Letters to the EditorPoliovirus-Specific Immunoglobulin M Antibodies

during Diagnosis of Acute Poliomyelitis orPostpoliovirus Syndrome or Monitoring of

Vaccine Responsiveness

The ,-capture assay to measure poliovirus-specific immuno-globulin M (IgM) antibodies for three poliovirus serotypes inserum and cerebrospinal fluid (CSF) in 114 patients withclinically determined acute poliomyelitis at Karachi, Pakistan,employed 35S-methionine-radiolabelled polioviruses. In themicrowell format, the appearance of poliovirus-specific IgMantibodies appeared a sensitive and specific test procedure forlaboratory confirmation of poliomyelitis. During the first 15days of patient illness, more poliomyelitis cases were confirmedby an intrathecal immune IgM response than by isolation ofvirus in the stool specimens (3). The microwell poliovirus IgMformat (3) might also be ideal for monitoring the intrathecalIgM response in patients with postpoliomyelitis syndrome whomanifest progressive muscular dystrophy decades after theinitial episode of acute poliomyelitis (1). Presently, intrathecalimmune reactivity is measured in CSF during electrophoresisof undiluted CSF specimens in agarose gel followed by a

passive transfer to polyvinyl difluoride membrane coated withthe poliovirus antigen. Following glutaraldehyde-inducedcross-linkage of immunoglobulin with the membrane, it ispossible to stain the poliovirus-specific IgM oligoclonal bands.Investigations with 36 patients, 16 men and 20 women, ofpostpoliomyelitis syndrome for intrathecal immune reactivityenabled detection of IgM oligoclonal bands in 21 patients, withno bands in any of the control group with a childhoodpoliomyelitis or a neuromuscular disease (4). The ,u-captureassay would enable extended monitoring of intrathecal IgMresponse in patients with postpoliomyelitis syndrome in indus-trialized countries.The use of radiolabelled materials in the ,u-capture assay for

poliomyelitis (3) is an obstacle against its extended diagnosticuse in developing countries, where the routine diagnosticlaboratories lack facilities for handling radioactive materials.Appropriate modifications would be needed in order to elim-inate the use of radioactive materials and toward adaptation ofthe assay format for quantification of poliovirus IgM in saliva.The immune response in serum and CSF pairs in 114 patientsin Pakistan (3) has been distinct, with no correlation inantibody titers in CSF-serum pairs. The salivary IgM quantummight well be an equally useful marker for a specific diagnosisof poliomyelitis. The sensitivity and specificity for hepatitis Avirus-specific IgM in saliva samples obtained with a treatedabsorbent pad have been 100% (51 of 51 samples) and 98%(46 of 47 samples) in relation to serum antibody titers.Moreover, the decline of hepatitis A IgM in oral samples wasparallel to, although somewhat more rapid than, that ofhepatitis A IgM in serum samples (5). The utility of the,u-capture immunoassay for saliva rather than blood or CSFwould be obvious in remote locations with poor facilities forhealth care and the absence of trained personnel to obtain CSFby lumbar puncture from patients labelled clinically as patientswith acute poliomyelitis.

Conventionally, the immune response to live attenuated or

enhanced potency inactivated poliovirus vaccine has beenmonitored through the quantification of IgG-class poliovirusantibodies in serum (2). Ready availability of simplified saliva-based techniques for poliovirus-specific IgM and IgA wouldenable one to ascertain whether there was a "window" phasebetween IgM and Ig response or some vaccinees responded bya selective IgA response. Even the patients with live poliovirusvaccine-induced or associated paralytic poliomyelitis mightdemonstrate an abnormal immune response.

REFERENCES

1. Dalakas, M. C. 1990. The post-polio syndrome. Curr. Opin. Rheu-matol. 2:901-907.

2. McBean, A. M., M. L. Thomas, P. Albrecht, et al. 1988. Serologicresponse to oral polio vaccine and enhanced-potency inactivatedpolio vaccines. Am. J. Epidemiol. 128:615-628.

3. Roivainen, M., M. Agboatwalla, M. Stenvik, T. Rysa, D. S. Akram,and T. Hovi. 1993. Intrathecal immune response and virus-specificimmunoglobulin M antibodies in laboratory diagnosis of acutepoliomyelitis. J. Clin. Microbiol. 31:2427-2432.

4. Sharief, M. K., R. Hentges, and M. Ciardi. 1991. Intrathecalimmune response in patients with the post-polio syndrome. N. Engl.J. Med. 325:749-755.

5. Thieme, T., P. Yoshihara, S. Piacentini, and M. Beller. 1992.Clinical evaluation of oral fluid samples for diagnosis of viralhepatitis. J. Clin. Microbiol. 30:1076-1079.

Subhash C. Arya, M.B.B.S., Ph.D.Centre for Logistical Research and InnovationM-122 (ofpart 2), Greater Kailash-IINew Delhi- 110048India

Author's ReplyWe acknowledge with pleasure Dr. Arya's interest in our

,u-capture assay for poliovirus-specific IgM-class antibodies.We also share Dr. Arya's vision on the implications of thistechnique in the control of poliomyelitis, and we are happy tosay that the new applications he proposed are in progress inour laboratory. Some time ago we analyzed a set of CSF andserum specimens from patients suffering from postpoliomyeli-tis syndrome by using the published ,u-capture technique withradiolabeled antigen (1). The results have been submitted forpublication elsewhere (2). Another interesting point is thevirus-specific IgM response in saliva. Studies aimed at the use

of salivary IgM response in laboratory diagnosis of poliomyeli-tis and in monitoring vaccine responses are in progress. It istrue that especially in developing countries the routine diag-nostic laboratories lack facilities for handling radiolabeled

1414

JOURNAL OF CLINICAL MICROBIOLOGY, May 1994, p. 1414-14160095-1137/94/$04.00+0

Vol. 32, No. 5

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

LET[ERS TO THE EDITOR 1415

antigen. So far, our attempts to use the ,u-capture techniquewith enzyme-conjugated antigen have resulted in lessenedsensitivity of the assay, and further work is necessary toestablish an enzyme immunoassay method for measuring po-liovirus-specific IgM antibodies.

REFERENCES

1. Roivainen, M., M. Agboatwalla, M. Stenvik, T. Rysa, D. S. Akram,and T. Hovi. 1993. Intrathecal immune response and virus-specific

immunoglobulin M antibodies in laboratory diagnosis of acutepoliomyelitis. J. Clin. Microbiol. 31:2427-2432.

2. Roivainen, M., E. Kinnunen, and T. Hovi. Twenty-one patients withstrictly defined postpoliomyelitis syndrome: no poliovirus-specificIgM antibodies in the cerebrospinal fluid, submitted for publica-tion.

Merja Roivainen, Ph.D.Tapani Hovi, M.D., Ph.D., professorEnterovirus LaboratoryNational Public Health InstituteMannerheimintie 166SF-00300 HelsinkiFinland

Detection of Salmonella typhi by PCR

In their paper, Song et al. describe a PCR-based diagnostictest for the detection of Salmonella typhi (3). The authorsemployed a nested PCR approach using as their first pair ofprimers an S. typhi-specific forward primer (ST 1) and acommon flagellin gene-derived reverse primer and nested tothem a second set of primers. In this second set, the forwardprimer (ST 3) was originally also thought to be S. typhi specific(1) but was later found to share the same DNA sequence withother type d flagellin genes (2). Therefore, it is not surprisingthat in the nested PCR, applied to cultured salmonella, anamplified product was obtained when S. typhi as well as S.muenchen DNA was used as template. In the Discussionsection, the authors doubt (quite rightly) the significance andactual probability of finding S. muenchen in blood samples.However, in order to avoid this problem altogether, theauthors could have used, as we are in our laboratory, adifferent forward primer for the first PCR which is derivedfrom the DNA sequence located just upstream to primer ST I(1, 3), i.e., 5' TATGCCGCTACATATGATGAG 3' (1), to-gether with primer ST 2 (1, 3). The use of these primers in thefirst round of DNA amplification should result in an amplifiedproduct using either S. typhi or S. muenchen DNA template(and also DNA from other Salmonella species expressingflagellar antigen d). Primer ST 1, which is the S. typhi-specific

primer, should then be used together with primer ST 4 (3) forthe nested reaction. As blood PCR was positive only for thenested reactions, false-positive amplification due to samplecontamination with other Salmonella species (like S.muenchen) will be avoided.

REFERENCES

1. Frankel, G., S. M. C. Newton, G. K. Schoolnik, and B.A. D.Stocker. 1989. Unique sequences in region VI of the flagellin geneof Salmonella typhi. Mol. Microbiol. 3:1379-1383.

2. Moshitch, S., L. Doll, B.-Z. Rubinfeld, B. A. D. Stocker, G. K.Schoolnik, Y. Gafni, and G. Frankel. 1992. Mono- and bi-phasicSalmonella typhi: genetic homogeneity and distinguishing charac-teristics. Mol. Microbiol. 6:2589-2597.

3. Song, J.-H., H. Cho, M. Y. Park, D. S. Na, H. B. Moon, and C. H.Pai. 1993. Detection of Salmonella typhi in the blood of patientswith typhoid fever by polymerase chain reaction. J. Clin. Microbiol.31:1439-1443.

Gad FrankelDepartment of BiochemistryImperial College of Science, Technology and MedicineLondon SW7 2AY, United Kingdom

Ed. Note: The author of the published article declined to respond.

Treatment of Late Lyme Disease: a Challenge to Accept

We have read with great interest Liegner's guest commen-tary (1). We present a case which supports Liegner's opinionsconcerning the diagnosis and treatment of Lyme disease.A 41-year-old male physician suffered a tick bite on his back.

Forty-four hours later, the tick was traumatically removed by adermatologist. Prophylactic oral doxycycline (200 mg/12 h) wasadministered for 5 consecutive days. Three months later, hecomplained of fatigue, febricula, and asthenia. The patientignored these symptoms until he noted generalized and pro-gressive muscle hypotrophy with fasciculations, accompaniedby nonspecific neurologic, gastrointestinal, genitourinary, andcardiorespiratory symptomatology 27 months after the tickbite. He was initially diagnosed as having a psychiatric disorderby several specialists. Ancillary studies included completeblood count, erythrocyte sedimentation rate, biochemical pro-

filing, serum immunoglobulins (Igs), thyroid hormones, humanimmunodeficiency virus, Treponema pallidum, Brucella mel-litensis, Salmonella typhi, Epstein Barr virus serum antibodytiters, tuberculin testing, chest X ray, electrocardiogram, elec-troencephalogram, echocardiography, abdominal ultrasound,and central nervous system (CNS) magnetic resonance imag-ing. Results were within the normal range except for a highserum IgM titer and partial IgA deficiency. Forty-one monthsafter the tick bite, the patient was diagnosed by a neurologist ashaving probable encephalomyelitis due to Borrelia burgdorferi.Serum and cerebrospinal fluid (CSF) antibody titers to B.burgdorferi, as well as CSF cytology and biochemistry, werenegative. Thus, no antibiotic therapy was initiated until furtherclinical deterioration was very evident. He received 2 g ofceftriaxone daily for 4 weeks. Marked early clinical improve-

VOL. 32, 1994

on Decem

ber 25, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 1993, p. 2427-24320095-1137/93/092427-06$02.00/0Copyright ) 1993, American Society for Microbiology

Intrathecal Immune Response and Virus-SpecificImmunoglobulin M Antibodies in Laboratory

Diagnosis of Acute PoliomyelitisM. ROIVAINEN,l* M. AGBOATWALLA,2 M. STENVIK,l T. RYSA,l D. S. AKRAM,2 AND T. HOVI'

Enterovirus Laboratory, KTL National Public Health Institute, Helsinki, Finland,and Department ofPaediatrics, Civil Hospital, Karachi, Pakistan2

Received 10 February 1993/Returned for modification 14 May 1993/Accepted 11 June 1993

The intrathecal immune response in 114 patients with clinically diagnosed acute poliomyelitis was studied bymeasuring poliovirus-specific immunoglobulin M (IgM) antibodies in cerebrospinal fluid (CSF) by a >-captureimmunoassay and by assessing the ratio between levels of poliovirus-neutralizing antibodies in serum and CSF.Fecal specimens were used for attempts to isolate the causative agents. Eighty-five percent of CSF specimenscollected during the first 15 days of disease contained virus-specific IgM antibodies. Forty-five of 48 testedchildren (94%) also showed virus-specific IgM responses in their sera. Later on, the antibody levels decreased,and positive results after 30 days of onset of paralytic symptoms were rare. If the presence of poliovirus-specificIgM antibodies in the CSF was considered diagnostic, more cases were confirmed by this test than by virusisolation. A relative increase in poliovirus-neutralizing antibodies in the CSF was observed in about one-thirdof the cases; in all but three cases the increase was observed together with the presence of virus-specific IgMantibodies. A systemic virus-specific response can be seen and poliovirus can be isolated from a subclinicallyinfected individual suffering from a concomitant poliomyelitis-like disease, while positive results by the twomethods demonstrating an intrathecal immune response are likely to indicate a true causal relationshipbetween infection and disease. Demonstration of poliovirus-specific IgM antibodies in the CSF thus appears tobe a sensitive and specific method for laboratory confirmation of clinically diagnosed poliomyelitis.

Poliomyelitis is a serious public health problem in devel-oping countries, with more than 100,000 new paralytic cases

occurring annually. In areas endemic for poliovirus, theparalyzed cases are diagnosed by clinical criteria, usuallywithout laboratory confirmation. Because the incidence ofdisease is decreasing, it has become increasingly importantto prove the etiology of individual cases of poliomyelitis byvirological techniques. Polioviruses grow well in cell cul-tures, and virus isolation from stool specimens is the stan-dard laboratory method for diagnosis of poliovirus infectionin industrialized countries. The other conventional methodfor the laboratory diagnosis of poliovirus infection is deter-mination of neutralizing antibodies in paired serum samplesfrom the acute and convalescent phases to three standardlaboratory serotypes of poliovirus. The conventional meth-ods are highly specific, but they are also rather laborious andtime-consuming and require the continuous use of cell cul-tures. A further problem with the conventional procedures isthat although a positive result confirms the existence ofpoliovirus infection in the patient, this does not necessarilyprove that it is the causative agent for the coinciding disease.The number of asymptomatic poliovirus infections exceedby hundreds-fold the number of paralytic cases.

Clearly, new, simple, and rapid methods are needed forthe virological diagnosis of poliomyelitis. Unlike many otherviral diseases, the kinetics of the serum immunoglobulin M(IgM) response have not been worked out, and the demon-stration of the presence of IgM antibodies is not in generaluse in the laboratory diagnosis of acute poliomyelitis. In-trathecal production of virus-specific antibodies can also be

* Corresponding author.

used for the early diagnosis of viral infection in the centralnervous system. Demonstration of a relative increase in totalvirus-specific antibody levels or the presence of virus-spe-cific IgM-class antibodies in the cerebrospinal fluid (CSF)has been used to diagnose other viral infections in the centralnervous system (2, 3, 6, 8, 12, 13). A positive result isconsidered to document a causal relationship between infec-tion and disease. A relative increase in the level of neutral-izing poliovirus antibodies in the CSF of five patients withpoliomyelitis was previously reported from the NationalPublic Health Institute (4), and one patient was described byothers (7). No systematic analysis has been published. Thediagnostic value of poliovirus-specific IgM antibodies in theCSF, if present (5), has not been assessed.We studied the intrathecal immune responses in 114

Pakistani children with clinically diagnosed paralytic polio-myelitis using both of the approaches mentioned above andcompared the results with those obtained with regular virusisolation from fecal specimens.

MATERIALS AND METHODS

Patients. All consecutive children with acute poliomyelitisof up to 3 months of onset coming to the Department ofPaediatrics, Civil Hospital, Karachi, Pakistan, from Novem-ber 1989 to August 1991 were enrolled in the study. Asrecommended by the World Health Organization, only pa-

tients with paralytic symptoms persisting for at least 60 dayswere included. Most patients were in the acute phase of thedisease, but some patients were enrolled in the study onlyafter 1 month or more had elapsed from the time of onset ofthe disease. A lower limb was the body part affected in 94%of the children. Clinical and epidemiological features of the

2427

Vol. 31, No. 9

2428 ROIVAINEN ET AL.

patients and observations during the follow-up period will bereported separately. The median age of the patients was 14months, with a range of between 2 and 60 months. Eighty-three children had no history of immunization against polio,while 18 children had received a complete series of at leastthree doses of oral poliovirus vaccine and 13 children hadreceived one or two doses. Four milliliters of blood wascollected from each patient by using aseptic precautions, andthe blood was centrifuged at room temperature to separatethe serum. Lumbar puncture was done, with the consent ofthe child's parents, by using aseptic precautions under localanesthesia, and CSF was collected. Fecal specimens ofpatients examined during the first weeks of disease werecollected in clean containers. For some patients, additionalsamples of blood and CSF were collected during later visitsto the hospital. The serum and CSF samples were designedto be collected on the same day, and for only five patientswas there a 1- to 5-day interval between the times ofcollection of the samples. Specimens were kept frozen at-20°C in Karachi and were eventually sent in dry ice toHelsinki for analysis. Of the 154 patients initially enrolled, 40were excluded from the present evaluation because CSF wasnot available for the IgM tests.

Reference specimens. CSF specimens from 20 Finnishchildren with nonparalytic neurological disease, kindly pro-vided by M.-L. Koskiniemi from the Department of Virol-ogy, University of Helsinki, and 58 CSF specimens frompatients without polio from the collections of the KTLNational Public Health Institute were used as negativecontrols in the ,u-capture test. A human serum specimenwhich was known to have a high-titer IgM class rheumatoidfactor (RF) activity was a generous gift from T. Palosuo ofthe KTL National Public Health Institute.Virus isolation. Viruses were isolated from stool speci-

mens by standard techniques by using monkey kidney-derived Vero and GMK cells, a human lung carcinoma cellline (A-549), and human embryonic fibroblast cells. Growthof virus was observed by microscopy, and the isolatedstrains were identified by neutralization with type-specificantisera. Specimens were considered negative if no cyto-pathic effect was seen after one blind passage and a totalincubation time of at least 4 weeks. For intratypic differen-tiation, we used a sandwich-type enzyme immunoassay withcross-absorbed rabbit antisera (14) to the attenuated Sabinviruses and the corresponding wild-type polioviruses. Theantisera were a gift from A. van Loon, Bilthoven, TheNetherlands.

Neutralization assay for antibodies. Neutralizing antibodiesin CSF and heat-inactivated sera were measured by astandard microneutralization test in Vero cells (la). Thelowest dilutions of serum and CSF that scored positive were1:4 and 1:2, respectively. Reciprocals of the titers obtainedwere used to calculate the serum/CSF ratio.

,u-Capture assay for IgM antibodies. Flat-bottom micro-well plates were coated overnight at room temperature withhuman ,-chain-specific immunoglobulin (from Sigma; di-luted in carbonate buffer [pH 9.4]) and were then blockedwith 0.1% bovine serum albumin (BSA) in phosphate-buff-ered saline (PBS) for 30 min at room temperature. Afterwashing three times with 0.1% Tween 20 in PBS (PBS-Tween), CSF samples diluted 1:10 in enzyme immunoassaybuffer (PBS with 1% BSA, 0.1% Tween 20, and 1% fetal calfserum) were added and allowed to react with the solid-phase-bound antibody for 2 h at 37°C. Serum samples werediluted in the same buffer and were tested at dilutions of1:100, 1:1,000, and 1:10,000. After three washes with PBS-

Tween, 30 ,ul of metabolically [35S]methionine-radiolabelledpurified (9) polioviruses of serotypes 1, 2, and 3, correspond-ing to about 20,000 cpm per well, was added to duplicatewells. After 1 h at 37°C, unbound virus was removed, thewells were washed three times with PBS-Tween, and thebound material was solubilized in 50 ,u of 0.3 N sodiumhydroxide and assayed for radioactivity by using a WallacMicroBeta scintillation counter. A titer of IgM antibodieswas calculated by using the following formula: titer = (cpmtest - cpm blank)/input cpm x 100 x dilution factor. Themeans for two test wells and at least six blanks were used inthe calculations. The dilution factor was the reciprocal of thedilution. Pilot tests on series of dilutions suggested that theformula applied to an individual dilution gives an estimate ofthe titer that is at least as accurate as that which can beobtained graphically. At high IgM levels, however, falselylow titers were obtained if only low test dilutions were used.Since the level of IgM varied considerably between individ-ual serum specimens, the use of three serum dilutionsthroughout the study turned out to be practical. CSF speci-mens from the first 30 patients without polio gave radioac-tivity values close to those of the buffer blanks. We consid-ered calculated CSF titers of 5 or more to be positive in thepresent study. Later on, we studied CSF from an additional48 patients without polio. In two cases, a calculated titer of5 was found. While occasional serum specimens fromhealthy persons with old immunity bound slightly moreradioactivity than the buffer blanks, the calculated titeralways remained below 100. Acute-phase serum specimensfrom patients with polio usually showed titers in the range ofthousands. A titer of 100 was taken as the cutoff level forserum specimens.The virus strains used for type 1 and type 2 assays were

the regular laboratory strains PV1/Mahoney and PV2/MEF-1, respectively. In the pilot phase of the study, weobserved that the standard PV3/Saukett strain missed casesof type 3 poliovirus infection that could be detected with alocal isolate PV3/Pakistan/KTLO80/90. The results presentedhere are based on tests with the latter strain only. In a largemajority of the tested specimens, a positive reaction wasrecorded against one serotype only. However, with 6 CSFand 11 serum specimens, low or moderate amounts ofradioactivity were bound from one or both of the otherserotypes as well. See the Discussion for the putativebackgrounds of these cross-reactions. For simplification,these specimens are listed in the Results according to theserotype showing the highest titer. This practice was, inmost cases, supported by the other diagnostic tests used.RF is a well-known source of falsely positive results in

solid-phase antigen IgM assays when >-chain-specific la-belled antibodies are used for detection (indirect assays).While RF is theoretically much less likely to interfere with,u-capture-based assays, we tested its effects on our ,u-cap-ture radioimmunoassay. A serum specimen with high RFactivity was found to be highly positive in both indirect IgGand indirect IgM assays for poliovirus type 1 antibodies (11)but was clearly negative in our p,-capture radioimmunoas-say. A serum specimen from a patient with polio with a lowIgM titer in our ,u-capture test bound the same amounts ofradioactivity in the presence and absence of the RF-contain-ing serum (data not shown). These results indicate that RFdoes not significantly affect the results of our p,-capture IgMassay.

J. CLIN. MICROBIOL.

INTRATHECAL IgM IN POLIO DIAGNOSIS 2429

cn

.0

0-i

2

1

0.7<0j7

3 I A

3 -_

0

C.

10 20 30 40 50 60 70 80 90 2100

DAYS AFTER ONSET OF DISEASE

iw-LUen

2

.0

-i

4

3

2<2

B

0~ 0<10 2 0 4 0 60 7 0 9 0

DAYS AFTER ONSET OF DISEASE

FIG. 1. Presence and decay of poliovirus-specific IgM antibodies in CSF (A) and serum (B) of patients with poliomyelitis. Specimenscollected from 114 children at various times after the onset of paralytic symptoms were analyzed as described in the text. Readings ofsuccessive specimens are connected with dashed lines if the first specimen was scored positive.

RESULTS

Poliovirus-specific IgM antibodies in CSF of patients withpolio. One or more CSF specimens collected from 114Pakistani children with clinically diagnosed paralytic polio-myelitis were tested in the ,u-capture radioimmunoassay forIgM antibodies against the three serotypes of poliovirus. Apositive result was obtained for 76 patients. Forty-six pa-tients had type 1 poliovirus-specific IgM antibodies in theirCSF, 21 had type 2-specific IgM antibodies, and 9 had type3-specific IgM antibodies.When the calculated IgM titers in CSF were plotted

against time after the onset of paralytic symptoms, it wasfound that the highest titers were seen during the first 15days. Eighty-five percent of specimens tested within thisperiod were positive (Fig. 1A). Thereafter, the antibodylevels declined rapidly; in most children the test was nega-tive for specimens collected 30 days or later after the onset

of disease. However, exceptionally high titers were still seenin two children at 1 and 3 months, respectively (Fig. 1A).

Poliovirus-specific IgM response in serum. One or moreserum specimens from 77 patients were also tested for IgMantibodies. The test was positive for 59 patients. Thirty-sixof these patients had a response against type 1 poliovirus, 21had a response against type 2 poliovirus, and 7 had aresponse against type 3 poliovirus. Like in the case of CSFIgM results, the titers were high immediately after the onsetof disease and usually declined during the subsequent fewweeks (Fig. 1B). Forty-five of 48 serum specimens (94%)collected during the first 15 days of disease containedpoliovirus-specific IgM class antibodies.

Neutralizing poliovirus antibodies in CSF. For some chil-dren, two or three successive sets of serum and CSFspecimens collected up to 4 months after the onset of diseasewere tested for neutralizing poliovirus antibodies to assess

VOL. 31, 1993

5

2430 ROIVAINEN ET AL.

TABLE 1. Correlation between results obtained by the virusisolation test and CSF IgM test for patients from whom samples

were obtained within 15 days after the onset of disease

No. of tests with the following virus isolationCSF IgM test result':test result

+ - Total

+ 34 23 576 138 144

Total 40 161 201

a Note that separate tests for the three serotypes on a given specimen arerecorded cumulatively.

the putative relative increase in antibody levels in CSF.Altogether, CSF samples from 84 of 105 children tested hadneutralizing antibodies against one or more serotypes ofpoliovirus. We considered a specimen pair positive if thereciprocals of the serum and CSF titers had a ratio of 64 orless. In this way, 39 of 105 tested children fulfilled thisdiagnostic criterion. Twenty-six of these children showed adecreased ratio for type 1 poliovirus antibodies, 8 childrenshowed a decreased ratio for type 2 poliovirus antibodies,and 5 children showed a decreased ratio for type 3 poliovirusantibodies. Unlike the IgM tests, positive results for this testdid not show a correlation with time after the onset ofdisease. Rather, several pairs of specimens collected 1 ormore months after the onset of disease showed the de-creased ratio (data not shown).

Intrathecal and systemic IgM responses as diagnostic tests.To assess mutual correlations of the results of the two IgMassays and in order to compare them with virus isolation, wetook into consideration only patients from whom specimenswere collected during the first 15 days of disease (cf. Fig. 1).Overall sensitivities of 94, 85, and 60% were recorded for theserum IgM test, CSF IgM test, and virus isolation, respec-tively, if detection of any of the serotypes was taken intoaccount. The mutual concordances of the results obtained bythe three methods are shown in Tables 1 to 3. We acknowl-edge the fact that every specimen was independently testedfor signs of infection by each of the three poliovirus sero-types. Hence, the number of tests is three times the numberof tested specimens. For simplification, the data for the threeserotypes are combined, despite potential masking of puta-tive serotype-specific differences (see Discussion).Twenty-three of 57 children showed a positive CSF IgM

result while being negative by virus isolation. On the otherhand, six patients excreted a poliovirus but did not show anintrathecal IgM response (Table 1). With regard to serum

TABLE 2. Correlation between results obtained by the virusisolation test and serum IgM test for patients from whom samples

were obtained within 15 days after the onset of disease

No. of tests with the following virus isolationSerum IgM test resulta:test result

+ - Total

+ 34 11 452 97 99

Total 36 108 144a Note that separate tests for the three serotypes on a given specimen are

recorded cumulatively.

TABLE 3. Correlation between results obtained by serum IgMand CSF IgM tests for patients from whom samples were

obtained within 15 days after the onset of disease

No. of tests with the following serum IgMCSF IgM test result":*test result

+ - Total

+ 42 2 448 107 115

Total 50 109 159

a Note that separate tests for the three serotypes on a given specimen arerecorded cumulatively.

IgM tests, 11 of 45 positive patients did not excrete poliovi-rus, but on the other hand, two poliovirus excretors did notshow an IgM response (Table 2). When the two IgM testswere compared, it was found that in 94% of the test pairs theresults for serum and CSF IgM agreed. Slightly more pa-tients had serum IgM than CSF IgM (Table 3). The overallperformance of each of the novel assays and virus isolationin confirming poliovirus infection in the patient material usedin the present study is given in Table 4. To calculate the totalnumbers of cases of illness caused by each serotype, we firstadded all cases in which any of the three immunological testsdescribed above or poliovirus isolation was positive. Of theremaining 20 patients, 3 showed a diagnostic increase inserum neutralizing antibodies and 1 had a fourfold decreaseaccording to an expected schedule. In 12 additional patients(10 with poliovirus type 1 infections and 2 with poliovirustype 3 infections) we considered a high serum level ofneutralizing antibodies against one serotype with no antibod-ies or a very low level against the two other serotypes"suggestively diagnostic." For eight of these patients, thefirst specimens were collected 1 month or more after theonset of disease; for four patients, earlier specimens were

TABLE 4. Overall performance of different diagnostic testsfor specimens from 110 children with virologically

confirmed paralytic poliomyelitise

No. of children with confirmed infection/no.Test of children tested for the following serotypeb:

Pv1 PV2 PV3 Total

Virus isolationIdentical serotype 23/48 16/21 10/17 49/86Other virus 18/48c 2/21d 4/17e

Ratio of neutralizing 26/61 8/28 5/16 39/105antibodies(serum/CSF)

CSF IgM 46/63 21/28 9/18 76/109Serum IgM 31/36 21/25 7/11 59/72

a Infection was considered to be due to the indicated poliovirus serotype ifany of the four tests was positive (see text). In addition, in 11 type 1, 1 type2, and 4 type 3 infections, none of the tests was positive, but neutralizingserum antibody levels supported the diagnosis (see text).

b PVl, PV2, and PV3, poliovirus serotypes 1, 2, and 3, respectively.c Two poliovirus type 2/Sabin; two poliovirus type 3/Sabin; one coxsack-

ievirus type A9, one echovirus type 7; one echovirus type 12; one echovirustype 19; one echovirus type 19 and adenovirus; one echovirus type 32; threeadenovirus; five untyped viruses.

d One coxsackievirus type B4, one echovirus type 4.1 One coxsackievirus type B4; one echovirus type 1; one echovirus type 21

plus adenovirus; one adenovirus.

J. CLIN. MICROBIOL.

INTRATHECAL IgM IN POLIO DIAGNOSIS 2431

available but the serum could not be tested for poliovirus-specific IgM antibodies. In this way, we confirmed 63 type 1,28 type 2, and 18 type 3 poliovirus infections in 114 patients.We had four patients with clinically diagnosed paralytic

poliomyelitis with no evidence of concomitant poliovirusinfection by any of the criteria used. One of these patientsexcreted echovirus type 19, but we do not know whether thisvirus had a role in the etiology of the disease. Eleven strainsof nonpolio enteroviruses, six adenoviruses, and five uniden-tified cytopathogenic agents were also isolated from 20patients with the designated poliovirus etiology of disease.In addition, in three patients with an intrathecal immuneresponse against type 1 poliovirus (listed in Table 4 accord-ing to their immune responses), virus isolation yielded aSabin-like type 2 or type 3 poliovirus strain. One patientexcreted wild-type type 1 and Sabin-like type 3 polioviruses.For one of the patients who excreted type 2 Sabin-likepoliovirus, another set of specimens collected 1 month laterwas available. The second serum specimen showed a sys-temic immune response, including an IgM response, againsttype 2 poliovirus, while the CSF still had a low level of IgMantibodies to type 1 poliovirus but none to type 2 poliovirus.

3

2

cnUo

0'w

I-

I-

00.7

<0.7

0

.

.

I

0

000 0

* 000o0 "m

0000

0 @0000 0

0 00 00

.

.

ee

.*-

*ee

e_ e* e*- ee mee

<2 2 3 4

LOG TITRE IgM (SERUM)

FIG. 2. Correlation of IgM titers in CSF and serum.

DISCUSSION

We showed in this report that both systemic and intra-thecal IgM responses can be reliably demonstrated in pa-tients with acute paralytic poliomyelitis and that the regular-ity and the transient nature of the responses enables their usein the virological diagnosis of poliomyelitis with an accuracythat appears to exceed that of the old "gold standard," virusisolation. Because of the hundreds-fold excess of subclinicalpoliovirus infections, the use of the systemic IgM responsefor laboratory confirmation of paralytic poliomyelitis facesthe same relative bias as the conventional techniques: sub-clinical wild-type poliovirus infections and primary vaccineresponses cannot be distinguished from those associatedwith paralytic disease. In contrast, an intrathecal virus-specific immune response, whether based on demonstrationof IgM antibodies or on the relative increase in the level ofneutralizing antibodies, is likely to reveal the causative agentof the disease. In the study described here we concentratedon assessing the usefulness of the latter assays as diagnostictests.The performance of a new diagnostic test is usually

evaluated by comparing the results with those obtained witha gold standard reference method and calculating the sensi-tivity and specificity of the new test. In the case of virolog-ical diagnosis of paralytic poliomyelitis, this is difficult sinceconventional methods, virus isolation, and an expectedincrease of neutralizing antibodies are known to be not onlyrelatively insensitive but are also known to yield false-positive results. In the present study, we tried to avoidfalse-positive results by using strict criteria in patient selec-tion. Although some nonpolio enteroviruses are known tocause rare cases of paralytic disease, it is generally agreedthat in a large majority of these cases the paralytic symptomsdo not persist for 8 weeks, which we used as a selectioncriterion for the material used in the present study.Leakage of poliovirus-specific IgM antibodies through a

damaged blood-brain barrier to the CSF or accidental con-tamination with blood during specimen collection couldcompromise the selectivity of the CSF IgM tests describedabove and are difficult to exclude unequivocally. Fixed limitproportions, which are used as diagnostic criteria in theapproach that assesses the putative relative increase in IgG

antibody levels, cannot be used in a study such as the onedescribed here because of the transient nature of the IgMresponses. To assess possible leakage of IgM antibodies inthe material used in the present study, we plotted individualpoliovirus-specific IgM titers in CSF against the correspond-ing titers in the serum specimens collected at the same time.While a significant part of the titers of linked specimen pairsappeared to be proportional, a large number of them showedno mutual correlation (Fig. 2). This suggests that the titersmeasured in CSF are not due to leakage of or contaminationby the systemic IgM antibodies but, rather, represent anindependently regulated local immune response. The inde-pendence of the two IgM responses is also likely to explainthe mismatched cases, in which only either a CSF or a serumspecimen was positive. A long incubation time and/or de-layed sampling of specimens may have been the backgroundin three patients whose CSF was positive and whose serumwas negative for IgM antibodies. The opposite situation wasfound in four patients, whose specimens were collected 2 to7 days after the onset of disease. The antibody response inthe CSF might perhaps have been evident in later specimensif they had been available.The results of our ,u-capture radioimmunoassay were

highly serotype specific, with a few exceptions. In 5% ofpatients the CSF and in 15% of patients the serum containedIgM antibodies that bound radioactivity from more than oneserotype. However, the extent of these reactions remainedlimited and in most cases did not confuse judgment of whichserotype caused the infection. Other methods were used toselect the correct serotype in those four patients whose seracontained highly cross-reactive IgM antibodies. While neu-tralizing antibodies to poliovirus show cross-reactivity be-tween the three serotypes only rarely and to a low degree,the viruses are known to share antigenic regions that aremore readily detectable by other assays. We have previouslyidentified an antigenic region with almost complete sequenceidentity at amino acids 37 to 53 of the VP1 capsid protein(10), and in the present study we found that serum and CSFspecimens that react with more than one serotype usuallyalso had antibodies to synthetic peptides derived from thissequence (data not shown).

5

VOL. 31, 1993

2432 ROIVAINEN ET AL.

When the data in Tables 1 to 3 were broken down byserotype, there appeared to be less concordance between thevirus isolation and CSF IgM results in the case of poliovirustype 3 infections than in those for the two other serotypes.One explanation for this would be that the type 3 strains thatcaused the infections differed from the strains used in theIgM tests. Failure of the laboratory strain PV3/Saukett todetect type 3 infections was observed in the pilot phase ofthe present study, and so a local isolate was used in the testsinstead. However, we do not know whether more than oneantigenic variant of type 3 poliovirus contributed to the casesof disease described here.Nonpolio enteroviruses and Sabin-like oral poliovirus

vaccine-derived polioviruses are frequently detected in fecalspecimens of healthy children in Karachi (1), as they are indeveloping countries in general, and may confuse attemptsto document wild-type poliovirus etiology of a paralyticdisease. In one of the patients examined in the present study,we found an intrathecal IgM response against type 1 polio-virus, while a Sabin-like type 2 virus was isolated from thepatient's feces. We do not know whether the type 1 virus,which appeared to have been the causative agent of thedisease, also was vaccine derived. Better knowledge ofspecific antigenic properties of the wild-type poliovirusstrains circulating in countries endemic for poliovirus mighthelp to develop strain-specific IgM assays, which could beused to distinguish IgM responses against wild-type- andvaccine-derived polioviruses.We found that about one-third of the patients in the

present study showed a decreased ratio between neutralizingpoliovirus antibody levels in serum and CSF. Almost all ofthese children also had poliovirus-specific IgM antibodies intheir CSF, indicating a high degree of specificity of a positiveresult in the calculated ratio approach. On the other hand,the sensitivity of the test as a single diagnostic procedure foracute poliomyelitis appeared to be relatively low. However,the test may be useful for patients coming for their first visitseveral weeks after the onset of the paralytic symptoms. Atthis time, the sensitivities of both the CSF IgM and the virusisolation tests have decreased to relatively low levels.

In conclusion, the ,u-capture-based demonstration of po-liovirus-specific IgM antibodies in CSF appears to have agreat potential as a diagnostic test for laboratory confirma-tion of paralytic poliomyelitis. The lumbar puncture requiredfor collection of the CSF specimen is a routine diagnosticprocedure for patients with paralytic symptoms. Apart fromthe apparently high degree of sensitivity and specificity ofthis novel test, it has a great advantage over the conventionaldiagnostic methods in that it demonstrates a local immuneresponse to the causative agent of the disease. Both virusisolation and tests that measure a systemic immune responsecan also yield positive results for patients with subclinicalinfections, which occur frequently. The technique used inthe present study involved radioactively labelled purifiedpolioviruses as probes for anti-,-captured IgM antibodies.Studies are in progress to develop a nonradioactive modifi-cation of the test for which the reagents would be morereadily available in different laboratories.

ACKNOWLEDGMENTS

M.R. is a research fellow of the Molecular Biology Program of theKTL National Public Health Institute. This study was supported bygrants from the Academy of Finland, the Sigrid Juselius Foundation,Helsinki, and FINNIDA, Helsinki.The technical assistance of Mervi Eskelinen, Eija Penttila, Elisa

Lamminsalo, and Siru Hyvari is gratefully acknowledged.

REFERENCES

1. Agboatwalla, M. 1992. A study of paralytic poliomyelitis in thepaediatric age group. M.D. thesis. Dow Medical College, Kara-chi, Pakistan.

la.Albrecht, P., G. van Steenis, and A. L. van Wezel. 1984.Standardization of poliovirus neutralizing antibody test. Rev.Infect. Dis. 6(Suppl. 2):S540-S544.

2. Burke, D. S., A. Nisalak, and M. A. Ussery. 1982. Antibodycapture immunoassay detection of Japanese encephalitis virusimmunoglobulin M and G antibodies in cerebrospinal fluid. J.Clin. Microbiol. 16:1034-1042.

3. Dykers, T. I., K. L. Brown, C. B. Gundersen, and B. J. Beaty.1985. Rapid diagnosis of LaCrosse encephalitis: detection ofspecific immunoglobulin M in cerebrospinal fluid. J. Clin. Mi-crobiol. 22:740-744.

4. Hovi, T., M. Stenvik, and E. Kinnunen. 1986. Diagnosis ofpoliomyelitis by demonstration of intrathecal synthesis of neu-tralizing antibodies. J. Infect. Dis. 153:998-999.

5. Julkunen, I., P. Ukkonen, M. Stenvik, T. Hoyi, L. Renkonen,and 0. Makelai. 1987. Proportions of immunoglobulin isotypes inparalytic poliomyelitis and after vaccination. J. Clin. Immunol.7:319-326.

6. Kahlon, J., S. Chatterjee, F. D. Lakeman, F. Lee, A. J. Nahmias,and R. J. Whitley. 1987. Detection of antibodies to herpessimplex virus in the cerebrospinal fluid of patients with herpessimplex encephalitis. J. Infect. Dis. 155:38-44.

7. Openshaw, H., and J. S. Lieberman. 1983. Vaccine-relatedpoliomyelitis: serum IgM and cerebrospinal fluid antibodies.West. J. Med. 138:420-422.

8. Reiber, H., and P. Lange. 1991. Quantification of virus-specificantibodies in cerebrospinal fluid and serum: sensitive and spe-cific detection of antibody synthesis in brain. Clin. Chem.37:1153-1160.

9. Roivainen, M., T. Hyypia, L. Piirainen, N. Kalkkinen, G.Stanway, and T. Hovi. 1991. RGD-dependent entry of coxsack-ievirus A9 into host cells and its bypass after cleavage of VP1protein by intestinal proteases. J. Virol. 65:4735-4740.

10. Roivainen, M., A. N6rvanen, M. Korkolainen, M.-L. Huhtala,and T. Hovi. 1991. Antigenic regions of poliovirus type 3/Sabincapsid proteins recognized by human sera in the peptide scan-ning technique. Virology 180:99-107.

11. Roivainen, M., L. Piirainen, and T. Hovi. 1993. Persistence andclass-specificity of neutralizing antibody response induced bytrypsin-cleaved type 3 poliovirus in mice. Vaccine 11:713-717.

12. Sever, J. L., H. Krebs, A. Ley, L. H. Barbosa, and D. Rubin-stein. 1974. Diagnosis of subacute panencephalitis. The valueand availability of measles antibody determinations. JAMA228:604-606.

13. Ukkonen, P., M. L. Granstrom, J. Raisanen, E.-M. Salonen, andK. Penttinen. 1981. Local production of mumps IgG and IgMantibodies in the cerebrospinal fluid of meningitis patients. J.Med. Virol. 8:257-265.

14. Van Wezel, A. L., and A. G. Hazendonk 1979. Intratypicdifferentiation of poliomyelitis. Intervirology 11:2-8.

J. CLIN. MICROBIOL.