Upload File

lecture 3 lecture 2 catch up vector structure copy number control selectable marker plasmid dna...

  • Home
  • Documents
  • Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database
51
Lecture 3 • Lecture 2 catch up • Vector structure • Copy number control • Selectable marker • Plasmid DNA isolation • ESTs • DNA sequencing • Entering the Honeybee database

Upload: cody-mitchell

Post on 23-Dec-2015

222 views

Category:

Documents


0 download

Report

Tags:

TRANSCRIPT

Page 1: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Lecture 3• Lecture 2 catch up

• Vector structure

• Copy number control

• Selectable marker

• Plasmid DNA isolation

• ESTs

• DNA sequencing

• Entering the Honeybee database

Page 2: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

How are different sizes of DNA strands separated on agarose gel?

Mixture of DNA molecules

Page 3: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

DNA separation is based on fragment size

Gel of the week

Decreasing S

ize

(+)

(-)

PCR1

PCR2

Page 4: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Size markers and their use to determine size

Page 5: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Size markers and their use to determine size

Mobility of a DNA fragment is proportional to the log of itssize in bases.

Page 6: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Plot of relative mobility of DNA vs log of size on semi-log graph paper

Page 7: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Varying concentrations of agarose

How does one make a 0.7%, 1.0% & 1.5%agarose gel?

Why are there varying concentrationsof agarose gels?

DNA Ladders

Page 8: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Varying concentrations of agarose

Why are there varying concentrationsof agarose gels?

Higher concentrations provide better resolution for smaller DNA fragments

Lower concentrations provide better resolution for larger DNA fragments

DNA Ladders

Page 9: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Experiment 1What is an EST?

Page 10: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

pT7T3-pac

Page 11: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

3 important parts of a vector

• Origin of replication

• Selectable marker

• Cloning sites

Page 12: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database
Page 13: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Origin of replication: considerations

• What is an origin of replication?

• Why do we need one?

• What properties should it have for easy plasmid DNA isolation?

Page 14: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

RepliconContains all info necessary to begin and end DNA replicationOrigin of replication (Ori) is a defined location within the replicon where DNA synthesis begins

Page 15: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

The ColE1 origin of replication

Page 16: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

ColE1 origin

• RNAII forms the primer for initiation of DNA synthesis

• RNAI and Rop protein are negative regulatory functions: RNAI binds to RNAII stopping primer formation; Rop protein stabilizes the complex formed by RNAI and RNAII.

Page 17: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

The ColE1 origin of replication

Page 18: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

RNAI:RNAII interaction

Page 19: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Rop protein negatively regulates the origin of replication

by stabilizing the RNAI:RNAII interaction.

Page 20: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Copy number

Plasmid Replicon=Origin

Copy number

pBR322 ColE1 15-20

pT7T3.pac ColE1 500-700

Page 21: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Why does pT7T3.pac have a high copy number?

• Point mutation in the origin that alters the initiation of RNAI transcription, such that the RNAI:RNAII complex does not form as well as wild-type.

• The region of the origin that encodes Rop protein is deleted.

Page 22: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Selectable Marker• Ampicillin resistance

• Ampicillin is a penicillin derivative.

• Blocks cross linking of the bacterial cell wall causing the cells to burst/lyse.

• Ampicillin resistance gene encodes a secreted enzyme that cleaves the beta-lactam ring.

Page 23: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Benzyl penicillin

lactam ring

Page 24: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Mechanism of resistance

Page 25: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Plasmid DNA isolation• Separate chromosomal DNA from

plasmid DNA

• Remove protein

• Remove RNA

• Easy

Page 26: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Starting material

Page 27: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Lysis and denaturation

Page 28: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Neutralization and centrifugation

Page 29: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Column

• Silica gel

• DNA binds at high salt.

• DNA is eluted at low salt.

• Removes glycogen and other cellular components.

Page 30: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database
Page 31: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

ESTs

• Expressed sequence tags?

• What are they?

• What do they represent?

• What do we use them for?

• What are their advantages?

Page 32: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

How is cDNA made?

First strand synthesis

3’ AAAAAAAAAAAAAAAAAAANNNNNNNNNNNNGCGGCCGCGTTGCTTTTTTTTTTTTTT 3’

Reverse transcriptase

Page 33: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Second strand synthesis

DNA polymerase I

Remove mRNA with OH or enzymatically

Cut hairpin

Add EcoRI adaptors GAATTCGGCACGAGG

Cut with NotI and insert into EcoRI NotI of vector

Page 34: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Normalized Library

mRNAs accumulate to different levels in a mRNA sample.

Normalization is a method of evening out the abundance levelsusing hybridization.

Page 35: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

T7 sequencing primer?

Page 36: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Dideoxy or Chain Termination Method

DNA SEQUENCING

1974

Maxam/Gilbert (USA) (Chemical Cleavage protocol)

Sanger (England) (natural process of DNA replication)

*

Phosphodiester bond cannot form with incoming nucleotides leading to termination of DNA synthesis

Page 37: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Sanger Sequencing in 1989

Page 38: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Primer

ADD:

Page 39: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Example output

Page 40: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Why is the size of the insert important?

• A sequencing run may only go 500-700 bases.

• What might you see and what might you not see?

Page 41: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

EST gel

Page 42: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Clipping an EST sequence

• What are we clipping out?

• Why do we look for GAATTCGGCACGAGG and GCAACGCGGCCGC?

• Why do we look for AAAAAAn?

Page 43: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

ExampleGAATTCGGCACGAGG

CGCGTTCTTGAAAAGACAGGTAAAATGCGAGTTCCAGAATGGGTAGAATTGTAAAGTCTGCACGATTCAAGGAACTTGCTCCATATGATCCAGATTGGTATTATATTAGATGTGCTGCTTTAGTTCGTCATATTTATATTCGAAGTCCAATTGGTGTTGGAGCAGTAACAAAAATTTTTGGAGGACGCAAACGTAATGGTACTCATCCTAGCCATTTCTGTCGATCGGCAGGTGGTGTTGCTCGCAAAGCTCTTCAGAGCTTGGAACAACTTAAACTCATTGAAAAATCTCCAGTTGGTGGACGTAAACTTACCAGTCAAGGCCGTAGAGATTTAGATCGCATTGCTGCCCAAGTCAAAGCAAAAAGCAAAAAACAACTTAAGTTACAAGAAACTCTTGTTCTCTAATTTCTTTATTTCTATAATAAAAATTAAAAAATCGTACATTTATATTCAAATTTTATTTATTCTACTATTATAAGTTAATTTTAGAAGTCTTAAATAATTTAATGGTAACAAAATATCACAAGACAATGTGCTATTATTTTTTTAATTGTTTATGAATTATCATAATTGAGGAAATTTTTAACTATAAATAGATAAAGTAAGAAATATAAATTTATAATTTATGATTATGTATTTTATATCTAAATGTATTT

ATTAATCTAAATATAAACAAATATACAT

AAAAAAAAAAAAAAAAAAAAAAAA

GCAACGCGGCCGC

AAGCTTATTCCCTTTAGTGAGGGTTAATTTTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTT

TC

Page 44: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Example output

Page 45: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

What could go wrong

• 18% of ESTs are in the reverse orientation.

• Potential of 2 inserts in the clone.

• What would this look like?

Page 46: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Step into liquid

Page 47: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Clipping a sequence I

Page 48: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Clipping Sequence II

Page 49: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Clipping Sequence III

Page 50: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Clipping Sequence IV

Page 51: Lecture 3 Lecture 2 catch up Vector structure Copy number control Selectable marker Plasmid DNA isolation ESTs DNA sequencing Entering the Honeybee database

Step into liquid


PARTHA PRATIM ESTs

Dna markers lecture

1st lecture - (DNA)

Dna lecture

Structure Dna Lecture

UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and ...modeling... · KIPP NYC College Prep Genetics and Biotech UNIT 9: Introduction to DNA Lecture 4: DNA Modeling and Intro

Lecture 2 Properties of DNA

Bioinformatics Lecture 1. DNA - the basics Drew Berry – DNA animations

Lecture 5 - DNA

Gene Lecture 9 DNA Structure

Lecture 3: DNA Recombination

SBA3503 Lecture DNA Manipulation

DNA Replication - lecture-notes.tiu.edu.iq

Last lecture summary. recombinant DNA technology DNA polymerase (copy DNA), restriction endonucleases (cut DNA), ligases (join DNA) DNA cloning – vector

Dna Replication - Biochemistry Lecture

Lecture 11 Recombinant Dna Tech

Lecture 15:Lecture 15: Chromosome Organization & DNA Packaging · PDF fileBME 42-620 Engineering Molecular Cell Biology Lecture 15:Lecture 15: Chromosome Organization & DNA Packaging

Dna Replication Lecture Notes

DNA Lecture Notes

DNA Replication II - lecture-notes.tiu.edu.iq

Lecture 9 10 dna-genes_chromosomes

Lecture 4: DNA transcription

Lecture 2 DNA 2013

Dna replication Lecture

Lecture 7 DNA REPLICATION

Lecture 1 Physical and chemical interactions DNA strand breaks DNA

Biotechnology Chapter Four Lecture- DNA

lecture 2 The first generation DNA Sequencing - cs.ucf.eduxiaoman/fall/lecture 2 The first generation DNA...DNA sequencing Determination of nucleotide sequence the determination of

Chromosomes and DNA Packaging--lecture

Property Dg Ests 1

EST clustering - BioinformaticsEST clustering EMBNet 2003 Interest for ESTs ESTs represent the most extensive available survey of the transcribed portion of genomes. ESTs are indispensable

dna Structure Lecture

DNA Replication – Process Lecture 17 1. Forms of DNA Helices 2 DNA Replication Template DNA (parent…

Lecture 3 - DNA Rearrangements & Epigenetics

Lecture 32 PCR & DNA Extraction