long-lasting antinociceptive effects of green light in ... · receiving green led light (wavelength...

Research Paper

Long-lasting antinociceptive effects of green lightin acute and chronic pain in ratsMohabM. Ibrahima,b,*, Amol Patwardhana,b, Kerry B. Gilbraitha, Aubin Moutalb, Xiaofang Yangb, Lindsey A. Chewb,Tally Largent-Milnesb, T. Philip Malana,b, Todd W. Vanderaha,b, Frank Porrecaa,b, Rajesh Khannab

AbstractTreatments for chronic pain are inadequate, and new options are needed. Nonpharmaceutical approaches are especially attractivewith many potential advantages including safety. Light therapy has been suggested to be beneficial in certain medical conditionssuch as depression, but this approach remains to be explored for modulation of pain. We investigated the effects of light-emittingdiodes (LEDs), in the visible spectrum, on acute sensory thresholds in naive rats as well as in experimental neuropathic pain. Ratsreceiving green LED light (wavelength 525 nm, 8 h/d) showed significantly increased paw withdrawal latency to a noxious thermalstimulus; this antinociceptive effect persisted for 4 days after termination of last exposure without development of tolerance. Noapparent side effects were noted and motor performance was not impaired. Despite LED exposure, opaque contact lensesprevented antinociception. Rats fitted with green contact lenses exposed to room light exhibited antinociception arguing for a role ofthe visual system. Antinociception was not due to stress/anxiety but likely due to increased enkephalins expression in the spinalcord. Naloxone reversed the antinociception, suggesting involvement of central opioid circuits. Rostral ventromedial medullainactivation prevented expression of light-induced antinociception suggesting engagement of descending inhibition. Green LEDexposure also reversed thermal and mechanical hyperalgesia in rats with spinal nerve ligation. Pharmacological and proteomicprofiling of dorsal root ganglion neurons from green LED-exposed rats identified changes in calcium channel activity, includinga decrease in the N-type (CaV2.2) channel, a primary analgesic target. Thus, green LED therapy may represent a novel,nonpharmacological approach for managing pain.

Keywords: Green-light phototherapy, Constellation pharmacology, Calcium imaging, Proteomics, Neuropathic pain, Thermalantinociception, Mechanical allodynia

1. Introduction

In the United States, over 100 million patients suffer from chronicpain.36 On average, 261 to 300 billion dollars are spent annually tomanage pain, and 297 to 336 billion dollars are lost to work non-productivity.36 Additionally, the emotional tax from chronic painhas resulted in life-altering events ranging from shattering familyunity71 to suicide attempts.26,29,32 Options for treatment of acute,postoperative pain, as well as for chronic pain, are limited, andmany drugs are marginally effective22 and often accompanied bysevere side effects.19 Nonpharmacological options for thetreatment of pain would be highly desirable and advantageousin safety, including lack of tolerance, somnolence, addiction,

gastrointestinal disturbances and, perhaps, other factors such asconvenience and cost.

Light therapy has been reported to be useful for multiplemedicalconditions. For example, light therapy, has been used to controldepression,20,25 to increase daytime circadian stimulation, toimprove sleep quality, and mitigate depression in Alzheimerdisease.21 Additionally, bright light improved the mood ofadolescents taking antidepressants compared with those withoutlight therapy.62 Exposing patients to bright light of more than 6000lux significantly improved seasonal affective disorder, a seriouscondition with increased risk of suicidality.20,25 Pain has sensory,cognitive, and affective dimensions.9,59 The emotional state ofpatients significantly influences pain.24 For example, chronicpsychological stress and depression increased pain perceptionin humanswhenpainful and nonpainful heat stimuli were applied totheir forearms.76 A similar response is also reported in rodents. Ina model of social defeat, rats demonstrated enhanced nociceptiveresponse to subcutaneous formalin administration.2 By contrast,elevated emotional status may decrease the perception of pain47;general happiness and laughter therapy significantly decreasedchronic pain scores in elderly patients.79 Similar findings wereobserved in primary care patients who were enrolled in positivepsychological intervention programs, which decreased their de-pression and improved overall functionality, as well as decreasedpain perception.42 It is possible that light therapy may havepsychological effects, possibly arising from physiological changessuch as increased endogenous opioid release, as shown in thisstudy, which affect pain response or its perception.

Sponsorships or competing interests that may be relevant to content are disclosed

at the end of this article.

Departments of a Anesthesiology and, b Pharmacology, College of Medicine,

University of Arizona, Tucson, AZ, USA

*Corresponding author. Address: Department of Anesthesiology, College of

Medicine, University of Arizona, 1501 North Campbell Dr, PO Box 245050, Tucson,

AZ 85724, USA. Tel.: (520) 626-4281; fax: (520) 626-2204. E-mail address:

[email protected] (M. M. Ibrahim).

Supplemental digital content is available for this article. Direct URL citations appear

in the printed text and are provided in the HTML and PDF versions of this article on

the journal’s Web site (www.painjournalonline.com).

PAIN 158 (2017) 347–360

© 2016 International Association for the Study of Pain

http://dx.doi.org/10.1097/j.pain.0000000000000767

February 2017·Volume 158·Number 2 www.painjournalonline.com 347

Copyright � 2017 by the International Association for the Study of Pain. Unauthorized reproduction of this article is prohibited.

mailto:[email protected]

http://www.painjournalonline.com

http://dx.doi.org/10.1097/j.pain.0000000000000767

www.painjournalonline.com

Few studies have investigated possible effects of light therapyon pain. A randomized clinical trial investigated the effect of brightlight exposure in managing nonspecific back pain where patientsreceived light exposure once a week for 3 weeks reduced pain asassessed by the Brief Pain Inventory suggesting an active role forlight in controlling pain.43 Preclinical studies on the possiblemodulation of pain by light therapy have not been reported. Here,we investigated the effect of light in modulation of acutenociception as well as in a model of chronic neuropathic pain.We found that green light produced antinociceptive andantihyperalgesic effects that involved descending, opioid-sensitive inhibition.

2. Methods

2.1. Animals

Pathogen-free, adult, male and female Sprague Dawley (SD) aswell as male Long Evans (LE) rats (weight at testing 250-350 g;Harlan–Sprague–Dawley, Indianapolis, IN) were housed ina climate-controlled room on a 12-hour light/dark cycle andwere allowed to have food and water ad libitum. All procedureswere approved by the University of Arizona Animal Care and UseCommittee and conformed to the guidelines of the NationalInstitutes of Health (publication no. 80–23, 1966) for the use oflaboratory animals. All behavioral experiments were conductedby experimenters blinded to the treatment conditions. Theexperiments were replicated a minimum of 2 times withindependent cohorts of animals.

2.2. Chemicals

All experimental compounds, doses, sources, and catalognumbers are described in Table 1.

2.3. Light-emitting diodes

Visible-spectrum light-emitting diode (LED) flex strips werepurchased from ledsupply.com (Randolph, VT). The specifi-cations of the LEDs were (1) #LS-AC60-6-BL, 472 nmwavelength (ie, blue), 8 W, 120 V, 120˚ beam angle; (2) #LS-AC60-6-GR, 525 nm wavelength (ie, green), 8 W, 120 V, 120˚beam angle; and (3) #LS-AC60-66-WH,white, 9.6W, 120 V, 120˚beam angle. Light-emitting diode strips were affixed to theoutside of clear plastic cages that housed the rats so as to preventthe strips from being chewed. Rats were exposed to the variousLEDs in these cages with full access to food and water in a darkroom devoid of any other source of light. After behavioralassessment, the rats were returned to their cages for additionalLED exposure. At the end of daily testing, the rats were returnedto their regular animal room where they were exposed to room

light (regular florescent bulbs). A lux meter (Tondaj LX1010B) wasused to determine the illuminance and luminous emittance of theLED strips.

Because there are no previously published data reporting theeffects of green LEDs on antinociception in rats, as a first step, weperformed “pilot” experiments using a fixed amount (330 lux—which represents 1 full “strip”) of green LEDs over time, notingthat antinociception developed only after 3 to 5 hours of exposurefor at least 3 days. This antinociception continued to graduallyincrease over the next 2 days of exposure, reaching its zenithbetween days 4 and 5 (data not shown). The bulk of the studieswere thus performedwith 8 hours daily exposure for 5 days. Next,we performed a light-intensity vs antinociception analysis, whichrevealed that lower lux intensity wasmore effective than higher luxexposure for 8 hours daily for 5 days. These pilot experimentsformed the basis of the exposure paradigm used in thesestudies—lux level, number of hours of exposure per day, andnumber of days of exposure.

2.4. Thermal sensory thresholds

Paw withdrawal latencies (PWLs) used were determined asdescribed by Hargreaves et al.28 Rats were acclimated withinPlexiglas enclosures on a clear glass plate maintained at 30˚C. Aradiant heat source (high-intensity projector lamp) was focusedonto the plantar surface of the hind paw. When the paw waswithdrawn, a motion detector halted the stimulus and a timer. Amaximal cut-off of 33.5 seconds was used to prevent tissuedamage.

2.5. Tactile thresholds

The assessment of tactile sensory thresholds was determined bymeasuring the withdrawal response to probing the hind paw witha series of calibrated fine (von Frey) filaments. Each filament wasapplied perpendicular to the plantar surface of the paw of ratsheld in suspended wire mesh cages. Withdrawal threshold wasdetermined by sequentially increasing and decreasing thestimulus strength (the “up and down” method), and data wereanalyzed with the nonparametric method of Dixon, as describedby Chaplan et al.,12 and expressed as the mean withdrawalthreshold.

2.6. Elevated plus maze

The elevated plus maze (EPM) consists of 4 elevated (50 cm) arms(50cm longand10cmwide)with2opposingarmscontaining30cmhigh opaque walls. Elevated plus maze testing occurred in a quiettesting roomwith ambient lighting at;500 lux. On the day of testing,the ratswere allowed to acclimate to the testing room for 20minutes.

Table 1

Experimental compounds used in this study.

Experimental compound Vendor Catalog number Target/mechanism of action Dose Route

Naloxone Tocris 0599 Nonselective opioid receptors 20 mg/kg Intraperitoneal (i.p.)

20 mg Intrathecal

Phentolamine Sigma P7547 Beta-adrenergic receptor 3 mg/kg i.p.

Propranolol Sigma P0884 Beta1-/beta2-adrenergic receptor 10 mg/kg subcutaneously

Phenoxybenzamine Sigma B019 Alpha 1-adrenergic receptor 1 mg/kg i.p.

348 M.M. Ibrahim et al.·158 (2017) 347–360 PAIN®


http://ledsupply.com

Each rat was placed in a closed arm, facing the entry platform andcagemates started in the same closed arm. Each rat was allowed 5minutes to explore the EPM and then returned to its home cage.Between animals, the EPM was cleaned thoroughly with Versa-Clean (Fisher Scientific, Waltham, MA). Elevated plus mazeperformance was recorded using an overhead video camera(MHD Sport 2.0 WiFi Action Camera; Walmart.com) for laterquantification. Open- and closed-arm entries were defined as thefront 2 paws entering the arm, and open-arm time began themoment the front paws entered the open arm and ended on exit. Ananxiety index was also calculated; the index combines EPMparameters into one unified ratio with values ranging from 0 to 1,with a higher value indicating increased anxiety.34 The followingequation was used for calculation of the anxiety index:

Anxiety index ¼ 12 ðopen arm time=5 minÞ1ðopen arm entry=total entryÞ:

2.7. Implantation of intrathecal catheters

For intrathecal (i.t.) drug administration, rats were implanted withcatheters as described by Yaksh and Rudy.83 Rats wereanesthetized with isoflurane and placed in a stereotactic device.The occipital muscles were separated from their occipitalinsertions and retracted caudally to expose the cisternalmembrane at the base of the skull. Polyethylene tubing waspassed caudally from the cisterna magna to the level of thelumbar enlargement. Animals were allowed to recover and wereexamined for evidence of neurologic injury. Animals with evidenceof neuromuscular deficits were excluded.

2.8. Fabricating rat contact lenses and imaging ofeyes postmortem

All plastic materials were purchased from Evergreen ScaleModels (Des Plaines, IL). We used the method developed byLevinson et al.,44 with the following modifications. In brief,0.25 mm sheets were cut into 2 cm2 pieces held by forcepsover a 6 mm ball bearing, shaped when malleable with a copperpipe of 9 mm internal diameter and then trimmed into a truncatedhemisphere with iris scissors and sanded with a fine grit andemery cloth to a depth of 3.5 6 0.2 mm and a base diameter of7.06 0.2 mm.We used aWeller 1095-1000W dual temperatureheat gun, instead of the Bunsen burner used by Levinson et al., asa heat source for the fabrication process. The rats whereanesthetized using isoflurane just long enough to place thecontact lens in their eyes and were allowed to recover fromanesthesia. The rats were anesthetized again with isoflurane toremove the contact lens at the end of each 8-hour exposure.

To examine if the contact lens induced any pathological damage,at the endof the experiment, the corneaswere excisedwith the smallrim of the sclera and then fixed for 30 minutes with 4% para-formaldehyde in phosphate-buffered saline as described pre-viously.64 Next, the corneas were transferred to a 30% sucrosesolutionuntil stainingwithEvansblue solution for 1minute. TheEvansblue dye solution was prepared by mixing 1 mL of a commerciallyprepared 0.5% Evans blue sterile aqueous solution with 9 mL ofnormal saline. This yielded a final solution of 0.05% Evans blue, witha pH of 6.75. After staining, the excess dye was removed by gentlypassing the tissue through 2 baths of normal saline solution. Lightmicroscope images of the stained corneas were obtained on anOlympus BX51 microscope with a Hamamatsu C8484 digitalcamera using a 4X UplanFL N, 0.13 numerical aperture, or

a 20X UplanSApo 0.75 numerical aperture objective. Thefreeware image analysis program ImageJ (http://rsb.info.nih.gov/ij/) was used to generate merged images.

2.8.1. Spinal nerve ligation

Nerve ligation injury produces tactile allodynia and thermalhypersensitivity.40 All nerve operations occurred 5 days after i.t.catheter implantation. Rats were anesthetized with 2% isofluranein O2 anesthesia delivered at 2 L/min (total time under anesthesiawas ,60 minutes). The skin over the caudal lumbar region wasincised and the muscles retracted. The L5 and L6 spinal nerveswere exposed, carefully isolated, and tightly ligated with 4-0 silkdistal to the dorsal root ganglion (DRG) without limiting the use ofthe left hind paw of the animal. All animals were allowed 7 days torecover before any behavioral testing. Any animals exhibitingsigns of motor deficiency were euthanized. Sham control ratsunderwent the same operation and handling as the spinal nerveligation (SNL) animals, but without the nerve ligation.

2.8.2. Rostral ventromedial medulla cannulation

Rats received a bilateral guide cannula (26GA, #C235-1.2 mm;Plastics One Inc, Roanoke, VA) directed to the rostral ventromedialmedulla (RVM). The cannula was placed at:211.0 from bregma,27.5 mm from the dura, and 0.6 mm on either side of the midline.Injectionsweremadebyexpelling0.5mL throughan injectioncannulaprotruding1mmbeyond the tip of theguide.Cannulaplacementwasconfirmed with 0.5 mL Evans blue injected into both sides of thecannula, and microscopic examination of medullary sections anddata from rats with misplaced cannula were eliminated from theexperiment. Acute single injections into the RVM were performed byinserting an injector (#C235I-SPC; Plastics One Inc) attached to a 2-mL Hamilton syringe and expelling 0.5 mL at the same coordinates.

2.9. Rotarod

Rats were trained to walk on a rotating rod (10 rev/min; Rotamex4/8 device, Columbus, OH) with a maximal cutoff time of 180seconds. Training was initiated by placing the rats on a rotatingrod and allowing them to walk until they either fell off or 180seconds was reached. This process was repeated 6 times andthe rats were allowed to recover for 24 hours before beginninggreen LED exposure. Before treatment, the rats were run once onamoving rod to establish a baseline value. Assessment consistedof placing the rats on the moving rod and timing them until eitherthey fell off or reached a maximum of 180 seconds.

2.10. Sample preparation for proteomics

The DRG and dorsal horn of the spinal cord from rats exposed toambient light or GLEDs (4 lux, 5 days, 8 hours/day) were isolatedand lysates were prepared by sonication in RIPA buffer (50mMTris-HCl, pH 7.4, 50mM NaCl, 2mM MgCl2, 1% [vol/vol] nonidetP40, 0.5% [mass/vol] sodium deoxycholate, and 0.1% [mass/vol]sodium dodecyl sulfate and protease (Cat#B14002; Biotool) andphosphatase inhibitors (Cat#B15002, Biotool), and BitNuclease(Cat#B16002, Biotool)). Protein concentrations were determinedusing the BCA protein assay (Cat#PI23225, Thermo FisherScientific, San Jose, CA). Proteins were precipitated using 100%ice-cold acetone and centrifuged at 15,000g at 4˚C for 10minutes. The pellets, containing solubilized proteins, wereresuspended in 100 mM Tris pH 5 7.4, 8 M urea (to eliminatecarrying forward any salt contamination) and their protein content



http://Walmart.com

http://rsb.info.nih.gov/ij/

http://rsb.info.nih.gov/ij/


analyzed by mass spectrometry at the Arizona ProteomicsConsortium after trypsin digestion.

2.10.1. Database searching

Tandem mass spectra were extracted. Charge state deconvo-lution and deisotoping were not performed. All tandem massspectrometry (MS/MS) samples were analyzed using Sequest(version 1.3.0.339; Thermo Fisher Scientific, San Jose, CA).Sequest was set up to search RattusNorvegicus_Uni-protKB_2016_0406_cont.fasta assuming the digestion enzymetrypsin. Sequest was searched with a fragment ion masstolerance of 0.80 Da and a parent ion tolerance of 10.0 PPM.Oxidation of methionine and carbamidomethyl of cysteine werespecified in Sequest as variable modifications.

2.10.2 Criteria for protein identification

Scaffold (version 4.5.1; Proteome Software Inc, Portland, OR)was used to validate MS/MS-based peptide and proteinidentifications. Peptide identifications were accepted if theycould be established at greater than 20.0% probability to achievea false discovery rate less than 0.1% by the Scaffold Local falsediscovery rate algorithm. Protein identifications were accepted ifthey could be established at greater than 100.0% probability andcontained at least 5 unique peptides. Protein probabilities wereassigned by the Protein Prophet algorithm.60 Proteins thatcontained similar peptides and could not be differentiated basedonMS/MS analysis alonewere grouped to satisfy the principles ofparsimony. Proteins sharing significant peptide evidence weregrouped into clusters. Proteins were annotated with geneontology terms from gene_association.goa_uniprot.3

2.11. Semiquantitative real-time polymerase chain reaction

Semiquantitative real-time polymerase chain reaction (RT-PCR)was performed as described previously.8,57 After GLED treat-ment or control, rat spinal cords were dissected and the lumbarregion isolated before flash freezing in liquid N2. The cords werekept at 280˚C until analysis. RNA was extracted from tissuesusing Tri reagent (Cat# TR118; MRC, Cincinnati, OH) accordingto the manufacturer’s protocol. Briefly, Tri reagent was added tothe cords before homogenization. The homogenates werecentrifuged at 5000g for 5 minutes at 4˚C to eliminate insolublematerials, then chloroformwas added to the supernatants at 20%(vol/vol). After centrifugation at 12,000g for 15 minutes at 4˚C, theupper, RNA-containing, aqueous fraction was harvested in a newtube and total RNA was subsequently precipitated by addingisopropanol (50%, vol/vol). The precipitates were subjected toa final centrifugation at 20,000g for 10 minutes at 4˚C, and theRNApellets werewashed twicewith 75%ethanol. Finally, purifiedRNA was resuspended in ultrapure water and stored at 220˚Cuntil analysis. To generate cDNA, 2 mg of purified RNA wereretrotranscribed using Maxima Reverse Transcriptase (Cat#EP0743; Thermo Fisher San Jose, CA) according to themanufacturer’s instructions. Quantitative RT-PCR analysis wasperformed using 5X HOT FIREPol Evagreen (Cat# 08-24-00020;Solis Biodyne, Tartu, Estonia) on a CFX connect (Bio-Rad,Hercules, CA) according to the manufacturer’s instructions.Specific primer sequences used are given in Table 2. L27expression was measured as a housekeeping gene to normalizetarget mRNA expression between samples. The relative mRNAlevel for each gene (x) relative to L27 mRNA (internal control) wascalculated using the DDCt method.49

2.12. Data analysis

The statistical significance of differences between mean wasdetermined by parametric analysis of variance followed by posthoc comparisons (Student–Newman–Keuls test) using Graph-Pad Software. Animal numbers required to achieve statisticalpower for each in vivo experiment were determined by G.Power3.1, using post hoc variance estimates from pilot experiments.Pharmacological profiling of sensory neuron data was analyzedusing SigmaPlot 12.5 and compared by z-test. Differences wereconsidered to be significant if P # 0.05. All data were plotted inGraphPad Prism 6.

3. Results

3.1. Antinociceptive effects of green light-emitting diodes

We first determined if various kinds of light conditions affectedresponses to a noxious thermal stimulus in naive rats. Rats wereexposed, for 8 hours, to ambient room light that consisted ofwhite fluorescent lights and ambient sunlight through glasswindows (600 lux), white LEDs (575 lux), or darkness (0 lux), andPWL was measured immediately after termination of illumination.As shown in Figure 1, the PWLs were unchanged across allconditions. By contrast, naive rats exposed to GLEDs (525 nmwavelength; 110 lux) for 8 hours daily for 5 days demonstrateda time-dependent increase in PWL that was significantly higherthan rats exposed to ambient room light. Testing was performedimmediately after termination of GLEDs (Fig. 1). Paw withdrawallatencies were also higher in rats exposed to blue LEDs (472 nmwavelength; 110 lux) but less than in those rats exposed toGLEDs (Fig. 1). The increase in PWLs, elicited by GLED exposure(Fig. 2A), plateaued by the second day and was unchangedthereafter until the fifth day (Fig. 2B). The GLED exposure wasterminated on day 5 and the PWLs were measured onsubsequent days to determine whether the increase in PWLswas transient or long lasting. The increase in PWLs induced byGLED exposure was maintained for 4 days before returning tobaseline (Fig. 2B).

The preceding experiments were conducted with 110 luxGLEDs. However, whether this lux level was sufficient to elicit theantinociceptive behavior is not known. Consequently, we exposed

Table 2

List of primers used for semiquantitative real-time

polymerase chain reaction.

Gene name (rat) Orientation Sequence Reference

PENK Forward CAGCTCTTTGGCTTCATCT 18

Reverse AGAGGCCAATGGAAGTGAGA

POMC Forward AGGACCTCACCACGGAAAG 11

Reverse ACTTCCGGGGATTTTCAGTC

OPRM1 Forward AAATGAAAGGGATTGAAAGCACA 60

Reverse CTCACTGGGTGACCTTCTGAACT

PDYN Forward CTGTCTCCTCCCATCTCTGC 17

Reverse TAGCTGCTCCAGGTGATGTG

PNOC Forward CAGACAGGGAGGACATGGAT

Reverse GGACTGCAAAGTGCAGACAA

L27 Forward ATCGCCAAGCGATCCAAGAT 8,48

Reverse CACAGAGTACCTTGTGGGCA



the rats toGLEDs spanning several lux intensities. Exposing rats for8 hours to 4 lux GLED levels was sufficient for increasing PWLscompared with nonexposed rats (Fig. 3). Similar levels of PWLswere observed with rats exposed to 12, 36, or 110 lux GLED levels(Fig. 3). Exposure of rats to GLED 330 lux level significantlyincreased PWLs compared with baseline ambient light-exposedrats but resulted in only a half-maximal response when comparedwith the other lux conditions (Fig. 3). As the 4-lux GLED exposurefor 8 hours was sufficient for achieving maximal antinociception,we used this lux level for all subsequent experiments.

We also tested if prolonged exposure to GLEDs could elicittolerance to the antinociceptive effect. Rats exposed to GLEDsfor an additional 7 days past the initial 5 days exposure (4 lux, 8 h/

d)—total of 12 days of GLED exposure—did not developtolerance (Fig. 3B). This is in contrast with published data withmorphine where analgesic tolerance can be observed within 3days67 and causes rats to be hyperalgesic within 5 days.82

3.2. Characterization of the role of the visual system in theantinociceptive effects of green light-emitting diodes

We determined whether the mechanism of GLED-inducedantinociception requires direct activation of the visual pathway byfashioning dark, opaque, plastic contact lenses that permitted nolight penetration (confirmed by measuring light intensity). Thesewere fitted onto the rats’ eyes under anesthesia. As a control,transparent clear lenses were also installed onto control rats’ eyes.The application of contact lenses did not alter the baseline PWL.Both groups of rats were then exposed to GLEDs for 8 hours dailyfor 5 days and their PWLsweremonitored. Following this exposureparadigm, rats fitted with the dark, opaque, contact lenses failed todevelop antinociception, whereas rats fitted with clear, trans-parent, contact lenses developed antinociception similar to ratswith no contacts (Fig. 4A). Consistent with the importance of thevisual system in the development of GLED-induced antinocicep-tion, rats fitted for 8 hours with “green” contacts that permit lighttransmission in the green part of the visual spectrum (Fig. 4B),developed antinociception when exposed to room light (Fig. 4C).Importantly, histological analysis of the eyes of the rats at the end ofthe experiments revealed nodamagecaused by either contact lens(data not shown). These results support a role for the visual systemin mediating the GLED-mediated antinociception.

To test if pigmented skin is involved in the antinociceptiveeffects of GLEDs, we selected the pigmented LE rats, which aredifferent from the albino SD rats that lack pigmentation. A similarlevel of antinociception was observed in SD or LE rats exposedto GLEDs for 8 hours daily for 5 days; the PWLs weresignificantly higher than the respective strains exposed toambient light (Fig. 5). The antinociception was not restricted tomale rats as female SD rats exposed to the same GLEDparadigm also exhibited increased PWLs (Fig. 5). Collectively,these results suggest that pigmentation is not important fordeveloping antinociception.

Figure 1. Effect of light-emitting diode (LED) exposure on thermal analgesia innaive rats. After measurement of baseline (BL) paw withdrawal latency (inseconds), rats were randomly assigned (n 5 6 per group) to exposures of8 hours daily for 5 days to dark; ambient room light; or white, green (l 5 525nm), or blue (l 5 472 nm) LEDs. At the end of this exposure paradigm, pawwithdrawal latencies were again measured. Blue and green LED exposuresresulted in thermal analgesia. *P , 0.05 when comparing with white LEDs(1-way analysis of variance followed by Student–Newman–Keuls test) and#P , 0.05 when comparing between green and blue LED exposures(nonparametric Student t test). Unless otherwise stated, the data representmean 6 SEM for all figures in this article.

Figure 2. Green light-emitting diode (GLED)-induced thermal analgesia—time course and duration of effect. (A) Schematic representation of the experimentaldesign, LED exposures, and Hargreaves testing. (B) Bar graph showing the paw withdrawal latency (in seconds) of rats (n5 6 per group) treated as shown in theschematic in A. BL indicates the baseline latency before GLED exposure. Green light-emitting diode exposure resulted in thermal analgesia starting at the secondday (D2) of phototherapy and lasted 4 days after cessation (till D9) of LED exposure. *P, 0.05 when comparing with BL (1-way analysis of variance followed byStudent–Newman–Keuls test).




3.3. Pharmacological characterization of the antinociceptiveeffects of green light-emitting diodes

Themechanisms thatmight underlie the antinociceptive effects ofGLEDs were investigated by determining possible contributionsof endogenous pain transmitters and circuits as well asmediatorsof stress. Naive rats exposed toGLEDs for 8 hours daily for 5 daysreceived antagonists immediately after light termination, and thenPWLs were measured 20 to 30minutes later. The GLED-inducedantinociception was reversed, to baseline levels, after adminis-tration of the mu-opioid receptor (MOR) antagonist naloxone (20mg/kg intraperitoneally [i.p.]). Twenty microgram, i.t., of naloxonealso reversed the antinociception (Fig. 6A). These results suggestthat GLED exposure likely elicits antinociception through releaseof endogenous opioids.

Neurons within the RVM are known to project to the spinal ormedullary dorsal horns to directly or indirectly enhance ordiminish nociceptive traffic.85 We examined the possible contri-bution of the RVM in the GLED-induced antinociceptive responseby microinjection of 2% lidocaine. Rostral ventromedial medulla

lidocaine reversed the development of antinociception when therats were exposed to GLEDs (Fig. 6B).

Although our data, thus far, suggest a role for the endogenousopioid system, it is possible that the exposure conditionsmay resultin stress-induced analgesia that could involve the sympathetic

Figure 3. Green light-emitting diode (GLED)-induced thermal analgesia—effect of level of illuminance—without development of tolerance. (A) Bar graphof pawwithdrawal latency (PWL, in seconds) of rats (n5 6 per group) exposedto the indicated illuminance level of GLED for 8 hours daily for 5 days. BLindicates the baseline latency before GLED exposure. Light-emitting diodeexposure, GLED exposure as low as 4 lux, resulted in thermal analgesia. (B)Bar graph of PWL (in seconds) of rats (n 5 6 per group) exposed to theindicated illuminance level of GLED for 8 hours daily for 5 and 12 days. ThePWLs were not different after 5 days and 12 days of consecutive exposure toGLED. *P, 0.05when comparingwith BL (1-way analysis of variance followedby Student–Newman–Keuls test). #P , 0.05 when comparing with other luxvalues (1-way analysis of variance followed by Student–Newman–Keuls test).n.s., not significant.

Figure 4. Involvement of the visual system in green light-emitting diode (LED)-induced thermal analgesia. (A) Bar graph of paw withdrawal latency (inseconds) of rats (n5 6 per group) before and after treatment with green LEDsas indicated. During the green LED exposure paradigm, the rats were fittedwith clear or dark plastic lenses on their eyes. Blocking green LED absorbanceto the eyes with dark contacts prevented the development of green LED-induced thermal analgesia. (B) Rats “wearing” green plastic eye contacts andexposed to ambient room light for 8 hours daily developed thermal analgesiaon days 3 and 4. *P, 0.05 when comparing with baseline (BL) (1-way analysisof variance followed by Student–Newman–Keuls test). (C) Absorbancespectra, in arbitrary units of clear, dark, or green contacts. Dark contactsabsorbed light in all wavelengths while green contacts showed a peakabsorbance in the 580 to 700-nm range.



nervous system with engagement of alpha- and beta-adrenergicreceptors by norepinephrine or epinephrine.5,10,45,51,74,78 Thus, toelucidate the role of the adrenergic system, several adrenergicreceptors antagonists were tested including phenoxybenzamine(1 mg/kg i.p.), a nonselective irreversible alpha-blocker; phentol-amine (3 mg/kg i.p.), a nonselective reversible alpha-blocker; andpropranolol (10 mg/kg s.c.), a nonselective beta-blocker. All thesedrugs given immediately after light termination and tested 15 to 20minutes afterwards failed to prevent or reverse the antinociceptiveeffect of GLEDs (Fig. 7A). Additionally, rats exposed to GLEDs orambient light were observed to have normal ambulation andhuddling, as well as maintained regular grooming behaviors (data

not shown), which is in contrast with diminished groomingobserved in stressed rats.38

To address the possibility of the antinociception being theresult of anxiety due to overstimulation of the visual system, weperformed EPM experiments. A cohort of rats exposed toGLEDs for 8 hours daily for 5 days developed antinociceptionas before (Fig. 7B), showed no signs of stress/anxiety as therewere no differences in closed- or open-arm entries, or in theanxiety index (Fig. 7C, D); the index combines EPMparameters into one unified ratio with values ranging from0 to 1, with a higher value indicating increased anxiety.34 Infact, rats exposed to GLEDs spent a significantly higheramount of time in the open arms than rats exposed to ambientroom light (Fig. 7E), suggesting that GLED exposure wasanxiolytic. Collectively, these results show that GLED-inducedantinociception is not due to an anxiety-related response inthese rats.

3.4. Exposure to green light-emitting diodes does not impairmotor performance

If, after exposure to GLEDs, the rats had a reducedmotor activity,then this could contribute to the antinociception. To test thispossibility, we investigated if the GLED exposure affected motorperformance using the rotarod assay. After verification ofantinociceptive behaviors induced by exposure to GLEDs for 8hours daily for 5 days exhibited antinociception, we observed nochange in the ability of the rats to stay on a rotating rod (Fig. 8).Thus, repeated GLED exposure does not affect motor perfor-mance or sedation.

3.5. Proteomics reveals green light-emitting diode effects inthe dorsal root ganglion and spinal dorsal horn

We used an unbiased proteomics approach to identify possibleprotein alterations, using liquid chromatography–MS/MS, intissues from ambient vs GLED-exposed rats. Among 559nonredundant proteins identified in our DRG samples (Lumbar

Figure 5.Green light-emitting diode (LED)-induced thermal analgesia does notrely on skin pigmentation and occurs in both genders. Bar graph of pawwithdrawal latency (in seconds) of male and female Sprague Dawley (SD) rats(white fur) and male Long Evans (LE) rats (n 5 6 per group) before and aftertreatment with green LEDs as indicated. All rats developed thermal analgesiacompared with their own baseline. *P , 0.05 when comparing with baseline(1-way analysis of variance followed by Student–Newman–Keuls test).

Figure 6.Green light-emitting diode (LED)-induced thermal analgesia involves activity of the descending pain pathways through endogenous opioid signaling. (A)Bar graph of paw withdrawal latency (in seconds) of rats (n 5 6 per group) before and after treatment with green LEDs as indicated. BL indicates the baselinelatency before green LEDs exposure. Inhibiting mu-opioid receptor (MOR) with naloxone (intraperitoneal [i.p.] or intrathecal [i.t.] administration) (Table 1) reversedgreen LED-induced thermal analgesia. Untreated (No Tx) rats or rats injected i.p. with saline (n5 6 per group) developed green LED-induced thermal analgesia. (B)Inactivation of the descending pathway pain with an injection of a 2% solution of lidocaine into the rostral ventromedial medulla of rats (n5 6 per group) reversedgreen LED-induced thermal analgesia. *P , 0.05 when comparing with BL (1-way analysis of variance followed by Student–Newman–Keuls test).




levels 4, 5, and 6 were pooled), 65 proteins were detected only inDRG from GLED-treated rats (Fig. 9A). Gene ontology termscorresponding to the biological processes (Fig. 9B), molecularfunctions (Fig. 9C), and cellular components (Fig. 9D) of theseproteins identified in DRG were extracted and comparedbetween ambient and GLED-exposed rats. We noted a highernumber of proteins associated with the “response to stimulus”

category and a fewer proteins associated with “growth” categoryin DRG from GLED-exposed rats compared with DRG fromambient room light-exposed rats (Fig. 9B). The molecularfunctions associated with these proteins suggest a decreased“structural molecule activity” and an increased “antioxidantactivity” in DRG from rats with GLED-induced thermal analgesiacompared with controls (Fig. 9C). Finally, fewer proteins fromGLED DRG appear to be localized in “organelle part” and“membrane” (Fig. 9D).

A total of 430 nonredundant proteins were identified in dorsalhorn tissues, of which 43 were found only in the samples fromrats with GLED-induced thermal analgesia (Fig. 9E). Weobserved a higher number of proteins associated with “meta-bolic process” and “cellular process” categories in the dorsalhorn from GLED-exposed rats compared with the dorsal hornfrom ambient room light-exposed rats (Fig. 9F). The molecularfunctions associated with these proteins suggest a decreased“transporter activity” and an increased “binding” functions in thedorsal horn from rats with GLED-induced thermal analgesiacompared with controls (Fig. 9G). Finally, more proteins wereobserved to be in “cytoskeleton” and “intracellular organelles,”whereas fewer proteins noted in “membrane,” “plasma mem-brane,” and “organelle membrane” in the dorsal horn fromGLED-exposed rats compared with the dorsal horn fromambient room light-exposed rats (Fig. 9H). Thus, fewer proteinsare localized in membranes in the dorsal horn, which iscorrelated, with fewer proteins implicated in localization pro-cesses in DRG.

Figure 7.Green light-emitting diode (LED)-induced thermal analgesia does not invoke a stress/anxiety response. (A) Bar graph of pawwithdrawal latency (PWL) (inseconds) of rats (n5 6 per group) before and after treatment with green LEDs as indicated. BL indicates the baseline latency before green LED exposure. Inhibitingthe alpha- (with phenoxybenzamine or phentolamine) or beta- (with propranolol) adrenergic receptors (Table 1) failed to reverse green LED-induced thermalanalgesia. (B) After verification that green LED exposure (8 hours X 5D) induces analgesia (B), rats were subjected to the elevated plus maze (EPM) test. (C) GreenLED exposure did not change the number of times the rats entered the open or closed arms in the EPM. (D) The anxiety index, an integrated measure of times andentries into the arms of the EPM, was not different between rats at BL and after exposure to the green LED paradigm. (E) The green LED-exposed rats spentsignificantly more time in the open arms, indicating that green LED exposure was anxiolytic. *P , 0.05 when comparing with BL (1-way analysis of variancefollowed by Student–Newman–Keuls test). ns, not significant.

Figure 8. Motor function is not affected by green light-emitting diode (LED)treatment. Bar graph of latency of rats (n5 6 per group) to fall off the rotarod atincremental speed. Thermal analgesia induced by green LED exposure did notimpair motoric performance as there were no differences between the fall-offlatencies between these and rats exposed to ambient room light. P . 0.05when comparing between the 2 conditions (paired Student t test).



3.6. Analgesic effects of green light-emitting diode exposurein neuropathic pain

Having determined thatGLEDsare antinociceptive in naive animals,we next asked if this nonpharmacological paradigm could beeffective in reversing allodynia and hyperalgesia associated with theSNL model of experimental neuropathic pain. Probing the plantarsurface of the hind paw ipsilateral to the side of nerve injury in SNLrats, 7 days postinjury, revealed thermal hyperalgesia (Fig. 10A) andtactile allodynia (Fig. 10B). Exposing SNL-injured rats for 8 hoursdaily to 4 lux GLED levels resulted in complete reversal of thermalhyperalgesia; the latencieswere significantly higher than baseline soas to be antinociceptive (Fig. 10A). Pawwithdrawal thresholdswerealso maximally reversed by a 3-day exposure to GLEDs (Fig. 10B).To address the duration of the GLED effect in SNL rats, weterminated GLED exposure and continued to measure antihyper-algesic and antiallodynic behaviors. After termination of GLEDs, ittook 10 days for the thermal latencies (Fig. 10C) and 4 days formechanical thresholds to return to postsurgical values (Fig. 10D).

Using quantitative RT-PCR, we determined expression levels ofmRNAs for various endogenous opioids in spinal cords of naiverats as well as rats with SNL or sham in the presence of GLEDexposure. Expression of the following genes was measured: (1)prepronociceptin (PNOC) coding for nocistatin, nociceptin, andorphanin17; (2) pro-opiomelanocortin (POMC) coding for N-terminal peptide of proopiomelanocortin (NPP), melanotropingamma, corticotropin, melanotropin alpha, lipotropin beta, lipo-tropin gamma, melanotropin beta, beta-endorphin, and met-enkephalin11; (3) proenkephalin-A (PENK) coding for synenkepha-lin, met-enkephalin (4 copies), met-enkephalin-arg-gly-leu, met-enkephalin-arg-phe, and leu-enkephalin18; (4) proenkephalin-B(PDYN) coding for alpha-neoendorphin, beta-neoendorphin, andleu-enkephalin (3 copies), big dynorphin, dynorphin A (1-17),dynorphin A (1-13), dynorphin A (1-8), leumorphin, and rimor-phin17; and (5) mu-type opioid receptor (OPRM1) coding forprepronociceptin and pro-opiomelanocortin.61 These analysesdemonstrate that expression of PENK gene, but not others, is

Figure 9. Comparative proteomic analysis of the dorsal root ganglia and dorsal horn of the spinal cord from rats exposed to ambient or green light-emitting diode(LED) using 1-dimensional liquid chromatography electrospray ionization–tandemmass spectrometry. Venn diagram of the identified proteins in control and greenLED-exposed rat dorsal root ganglia (A) and dorsal horn of the spinal cord (E). Biological process (B and F), molecular function (C andG), and cellular component (DandH) were analyzed using the Proteome software scaffold. The numbers indicate the percent of proteins detected in the proteomic study that are clustered in theannotated groups from naive (black) or green LED-exposed rats (green).




significantly increased after GLED exposure (Fig. 10E), suggestingthat the increased enkephalin levels in the spinal cord of GLED-exposed rats could be one contributing factor for their analgesia.

4. Discussion

We characterized the antinociceptive and antihyperalgesic effectsof GLED phototherapy. In naive rats, the antinociceptive effect ofGLEDs involves (1) visual system, (2) mu-opioid receptor pathwaysand descending pain inhibitory pathways from the RVM, (3)increased spinal cord expression of enkephalins, and (4) alterationsin spinal cord and nociceptor proteomes. We were unable to link

GLED-mediated antinociception to stress/anxiety.WedemonstrateGLED phototherapy’s ability to reverse reduced sensory thresholdsin a model of neuropathic pain, supporting its use as a possiblenovel, nonpharmacological approach in managing chronic pain.

A key issue in interpreting photically induced antinociception isdelineating the route of entry of light and its possible relationshipwith pain modulatory circuits. Here, whole-body illumination withGLEDs for 8 hours resulted in antinociception. By contrast,previous studies reported reversal of pain in mice after 30 to 150seconds of infrared LED exposure directly touching the skin.15,16

The differences in exposure times (seconds vs hours) and “routesof administration” with either direct skin exposure or whole-body

Figure 10. Exposure to green light-emitting diode (LED) reverses thermal hyperalgesia and mechanical allodynia induced in a model of neuropathic pain. (A) Sevendays after a spinal nerve ligation (SNL) surgery on their left hind paw, rats (n5 6 per group for all groups throughout this figure) displayed a significant decrease in theirpaw withdrawal latencies (in seconds), which was completely reversed by daily 8 hours of exposure to green LEDs (4 lux). #P, 0.05 when comparing with baseline(BL), *P, 0.05 when comparing with BL or SNL (1-way analysis of variance followed by Student–Newman–Keuls test). (B) Bar graph of paw withdrawal thresholds(PWTs, in grams) of rats after receiving an SNL injury and after green LED exposure for 3 days (4 lux, 8 hours per day). BL indicates the baseline PWT before green LEDexposure. Pawwithdrawal thresholdswere completely reversed after 3 days of green LEDexposure comparedwith postsurgery (post-Sx) levels. #P, 0.05comparedwith BL (1-way analysis of variance followed by Student–Newman–Keuls test). Time course of return to BL for pawwithdrawal latencies (C) and PWTs (D). Some errorbars are smaller than the bars. (E) Quantitative real-time polymerase chain reaction for the indicated genes from the spinal cords of naive rats as well rats with SNL1green LEDs or Sham1 green LEDs. ThemRNA levels for each genewere normalized to L27mRNA (a ribosomal internal control gene). The L27-normalized values foreach conditionwere divided by the L27-normalized values for naive and are expressed as fold change over naive levels. Data represent mean fold change6SEM (n53 for each). A robust upregulation of PENK mRNA was observed in SNL 1 green LEDs or Sham 1 green LED condition (*, P , 0.05, Student t test vs control).



illumination could result in engagement of different mechanisms.Additionally, lower-intensity GLEDs was more antinociceptive.These results are consistent with a recent study,63 which reportedthat low-intensity green light reduced the intensity of migraines by;15% compared with lights of other colors and higher intensities.

Blocking GLED access to the eyes prevented antinociception,arguing for an important role by the visual system in thedevelopment of antinociception. Our data point to a role for thevisual system in the antinociceptive and antiallodynic effects ofGLEDs. However, exactly how this occurs is unknown. Electricalstimulation of the optic nerves in rats has been reported toincrease blood pressure and heart rate, and to decreasebaroreceptor-mediated vagal bradycardia. This effect was largelyattenuated by inactivation of the periaqueductal grey (PAG), ananatomical region known to modulate pain,33,54 suggestingmechanistic neural links between the optic nerve and the PAG.13

Light-sensitive melanopsin-containing ganglion cells in theeyes69 project directly to the circadian rhythm controlling supra-chiasmatic nucleus31,80 and PAG30; these structures are con-nected.41 Importantly, the suprachiasmatic nucleus has beenlinkedwith pain as inferred fromdisruption of the circadian rhythmof thermoregulation in models of chronic inflammatory pain inrats75 and increased c-fos levels in rats with cystitis pain.6 Finally,a retrograde labeling of the PAG demonstrated glutamate-likeimmunoreactivity in several regions of the brain including theoccipital cortices,4 further supporting a link between the visualsystem and pain response. Martenson et al.52 have recentlyidentified a possible circuitry for photic stimulation that includedpain-modulating “ON-cells” and “OFF-cells” in the RVM whichproject to the dorsal horn of the spinal cord where theyare postulated to modulate somatosensory processing. An

imbalance of these may lead to enhanced or diminished painwith ON-cells facilitating nociception and OFF-cells inhibitingnociception. Our studies support a role for the RVM as itschemical inactivation prevented GLED-induced antinociception.

We demonstrated that GLED-induced antinociception involvesopioid receptors. However, whether this occurs through a periph-eral or central mechanism of action is at present unknown.Suppression of GLED-induced antinociception with the opioidreceptor antagonist naloxone, administered systemically, maysupport a role of peripheral opioid receptors, which is consistentwith previous reports demonstrating that administration ofnaloxone prevents infrared spectrum therapy–induced antinoci-ception in models of postoperative16 or inflammatory pain.53

However, the ability of naloxone given i.t. to reverse theantinociception effect argues in favor of a central site of action forthe GLEDs since this dose and volume would not be expected tohave a significant effect if the site of action was in the periphery. It isconceivable that GLEDs may have both central and peripheraleffects. Future studies will explore these possibilities.

Although overstimulation of the visual system could causestress-induced antinociception, our data suggest that GLED-induced antinociception is not linked to stress/anxiety for severalreasons. First, pharmacological antagonism of receptors impli-cated in stress did not affect antinociception. Second, behavioralstudies did not link GLED-induced antinociception to anxiety inthe EPM experiments. Finally, grooming behaviors of rats withGLED exposures were unaffected, thus implying no link to stress.Future studies will assess neurochemical correlates of stress (eg,glucocorticoids) in GLED antinociception.

Sensory neuronal adaptations, due to possible changes inactivities of voltage-gated calcium and/or sodium channels, may

Table 3

Proteins enriched in tissues from rats exposed to green light-emitting diodes.

Identified proteins Gene name Accession number* % Sequence coverage Pain implication

Dorsal root ganglia

Carboxypeptidase ctsa Q6AYS3_RAT 12 Enkephalin degradation14

Alpha-synuclein snca SYUA_RAT 46 Expressed in laminae I, II, VII, and X of the dorsal horn81

Microtubule-associated protein mapt F1LST4_RAT 19 Lost in neuropathic pain39

Thioredoxin txn THIO_RAT 54 Improves ziconotide-induced analgesia.84 Expression is

changed after surgery23

Stathmin stmn1 STMN1_RAT 37 Substrate for Cdk571

Acid ceramidase asah1 A0A0G2K8T0_RAT 28 Inactivating mutation in Farber disease (patients experience

pain)7,86

Haptoglobin hp A0A0H2UHM3_RAT 18 Serum concentration decreased in abdominal pain in

horses67

Cofilin 2 cfl2 M0RC65_RAT 46 Phosphorylation is associated with hyperalgesia46,87

Calretinin calb2 CALB2_RAT 21 Protects against TRPV1-mediated toxicity in pain-sensing

neurons65

Lactoylglutathione lyase glo1 LGUL_RAT 45 Expression reduced in diabetic neuropathy.37 Catalyses the

detoxification of methylglyoxal, a positive regulator of

TRPA1, upregulated during painful neuropathy1

Dorsal horn of the spinal cord

Lactoylglutathione lyase glo1 LGUL_RAT 54 Expression reduced in diabetic neuropathy.37 Catalyses the

detoxification of methylglyoxal, a positive regulator of

TRPA1, upregulated during painful neuropathy1

Purine nucleoside phosphorylase pnp PNPH_RAT 25 Catalyses the breakdown of adenosine into inosine, which

induces antinociception in the formalin test58

Aspartyl aminopeptidase dnpep Q4V8H5_RAT 17 Catalyses angiotensin III synthesis which activates inhibitory

pain descending pathways from the periaqueductal grey

matter66

Cathepsin B ctsb Q6IN22_RAT 22 Expressed in microglia during inflammatory pain77

Alpha glucosidase 2 alpha neutral subunit ganab D3ZAN3_RAT 14 Deficiency causes Pompe disease with increased mild

pain27

* Accession number is from Universal Protein Resource (UniProt).




help explain the molecular mechanisms underlying GLED-inducedantinociception. N-type voltage-gated calcium channels (CaV2.2)are key for antinociception.73 The overall functional competence ofneurons for calcium influx, as assessed by their ability to respond toagonists of various receptors using a high-throughput calciumimaging platform,56 was not different between sensory neuronsfrom rats exposed to ambient light orGLEDs (Supplementary Fig. 1,available online at http://links.lww.com/PAIN/A358). However, weobserved a decrease in depolarization-inducedCa21 influx throughCaV2.2 in sensory neurons from GLED-exposed rats (Supplemen-tary Fig. 1E, http://links.lww.com/PAIN/A358). No changes wereobserved in sodium channels (Supplementary Fig. 2, availableonline at http://links.lww.com/PAIN/A358) ruling out their involve-ment in neuronal adaptations and GLED-induced analgesia. It ispossible that the prolonged antinociceptive effect of GLEDsmay, inpart, be attributed to long-term changes in CaV2.2 or other calciumchannel subtypes. Further studieswill investigate the role of calciumand other channels in mediating the long-lasting effect of GLEDs.

Unbiased proteomics identified a protein signature in the dorsalroot ganglia and dorsal horn of GLED-exposed antinociceptiverats. Stratification of proteins based on gene ontology termscorresponding to biological processes, molecular functions, andcellular components revealed an enrichment of proteins related toantioxidant activity in ganglia of GLED-exposed rats, a findingconsistent with reported reduction in antioxidant activities (eg,catalase and superoxide dismutase) in rats with inflammatorypain.53 Additionally, low-level light therapy reduces levels ofinflammatory mediators (eg, interleukins 6 and 8) associated withintervertebral disc degeneration, a key cause of low back pain.35

We noted a reduction in the number of membrane-localizedproteins in the dorsal horn of GLED-exposed rats, whichlikely correlates with decreased signaling capabilities of neurons.Our findings uncovered proteins enriched in tissues fromGLED-exposed rats that are reportedly linked to antinociception(Table 3). For example, purine nucleoside phosphorylase breaksdown adenosine into inosine, which has antinociceptive propertiesthrough actions on the adenosine A1 receptor58 and throughpertussis toxin–sensitive G protein–coupled receptors andthe subsequent inactivation of calcium channels.50 Aspartylaminopeptidase, which converts angiotensin II to angiotensin III,is reported to activate inhibitory pain-descending pathways fromthe PAG.66 Our findings of chemical inactivation of the RVMfurther support a role of inhibitory pain-descending pathways inGLED-mediated antinociception. Another example is lactoylgluta-thione lyase (ie, glyoxalase-1), which catalyzes the detoxification ofmethylglyoxal, a cytotoxic ketoaldehyde, which is directly linked toactivating nociceptors.1 Moreover, expression of glyoxalase-1 isreduced in diabetic neuropathy.37 These lines of evidence, alongwith those listed in Table 3, build a picture consistent with globalchanges induced by GLEDs to produce antinociception.

Weused amodel of neuropathic pain to illustrate the possible useof GLEDs as a nonpharmacological treatment. Spinal nerve ligationis a commonly used model of neuropathic pain in rats.40 Commonneuropathic pain medications reverse hypersensitivity associatedwith neuropathic conditions, but do not usually produce antinoci-ception. For example, gabapentin blocks the N-type calciumchannel48 to reverse tactile allodynia and thermal hyperalgesia indiabetic neuropathy; however, it failed to produce antinociception.70

Carbamazepine, an antiepileptic medication used for neuropathicpain, blocks sodiumchannels to reverse thermal hyperalgesia in tail-flick test in a model of cisplatin-induced hyperalgesia, but fails toproduce antinociception.55 By contrast, GLEDs reversed tactile andthermal hypersensitivity associated with SNL and produced long-lasting antinociception. We observed that GLEDs decreased

calcium influx through the N-type calcium channel (supplementaryFig. 1F, http://links.lww.com/PAIN/A358), which may account forboth the antiallodynic and antihyperalgesic effects; however, theexact mechanisms contributing to the long-lasting nature of theeffect is presently unknown. We also observed that GLEDs activateopioid receptors, which may account for antiallodynia, antihyper-algesia, and antinociception. The complete reversal of the effects ofGLEDsusing naloxone also argues for a key role for opioid receptorsin producing antiallodynia, antihyperalgesia, and antinociception. Itis conceivable that multiple mechanisms of actions may actsynergistically to produce the effects seen with GLEDs. In contrastwith the side effects observed with opioids, an advantage of theGLED approach is lack of side effects, such as development oftolerance, sedation, respiratory depression, and motor coordina-tion. Equally important was the lack of hyperalgesia after prolongedGLED exposure. The lack of these side effects suggests that usingGLEDs may be a safe treatment for neuropathic and other painstates, and may also complement the use of pain medications.

Our findings identify the cellular and molecular basis of GLED-mediated antinociception. From a translational perspective, thediscovery that GLED exposure is antinociceptive and antiallodynic,opens up routes for the development of a noninvasive therapeuticapproach to pain. Consequently, modulating the duration andintensity of GLEDsmay prove useful, clinically, for reducing opioid inpain management. Additionally, the long-lasting and nontolerance-inducing effects of GLEDs may improve patient compliance.

Conflict of interest statement

The authors have no conflicts of interest to declare.

Acknowledgements

The authors thank Dr Chris Atcherley for helpwith determining theabsorbance properties of the fabricated lenses andMollyM. Ryanfor assistance with analysis of proteomics data.M. M. Ibrahim and A. Patwardhan are co-first authors. M. M.Ibrahim and R. Khanna contributed equally. F. Porreca andR. Khanna are co-senior authors.This work was supported, in part, by a Career DevelopmentAward from the University of Arizona Health Sciences (to A.Patwardhan), and a Children’s Tumor Foundation NF1 Synodosgrant (to R. Khanna), and start-up seed funds (to M. M. Ibrahimand R. Khanna). A. Moutal was partially supported by a YoungInvestigator Award from the Children’s Tumor Foundation.

Appendix A. Supplemental Digital Content

Supplemental Digital Content associated with this article can befound online at http://links.lww.com/PAIN/A358.

Supplemental media

Video content associated with this article can be found online athttp://links.lww.com/PAIN/A385

Article history:Received 27 May 2016Received in revised form 24 October 2016Accepted 26 October 2016Available online 19 November 2016

References

[1] Andersson DA, Gentry C, Light E, Vastani N, Vallortigara J, Bierhaus A,Fleming T, Bevan S. Methylglyoxal evokes pain by stimulating TRPA1.PLoS One 2013;8:e77986.



http://links.lww.com/PAIN/A358






[2] Andre J, Zeau B, Pohl M, Cesselin F, Benoliel JJ, Becker C.Involvement of cholecystokininergic systems in anxiety-inducedhyperalgesia in male rats: behavioral and biochemical studies.J Neurosci 2005;25:7896–904.

[3] Ashburner M,Ball CA,Blake JA,Botstein D,Butler H,Cherry JM,Davis AP,Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP, Issel-Tarver L,Kasarskis A, Lewis S,Matese JC, Richardson JE, Ringwald M, Rubin GM,Sherlock G. Gene ontology: tool for the unification of biology. The GeneOntology Consortium. Nat Genet 2000;25:25–9.

[4] Beitz AJ. Possible origin of glutamatergic projections to the midbrainperiaqueductal gray and deep layer of the superior colliculus of the rat.Brain Res Bull 1989;23:25–35.

[5] Bodnar RJ, Kelly DD, Brutus M, Greenman CB, Glusman M. Reversal ofstress-induced analgesia by apomorphine, but not by amphetamine.Pharmacol Biochem Behav 1980;13:171–5.

[6] Bon K, Lanteri-Minet M, de Pommery J, Michiels JF, Menetrey D.Cyclophosphamide cystitis as a model of visceral pain in rats: minoreffects at mesodiencephalic levels as revealed by the expression of c-fos,with a note on Krox-24. Exp Brain Res 1997;113:249–64.

[7] Bonafe L, Kariminejad A, Li J, Royer-Bertrand B, Garcia V, Mahdavi S,Bozorgmehr B, Lachman RL, Mittaz-Crettol L, Campos-Xavier B,Nampoothiri S, Unger S, Rivolta C, Levade T, Superti-Furga A.Peripheral osteolysis in adults linked to ASAH1 (acid ceramidase)mutations: a new presentation of Farber disease. Arthritis Rheumatol2016;68:2323–7.

[8] Brittain JM, Piekarz AD,Wang Y, Kondo T, Cummins TR, Khanna R. Anatypical role for collapsin response mediator protein 2 (CRMP-2) inneurotransmitter release via interaction with presynaptic voltage-gatedcalcium channels. J Biol Chem 2009;284:31375–90.

[9] Bushnell MC, Ceko M, Low LA. Cognitive and emotional control of painand its disruption in chronic pain. Nat Rev Neurosci 2013;14:502–11.

[10] Butler RK, Finn DP. Stress-induced analgesia. Prog Neurobiol 2009;88:184–202.

[11] Cakir I, Cyr NE, Perello M, Litvinov BP, Romero A, Stuart RC, Nillni EA.Obesity induces hypothalamic endoplasmic reticulum stress and impairsproopiomelanocortin (POMC) post-translational processing. J Biol Chem2013;288:17675–88.

[12] Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitativeassessment of tactile allodynia in the rat paw. J Neurosci Methods 1994;53:55–63.

[13] Cheng ZB, Kobayashi M, Nosaka S. Effects of optic tract stimulation onbaroreflex vagal bradycardia in rats. Clin Exp Pharmacol Physiol 2001;28:721–8.

[14] Chipkin RE, Latranyi MZ, Iorio LC, Barnett A. Potentiation of [D-ala2]enkephalinamide analgesia in rats by thiorphan. Eur J Pharmacol 1982;83:283–8.

[15] Cidral-Filho FJ, Martins DF, More AO, Mazzardo-Martins L, Silva MD,Cargnin-Ferreira E, Santos AR. Light-emitting diode therapy inducesanalgesia and decreases spinal cord and sciatic nerve tumour necrosisfactor-alpha levels after sciatic nerve crush in mice. Eur J Pain 2013;17:1193–204.

[16] Cidral-Filho FJ, Mazzardo-Martins L, Martins DF, Santos AR. Light-emitting diode therapy induces analgesia in a mouse model ofpostoperative pain through activation of peripheral opioid receptors andthe L-arginine/nitric oxide pathway. Lasers Med Sci 2014;29:695–702.

[17] D’Addario C, Caputi FF, Ekstrom TJ, Di Benedetto M, Maccarrone M,Romualdi P, Candeletti S. Ethanol induces epigenetic modulation ofprodynorphin and pronociceptin gene expression in the rat amygdalacomplex. J Mol Neurosci 2013;49:312–19.

[18] Denning GM, Ackermann LW, Barna TJ, Armstrong JG, Stoll LL,Weintraub NL, Dickson EW. Proenkephalin expression and enkephalinrelease are widely observed in non-neuronal tissues. Peptides 2008;29:83–92.

[19] Dworkin RH,O’Connor AB, Backonja M, Farrar JT, Finnerup NB, JensenTS, Kalso EA, Loeser JD, Miaskowski C, Nurmikko TJ, Portenoy RK,Rice AS, Stacey BR, Treede RD, Turk DC, Wallace MS. Pharmacologicmanagement of neuropathic pain: evidence-based recommendations.PAIN 2007;132:237–51.

[20] Eastman CI, Young MA, Fogg LF, Liu L, Meaden PM. Bright lighttreatment of winter depression: a placebo-controlled trial. Arch GenPsychiatry 1998;55:883–9.

[21] Figueiro MG,Plitnick BA,Lok A, Jones GE,Higgins P,Hornick TR,Rea MS.Tailored lighting intervention improves measures of sleep, depression,and agitation in persons with Alzheimer’s disease and relateddementia living in long-term care facilities. Clin Interv Aging 2014;9:1527–37.

[22] Finnerup NB, Attal N, Haroutounian S,McNicol E, Baron R,Dworkin RH,Gilron I, Haanpaa M, Hansson P, Jensen TS, Kamerman PR, Lund

K, Moore A, Raja SN, Rice AS, Rowbotham M, Sena E, Siddall P,Smith BH, Wallace M. Pharmacotherapy for neuropathic pain inadults: a systematic review and meta-analysis. Lancet Neurol 2015;14:162–73.

[23] Fricova J, Vejrazka M, Stopka P, Krizova J, Belacek J, Rokyta R. Theinfluence of pre-emptive analgesia on postoperative analgesia and itsobjective evaluation. Arch Med Sci 2010;6:764–71.

[24] Gaskin ME, Greene AF, Robinson ME, Geisser ME. Negative affect andthe experience of chronic pain. J Psychosom Res 1992;36:707–13.

[25] Golden RN, Gaynes BN, Ekstrom RD, Hamer RM, Jacobsen FM,Suppes T, Wisner KL, Nemeroff CB. The efficacy of light therapy in thetreatment of mood disorders: a review andmeta-analysis of the evidence.Am J Psychiatry 2005;162:656–62.

[26] Gray D, Coon H, McGlade E, Callor WB, Byrd J, Viskochil J, Bakian A,Yurgelun-Todd D, Grey T, McMahon WM. Comparative analysis ofsuicide, accidental, and undetermined cause of death classification.Suicide Life Threat Behav 2014;44:304–16.

[27] Gungor D, Schober AK, Kruijshaar ME, Plug I, Karabul N, Deschauer M,van Doorn PA, van der Ploeg AT, Schoser B, Hanisch F. Pain in adultpatients with Pompe disease: a cross-sectional survey. Mol Genet Metab2013;109:371–6.

[28] Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new andsensitive method for measuring thermal nociception in cutaneoushyperalgesia. PAIN 1988;32:77–88.

[29] Hassett AL, Aquino JK, Ilgen MA. The risk of suicide mortality in chronicpain patients. Curr Pain Headache Rep 2014;18:436.

[30] Hattar S, Kumar M, Park A, Tong P, Tung J, Yau KW, Berson DM.Central projections of melanopsin-expressing retinal ganglion cells in themouse. J Comp Neurol 2006;497:326–49.

[31] Hattar S, Liao HW, Takao M, Berson DM, Yau KW. Melanopsin-containing retinal ganglion cells: architecture, projections, and intrinsicphotosensitivity. Science 2002;295:1065–70.

[32] Hooley JM, Franklin JC, Nock MK. Chronic pain and suicide:understanding the association. Curr Pain Headache Rep 2014;18:435.

[33] Hosobuchi Y. Combined electrical stimulation of the periaqueductal graymatter and sensory thalamus. Appl Neurophysiol 1983;46:112–5.

[34] Huynh TN, Krigbaum AM, Hanna JJ, Conrad CD. Sex differences andphase of light cycle modify chronic stress effects on anxiety anddepressive-like behavior. Behav Brain Res 2011;222:212–22.

[35] Hwang MH, Shin JH, Kim KS, Yoo CM, Jo GE, Kim JH, Choi H. Lowlevel light therapy modulates inflammatory mediators secreted by humanannulus fibrosus cells during intervertebral disc degeneration in vitro.Photochem Photobiol 2015;91:403–10.

[36] Institute of Medicine (US), Committee on Advancing Pain Research Careand Education. Relieving pain in America: a blueprint for transformingprevention, care, education, and research. Washington, DC: NationalAcademies Press, 2011.

[37] Jack MM, Ryals JM, Wright DE. Protection from diabetes-inducedperipheral sensory neuropathy—a role for elevated glyoxalase I? ExpNeurol 2012;234:62–9.

[38] Katz RJ, Roth KA. Stress induced grooming in the rat—an endorphinmediated syndrome. Neurosci Lett 1979;13:209–12.

[39] Kim DS, Lee SJ, Park SY, Yoo HJ, Kim SH, Kim KJ, Cho HJ.Differentially expressed genes in rat dorsal root ganglia followingperipheral nerve injury. Neuroreport 2001;12:3401–5.

[40] Kim KJ, Yoon YW, Chung JM. Comparison of three rodent neuropathicpain models. Exp Brain Res 1997;113:200–6.

[41] Krout KE, Kawano J, Mettenleiter TC, Loewy AD. CNS inputs to thesuprachiasmatic nucleus of the rat. Neuroscience 2002;110:73–92.

[42] Lambert D’raven LT, Moliver N, Thompson D. Happiness interventiondecreases pain and depression, boosts happiness among primary carepatients. Prim Health Care Res Dev 2015;16:114–26.

[43] Leichtfried V, Matteucci Gothe R, Kantner-Rumplmair W, Mair-Raggautz M, Bartenbach C, Guggenbichler H, Gehmacher D, Jonas L,Aigner M, Winkler D, Schobersberger W. Short-term effects of brightlight therapy in adults with chronic nonspecific back pain: a randomizedcontrolled trial. Pain Med 2014;15:2003–12.

[44] Levinson DM, Sheridan CL, Hottman TJ, Justesen DR, Creel DJ,Sanders RE. Assessment of the contact eye cover as an effectivemethodof restricting visual input. Behavior Research Methods instrumentation1978;10:376–88.

[45] Lewis JW, Cannon JT, Liebeskind JC. Opioid and nonopioidmechanisms of stress analgesia. Science 1980;208:623–5.

[46] Li Y, Hu F, Chen HJ, Du YJ, Xie ZY, Zhang Y, Wang J, Wang Y. LIMK-dependent actin polymerization in primary sensory neurons promotes thedevelopment of inflammatory heat hyperalgesia in rats. Sci Signal 2014;7:ra61.

[47] Linton SJ, Shaw WS. Impact of psychological factors in the experience ofpain. Phys Ther 2011;91:700–11.




[48] Liukkonen A. The nurse’s decision-making process and theimplementation of psychogeriatric nursing in a mental hospital. J AdvNurs 1992;17:356–61.

[49] Livak KJ, Schmittgen TD. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods2001;25:402–8.

[50] Macedo-Junior SJ, Nascimento FP, Luiz-Cerutti M, Santos AR. Role ofpertussis toxin-sensitive G-protein, K1 channels, and voltage-gatedCa21 channels in the antinociceptive effect of inosine. Purinergic Signal2013;9:51–8.

[51] Maier SF. Stressor controllability and stress-induced analgesia. Ann N YAcad Sci 1986;467:55–72.

[52] Martenson ME, Halawa OI, Tonsfeldt KJ, Maxwell CA, Hammack N,Mist SD, Pennesi ME, Bennett RM, Mauer KM, Jones KD, HeinricherMM. A possible neural mechanism for photosensitivity in chronic pain.PAIN 2016;157:868–78.

[53] Martins DF, Turnes BL,Cidral-Filho FJ,Bobinski F,Rosas RF,Danielski LG,Petronilho F, Santos AR. Light-emitting diode therapy reduces persistentinflammatory pain: role of interleukin 10 and antioxidant enzymes.Neuroscience 2016;324:485–95.

[54] Millan MJ. Descending control of pain. Prog Neurobiol 2002;66:355–474.[55] Mohajjel Nayebi A, Sharifi H, Ramadzani M, Rezazadeh H. Effect of

acute and chronic administration of carbamazepine on Cisplatin-inducedhyperalgesia in rats. Jundishapur J Nat Pharm Prod 2012;7:27–30.

[56] Moutal A, Chew LA, Yang X, Wang Y, Yeon SK, Telemi E, Meroueh S,Park KD, Shrinivasan R, Gilbraith KB, Qu C, Xie JY, Patwardhan A,Vanderah TW, Khanna M, Porreca F, Khanna R. (S)-lacosamideinhibition of CRMP2 phosphorylation reduces postoperative andneuropathic pain behaviors through distinct classes of sensory neuronsidentified by constellation pharmacology. PAIN 2016;157:1448–63.

[57] Moutal A, Honnorat J, Massoma P, Desormeaux P, Bertrand C,Malleval C, Watrin C, Chounlamountri N, Mayeur ME, Besancon R,Naudet N, Magadoux L, Khanna R, Ducray F, Meyronet D, ThomassetN. CRMP5 controls glioblastoma cell proliferation and survival throughnotch-dependent signaling. Cancer Res 2015;75:3519–28.

[58] Nascimento FP, Macedo-Junior SJ, Pamplona FA, Luiz-Cerutti M,Cordova MM, Constantino L, Tasca CI, Dutra RC, Calixto JB, Reid A,Sawynok J, Santos AR. Adenosine A1 receptor-dependent antinociceptioninduced by inosine in mice: pharmacological, genetic and biochemicalaspects. Mol Neurobiol 2015;51:1368–78.

[59] Navratilova E, Xie JY, King T, Porreca F. Evaluation of reward from painrelief. Ann N Y Acad Sci 2013;1282:1–11.

[60] Nesvizhskii AI, Keller A, Kolker E, Aebersold R. A statistical model foridentifying proteins by tandem mass spectrometry. Anal Chem 2003;75:4646–58.

[61] Ni J, Gao Y, Gong S, Guo S, Hisamitsu T, Jiang X. Regulation ofmu-opioid type 1 receptors by microRNA134 in dorsal root ganglionneurons following peripheral inflammation. Eur J Pain 2013;17:313–23.

[62] Niederhofer H, von Klitzing K. Bright light treatment as add-on therapy fordepression in 28 adolescents: a randomized trial. Prim Care CompanionCNS Disord 2011;13:PCC.11m01194.

[63] Noseda R, Bernstein CA, Nir RR, Lee AJ, Fulton AB, Bertisch SM,Hovaguimian A, Cestari DM, Saavedra-Walker R, Borsook D, Doran BL,Buettner C, Burstein R. Migraine photophobia originating in cone-drivenretinal pathways. Brain 2016;139:1971–86.

[64] Nyberg MA, Peyman GA, McEnerney JK. Evaluation of donor cornealendothelial viability with the vital stains rose bengal and evans blue.Albrecht Von Graefes Arch Klin Exp Ophthalmol 1977;204:153–9.

[65] Pecze L, Blum W, Schwaller B. Mechanism of capsaicin receptorTRPV1-mediated toxicity in pain-sensing neurons focusing on the effectsof Na(1)/Ca(21) fluxes and the Ca(21)-binding protein calretinin.Biochim Biophys Acta 2013;1833:1680–91.

[66] Pelegrini-da-Silva A, Rosa E, Guethe LM, Juliano MA, Prado WA,Martins AR. Angiotensin III modulates the nociceptive control mediatedby the periaqueductal gray matter. Neuroscience 2009;164:1263–73.

[67] Pihl TH, Andersen PH, Kjelgaard-Hansen M, Morck NB, Jacobsen S.Serum amyloid A and haptoglobin concentrations in serumand peritonealfluid of healthy horses and horses with acute abdominal pain. Vet ClinPathol 2013;42:177–83.

[68] Porreca F, Cowan A, Raffa RB, Tallarida RJ. Tolerance and cross-tolerance studies with morphine and ethylketocyclazocine. J PharmPharmacol 1982;34:666–7.

[69] Provencio I, Rodriguez IR, Jiang G, Hayes WP, Moreira EF, Rollag MD.A novel human opsin in the inner retina. J Neurosci 2000;20:600–5.

[70] Reda HM, Zaitone SA, Moustafa YM. Effect of levetiracetam versusgabapentin on peripheral neuropathy and sciatic degeneration instreptozotocin-diabetic mice: influence on spinal microglia andastrocytes. Eur J Pharmacol 2016;771:162–72.

[71] Shah K, Lahiri DK. A tale of the good and bad: remodeling of themicrotubule network in the brain by Cdk5. Mol Neurobiol 2016. DOI:10.1007/s12035-016-9792-7.

[72] Smith AA, Friedemann ML. Perceived family dynamics of persons withchronic pain. J Adv Nurs 1999;30:543–51.

[73] Snutch TP. Targeting chronic and neuropathic pain: the N-type calciumchannel comes of age. NeuroRx 2005;2:662–70.

[74] Spradley JM, Davoodi A, Carstens MI, Carstens E. Effects of acutestressors on itch- andpain-related behaviors in rats. PAIN2012;153:1890–7.

[75] Stein C, Millan MJ, Herz A. Unilateral inflammation of the hindpaw in ratsas a model of prolonged noxious stimulation: alterations in behavior andnociceptive thresholds. Pharmacol Biochem Behav 1988;31:445–51.

[76] Strigo IA, Simmons AN, Matthews SC, Craig AD, Paulus MP.Association of major depressive disorder with altered functional brainresponse during anticipation and processing of heat pain. Arch GenPsychiatry 2008;65:1275–84.

[77] Sun L, Wu Z, Hayashi Y, Peters C, Tsuda M, Inoue K, Nakanishi H.Microglial cathepsin B contributes to the initiation of peripheralinflammation-induced chronic pain. J Neurosci 2012;32:11330–42.

[78] Takahashi M, Izumi R, Kaneto H. The role of the catecholaminergicmechanism in foot shock (FS) stress- and immobilized-water immersion(IW) stress-induced analgesia in mice. Jpn J Pharmacol 1984;35:175–9.

[79] Tse MM, Lo AP, Cheng TL, Chan EK, Chan AH, Chung HS. Humortherapy: relieving chronic pain and enhancing happiness for older adults.J Aging Res 2010;2010:343574.

[80] van Esseveldt KE, Lehman MN, Boer GJ. The suprachiasmatic nucleusand the circadian time-keeping system revisited. Brain Res Brain Res Rev2000;33:34–77.

[81] Vivacqua G, Yin JJ, Casini A, Li X, Li YH, D’Este L, Chan P, Renda TG,Yu S. Immunolocalization of alpha-synuclein in the rat spinal cord by twonovel monoclonal antibodies. Neuroscience 2009;158:1478–87.

[82] Xie JY, Herman DS, Stiller CO, Gardell LR, Ossipov MH, Lai J, PorrecaF, Vanderah TW. Cholecystokinin in the rostral ventromedial medullamediates opioid-induced hyperalgesia and antinociceptive tolerance.J Neurosci 2005;25:409–16.

[83] Yaksh TL, Rudy TA. Chronic catheterization of the spinal subarachnoidspace. Physiol Behav 1976;17:1031–6.

[84] Zhan J, Chen X, Wang C, Qiu J, Ma F, Wang K, Zheng S. A fusionprotein of conotoxin MVIIA and thioredoxin expressed in Escherichia colihas significant analgesic activity. Biochem Biophys Res Commun 2003;311:495–500.

[85] Zhang Y, Zhao S, Rodriguez E, Takatoh J, Han BX, Zhou X, Wang F.Identifying local and descending inputs for primary sensory neurons.J Clin Invest 2015;125:3782–94.

[86] Zhou J, Tawk M, Tiziano FD, Veillet J, Bayes M, Nolent F, Garcia V,Servidei S, Bertini E, Castro-Giner F, Renda Y, Carpentier S, Andrieu-Abadie N, Gut I, Levade T, Topaloglu H, Melki J. Spinal muscularatrophy associated with progressive myoclonic epilepsy is caused bymutations in ASAH1. Am J Hum Genet 2012;91:5–14.

[87] Zulauf L, Coste O, Marian C, Moser C, Brenneis C, Niederberger E.Cofilin phosphorylation is involved in nitric oxide/cGMP-mediatednociception. Biochem Biophys Res Commun 2009;390:1408–13.



http://dx.doi.org/10.1007/s12035-016-9792-7

long-lasting antinociceptive effects of green light in ... · receiving green led light (wavelength...

Documents