live cell fret and protein dynamics reveal two types of mutant

Live cell imaging and biophotonic methods revealtwo types of mutant huntingtin inclusions

Nicholas S. Caron1,{, Claudia L. Hung1,{, Randy S. Atwal2 and Ray Truant1,∗

1Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, ON, Canada L8N 3Z5 and2Department of Neurology, Harvard Medical School, Massachussetts General Hospital, Boston, MA 02114, USA

Received November 25, 2013; Revised November 25, 2013; Accepted December 9, 2013

Huntington’s disease (HD) is an autosomal dominant, neurodegenerative disorder that can be characterized bythe presence of protein inclusions containing mutant huntingtin within a subset of neurons in the brain. Sincetheir discovery, the relevance of inclusions to disease pathology has been controversial. We show usingsuper-resolution fluorescence imaging and Forster resonance energy transfer (FRET) in live cells, thatmutant huntingtin fragments can form two morphologically and conformationally distinct inclusion types.Using fluorescence recovery after photobleaching (FRAP), we demonstrate that the two huntingtin inclusiontypes have unique dynamic properties. The ability to form one or the other type of inclusion can be influencedby the phosphorylation state of serine residues at amino acid positions 13 and 16 within the huntingtin protein.We can define two types of inclusions: fibrillar, which are tightly packed, do not exchange protein with the sol-uble phase, and result from phospho-modification at serines 13 and 16 of the N17 domain, and globular, whichare loosely packed, can readily exchange with the soluble phase, and are not phosphorylated in N17. We hy-pothesize that the protective effect of N17 phosphorylation or phospho-mimicry seen in animal models, at thelevel of protein inclusions with elevated huntingtin levels, is to induce a conformation of the huntingtinamino-terminus that causes fragments to form tightly packed inclusions that do not exit the insoluble phase,and hence exert less toxicity. The identification of these sub-types of huntingtin inclusions could allow fordrug discovery to promote protective inclusions of mutant huntingtin protein in HD.

INTRODUCTION

Huntington’s disease (HD) is a progressive, neurodegenerativedisease caused by a CAG trinucleotide expansion within the Httgene that codes for a polymorphic polyglutamine tract near theamino-terminusof the 350 kDa huntingtin protein (1). Individualshaving polyglutamine tracts with 4–36 repeats do not developdisease, whereas those with tracts exceeding the critical thresholdof 37 glutamines develop HD pathology with an inverse correl-ation between age-onset and CAG expansion length (2,3). Thehuntingtin protein is ubiquitously expressed in every humancell, yet neurodegeneration in early HD is selectively restrictedto the basal ganglia and cerebral cortex of the brain. Huntingtinis a highly conserved protein across vertebrates and is involvedin a variety of cellular functions including roles in vesicular trans-port (4–6), transcriptional regulation (7–10) and cytoskeletal dy-namics (11,12). The diverse functions of huntingtin likely stemfrom its ability to promote molecular interactions by behaving

as a scaffold protein (13). The polyglutamine expanded mutanthuntingtin protein disrupts many of these critical cellular func-tions. Notably, mutant huntingtin can aggregate to form inclusionbodies, where a cellular hallmark of HD is the presence of mutanthuntingtincontaining inclusions withinneurons andglia of humanpatient brains (14).

The ability of mutant huntingtin fragments to form cytoplas-mic and nuclear inclusions was initially described in the R6/2transgenic HD mouse model, which expresses human huntingtinexon1 with a CAG expansion (15,16). Brain slices from the R6/2mice revealed the presence of numerous inclusion bodies com-posed of mutant huntingtin fragments that stained positive forubiquitin (16). Similar inclusions reported in human HDpatient brains also contained amino-terminal fragments of hun-tingtin and stained positive for ubiquitin (14).

Many studies have demonstrated that full-length huntingtincan be proteolytically cleaved to produce several prominentamino-terminal fragments, the smallest being exon1 (huntingtin

†These authors contributed equally to this work.

∗To whom correspondence should be addressed at: HSC 4N54, 1200 Main Street West, Hamilton, ON, Canada L8N3Z5. Email: [email protected]

# The Author 2013. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

Human Molecular Genetics, 2014, Vol. 23, No. 9 2324–2338doi:10.1093/hmg/ddt625Advance Access published on December 11, 2013

Downloaded from https://academic.oup.com/hmg/article-abstract/23/9/2324/632412by gueston 10 April 2018

1–81) (17–22). Furthermore, aberrant splicing of the huntingtinmRNA transcript can lead to the translation of the pathogenicexon1 huntingtin protein in HD mouse models and HD humanfibroblasts (23). Therefore, it is hypothesized that small frag-ments of mutant huntingtin occur naturally in HD brains wherethey self-associate to form inclusions.

Protein aggregationoccurs inmostneurodegenerative disordersincluding Alzheimer’s disease (AD), Parkinson’s disease, amyo-trophic lateral sclerosis and the polyglutamine disorders. Inthese diseases, aggregated protein commonly forms eitheramyloid or amorphous aggregates. Amyloid aggregates arehighly insoluble and have a rigid b-sheet structure, whereasamorphous aggregates are unstructured (24). The classicamyloidhypothesis defines the deposition of misfolded amyloid-bprotein into insoluble plaques within the brain as one of theprimary pathogenic causes of neurodegeneration in AD (25,26).The amyloid hypothesis has since been revised and adapted to de-scribe a common pathogenic mechanism for most neurodegenera-tive diseases (27). In HD, this hypothesis is often referred to as thetoxic fragment hypothesis (17,28,29). It postulates that the proteo-lytic cleavage of mutant huntingtin generates toxic amino-terminal fragments that can misfold and accumulate in neuronalinclusions, leading to the neurodegeneration associated withHD. For the sake of nomenclature consistency, this manuscriptwill refer to aggregated mutant huntingtin in concentratedpuncta as inclusion bodies.

Several pathogenic mechanisms have been proposed to de-scribe the toxicity of mutant huntingtin inclusions in HD. Inclu-sions have been implicated in neuronal death by sequesteringcritical cellular proteins leading to their functional loss (30), phys-icallyoccludingactive vesicle traffickingbetween the nucleus andneuronal extremities (31), and by impairing ubiquitin-dependentproteolysis of misfolded proteins by the proteasome (32). Alterna-tive hypotheses view inclusion formationas being either benign oreven neuroprotective (33). Live cell imaging in neurons revealsthat the presence of huntingtin exon1 fragment inclusions corre-lates with enhanced survival, relative to neurons expressingexon1 without inclusions (33,34). It has been proposed that the re-sponse to mutant huntingtin-induced cell stress is the formation ofthese inclusions, which accumulate and sequester mutant protein.These studies identify the soluble monomeric or oligomeric formsof mutant huntingtin as being the cytotoxic species. This isobserved by the protective effect of the polyglutamine-bindingpeptide (QBP1) in cultured cells, which preferentially bindssoluble mutant huntingtin (35). Using high-throughput screens,compounds have been identified that can paradoxically reducecellular toxicity by either inhibiting (36) or promoting (37) the for-mation of mutant huntingtin inclusions. Studies like these havenecessitated the need to revisit the toxic fragment hypothesis forHD (38).

HD is one of nine CAG trinucleotide repeat disorders that areall caused by expanded polyglutamine tract lengths within dif-ferent cellular proteins (39). Despite the commonality betweenthe polyglutamine disorders, each of these diseases typicallyaffect only a specific subset of neurons within the brain (39). Fur-thermore, the polyglutamine thresholds for disease pathology inmost of the CAG trinucleotide diseases differ from the 37 repeatsrequired for HD, which suggests that the context of polygluta-mine within the pathogenic protein is important. Thus, somestudies have focused on the importance of the sequences flanking

the polyglutamine tract in mediating the toxicity of mutant hun-tingtin as well as its ability to form inclusions (40,41). The N17domain of huntingtin comprises the first 17 residues of theprotein prior to the polyglutamine tract. N17 adopts an amphi-pathic alpha-helical structure that allows it to interact withvarious proteins in the cytoskeleton and to associate with mem-branes (42,43). Recent studies performed by our group andothers have shown that introducing serine 13 and 16 mutationswithin N17 can influence the ability of mutant huntingtin toform inclusions, the rate of inclusion formation, and also themorphology of the huntingtin inclusions (44,45). Additionally,promoting phosphorylation at residues 13 and 16 of the N17domain has been shown to alleviate mutant huntingtin toxicityin an animal model of HD (46). Flanking the polyglutaminetract on the carboxyl-terminus is a region with two pureproline tracts separated by a proline-rich region. This domainhas also been shown to interact with a variety of proteins that dir-ectly impact the toxicity of mutant huntingtin and its ability toform inclusions (47,48). Therefore, these studies strongly impli-cate the importance of flanking sequences to the polyglutaminetract in modulating toxicity and inclusion formation.

Previously, our group developed a Forster resonance energytransfer (FRET) sensor to demonstrate that the polyglutaminetract of huntingtin can behave as a hinge, allowing the N17domain to fold back onto the distal polyproline region of hunting-tin (41). FRET involves the non-radiative transfer of energybetween a donor and an acceptor molecule, which allows for thehigh spatial resolution of dynamicmolecular interactionsand con-formational changes in live cells (12,49,50). The exon1 FRETsensor was used to measure the intramolecular interactionsbetween N17 and the polyproline domain as an indication of theconformation of soluble huntingtin in live cells. Here, we haveapplied the mutant huntingtin exon1 FRET sensor to observethe organization of polyglutamine expanded huntingtin withinprotein inclusions, measuring the intermolecular interactionbetween individual huntingtin fragments. We demonstrate usingFRET, fluorescence recovery after photobleaching (FRAP) andsuper-resolution fluorescence imaging that mutant huntingtinfragments can form two morphologically and dynamically dis-tinct inclusion types. We also show that the morphology of inclu-sions can be influenced by altering the phosphorylation state ofserines 13 and 16 of N17. The definition of two distinct inclusiontypes, and the ability to identify them could lead to new insightsinto the controversy of the role of protein inclusions in HD andother polyglutamine diseases.

RESULTS

Huntingtin fragments can form morphologically uniqueinclusion types

Using fluorescence microscopy imaging, three dimensional (3D)deconvolution and iso-surface rendering, we were able to identifytwo morphologically distinct types of inclusions formed by theoverexpression of mutant huntingtin fragments in striatal neuronderived STHdhQ7/Q7 cells (Fig. 1). Image deconvolution involvescapturing multiple images in the z plane and using algorithms torestore the out-of focus light to one focal point in a quantitativemanner, increasing the signal-to-noise ratio and resolution. Twodifferent mutant huntingtin (Q138) fragments were generated

Human Molecular Genetics, 2014, Vol. 23, No. 9 2325


by fusing a fluoro-phore at the carboxyl-terminus to generate hun-tingtin exon1 Q138-YFP (Ex1 Q138-YFP) and huntingtin aminoacids 1–171 Q138-YFP (1–171 Q138-YFP). The first type of in-clusion, which we termed fibrillar, appears to lack a defined shapeand is composed of mutant huntingtin fibres organized in an astralmorphology (Fig. 1A). The second type, which we termed globu-lar, tends to be spherically shaped with discrete and well-definededges (Fig. 1B). To further distinguish the morphologies of theseinclusions, super-resolution structured illumination microscopy(SR-SIM) was used, a method that improves lateral resolutionto �100 nm by illuminating the sample with a series of excitationlight patterns (51). Imaging revealed very distinct morphologiesbetween the globular inclusions (Fig. 1C) and fibrillar inclusions(Fig. 1D), highlighting a cytoskeletal element in the globular in-clusion.

To confirm that these different inclusion types were not just anartifact of the fluorescent protein fusion, we also generated hun-tingtin constructs with a small hemagglutinin (HA) tag andexpressed them in STHdhQ7/Q7 cells. Immunofluorescence (IF)with additional antigen retrieval revealed that both huntingtin

exon1 Q138-HA (Ex1 Q138-HA) and 1–171 Q138-HA frag-ments can formbothfibrillar andglobular inclusion types (Supple-mentary Material, Fig. S1). Thus, these morphologies werevalidated as fluorescent protein fusions, allowing further observa-tions in live cells.

In addition to characterizing the inclusions by their morph-ology, the fibrillar type of inclusion can be distinguished fromthe globular type using a thioflavin-T staining assay. Thioflavin-Tis commonlyused tostainamyloidfibrilswithadetectableb-sheetstructure (52). Fibrillar inclusions were thioflavin-T positive(Fig. 2A), while globular inclusions did not showthioflavin-Tspe-cific staining (Fig. 2B). As a positive control, STHdhQ7/Q7 cellswere transfected with amyloid-beta 1–42-mRFP (Ab 1–42-mRFP), the amyloid fibril-forming cleavage product of theamyloid precursor protein in AD. Inclusions formed from theoverexpression of the amyloid-b construct stained positive forthioflavin-T (Fig. 2C).

Immunofluorescence against ubiquitin was performed to testwhether one or both types of inclusions consisted of misfoldedprotein. Both types of inclusions formed in STHdhQ7/Q7 cells

Figure 1. Huntingtin fragments can form two morphologically unique inclusion types. Maximum intensity projections of deconvolved z-stacks followed by iso-surface rendering of (A) fibrillar and (B) globular inclusion types formed in STHdhQ7/Q7 cells using Ex1 Q138-YFP. (C) SR-SIM images of a globular inclusionwith a cytoskeletal structure present in the inclusion. (D) SR-SIM image of a fibrillar inclusion. Scale bar ¼ 1 mm.

2326 Human Molecular Genetics, 2014, Vol. 23, No. 9


http://hmg.oxfordjournals.org/lookup/suppl/doi:10.1093/hmg/ddt625/-/DC1


transfected with Ex1 Q138-HA revealed ubiquitinated protein;however, no difference in ubiquitination between types wasdetected (Supplementary Material, Fig. S2).

Fluorescence lifetime imaging microscopy-FRET revealstwo conformationally distinct inclusion types formed bymutant huntingtin fragments

Despite their unique phenotypes, visually distinguishing betweenthe two types of inclusions was challenging due to the high inten-sity and diffraction-limited spatial resolution of these inclusionsusing standard microscopy. To overcome these limitations, weimplemented FRET-based techniques to study these two typesof inclusions at nanometer resolution in live cells. FRET is a well-established technique used to measure molecular interactions andconformational changes in live cells (50). As donor and acceptorprobes for FRET, we chose a well-established FRET pair consist-ing of a cyan fluorescent protein variant, mCerulean (mCer), andan enhanced yellow fluorescent protein (eYFP) (53,54). The mostaccurate method of measuring FRET is using fluorescence life-time imaging microscopy (FLIM), where fluorescence lifetimerefers to the amount of time a valence electron remains in theexcited state prior to returning to ground state and emitting aphoton (55,56). The lifetime of a fluorophore can be directlyaffected by the biochemical and biophysical properties of the sur-rounding microenvironment; notably, FRET between two mole-cules causes a decrease in the donor fluorophore lifetime (55).

All controls for FLIM were performed to validate the use ofmCer and eYFP as a FRET pair in our live cell system (Supple-mentary Material, Fig. S3).

To determine if we could detect FRET changes when hunting-tin fragments were organized into higher-order inclusion struc-tures within live STHdhQ7/Q7 cells, we tested the huntingtinexon1 Q138 sensor tagged at the amino-terminus with mCerand at the carboxyl-terminus with eYFP (mCer-Ex1 Q138-eYFP). Using FLIM to measure FRET, we were able to accuratelymeasure intra- and intermolecular interactions between individualhuntingtin molecules during the nucleation and maturation ofinclusions, allowing us to differentiate between the two inclusiontypes based on overall structure. The fibrillar type of inclusionconsistently had significantly higher percent FRET efficiencyvalues relative to the globular type of inclusion (Fig. 3A, B andD). This suggested a higher degree of interaction within orbetween huntingtin molecules in the fibrillar inclusions comparedwith the globular type. To determine whether the FRET we mea-sured was a result of intra- or intermolecular FRET, weco-expressed mCer-Ex1 Q138 and Ex1 Q138-eYFP constructson separate plasmids and measured fluorescence lifetime at bothfibrillar (Fig. 3C) and globular (data not shown) inclusions.Since the lifetimes at fibrillar and globular inclusions weresimilar to those found using the FRET sensor, we concludedthat the majority of the FRET measured at each type of inclusionwas a result of intermolecular FRET between huntingtinfragments.

Figure 2. Fibrillar inclusions are detectable by thioflavin-T staining assay. Thioflavin-T staining of STHdhQ7/Q7 cells that formed either (A) fibrillar or (B) globularinclusions following 24 h expression of Ex1 Q138-mRFP. (C) Positive control for thioflavin-T assay showing staining of STHdhQ7/Q7 cells expressing Ab 1–42-mRFP for 24 h that have formed amyloid fibril aggregates. Inclusions of interest are denoted with an arrow, where G refers to a globular inclusion, and Frefers to a fibrillar inclusion. Scale bar ¼ 10 mm.






In order to acquire higher spatial resolution of FRET valueswithin each inclusion type, we collected z-stacks and performeddeconvolution on both fibrillar and globular inclusions formedby the huntingtinexon1 FRET sensor.FRET efficiency was calcu-lated using sensitized emission FRET (seFRET) as an alternativeto FLIM-FRET. seFRET is a technique in which the excitation ofthe donor leads to the non-radiative transfer of energy between theprobes, causing an increase in fluorescence intensity of the accept-or (sensitized emission) that can be quantified to generate ratio-metric FRET images (57). Consistent with the data collectedusing FLIM, we observed that the FRET within fibrillar inclusionswas dramaticallyhigher than that in the globular typeof inclusions(Fig. 3E and F). Additionally, we noted a heterogeneous distribu-tion of FRET efficiency values within the fibrillar inclusions;ranging from high FRET in the centre to progressively lowerFRET towards the edges of the inclusion (Fig. 3F). This suggestedtighter, more densely packed huntingtin molecules at the core offibrillar inclusions relative to the edges, and overall moreloosely packed protein in globular inclusions (Fig. 3E), through-out the entire volume of the inclusion.

FRAP demonstrates that the fibrillar and globular inclusiontypes have distinct exchange dynamics

Next, we used FRAP to gain insight into the recruitment dynam-ics of mutant huntingtin entering both fibrillar and globularinclusions within live STHdhQ7/Q7 cells. FRAP uses photolysisto permanently destroy the fluorophore of a fluorescent protein

with high-intensity light. Any signal seen in a region of interest(ROI) over time is the result of unbleached molecules enteringthis space, thus giving a read-out of protein dynamics (58,59).We precisely photobleached both types of inclusions and mea-sured the recovery of fluorescence to these ROI over time. Thefluorescence recovery to the ROI in this assay represented the re-cruitment of soluble polyglutamine expanded huntingtin intoinclusions. We observed that the fluorescence recovery withinthe globular type of inclusion occurred rapidly relative to the fi-brillar inclusion type (Fig. 4A and B). The recovery of fluores-cence to each inclusion type was temporally quantified forboth Ex1 Q138-YFP and 1–171 Q138-YFP. The globular inclu-sions recovered significantly faster than the fibrillar types forboth constructs (Fig. 4C and D).

To test whether inclusion formation could recruit and seques-ter soluble huntingtin protein, we monitored inclusion formationtemporally within STHdhQ7/Q7 cells over 24 h periods using anenvironmentally controlled microscope system (338C, 5%CO2). We observed that the formation of the globular inclusionsdid not affect the fluorescence of the soluble mutant huntingtinwithin the cells (Fig. 4E). Conversely, the formation of fibrillarinclusions progressively caused all the soluble mutant huntingtinin the cell to be absorbed and sequestered to the inclusion(Fig. 4F). We quantified the recruitment of soluble huntingtininto inclusions by temporally measuring the loss of fluorescencefrom a specific ROI in the cytoplasm of cells forming inclusionsfollowing expression of either Ex1 Q138-YFP (Fig. 4G) or 1–171 Q138-YFP (Fig. 4H). We measured significantly more

Figure 3. Comparing the fluorescence lifetime (t) changes in globular versus fibrillar inclusion types. Sample FLIM images of (A) fibrillar and (B) globular inclusionsformed using the mCer-Ex1 Q138-eYFP FRET sensor. (C) Co-expression of mCer-Ex1 Q138 and Ex1 Q138-eYFP as a control to show contribution of intermolecularversus intramolecular FRET. Photon-weighted images, photon-weighted lifetime images and lifetime histograms of each image are presented. Lifetimes shown in thephoton-weighted lifetime images are pseudo-colored using the rainbow scale lookup table (LUT) and correspond to lifetime values represented in the histogram. Thedashed red lines within each histogram represents the approximate lifetime with the most representative pixels (mode). Scale bar ¼ 10 mm. (D) Quantification ofFRET efficiency using the huntingtin FRET sensor comparing globular versus fibrillar inclusion types under steady state conditions in live cells (n ¼ 30, N ¼ 3,∗P , 0.001). All imaging was done in Hank’s balanced salt solution (HBSS) (pH 7.3). Sample deconvolved z-stacks of (E) globular and (F) fibrillar inclusionsusing seFRET. The donor/donor image represents excitation and emission of mCerulean. Donor/acceptor image represents excitation of mCerulean and emissionof eYFP. FRET efficiency images have been pseudocolored using a rainbow LUT that corresponds to the corrected FRET efficiency values represented on thescale below the panels. Scale bar ¼ 1 mm.



Figure 4. Comparing the dynamics of globular versus fibrillar inclusions. Live cell assayshowing the recovery of fluorescence followingbleaching of either (A) globu-lar or (B) fibrillar inclusion using a high-intensity 488 nm laser in STHdhQ7/Q7 cells overexpressing 1–171 Q138-YFP. Pre-bleach acquisition shows the cell prior toROI (circle) photobleaching. Quantifications of relative fluorescence recovery to either fibrillar or globular inclusions (over a 75 s time period) following expression ofeither (C) Ex1 Q138-YFP or (D) 1–171 Q138-YFP huntingtin fragments in STHdhQ7/Q7 cells for 24 h. Plotted values represent arbitrary units (AU) of fluorescenceintensity and error bars represent standard error. The asterisk represents time point and forward where P , 0.001 (N ¼ 3, n ¼ 10). Temporal movies of live cellsexpressing Ex1 Q138-YFP constructs forming either (E) globular or (F) fibrillar inclusions. Movies were made with an environmentally controlled microscope at338C, 5% CO2 using a 40× objective where images were taken every 5 min for 24 h. Quantification of temporal fluorescence loss at a specific ROI for both fibrillarand globular inclusions following expression of either (G) Ex1 Q138-YFP or (H) 1–171 Q138-YFP in STHdhQ7/Q7 cells for 24 h. Plotted values represent normalizedintensity, and error bars represent standard error (n ¼ 5, N ¼ 10 for Ex1 and n ¼ 9, N ¼ 8 for 1–171, ∗P , 0.001).



fluorescence loss in cells forming fibrillar compared with globu-lar inclusions at multiple time points (Fig. 4G and H).

Mutant huntingtin is actively recruited to globularinclusions by microtubules

In order to investigate whether mutant huntingtin inclusions loca-lized to components of the cytoskeleton, IFwas performed againstb-tubulin, actin and vimentin. Globular inclusions were found tolocalize along microtubule filaments (Fig. 5A) whereas fibrillarinclusions did not (Fig. 5B). To test if mutant huntingtin wasbeing actively recruited to either inclusion type along cytoskeletalstructures, we treated cells expressing the mutant exon1 fragmentwith compounds that would inhibit microtubule or actin polymer-ization. We noted that live cells expressing mutant exon1 for�10 h treated with low concentrations of nocodazole, a potent in-hibitor of microtubule polymerization, greatly reduced the

formation of large globular inclusions and caused many smallerinclusions to be dispersed throughout the cytoplasm after �3 hof treatment (Fig. 5C). These results complement our FRAPdata which demonstrated that fluorescence within the globularinclusionsrecovered rapidlyas if recruitmentofmutanthuntingtinwasdrivenviaanactiveprocess.This was furtherdemonstratedbytemporal observation of the effect of nocodazole on fully formedglobular inclusions (Fig. 5E) (supplemental Video 1). Cellsexpressing mutant exon1 for 24 h revealed that large globularinclusionscouldbreakup intosmaller inclusionsdue to the disrup-tion of the active recruitment of mutant huntingtin. Notably, treat-ment with the highest concentrations of nocodazole had no effecton the formation of fibrillar inclusions within the cell (Fig. 5D).Treatment of live cells with phalloidin, a potent inhibitor ofactin polymerization, had no effect on the formation or size ofeither fibrillar or globular inclusion types (data not shown). There-fore, these data support the hypothesis that mutant huntingtin is

Figure 5. Active recruitment of mutant huntingtin into globular inclusions is microtubule dependent. Immunofluorescence (IF)b-tubulin performed on STHdhQ7/Q7

cells that formed either (A) globular or (B) fibrillar inclusions following 24 h expression of Ex1 Q138-YFP. Effect of �3 h nocodazole treatment on STHdhQ7/Q7 cellsexpressing mCer-Ex1 Q138-YFP for �10 h forming either (C) globular or (D) fibrillar inclusions. (E) Temporal movie of a live cell with fully formed globular inclu-sions after expression of mCer-Ex1 Q138-YFP for 24 h treated with 40 ng/mL nocodazole over 2 h. Inclusions of interest are denoted with an arrow, where F refers to afibrillar inclusion. Scale bar ¼ 10 mm.



being shuttled into globular inclusions via molecular motors onmicrotubules, whereas mutant huntingtin is being recruited to fi-brillar inclusions by passive diffusion.

Temporal FRET reveals distinct formation and maturationdynamics of fibrillar and globular inclusions

To gain further insight into the structure of both inclusion typesduring their formation and maturation in live cells, we used thehuntingtin exon1 sensor to generate temporal FRET videosusing the seFRET technique. For these temporal experiments,we substituted mCerulean for mTurquoise2 (mTq2) due to itsincreased brightness and photostability over other cyan fluores-cent protein variants (60). seFRET is an appropriate method inthis context because the donor and acceptor fluorophores haveapproximately the same quantum yield, and expression levels

are identical due to the fixed 1:1 ratio of the sensor. Thismethod allows rapid and continuous temporal measurementsof FRET. The FRET images were pseudocoloured with alookup table (LUT) where FRET efficiency values correspondto the color ramp presented below the images. Following expres-sion of mTq2-Ex1 Q138-eYFP in STHdhQ7/Q7 cells for �24 h,we measured the changes in FRET efficiency at 2 min intervalsfor 60 min. The formation of fibrillar inclusions caused a dramat-ic increase in relative FRET efficiency over the period of obser-vation (Fig. 6A and B). These high FRET values measured infibrillar inclusions using seFRET were consistent with the rela-tive values measured using FLIM, and thus validated the useof seFRET in our system with the huntingtin sensor. Conversely,the formation and maturation of globular inclusions did notcause any significant increase in FRET efficiency over time,despite having comparable fluorescence intensities to the

Figure 6. Comparing the formation of fibrillar versus globular inclusions using temporal seFRET. (A, C and E) Temporal fluorescence intensity images of STHdhQ7/Q7

cells expressing mTq2-Ex1 Q138-eYFP FRET sensor during the formation of (A and E) fibrillar and (C and E) globular inclusions. (B, D and F) Corresponding temporalcorrectedFRETefficiency imagesgeneratedusingseFRETmoduleshowingthe formationof(BandF)fibrillar and(DandF)globular inclusions.FRETimageshavebeenpseudocoloured using a rainbow LUT that corresponds to corrected FRET efficiency values represented on the scale below the panels. Inclusions of interest are denotedwith an arrow, where G refers to a globular inclusion, and F refers to a fibrillar inclusion. Scale bar¼ 10 mm.



fibrillar inclusions (Fig. 6C and D). As a control to normalizeFRET values between inclusion types, we captured a cell thatformed both fibrillar and globular inclusions (Fig. 6E and F,white arrows F, G). As seen in cells forming only one type inclu-sion, fibrillar formation caused a drastic increase in FRET effi-ciency whereas globular formation caused little to no FRETchanges above background values (Fig. 6E and F).

Full-length, endogenous huntingtin is actively recruited toglobular inclusions and sequestered within fibrillarinclusions

In order to validate the physiological relevance of studying hun-tingtin exon1 inclusions, we wanted to test whether endogenoushuntingtin could be recruited and sequestered to sites of mutanthuntingtin aggregation. Most standard methods of cell fixationfor IF fall within two categories: the crosslinking (aldehydes)and the denaturing (alcohol) fixatives. Therefore, we tried bothfixation methods with a variety of permeabilization techniquesto determine which would be optimal to assay the presence of en-dogenous huntingtin within exon1 inclusions. To label endogen-ous huntingtin, we chose validated huntingtin monoclonalantibodies 1HU4C8 (MAB2166) which recognizes an epitope

between amino acids 181–810 of huntingtin and HDC8A4which recognizes amino acids 2703–2911. These antibodieswere generated to huntingtin epitopes downstream of exon1(amino acids 1–81) and therefore do not recognize the overex-pressed Ex1 Q138-YFP. To control for spectral bleed throughbetween channels due to the high fluorescence intensity of theinclusions, all primary antibodies were indirectly labelled witha Cy5 conjugated secondary antibody that is spectrally distinctfrom YFP. Fixation with paraformaldehyde (PFA) followed byantigen retrieval using formic acid and permeabilization with adetergent allowed us to detect full length, endogenous huntingtinat fibrillar (Fig. 7A and C) but not globular (Fig. 7B and D) inclu-sions using both 1HU4C8 (Fig. 7A and B) and HDC8A4 (Fig. 7Cand D) antibodies. Alternatively, fixation and permeabilizationwith methanol, which denatures cellular proteins by disruptinghydrophobic interactions, caused loss of the fluorescence at theglobular but not the fibrillar type of inclusion (SupplementaryMaterial Fig. S4a). Notably, 1HU4C8 (Supplementary Material,Fig. S4b), MAB2168 (Supplementary Material, Fig. S4c) andHDC8A4 (Supplementary Material, Fig. S4d) antibodiesdetected full-length huntingtin within the fibrillar inclusionsunder these conditions. Despite attempting every permutationof fixative and permeabilization agents to perform IF, we were

Figure 7. Full-length, endogenous huntingtin is actively recruited and sequestered within fibrillar inclusions. Representative IF images of STHdhQ7/Q7 cells expres-sing Ex1 Q138-YFP followed by fixation with 4% PFA, antigen retrieval using 10% formic acid and permeabilization using Triton X-100 detergent. IF was performedusing both (A and B) 1HU4C8 and (C and D) HDC8A4 monoclonal antibodies on either (A and C) fibrillar or (B and D) globular huntingtin inclusions. Primary anti-bodies were indirectly labelled with secondary antibodiesconjugated with Cy5 to prevent spectralbleedthrough due to the high fluorescence intensity of the inclusions.Inclusions of interest are denoted with an arrow, where G refers to a globular inclusion, and F refers to a fibrillar inclusion. Scale bar ¼ 10 mm.









never able to identify increased endogenous huntingtin at globu-lar inclusions. This result was consistent with the fragmentFRET and FRAP data, where soluble huntingtin had a low resi-dence time in globular inclusions.

N17 phospho-mutants influence huntingtin inclusionmorphology

Phospho-modifications of serine residues 13 and 16 within N17have been shown to affect the localization and toxicity of hunting-tin within the cell (42,44,45). Previous work by others withsynthetic huntingtin 1–50 peptides have shown that phospho-mimicry at serines 13 and 16 alters inclusion morphology invitro (45). In order to assay the effects of phospho-mutations onthe type of inclusions formed in live cells, we generated mutanthuntingtin Ex1 Q142-YFP constructs with serines 13 and 16mutated to glutamic acids (S13ES16E) to mimic phosphorylationor to alanines (S13AS16A) to render N17 resistant to phosphoryl-ation. A polyglutamine repeat length of 142 was considered to besimilar to the 138 polyglutamine length, so Ex1 Q138-YFPwithout serine mutations was used as a control. When overex-pressed in STHdhQ7/Q7 cells, the huntingtin phospho-mimetic

(S13ES16E) mutant predominantly formed the fibrillar type of in-clusion (Fig.8A). Conversely, the alanine mutationskewed the in-clusion population towards the globular type of inclusion(Fig. 8A). As expected, the polyglutamine expanded N17 wildtype constructs produced a mixed phenotype of both fibrillarand globular types of inclusions, as residues S13 and S16 canexist in both phospho-states (Fig. 8A). We also observed theeffect on inclusion morphology of fusing YFP to the amino-terminus of the exon1 mutants (Fig. 8B). Consistent with thecarboxyl-terminus tagged constructs, phospho-mimetic mutantsformed more fibrillar and phospho-resistant mutants formedmore globular inclusions (Fig. 8B). This suggested that the loca-tion of the fluorescent tag on huntingtin fragments can alter inclu-sion formation properties, but does not affect the type of inclusionformed by altering the phosphorylation status.

Kinase inhibitors influence huntingtin inclusion morphology

In order to study the effects of true phospho-modulation on thetype of inclusion formed by amino-terminal huntingtin frag-ments, we used kinase inhibitors known to either inhibit orpromote phosphorylation of huntingtin at serine residues 13

Figure 8. Phosphorylation state of N17 S13 and S16 can influence the fate of the inclusion type. Quantification of percent transfected cells with globular (white bars) orfibrillar (grey bars) inclusions following expression in STHdhQ7/Q7 of (A) Ex1 Q138-YFP or (B) YFP-Ex1 Q138 constructs with serines 13 and 16 mutated to eitheralanines (S13AS16A) or glutamic acids (S13ES16E). NS, not significant, ∗P ¼ 0.029, ∗∗P ¼ 0.009 and ∗∗∗P , 0.001. N ¼ 4, n ¼ 150. (C) Quantification of percenttransfected cells with either fibrillar or globular inclusions for Ex1 Q138-YFP following either no treatment or treatment with CK2 and IKK inhibitors (2 mM DMAT,1 mM quinalizarin, 4 mM BMS-345541, 2 mM IMD-0354 and 5 mM Bay 11–7082). NS, not significant, ∗P ¼ 0.029, ∗∗P ¼ 0.009. n ¼ 150, N ¼ 3. (D) Differentialmigration of mCer-Ex1 Q138-YFP inclusions following treatment with CK2 or IKK inhibitors (1 mM DMAT and 5 mM Bay 11–7082) under native non-denaturingconditions. All bands migrate at �440 kDa.



and 16 of N17. Phosphorylation at N17 can be inhibited by caseinkinase 2 (CK2) inhibitors DMAT and quinalizarin (44). Con-versely, N17 phosphorylation can be promoted by treatmentswith IKK inhibitors, the ATP analog Bay 11-7082, and the allo-steric inhibitors BMS-345541 and IMD-0354 (44). STHdhQ7/Q7

cells overexpressing Ex1 Q138-YFP treated with CK2 inhibitorshad little effect on the type of inclusion formed in the cell,whereas the IKK inhibitors skewed the cellular inclusion popu-lation towards the fibrillar type (Fig. 8C). These results suggestthat the fate of inclusions that form in the cell can be influencedby kinase inhibitors or other small molecules that alter the phos-phorylation state of serines 13 and 16 of N17.

To further validate the effect of small molecules on inclusiontype, we treated STHdhQ7/Q7 cells expressing Ex1 Q138-YFPwith either CK2 or IKK beta inhibitors and looked at the inclu-sion migration under non-denaturing conditions using poly-acrylamide gel electrophoresis (PAGE). Native PAGEmaintains the folded structure/conformation and the hydro-dynamic size of proteins, thus mobility varies with changes inthe biophysical properties of the huntingtin inclusions. Consist-ent with data that IKK inhibitors skew the cellular inclusionpopulation towards the fibrillar type of inclusions, we notedthat these inclusions migrated further since they are moretightly packed (Fig. 8D). Conversely, CK2 inhibitor treatmentof cells had little effect on inclusion type (Fig. 8C) and alsodid not alter the migration of inclusions relative to untreatedusing native PAGE (Fig. 8D).

DISCUSSION

The concept that mutant huntingtin can form multiple types ofinclusions has previously been proposed by others, based onobservations with small huntingtin fragments in cell culture andsynthetic protein in vitro at super-physiological concentrations(40,45,61). Fibrillar and heterogeneous morphology inclusionshave also been noted in HD brains (14). The formation of amorph-ous or amyloid aggregates is initiated by the presence of abnor-mally folded protein. Past studies have described a pathway forthe formation of amyloid aggregates where abnormally foldedmonomers initiate the formation of oligomeric intermediates.These intermediates have been described to be globular in shapeand lead to the formation of fibrillar aggregates (62). The globularinclusions described in this study were not the same as the inter-mediates since we never observed the direct conversion of globu-lar to fibrillar inclusions. These two types of inclusions weretherefore identified as two distinct terminal forms of aggregatedmutant huntingtin. We also concluded that these inclusionswere not aggresomes, a type of cytoplasmic aggregate thatforms at the centrosome, since neither inclusion type was foundto localize to the centrosome or cause the characteristic redistribu-tion of vimentin to the periphery of the inclusions (63).

This manuscript characterizes different inclusion types basedon a number of biophysical properties in live cells. A thioflavin-Tfluorescent staining assay shows that the fibrillar type of inclusionhas a detectable amyloid fibril structure and that the globular typedoes not. Notably, both types of inclusions were positive for ubi-quitin, a characteristic of misfolded protein. Using biophotonictechniques including FLIM-FRET, seFRET, FRAP, deconvolu-tion and temporal imaging, we observed that the fibrillar and

globular inclusion types formed by polyglutamine expanded hun-tingtin have distinct morphological, structural and dynamic prop-erties in live cells. We consistently measured increased FRETefficiency of the huntingtin sensor in fibrillar inclusions relativeto the globular type, regardless of the intensity and size of the in-clusion formed. Notably, intermolecular FRET between multiplehuntingtin molecules represented the majority of the FRET mea-sured at both inclusion types,witha small contribution of intramo-lecular FRET between the N17 and polyproline domains.Therefore, the higher FRET values we observed within fibrillarinclusions represented a tighter, more compact and structured or-ganization of huntingtin fragments, as compared with the globularinclusions.

Using FRAP, we demonstrated that globular and fibrillar inclu-sions formed by mutant huntingtin fragments have very distinctrecruitment dynamics. FRAP studies have been performed onmultiple polyglutamine protein inclusions to show heterogeneityin the dynamics of inclusions from different diseases.This impliesthat the context of polyglutamine is important and regions flank-ing the polyglutamine tracts may contribute to differentdynamic properties in different polyglutamine disease proteins(64). Here, we describe that inclusion heterogeneity can existwithin one polyglutamine disease protein, mediated by post-translational modifications of a flanking region. We noted that fol-lowing photobleaching of inclusions, the soluble huntingtin in thecell was recruited back into globular inclusions significantly morerapidly relative to thefibrillar typeof inclusions.Wedemonstratedthat soluble huntingtin was actively being shuttled into globularinclusions along microtubules. Treatment of cells expressingmutant exon1 fragments with low concentrations of nocodazoleprevented the formation of large globular inclusions and causeda redistribution of smaller inclusions throughout the cell. Theseresults are consistent with previous research that has shown thathuntingtin plays a critical role in cytoskeletal dynamics and inter-acts directly with microtubules (65).

Temporal experiments done with an incubated microscopeshowed that fibrillar inclusion formation caused all the solublemutant huntingtin in the cell to be progressively recruited andsequestered within the inclusion. These data suggested that thehuntingtin within fibrillar inclusions remained relatively staticand was not being dynamically exchanged between the solubleand insoluble phases. Conversely, when the globular typeformed, these inclusions quickly grew and maintained theirsize without affecting the fluorescence of the soluble huntingtinwithin the cells. This suggested that there was a constantdynamic exchange between the soluble and insoluble phases inthese inclusions.

Using site directed mutagenesis, we demonstrated thatS13ES16E or S13AS16A mutants in the context of polygluta-mine-expanded exon1 were enough to push the cellular popula-tion of inclusions towards the fibrillar or globular type,respectively. This observation is consistent with work done byothers using purified synthetic huntingtin 1–56 Q37 constructswith either phospho-mimetic or alanine mutations at serine resi-dues 13 and 16 expressed in vitro (45). Using electron micros-copy, they discovered that huntingtin peptides with S13 andS16 mutations can associate to form morphologically differentinclusion types (45). Despite this, our data showed that constitu-tive phospho-mimicry or alanine mutations at these sites did notskew the population of inclusions entirely to one form or the



other, suggesting that other factors can influence inclusion fatewithin the cell. We hypothesize that these auxiliary factorscould be other post-translational modifications or molecularinteractions with either N17 or the polyproline domain. Arecent study by our group has shown that N17 phosphorylationcan affect soluble huntingtin conformation (41), and we hy-pothesize that these conformational differences can influencethe nucleation and properties of an inclusion when high levelsof protein are present.

Previous work has shown that mutant huntingtin is hypo-phosphorylated at serines 13 and 16 of N17 and that increasingphosphorylation at these sites can reduce the toxicity of themutant protein (44). Others have demonstrated that promotingphosphorylation at these residues can dramatically improvemotor function in an HD mouse model (46). In this study, weshow that the type of inclusion formed by mutant huntingtincan be affected by small molecule kinase inhibitors that modu-late the phospho-state of serine residues 13 and 16 of N17,described by us previously (44).

The distinct properties of these huntingtin inclusions suggestthat one type may represent a toxic form, whereas the other maybe benign or even protective to the cell. The globular inclusionswere shown to have a looser packing of mutant huntingtin,which allowed for the rapid recruitment and continuous exchangeof mutant protein with the soluble phase. Additionally, S13AS16Amutations skewed the population of inclusions toward the globulartype. Conversely, fibrillar inclusions were shown to be denselypacked and soluble mutant huntingtin was slowly recruited andsequestered within these inclusions (see model, Fig. 9). This se-questration of the mutant protein within the fibrillar inclusionscould represent a cellular stress response to cope with mutanthuntingtin load.

Many groups have shown that transgenic mice expressingexon1 of huntingtin rapidly develop motor and cognitive symp-toms comparable to HD (15). Despite the striking phenotypes inthese transgenic animals, the question of whether this small frag-mentoccurs naturally in the brains of HDpatientshas been contro-versial. However, recent work has elegantly shown that aberrantsplicing of the huntingtin pre-mRNA leads to the translation ofanexon1 fragment ina varietyofHDmodelsand human HDfibro-blasts (23). This work supports the hypothesis that exon1 frag-ments can occur naturally in abundance within neurons andother cells. However, a caveat of our studies, and those of othersusing small fragment over-expression, is that the protein concen-trations are either super-physiological, or only relevant to neuronsin late-stage HD with a massive accumulation of mutant protein.Regardless, the characterization of inclusions in late or severe HDcould provide insight into huntingtin properties in early HD oreven premanifest HD, which is likely the therapeutic window inthis disease.

Using FRET techniques in live cells to visualize inclusionsprovides a valuable tool to accurately measure the unique con-formational/structural differences for each type of inclusionwithin a cell. Additionally, FRET offers an added level of infor-mation by providing high spatial resolution, beyond even that ofsuper-resolution microscopy. This assay is amenable to high-content screening since it provides a reliable and robust pheno-typic read-out of inclusion type. This would allow for the screen-ing of compounds that could skew the cellular population ofinclusions towards one type or the other. Furthermore, since

inclusion formation is a characteristic of most neurodegenera-tive disorders, a FRET sensor to quantify different inclusiontypes could be adapted to other neurodegenerative disease pro-teins.

MATERIALS AND METHODS

Tissue culture

Immortalized mouse striatal STHdhQ7/Q7 cells were grown aspreviously described (42).

Plasmid construct

The huntingtin exon1 Q138 sensor was generated from cDNAusing forward primer GATCTCCGGAATGGCGACCCTGwith a BspEI restriction site and reverse primer GATCGGTACCGGGTCGGTGCAGCGGCTC with an Acc65I site. ThePCR insert was then cloned into either a YFP-N1 plasmid (Clon-tech) or a modified mCerulean-C1 plasmid (Clontech) with aneYFP insert cloned into BamHI and XbaI sites at the opposingend of the multiple cloning site. The HA-tagged constructswere generated using synthetic oligos (MOBIX) GATCCTACCCATACGATGTTCCAGATTACGCTT with a BamHIrestriction site overhang and CTAGAAGCGTAATCTGGAACATCGTATGGGTAG with an XbaI restriction site overhang.The insert was then cloned into a huntingtin exon1 Q138 orhuntingtin 1–171 Q138 vector.

Figure 9. Model of the dynamics of two distinct inclusion types formed frommutant huntingtin protein. Soluble huntingtin exon1 with a CAG expansionbeyond 37 repeats adopts an open conformation, pushing N17 and polyprolineout of alignment. Globular inclusions can form, and readily exchange proteinwith the soluble phase, likely allowing mutant huntingtin to interact functionallyin pathways required by normal huntingtin. Fibrillar inclusions can also form, es-pecially if N17 is phosphorylated, causing tightly-packed protein deposits that donot exchange with the soluble phase, thus are protective in HD. We did notobserve one inclusion type directly converting to another.



Transfection

Transfection of STHdhQ7/Q7 cells was done using TurboFect invitro reagent (Fermentas, R0531) as previously described (41).

Primary antibodies

The huntingtin specific mouse monoclonal 1HU 4C8 (MilliporeInternational, MAB2166) and HDC8A4 (Pierce Antibodies,MA1-82100) antibodies were used to perform IF of endogenoushuntingtin in STHdhQ7/Q7 cells.

Immunofluorescence

Immunofluorescence on STHdhQ7/Q7 cells to visualize endogen-ous huntingtin was done either using the antigen retrieval or themethanol method. For the antigen retrieval method, cells werefixed with 4% PFA for 20 min at 48C. Cells were then washed2× with PBS and treated with 10% formic acid for 20 min atroom temperature. Cells were then washed again 2× with PBSand subsequently permeabilized with Triton X-100 detergent(BioShop, TRX777.100) for 10 min at room temperature.Using the methanol method, cells were fixed and permeabilizedusing ice-cold methanol for 12 min at 2208C. Consistentbetween both methods, cells were then blocked 3× with 2%FBS in PBS blocking solution. Primary antibodies were addedto cells at a concentration of 1:100 in a solution of 2% FBS inPBS with 0.02% Tween 20 (Sigma, P9416). Antibodies werethen labelled with the far-red Cy5 (Molecular Probes, A10524)(ex 650 nm/em 670 nm) dye at a concentration of 1:500.

To visualize overexpressed huntingtin HA-tagged constructs,IF was done using the antigen retrieval method described above.Primary antibody to the HA tag (Abcam, AB16918) was added tothe cells at a concentration of 1:250 in a solution of 2% FBS inPBS with 0.02% TWEEN20. Antibody was then labeled withthe AlexaFluor 488 (Molecular Probes, A21206) (ex 499 nm/em 519 nm) dye at a concentration of 1:500.

For visualization of ubiquitin, IF was done using antigen re-trieval method with an anti-ubiquitin antibody (Sigma,SAB4503053) added to the cells at a concentration of 1:100 in asolution of 2% FBS in PBS with 0.02% Tween 20. For visualiza-tion of b-tubulin, IF was done with 4% PFA fixation withoutantigen retrieval with an anti b-tubulin antibody (University ofIowa Hybridoma Bank, E7-S) at a concentration of 1:250 in 2%FBS in PBS with 0.02% Tween 20. Both anti-ubiquitin and antib-tubulin primary antibodies were labelled with Cy5 dye at a con-centration of 1:500.

Imaging

Live cell temporal videos of inclusion formation were acquiredwith a 40× air objective using a Lumascope 500 inverted wide-field epifluorescent microscope (Etaluma Inc., Carlsbad, CA,USA) housed in an incubator regulated at 338C with 5% CO2.

Inclusion imaging was done with a 60× oil immersion object-ive (PlanApo NA ¼ 1.4) on a Nikon Eclipse Ti2000 invertedwidefield epifluorescent microscope using the Orca-Flash4.0CMOS camera (Hamamatsu, Japan). Image acquisition wasdone using the NIS-Elements Advanced Research version4.10.01 64-bit acquisition software from Nikon (USA). z-Stacks

of inclusions were acquired using a motorized stage (Prior Scien-tific, USA) with step sizes of 0.3–0.5 mm. Deconvolution wasdone on z-stacks using the AutoQuant blind deconvolutionmodule as part of the NIS-Elements version 4.10.01 softwarepackage (Nikon). Iso-surface rendering on inclusions wasapplied using the Imaris software from Bitplane (AG).

Thioflavin-T amyloid fibril staining

After 24 h of expression of Ex1 Q138-mRFP, transfectedSTHdhQ7/Q7 cells were fixed with 4% PFA for 30 min andstained with 0.05% thioflavin-T (Sigma, T3516) for 8 min. Cellswere washed 3× with PBS and imaged. Positive control for theassay was STHdhQ7/Q7 cells transfected with Ab 1–42-mRFPwith 24 h of expression. Cells were fixed and stained as describedabove.

Native polyacrylamide gel electrophoresis

Cell samples were lysed using an NP-40 lysis buffer on ice for15 min. Supernatants were collected and the remaining pelletwas resuspendend in NP-40 lysis buffer and sonicated. Proteinconcentrations for soluble and insoluble fractions were calcu-lated using a Bradford assay. Samples were prepared with a non-reducing loading buffer without boiling. The 7% acrylamide gelsand running buffers were prepared without SDS or any other re-ducing agents.

Small molecule treatments

Transfected STHdhQ7/Q7 cells were treated with compounds atconcentrations optimized previously (44). Cells were treatedwith compounds for �16 h prior to experiments.

Time-Domain FLIM and analysis

Time-domain FLIM and analysis of FLIM data were performedas previously described (41,49).

Sensitized emission FRET

seFRET was performed using the FRET module as part ofNIS-Elements version 4.10.01. All controls were performed asrequired by the FRET module. Percent FRET efficiency valueswere calculated by the module using equations derived fromthe Gordon method. A rainbow look-up table was applied tothe ratiometric FRET image to show the range of FRET effi-ciency values.

Statistical analysis

All statistical analyses were done using the SigmaPlot software11.0 (Systat Software Inc.). For comparisons between twogroups, Student’s t-tests were performed if data passed the nor-mality assumptions. If data did not pass the normality test, itwas analyzed by the Mann–Whitney method. For multiple pair-wise comparisons, one-way analysis of variance (ANOVA)using the Student–Newman–Keuls method was performed ifthe data passed the normality test of distribution. If the data didnot pass the normality assumptions, then we performed a



one-way ANOVA on ranks using the Tukey test. For FLIM quan-tifications, every cell was represented as its own N and the box-whisker plot graph was generated using cumulative data fromthree-independent trials.

SUPPLEMENTARY MATERIAL

Supplementary material is available at HMG online.

Conflict of Interest statement. None declared.

FUNDING

This work was supported with operating grants to R.T. fromthe Huntington Society of Canada, the Canadian Institutes ofHealth Research (CIHR MOP-119391) and the KrembilFamily foundation.

REFERENCES

1. The Huntington’s Disease Collaborative Research Group (1993) A novelgene containing a trinucleotide repeat that is expanded and unstable onHuntington’s disease chromosomes. Cell, 72, 971–983.

2. Duyao, M., Ambrose, C., Myers, R., Novelletto, A., Persichetti, F., Frontali,M., Folstein, S., Ross, C., Franz, M., Abbott, M. et al. (1993) Trinucleotiderepeat length instability and age of onset in Huntington’s disease. Nat.Genet., 4, 387–392.

3. Stine, O.C., Pleasant, N., Franz, M.L., Abbott, M.H., Folstein, S.E. and Ross,C.A. (1993) Correlation between the onset age of Huntington’s disease andlength of the trinucleotide repeat in IT-15. Hum. Mol. Genet., 2, 1547–1549.

4. Block-Galarza, J., Chase, K.O., Sapp, E., Vaughn, K.T., Vallee, R.B.,DiFiglia, M. and Aronin, N. (1997) Fast transport and retrograde movementof huntingtin and HAP 1 in axons. Neuroreport, 8, 2247–2251.

5. Caviston, J.P., Ross, J.L., Antony, S.M., Tokito, M. and Holzbaur, E.L.(2007) Huntingtin facilitates dynein/dynactin-mediated vesicle transport.Proc. Natl. Acad. Sci. USA, 104, 10045–10050.

6. Gauthier, L.R., Charrin, B.C., Borrell-Pages, M., Dompierre, J.P., Rangone,H., Cordelieres, F.P., De Mey, J., MacDonald, M.E., Lessmann, V.,Humbert, S. et al. (2004) Huntingtin controls neurotrophic support andsurvival of neurons by enhancing BDNF vesicular transport alongmicrotubules. Cell, 118, 127–138.

7. Li, S.H., Cheng, A.L., Zhou, H., Lam, S., Rao, M., Li, H. and Li, X.J. (2002)Interaction of Huntington disease protein with transcriptional activator Sp1.Mol. Cell. Biol., 22, 1277–1287.

8. Sugars, K.L. and Rubinsztein, D.C. (2003) Transcriptional abnormalities inHuntington disease. Trends Genet., 19, 233–238.

9. Zuccato, C., Ciammola, A., Rigamonti, D., Leavitt, B.R., Goffredo, D.,Conti, L., MacDonald, M.E., Friedlander, R.M., Silani, V., Hayden, M.R.et al. (2001) Loss of huntingtin-mediated BDNF gene transcription inHuntington’s disease. Science, 293, 493–498.

10. Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M., Conti, L.,Cataudella, T., Leavitt, B.R., Hayden, M.R., Timmusk, T. et al. (2003)Huntingtin interacts with REST/NRSF to modulate the transcription ofNRSE-controlled neuronal genes. Nat. Genet., 35, 76–83.

11. DiProspero, N.A.,Chen, E.Y.,Charles, V., Plomann,M., Kordower, J.H. andTagle, D.A. (2004) Early changes in Huntington’s disease patient brainsinvolve alterations in cytoskeletal and synaptic elements. J. Neurocytol., 33,517–533.

12. Munsie, L., Caron, N., Atwal, R.S., Marsden, I., Wild, E.J., Bamburg, J.R.,Tabrizi, S.J. and Truant, R. (2011) Mutant huntingtin causes defective actinremodeling during stress: defining a new role for transglutaminase 2 inneurodegenerative disease. Hum. Mol. Genet., 20, 1937–1951.

13. Shirasaki, D.I., Greiner, E.R., Al-Ramahi, I., Gray, M., Boontheung, P.,Geschwind, D.H., Botas, J., Coppola, G., Horvath, S., Loo, J.A. et al. (2012)Network organization of the huntingtin proteomic interactome inmammalian brain. Neuron, 75, 41–57.

14. DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel,J.P. and Aronin, N. (1997) Aggregation of huntingtin in neuronal

intranuclear inclusions and dystrophic neurites in brain. Science, 277, 1990–1993.

15. Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A.,Hetherington, C., Lawton, M., Trottier, Y., Lehrach, H., Davies, S.W. et al.(1996) Exon 1 of the HD gene with an expanded CAG repeat is sufficient tocause a progressive neurological phenotype in transgenic mice. Cell, 87,493–506.

16. Davies, S.W., Turmaine, M., Cozens, B.A., DiFiglia, M., Sharp, A.H., Ross,C.A., Scherzinger, E., Wanker, E.E., Mangiarini, L. and Bates, G.P. (1997)Formation of neuronal intranuclear inclusions underlies the neurologicaldysfunction in mice transgenic for the HD mutation. Cell, 90, 537–548.

17. Goldberg, Y.P., Nicholson, D.W., Rasper, D.M., Kalchman, M.A., Koide,H.B., Graham, R.K., Bromm, M., Kazemi-Esfarjani, P., Thornberry, N.A.,Vaillancourt, J.P. et al. (1996) Cleavage of huntingtin by apopain, aproapoptoticcysteine protease, is modulated by the polyglutamine tract. Nat.Genet., 13, 442–449.

18. Kim, Y.J., Yi, Y., Sapp, E., Wang, Y., Cuiffo, B., Kegel, K.B., Qin, Z.H.,Aronin, N. and DiFiglia, M. (2001) Caspase 3-cleaved N-terminal fragmentsof wild-type and mutant huntingtin are present in normal and Huntington’sdisease brains, associate with membranes, and undergo calpain-dependentproteolysis. Proc. Natl. Acad. Sci. USA, 98, 12784–12789.

19. Wellington, C.L., Ellerby, L.M., Hackam, A.S., Margolis, R.L., Trifiro,M.A., Singaraja, R., McCutcheon, K., Salvesen, G.S., Propp, S.S., Bromm,M. et al. (1998) Caspase cleavage of gene products associated with tripletexpansion disorders generates truncated fragments containing thepolyglutamine tract. J. Biol. Chem., 273, 9158–9167.

20. Wellington, C.L., Ellerby, L.M., Gutekunst, C.A., Rogers, D., Warby, S.,Graham, R.K., Loubser, O., van Raamsdonk, J., Singaraja, R., Yang, Y.Z.et al. (2002) Caspase cleavage of mutant huntingtin precedesneurodegeneration in Huntington’s disease. J. Neurosci. , 22, 7862–7872.

21. Hoffner, G., Island, M.L. and Djian, P. (2005) Purification of neuronalinclusions of patients with Huntington’s disease reveals a broad range ofN-terminal fragments of expanded huntingtin and insoluble polymers. J.Neurochem., 95, 125–136.

22. Landles, C., Sathasivam, K., Weiss, A., Woodman, B., Moffitt, H.,Finkbeiner, S., Sun, B., Gafni, J., Ellerby, L.M., Trottier, Y. et al. (2010)Proteolysis of mutant huntingtin produces an exon 1 fragment thataccumulates as an aggregated protein in neuronal nuclei in Huntingtondisease. J. Biol. Chem., 285, 8808–8823.

23. Sathasivam, K., Neueder, A., Gipson, T.A., Landles, C., Benjamin, A.C.,Bondulich, M.K., Smith, D.L., Faull, R.L., Roos, R.A., Howland, D. et al.(2013) Aberrant splicing of HTT generates the pathogenic exon 1 protein inHuntington disease. Proc. Natl. Acad. Sci. USA, 110, 2366–2370.

24. Ross, C.A. and Poirier, M.A. (2004) Protein aggregation andneurodegenerative disease. Nat. Med., 10(Suppl), S10–S17.

25. Hardy, J.A. and Higgins, G.A. (1992) Alzheimer’s disease: the amyloidcascade hypothesis. Science, 256, 184–185.

26. Hardy, J. and Allsop, D. (1991) Amyloid deposition as the central event in theaetiology of Alzheimer’s disease. Trends Pharmacol. Sci., 12, 383–388.

27. Glabe, C.G. (2006) Common mechanisms of amyloid oligomerpathogenesis in degenerative disease. Neurobiol. Aging, 27, 570–575.

28. Cooper, J.K., Schilling, G., Peters, M.F., Herring, W.J., Sharp, A.H.,Kaminsky, Z., Masone, J., Khan, F.A., Delanoy, M., Borchelt, D.R. et al.(1998) Truncated N-terminal fragments of huntingtin with expandedglutamine repeats form nuclear and cytoplasmic aggregates in cell culture.Hum. Mol. Genet., 7, 783–790.

29. Hackam, A.S., Singaraja, R., Wellington, C.L., Metzler, M., McCutcheon,K., Zhang, T., Kalchman, M. and Hayden, M.R. (1998) The influence ofhuntingtin protein size on nuclear localization and cellular toxicity. J. CellBiol., 141, 1097–1105.

30. Preisinger, E., Jordan, B.M., Kazantsev, A. and Housman, D. (1999)Evidence for a recruitment and sequestration mechanism in Huntington’sdisease. Philos. Trans. R. Soc. London B Biol. Sci., 354, 1029–1034.

31. Gunawardena, S., Her, L.S., Brusch, R.G., Laymon, R.A., Niesman, I.R.,Gordesky-Gold, B., Sintasath, L., Bonini, N.M. and Goldstein, L.S. (2003)Disruption of axonal transport by loss of huntingtin or expression ofpathogenic polyQ proteins in Drosophila. Neuron, 40, 25–40.

32. Bence, N.F., Sampat, R.M. and Kopito, R.R. (2001) Impairment of theubiquitin-proteasome system by protein aggregation. Science, 292, 1552–1555.

33. Saudou, F., Finkbeiner, S., Devys, D. and Greenberg, M.E. (1998)Huntingtin acts in the nucleus to induce apoptosis but death does notcorrelate with the formation of intranuclear inclusions. Cell, 95, 55–66.




34. Arrasate, M., Mitra, S., Schweitzer, E.S., Segal, M.R. and Finkbeiner, S.(2004) Inclusion body formation reduces levels of mutant huntingtin and therisk of neuronal death. Nature, 431, 805–810.

35. Nagai, Y., Inui, T., Popiel, H.A., Fujikake, N., Hasegawa, K., Urade, Y.,Goto, Y., Naiki, H. and Toda, T. (2007) A toxic monomeric conformer of thepolyglutamine protein. Nat. Struct. Mol. Biol., 14, 332–340.

36. Chopra, V., Fox, J.H., Lieberman, G., Dorsey, K., Matson, W., Waldmeier,P., Housman, D.E., Kazantsev, A., Young, A.B. and Hersch, S. (2007) Asmall-molecule therapeutic lead for Huntington’s disease: preclinicalpharmacology and efficacy of C2–8 in the R6/2 transgenic mouse. Proc.Natl. Acad. Sci. USA, 104, 16685–16689.

37. Bodner, R.A., Housman, D.E. and Kazantsev, A.G. (2006) New directionsfor neurodegenerative disease therapy: using chemical compounds to boostthe formation of mutant protein inclusions. Cell Cycle, 5, 1477–1480.

38. Truant, R., Atwal, R.S., Desmond, C., Munsie, L. and Tran, T. (2008)Huntington’s disease: revisiting the aggregation hypothesis inpolyglutamine neurodegenerative diseases. FEBS J., 275, 4252–4262.

39. Truant, R., Raymond, L.A., Xia, J., Pinchev, D., Burtnik, A. and Atwal, R.S.(2006) Canadian Association of Neurosciences Review: polyglutamineexpansion neurodegenerative diseases. Can. J. Neurol. Sci. , 33, 278–291.

40. Duennwald, M.L., Jagadish, S., Muchowski, P.J. and Lindquist, S. (2006)Flanking sequences profoundly alter polyglutamine toxicity in yeast. Proc.Natl. Acad. Sci. USA, 103, 11045–11050.

41. Caron, N.S., Desmond, C.R., Xia, J. and Truant, R. (2013) Polyglutaminedomain flexibility mediates the proximity between flanking sequences inhuntingtin. Proc. Natl. Acad. Sci. USA, 110, 14610–14615.

42. Atwal, R.S., Xia, J., Pinchev, D., Taylor, J., Epand, R.M. and Truant, R.(2007) Huntingtin has a membrane association signal that can modulatehuntingtin aggregation, nuclear entry and toxicity. Hum. Mol. Genet., 16,2600–2615.

43. Rockabrand, E., Slepko, N., Pantalone, A., Nukala, V.N., Kazantsev, A.,Marsh, J.L., Sullivan, P.G., Steffan, J.S., Sensi, S.L. and Thompson, L.M.(2007) The first 17 amino acids of Huntingtin modulate its sub-cellularlocalization, aggregation and effects on calcium homeostasis. Hum. Mol.Genet., 16, 61–77.

44. Atwal, R.S., Desmond, C.R., Caron, N., Maiuri, T., Xia, J., Sipione, S. andTruant, R. (2011) Kinase inhibitors modulate huntingtin cell localization andtoxicity. Nat. Chem. Biol., 7, 453–460.

45. Gu, X., Greiner, E.R., Mishra, R., Kodali, R., Osmand, A., Finkbeiner, S.,Steffan, J.S., Thompson, L.M., Wetzel, R. and Yang, X.W. (2009) Serines 13and 16 are critical determinants of full-length human mutant huntingtininduced disease pathogenesis in HD mice. Neuron, 64, 828–840.

46. Di Pardo, A., Maglione, V., Alpaugh, M., Horkey, M., Atwal, R.S., Sassone,J., Ciammola, A., Steffan, J.S., Fouad, K., Truant, R. et al. (2012)Ganglioside GM1 induces phosphorylation of mutant huntingtin andrestores normal motor behavior in Huntington disease mice. Proc. Natl.Acad. Sci. USA, 109, 3528–3533.

47. Burnett, B.G., Andrews, J., Ranganathan, S., Fischbeck, K.H. and DiProspero, N.A. (2008) Expression of expanded polyglutamine targetsprofilin for degradation and alters actin dynamics. Neurobiol. Dis., 30, 365–374.

48. Modregger, J., DiProspero, N.A., Charles, V., Tagle, D.A. and Plomann, M.(2002) PACSIN 1 interacts with huntingtin and is absent from synapticvaricosities in presymptomatic Huntington’s disease brains. Hum. Mol.Genet., 11, 2547–2558.

49. Caron, N.S., Munsie, L.N., Keillor, J.W. and Truant, R. (2012) UsingFLIM-FRET to measure conformational changes of transglutaminase type 2in live cells. PloS ONE, 7, e44159.

50. Van Der Meer, B.W., Coker, I. and Chen, S.Y.S. (1994) Resonance Energy

Transfer: Theory and Data. VCH, New York.

51. Gustafsson, M.G. (2000) Surpassing the lateral resolution limit by a factor oftwo using structured illumination microscopy. J. Microsc., 198, 82–87.

52. Groenning, M. (2010) Binding mode of Thioflavin T and other molecularprobes in the context of amyloid fibrils-current status. J. Chem. Biol., 3,

1–18.

53. Rizzo, M.A., Springer, G.H., Granada, B. and Piston, D.W. (2004) Animprovedcyan fluorescent protein variant useful for FRET. Nat. Biotechnol.,22, 445–449.

54. Rizzo, M.A., Springer, G., Segawa, K., Zipfel, W.R. and Piston, D.W. (2006)Optimization of pairings and detection conditions for measurement of FRETbetween cyan and yellow fluorescent proteins. Microsc. Microanal. , 12,

238–254.

55. Chen, Y., Mills, J.D. and Periasamy, A. (2003) Protein localization in livingcells and tissues using FRET and FLIM. Differentiation, 71, 528–541.

56. Wallrabe, H. and Periasamy, A. (2005) Imaging protein molecules usingFRET and FLIM microscopy. Curr. Opin. Biotechnol., 16, 19–27.

57. Tsien, R.Y., Bacskai, B.J. and Adams, S.R. (1993) FRET for studyingintracellular signalling. Trends Cell Biol., 3, 242–245.

58. Meyvis, T.K., De Smedt, S.C., Van Oostveldt, P. and Demeester, J. (1999)Fluorescence recovery after photobleaching: a versatile tool for mobility and

interaction measurements in pharmaceutical research. Pharm. Res., 16,1153–1162.

59. Howell, J.L. and Truant, R. (2002) Live-cell nucleocytoplasmic proteinshuttle assay utilizing laser confocal microscopy and FRAP. BioTechniques,

32, 80–82, 84, 86–87.

60. Goedhart, J., von Stetten, D., Noirclerc-Savoye, M., Lelimousin, M., Joosen,L., Hink, M.A., van Weeren, L., Gadella, T.W. Jr. and Royant, A. (2012)

Structure-guided evolution of cyan fluorescent proteins towards a quantumyield of 93%. Nat. Commun., 3, 751.

61. Scherzinger, E., Lurz, R., Turmaine, M., Mangiarini, L., Hollenbach, B.,Hasenbank, R., Bates, G.P., Davies, S.W., Lehrach, H. and Wanker, E.E.

(1997) Huntingtin-encoded polyglutamine expansions form amyloid-likeprotein aggregates in vitro and in vivo. Cell, 90, 549–558.

62. Poirier, M.A., Li, H., Macosko, J., Cai, S., Amzel, M. and Ross, C.A. (2002)Huntingtin spheroids and protofibrils as precursors in polyglutamine

fibrilization. J. Biol. Chem., 277, 41032–41037.

63. Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach,H. and Wanker, E.E. (2001) Accumulation of mutant huntingtin fragments in

aggresome-like inclusion bodies as a result of insufficient proteindegradation. Mol. Biol. Cell, 12, 1393–1407.

64. Chai, Y., Shao, J., Miller, V.M., Williams, A. and Paulson, H.L. (2002)Live-cell imaging reveals divergent intracellular dynamics of polyglutamine

disease proteins and supports a sequestration model of pathogenesis. Proc.

Natl. Acad. Sci. USA, 99, 9310–9315.

65. Hoffner, G., Kahlem, P. and Djian, P. (2002) Perinuclear localization ofhuntingtin as a consequence of its binding to microtubules through an

interaction with beta-tubulin: relevance to Huntington’s disease. J. Cell Sci.,115, 941–948.



live cell fret and protein dynamics reveal two types of mutant

Documents