a complex process (reviewed in On the basis of structural and regulatory similaritiesbetween Ras superfamily GTPases, it is frequently possi-Werner-Washburne et al. 1993) and Rhb1 inactivation

may be only one of multiple signals required for this ble to construct dominant-positive mutants and domi-nant-negative mutants that can help analyze GTPasetransition. Third, Rhb1-D121A may not be adequately

expressed in the terminally arrested cells after thiamine functions. The analogous mutants in rhb1 were, how-ever, uninformative. In particular, neither the potentialis removed from the media. Consistent with this hypoth-

esis, rhb1-D121A spores germinated more slowly than dominant-positive mutant, rhb1-Q64L, nor the potentialdominant-negative mutant, rhb1-S20N, had dominantrhb11 spores, suggesting that Rhb1-D121A levels are lim-

iting for spore germination even when the rhb1-D121A phenotypes when overexpressed. In light of these re-sults, it is interesting that overexpression of the analo-promoter was never repressed (data not shown). Fur-

ther experiments will be needed to differentiate be- gous Rheb mutants also failed to affect the growth ofNIH-3T3 cells (Clark et al. 1997). Further analysis oftween these possibilities.


TABLE 3

Effect of rhb1 mutants on sporulation of ras12 diploids

Plasmid % sporulation

pREP41 0.5pAL-Ras1 60pREP41-Byr2 8.0p3XHArhb1 0.4p3HXArhb1-Q64L 0.5

The indicated plasmids were introduced into ras12 diploids(CA5/CA7), cells were grown on MMGlu plates to stimulatesporulation, and the fraction of asci was determined. At least1000 cells from multiple, independent transformants werecounted for each mutant.

Figure 7.—Mutations in the cAMP pathway only slightlythese rhb1 mutants showed that rhb1-Q64L, but not rhb1- affect the arrest of rhb1-D121A mutants. rhb12 cyr12 cellsS20N and rhb1-T38M, was functional since it comple- (KFY60), rhb12 cgs12 cells (KFY61), or rhb12 cells (KM251)

containing p81Xrhb1-D121A [p(rhb1-D121A)] were grown inmented rhb12 mutants. Once again, similar results wereMM, thiamine was added at time zero, and cell number wasobtained with mammalian Rheb mutants where Rhebdetermined.and Rheb-Q64L, but not Rheb-S20N, antagonized cellu-

lar transformation of NIH-3T3 cells by H-RasV12(Clark et al. 1997). cade. The sporulation of ras12 diploids provides a sensi-

We found no evidence for overlapping functions reg- tive assay for Byr2 activation in vivo (Bauman and Al-ulated by Ras1 and Rhb1. In particular, overexpression bright 1998). Even in this assay, though, there wasof ras1 did not suppress the lethality of rhb12 mutants no evidence that Rhb1 or Rhb1-Q64L stimulated Byr2and overexpression of rhb1 did not suppress the mor- activity.phological or mating defects of ras1null mutants. Further- On the basis of the analysis of rhb12 mutants, wemore, ras12 rhb1-D121A mutants had phenotypes that hypothesize that Rhb1 negatively regulates entry intowould be expected from simply adding the phenotypes stationary phase when extracellular nitrogen levels areof ras12 and rhb1-D121A mutants. We were particularly adequate for growth. An analogous function for mam-interested in shared effectors for Rhb1 and Ras1 since malian Rheb would be consistent with the transcrip-mammalian Rheb and H-Ras both bind Raf-1 (Clark tional induction of rheb mRNA by growth factors andet al. 1997; Yee and Worely 1997). In many ways, the the similarity of Rheb-related GTPases to other Ras su-Byr2 kinase is analogous to Raf-1 since activated Ras perfamily GTPases that regulate cell growth and differ-binds both kinases to cause their translocation to the entiation. If this hypothesized function for Rhb1 is cor-plasma membrane and activation of a MAP-kinase cas- rect, then what pathways might be regulated by Rhb1?

cAMP levels and Spc1 kinase activity are part of twopathways that respond to extracellular nutrients. rhb1mutant phenotypes are not, however, consistent withRhb1 signaling exclusively through the pathways thatregulate cAMP or Spc1. In particular, mutants withoutcAMP continue to grow (Young et al. 1989; Maeda et al.1990) while mutants that hyperactivate Spc1 are large,swollen, and frequently lyse (Millar et al. 1995; Shio-zaki and Russell 1995). Alternatively, Fnx1 expressionor activity might be negatively regulated by Rhb1 sinceFnx1 overexpression caused cells to enter stationaryphase and Fnx1 is likely localized to the plasma mem-brane (Dimitrov and Sazer 1998). However, even ifRhb1 negatively regulates Fnx1, Rhb1 must performother essential functions since fnx12 mutants are viableand can enter stationary phase in some conditions. Our

Figure 6.—rhb1-D121A ras12 mutants arrest growth like inability to identify likely Rhb1-signaling pathways byrhb1-D121A mutants. rhb12 ras12 cells (KM252) or rhb12 cells

comparison to other mutant phenotypes means that(KM251) containing p81Xrhb1-D121A [p(rhb1-D121A)] wereadditional biochemical and genetic approaches will begrown in MM, thiamine was added at time zero, and cell

number was determined. needed to further understand Rhb1 function.


Higgins, D., J. Thompson and T. Gibson, 1996 Using CLUSTAL forWe thank Dr. Kathleen Gould for providing strains and plasmids multiple sequence alignments. Methods Enzymol. 266: 383–402.

used in this study and David McFarland and Melanie Wright for Kunkel, T. A., 1985 Rapid and efficient site-specific mutagenesisassistance with flow cytometric analysis. Experiments were performed without phenotypic selection. Proc. Natl. Acad. Sci. USA 82: 488–

492.in part through the use of the VUMC Cell Imaging Resource (sup-Mach, K. E., Q. Cheng and C. F. Albright, 1998 ras1 and pat1ported by CA68485 and DK20593). This work was supported by Na-

alleles interact to quantitatively and qualitatively alter conjugationtional Institutes of Health grant GM-51952.in fission yeast. Curr. Genet. 34: 172–182.

Maeda, T., T. Mochizuki and M. Yamamoto, 1990 Adenylyl cyclaseis dispensable for vegetative cell growth in the fission yeast Schizo-saccharomyces pombe. Proc. Natl. Acad. Sci. USA 87: 7814–7818.

LITERATURE CITED Masuda, T., K. Kariya, M. Shinkai, T. Okada and T. Kataoka,1995 Protein kinase byr2 is a target of ras1 in the fission yeastAlfa, C., J. Hyams, M. McLeod and E. Warbrik, 1993 ExperimentsSchizosaccharomyces pombe. J. Biol. Chem. 270: 1979–1982.With Fission Yeast: A Laboratory Course Manual. Cold Spring Harbor

Maundrell, K., 1993 Thiamine-repressible expression vectors pREPLaboratory Press, Cold Spring Harbor, NY.and pRIP for fission yeast. Gene 123: 127–130.Ausubel, F., R. Brent, R. Kingston, D. Moore, J. Seidman et al.,

Millar, J. B., A. Buck and M. G. Wilkinson, 1995 Pyp1 and Pyp2(Editors), 1995 Current Protocols in Molecular Biology. John Wi-PTPases dephosphorylate an osmosensing MAP kinase control-ley & Sons, New York.ling cell size at division in fission yeast. Genes Dev. 9: 2117–2130.Basi, G., E. Schmid and K. Maundrell, 1993 TATA box mutations

Mochizuki, N., and M. Yamamoto, 1992 Reduction in the intracel-in the Schizosaccharomyces pombe nmt1 promoter affect transcriptionlular cAMP level triggers initiation of sexual development inefficiency but not transcription start point or thiamine repressibil-fission yeast. Mol. Gen. Genet. 233: 17–24.ity. Gene 123: 131–136.

Moores, S., M. Schaber, S. Mosser, E. Rands, M. O’Hara et al.,Bauman, P., and C. Albright, 1998 Functional analysis of domains1991 Sequence dependence of protein isoprenylation. J. Biol.in the Byr2 kinase. Biochimie 80: 621–625.Chem. 266: 14603–14610.Boguski, M. S., and F. McCormick, 1993 Proteins regulating ras

Moreno, S., A. Klar and P. Nurse, 1991 Molecular genetic analysisand its relatives. Nature 366: 643–654.of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:Bos, J., 1997 Ras-like GTPases. Biochim. Biophys. Acta 1333: M19–795–823.M31.

Nadin-Davis, S. A., and A. Nasim, 1988 A gene which encodes aBourne, H. R., D. A. Sanders and F. McCormick, 1990 The GTPase predicted protein kinase can restore some functions of the rassuperfamily: a conserved switch for diverse cell functions. Nature gene in fission yeast. EMBO J. 7: 985–993.348: 125–132. Nadin-Davis, S. A., A. Nasim and D. Beach, 1986 Involvement ofBourne, H., D. Sanders and F. McCormick, 1991 The GTPase ras in sexual differentiation but not in growth control in fission

superfamily: conserved structure and molecular mechanism. Na- yeast. EMBO J. 11: 2963–2971.ture 349: 117–127. Sambrook, J., E. F. Fritsch and T. Maniatis, 1989 Molecular Clon-

Campbell, S. L., R. Khosravi-Far, K. L. Rossman, G. J. Clark and ing: A Laboratory Manual. Cold Spring Harbor Laboratory Press,C. J. Der, 1998 Increasing complexity of Ras signaling. Onco- Cold Spring Harbor, NY.gene 17: 1395–1413. Shiozaki, K., and P. Russell, 1995 Cell-cycle control linked to extra-

Chang, E. C., M. Barr, Y. Wang, V. Jung, H.-P. Xu et al., 1994 Coop- cellular environment by MAP kinase pathway in fission yeast.erative interaction of S. pombe proteins required for mating and Nature 378: 739–743.morphogenesis. Cell 79: 131–141. Shiozaki, K., and P. Russell, 1996 Conjugation, meiosis, and the

Clark, G. J., M. S. Kinch, K. Rogers-Graham, S. M. Sebti, A. D. osmotic stress response are regulated by the Spc1 kinase throughHamilton et al., 1997 The Ras-related protein Rheb is farnesy- Atf1 transcription factor in fission yeast. Genes Dev. 10: 2276–lated and antagonizes Ras signaling and transformation. J. Biol. 2288.Chem. 272: 10608–10615. Shirayama, M., Y. Matsui and A. Toh-e, 1994 The yeast TEM1

Cook, S. J., and F. McCormick, 1993 Inhibition by cAMP of ras- gene, which encodes a GTP-binding protein, is involved in termi-dependent activation of raf. Science 262: 1069–1072. nation of M phase. Mol. Cell. Biol. 14: 7476–7482.

Costello, G., L. Rodgers and D. Beach, 1986 Fission yeast enters Song, K., K. E. Mach, C.-Y. Chen, T. Reynolds and C. F. Albright,the stationary phase G0 from either mitotic G1 or G2. Curr. Genet. 1996 A novel suppressor of ras1 in fission yeast, bry4, is a dosage-11: 119–125. dependent inhibitor of cytokinesis. J. Cell Biol. 133: 1307–1319.

Davey, J., 1998 Fusion of a fission yeast. Yeast 14: 1529–1566. Stang, S., D. Bottorff and J. Stone, 1997 Interaction of activatedDeVoti, J., G. Seydoux, D. Beach and M. McLeod, 1991 Interaction Ras with Raf-1 alone may be sufficient for transformation of rat2

between ran11 protein kinase and cAMP dependent protein cells. Mol. Cell. Biol. 17: 3047–3055.kinase as negative regulators of fission yeast meiosis. EMBO J. Su, S. S. Y., Y. Tanaka, I. Samejima, K. Tanaka and M. Yanagida,10: 3759–3768. 1996 A nitrogen starvation-induced dormant G0 state in fission

Dimitrov, K., and S. Sazer, 1998 The role of fnx1, a fission yeast yeast: the establishment from uncommitted G1 state and its delaymultidrug resistance protein, in the transition of cells to a quies- for return to proliferation. J. Cell Sci. 109: 1347–1357.cent G0 state. Mol. Cell. Biol. 18: 5239–5246. Toda, T., M. Shimanuki and M. Yanagida, 1991 Fission yeast genes

Fantes, P., and P. Nurse, 1977 Control of cell size at division in that confer resistance to staurosporine encode an AP-1-like tran-fission yeast by a growth-modulated size control over nuclear scription factor and a protein kinase related to the mammaliandivision. Exp. Cell Res. 107: 377–386. ERK1/MAP2 and budding yeast FUS3 and KSS1 kinases. Genes

Fisher, D., and P. Nurse, 1996 A single fission yeast mitotic cyclin Dev. 5: 60–73.B p34cdc2 kinase promotes both S-phase and mitosis in the ab- Tu, H., M. Barr, D. Dong and M. Wigler, 1997 Multiple regulatorysence of G1 cyclins. EMBO J. 15: 850–860. domains on the Byr2 protein kinase. Mol. Cell. Biol. 17: 5876–

Forsburg, S., 1993 Comparison of Schizosaccharomyces pombe expres- 5887.sion systems. Nucleic Acids Res. 21: 2955–2956. Van Aelst, L., M. Barr, S. Marcus, A. Polverino and M. Wigler,

Fukui, Y., and M. Yamamoto, 1988 Isolation and characterization of 1993 Complex formation between ras and raf and other proteinSchizosaccharomyces pombe mutants phenotypically similar to ras12. kinases. Proc. Natl. Acad. Sci. USA 90: 6213–6217.Mol. Gen. Genet. 215: 26–31. Wang, Y., H.-P. Xu, M. Riggs, L. Rodgers and M. Wigler, 1991

Fukui, Y., T. Kozasa, Y. Kaziro, T. Takeda and M. Yamamoto, 1986 byr2, a Schizosaccharomyces pombe gene encoding a protein kinaseRole of a ras homolog in the life cycle of Schizosaccharomyces pombe. capable of partial suppression of the ras1 mutant phenotype.Cell 44: 329–336. Mol. Cell. Biol. 11: 3554–3563.

Gromov, P. S., P. Madsen, N. Tomerup and J. E. Celis, 1995 A novel Wantanabe, Y., Y. Iino, K. Furahata, C. Shimoda and M. Yamamoto,approach for expression cloning of small GTPases: identification, 1988 The S. pombe mei2 gene encoding a crucial molecule fortissue distribution and chromosome mapping of the human ho- commitment to meiosis is under the regulation of cAMP. EMBO

J. 7: 761–767.molog of rheb. FEBS Lett. 377: 221–226.


Warshawsky, D., and L. Miller, 1994 Improved method for rapid gene, encodes a novel Ras-related protein. J. Biol. Chem. 269:transformation of intact Schizosaccharomyces pombe cells. Biotech- 16333–16369.niques 16: 798–799. Yee, W. M., and P. F. Worely, 1997 Rheb interacts with Raf-1 and

Werner-Washburne, M., E. Braun, G. Johnston and R. Singer, may function to integrate growth factor- and protein kinase1993 Stationary phase in the yeast Saccharomyces cerevisiae. Micro- A-dependent signals. Mol. Cell. Biol. 17: 921–933.biol. Rev. 57: 383–401. Young, D., M. Riggs, J. Field, A. Vojtek, D. Broek et al., 1989 The

Wu, J., P. Dent, T. Jelinek, A. Wolfman, M. J. Weber et al., 1993 adenylyl cyclase gene from Schizosaccharomyces pombe. Proc. Natl.Inhibition of the EGF-activated MAP kinase signaling pathway by Acad. Sci. USA 86: 7989–7993.adenosine 39,59-monophosphate. Science 262: 1065–1069.

Yamagata, K., L. K. Sanders, W. E. Kaufmann, W. Yee, C. A. Barnes Communicating editor: P. G. Younget al., 1994 rheb, a growth factor and synaptic activity regulated

loss of rhb1, a rheb-related gtpase in fission yeast, causes

Documents