living environmenttywlshannon.weebly.com/.../lab_22_genetic_engineering.docx · web viewgenetic...

Name:________________________________________ Sec:_________________ Date:________________________

Lab 21: Genetic Engineering

Objective: In this lab students will be able to simulate different types of genetic engineering and determine their place in genetic research.

Introduction: Genetic engineering is a practice in which scientists manipulate genes. This research is done in order to determine relationships between organisms, make advances in medicine, and create new and improved organisms. They use a variety of techniques which we will investigate during this experiment. Each technique is used for a specific area of genetic research.

1. Define Genetic Engineering: _________________________________________________________________

2. What are three reasons why scientists manipulate genes?

a. __________________________________________________________________________________

b. __________________________________________________________________________________

c. __________________________________________________________________________________

ACTIVITY #1: GENE TRANSFER

1. Define gene transfer: _______________________________________________________________________________

2. How is this technique used in the real world? ____________________________________________________________

_________________________________________________________________________________________________

3. Paste your newly created recombinant DNA in the box below.

ACTIVITY #2: GEL ELECTROPHORESIS

1. Define gel electrophoresis: __________________________________________________________________________


_________________________________________________________________________________________________

3. Create your gel electrophoresis below by coloring in the corresponding bands.

4. Which suspect committed the crime? ___________________

ACTIVITY #3: SELECTIVE BREEDING

1. Define selective breeding: ___________________________________________________________________________


_________________________________________________________________________________________________

3. Paste the parents and the offspring you believe were involved in selective breeding below.

4. List one characteristic the new breed got from each of its parents.

a. _______________________________________________________

b. _______________________________________________________

CRIME SCENE DNA SUSPECT #1 SUSPECT #2 SUSPECT #410987654321

ACTIVITY #4: CLONING

1. Define cloning: _______________________________________________________________________________


_________________________________________________________________________________________________

3. Describe each of the numbered steps from the picture of the cloning process in the box below.

STEP DESCRIPTION OF STEP

1

2

3

4

5

4. Will the new sheep created be more genetically similar to Dolly or to the donor sheep that it developed inside of? Explain your response.

5. Should scientists be able to use this technique to clone humans? Explain your response.

CONCLUSIONS

There are many ethical concerns that surround the area of genetic engineering. Many people believe that playing with nature is immoral and scientists shouldn’t manipulate genes. Others believe it is necessary for the medical advances and well being of humans to do such things. What do you believe? Support your response with information that you have learned in this lab.

ACTIVITY #1: GENE TRANSFER

Gene transfer is the process in which genes from one organism are transferred into the genes of another organism. This technique has been very helpful when creating medical advances. One example of a medical situation improved by this technique is insulin production used for Diabetics. Before gene transfer, people who could not produce insulin on their own were forced to inject themselves with insulin extracted from pigs. This caused little side effects, but scientists were determined to provide these patients with human insulin. Therefore, scientists found a way to locate the insulin gene in human cells, extract it (remove it) and insert the gene into bacteria cells. Once the gene is incorporated into bacterial DNA, they will begin making the protein insulin during protein synthesis. The insulin is then taken from these cells and put into a solution that can be injected into humans. Even though bacterial cells are making this insulin, it is still created from human DNA that has been inserted into their genome. Once one bacterial cell has been changed , it will reproduce by asexual reproduction, creating millions of genetically identical bacteria cells that are all able to create human insulin.

1. Extract a DNA sample from the human body cell. 2. Your scissor is a restriction enzyme. You are looking for a specific sequence of DNA which is indicated to you by the

red line on the DNA sample you have extracted from a human body cell.3. Cut along the red line. You have just removed the insulin gene from your DNA sample. 4. You will notice that the piece of DNA has two fee base pairs on each end. These are called sticky ends.5. Extract a DNA sample from the bacterial cell.6. Your scissor is the same restriction enzyme so you are looking for the same specific sequence of DNA which is

indicated to you by the red line. 7. Cut along the red line. 8. Place your human DNA sample inside of the bacterial DNA by allowing the free base pairs of each sample to bond

together. 9. You have created a piece of recombinant DNA. (Glue your new DNA to your data sheet.)


Gel Electrophoresis is the process in which DNA strands from several organisms are compared in order to determine relationships between them. Forensic scientists use this particular type of testing in order to determine the victims or suspects of a crime scene. This technique is also used in paternity tests. They can use this technique to compare different blood samples, and other bodily fluids. The DNA samples are first extracted (taken) from the sample they collect, and then they are cut using restriction enzymes. These are special enzymes that look for specific DNA sequences and cut in between them. Once the DNA is chopped into pieces they place the fragments (pieces of DNA) into a blue gel. This gel has an electric charge on both ends. Since DNA is a negatively charged molecule, it travels towards the positive end of the gel. This is because opposites attract. Small pieces will travel very quickly thru this gel, while the larger pieces move slower. Once the gel hardens, the DNA can no longer move and they are stuck in place. The end result of this experiment is a separation of DNA strands by size. The scientists will examine the placement of DNA in order to determine relationships between organisms. The more bands in common the more related they are.

1. Extract DNA from each of the Suspects and from the crime scene. 2. Scan the DNA samples, just as a restriction enzyme would, and locate the letters TTAA. 3. Using your scissors which act as restriction enzymes, cut the sequence between the letters TT and AA. 4. Count the number of bases on each fragment of DNA. Write this number on the back. 5. “Place your DNA into the gel” by coloring in the numbered bands for each suspect. You determine the numbers by

counting the bases in each fragment, which you have already done. (Record on your data sheet.)6. Determine which individual has DNA most similar to that found at the crime scene. (Record on your data sheet.)


Gel Electrophoresis is the process in which DNA strands from several organisms are compared in order to determine relationships between them. Forensic scientists use this particular type of testing in order to determine the victims or suspects of a crime scene. This technique is also used in paternity tests. They can use this technique to compare different blood samples, and other bodily fluids. The DNA samples are first extracted (taken) from the sample they collect, and then they are cut using restriction enzymes. These are special enzymes that look for specific DNA sequences and cut in between them. Once the DNA is chopped into pieces they place the fragments (pieces of DNA) into a blue gel. This gel has an electric charge on both ends. Since DNA is a negatively charged molecule, it travels towards the positive end of the gel. This is because opposites attract. Small pieces will travel very quickly thru this gel, while the larger pieces move slower. Once the gel hardens, the DNA can no longer move and they are stuck in place. The end result of this experiment is a separation of DNA strands by size. The scientists will examine the placement of DNA in order to determine relationships between organisms. The more bands in common the more related they are.

1. Extract DNA from each of the Suspects and from the crime scene. 2. Scan the DNA samples, just as a restriction enzyme would, and locate the letters TTAA. 3. Using your scissors which act as restriction enzymes, cut the sequence between the letters TT and AA. 4. Count the number of bases on each fragment of DNA. Write this number on the back. 5. “Place your DNA into the gel” by coloring in the numbered bands for each suspect. You determine the numbers by

counting the bases in each fragment, which you have already done. (Record on your data sheet.)6. Determine which individual has DNA most similar to that found at the crime scene. (Record on your data sheet.)

ACTIVITY #3: Selective Breeding

Selective breeding is the process in which scientists mate two organisms in order to create an even better organism. They use this technique to improve the food we eat, the medicines we take, and it is also used to satisfy human preference. For example, let’s say there are two types of strawberries on a farm: one type that grew very large, but were not very sweet, and one type that stay small, but were super sweet. Scientists may decided to mate the flowers from these strawberries until they are able to create a type of strawberry that is large and sweet. We also see this type of genetic engineering often in pets. The new breeds of designer dogs that have been popular in the last couple years are a product of genetic engineering. For example the Labradoodle, Cockapoo, Puggle, etc are just a few examples of dog breeds created by scientists by mating two types of dogs to create a new breed.

1. Look at the pictures of five organisms. 2. Determine which two organisms were bred together to create the third. Two of the pictures can be thrown out. 3. Paste the pictures onto your data sheet in the designated areas. 4. After you have determined the parents and the offspring created, list one characteristic that the new breed got

from each parent. (Record this on the data sheet.)

ACTIVITY #3: Selective Breeding

Selective breeding is the process in which scientists mate two organisms in order to create an even better organism. They use this technique to improve the food we eat, the medicines we take, and it is also used to satisfy human preference. For example, let’s say there are two types of strawberries on a farm: one type that grew very large, but were not very sweet, and one type that stay small, but were super sweet. Scientists may decided to mate the flowers from these strawberries until they are able to create a type of strawberry that is large and sweet. We also see this type of genetic engineering often in pets. The new breeds of designer dogs that have been popular in the last couple years are a product of genetic engineering. For example the Labradoodle, Cockapoo, Puggle, etc are just a few examples of dog breeds created by scientists by mating two types of dogs to create a new breed.

1. Look at the pictures of five organisms. 2. Determine which two organisms were bred together to create the third. Two of the pictures can be thrown out. 3. Paste the pictures onto your data sheet in the designated areas. 4. After you have determined the parents and the offspring created, list one characteristic that the new breed got

from each parent. (Record this on the data sheet.)


Cloning is the process in which genetically identical organisms are created. Once scientists have successful created superior breeds using any of the above techniques, they are going to want to keep that genetic information alive and being passed on. In situations where the species reproduce asexually, it is easy to pass on the genetic information since their offspring are identical. Sexual reproduction makes things a little bit trickier because it causes genetic variations. Scientists have been working to find ways to clone the genes of sexually reproducing organisms, in order to create offspring with identical genetic information. The successful attempt at this was seen in a sheep named Dolly. The scientists extracted the DNA from one of her body cells (which had 46 chromosomes), and then extracted DNA from one an egg cell of another sheep (which had 23 chromosomes). They replaced the egg cell’s DNA with the body cell DNA from Dolly and tricked the another sheep’s uterus into thinking this egg cell had been fertilized and was now a zygote. Several months later, the sheep gave birth to a clone of Dolly. The new sheep that was created was completely genetically identical to Dolly.

1. Each number in the diagram represents a step in the process of cloning. 2. On your data sheet, describe each numbered step in the process. 3. Answer the questions that follow.



1. Each number in the diagram represents a step in the process of cloning. 2. On your data sheet, describe each numbered step in the process3. Answer the questions that follow.



1. Each number in the diagram represents a step in the process of cloning. 2. On your data sheet, describe each numbered step in the process. 3. Answer the questions that follow.

Crime scene

GTTAACCGTTAATAGGTTAAAGTTAAGA GTTAACCGTTAATAGGTTAAAGTTAAGA






















Suspect #2























Suspect #1

AGTTTAACGCAGATTAAGGATTAAATGC AGTTTAACGCAGATTAAGGATTAAATGC






















Suspect #3

ATTAAGATCTTAACTTAAGAGTCCTTAA ATTAAGATCTTAACTTAAGAGTCCTTAA





















living environmenttywlshannon.weebly.com/.../lab_22_genetic_engineering.docx · web viewgenetic...

Documents