American Journal of Medical Genetics (Neuropsychiatric Genetics) 114:24±30 (2002)

Lack of Association Between HoxA1 and HoxB1 GeneVariants and Autism in 110 Multiplex Families

Jun Li,1 Holly K. Tabor,1 Loan Nguyen,1 Christopher Gleason,1 Linda J. Lotspeich,2 Donna Spiker,2

Neil Risch,1 and Richard M. Myers1*1Department of Genetics, Stanford University School of Medicine, Stanford, California2Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, California

A recent report suggested that the HoxA1and/or HoxB1 genes play a role in suscept-ibility to autism. To determine whetherthese ®ndings could be con®rmed, wescreened these genes for DNA polymorph-isms by sequencing all exons in 24 indivi-duals with autism. We identi®ed the samesequence variants in the genes thatappeared in this report, which include onesingle-base substitution variant in HoxA1and a common haplotype in HoxB1. Weperformed an association study by applyingthe transmission disequilibrium test todetect possible association of these variantsto autism in 110 multiplex families. Ourresults demonstrated no deviation from thenull hypothesis of no association. We havealso separately examined transmissionswithin individual mating types, for paternalversus maternal alleles, to affected versusunaffected children, and for transmission toaffected boys versus girls. None of thesesubsets revealed signi®cant deviation fromthe null expectation. Our interpretation ofthese ®ndings is that it is unlikely thatHoxA1 and HoxB1 play a signi®cant role inthe genetic predisposition to autism.ß 2001 Wiley-Liss, Inc.

KEY WORDS: autism; lack of association;Hox A1 and Hox B1

DATA BASE: HoxA1 (Genbank no. 500756);HoxB1 (Genbank no. 32383);Autism disorder (OMIMno. 209850)

INTRODUCTION

Autism is a severe neurodevelopmental disordercharacterized by marked social de®cits, delay, anddeviance in language development and communicationskills, and a restricted range of stereotypical, repetitivebehaviors, and interests. It has an onset in the ®rst3 years of life and a population prevalence of 1 inabout 2,500 births. As the most severe form of thebroadly de®ned pervasive developmental disorders(MIM209850), autism is generally agreed to resultfrom abnormalities in early neurodevelopment. Theetiology of autism is largely unknown. However, familyand twin studies have provided compelling evidence fora strong genetic component in most idiopathic cases[Steffenburg et al., 1989; Bailey et al., 1995]. Sibling-ship recurrence risk is about 3%, 50±100 times greaterthan the population prevalence, demonstrating a sub-stantial contribution to autism by hereditary factors[Smalley et al., 1988; Bolton et al., 1994; Szatmari et al.,1998]. The 25-fold difference in concordance rates formonozygotic twins (75%) and dizygotic twins (3%)suggests that autism is unlikely to be caused by asingle gene. Known genetic disorders with autisticfeatures, such as fragile X syndrome [Feinstein andReiss, 1998] and tuberous sclerosis [Smalley, 1998],account for only a small percentage of cases. A reportedsegregation analysis was most consistent with apolygenic model of inheritance [Jorde et al., 1991].

In the absence of speci®c hypotheses regarding thebiological functions that are disrupted in autism,genetic linkage studies seek to identify the location ofsusceptibility loci by tracking the cosegregation ofpolymorphic DNA markers with the disease in families.Results from four whole-genome scans have beenreported [International Molecular Genetic Study ofAutism Consortium, 1998; Collaborative LinkageStudy of Autism, 1999; Philippe et al., 1999; Rischet al., 1999]. Although some of these studies foundsuggestions of linkage at some chromosomal regions,none revealed signi®cant evidence (MLS>3.6 fordeclaration of genome-wide signi®cance) [Lander andKruglyak, 1995]. Our group, for example, found onlyone area of suggestive linkage with a chromosome 1marker (MLS¼2.15) [Risch et al., 1999]. Furthermore,

Grant sponsor: National Institutes of Health; Grant number:MH52708.

*Correspondence to: Richard M. Myers, Department of Genet-ics, M344, Stanford University School of Medicine, Stanford, CA94305. E-mail: myers@shgc.stanford.edu

Received 12 January 2001; Accepted 22 May 2001

ß 2001 Wiley-Liss, Inc.DOI 10.1002/ajmg.1618

we had only modestly positive or negative evidence incandidate regions identi®ed in other studies. Our dataare most compatible with a model involving more than10 loci, each with a small or moderate effect.

As none of the suggestive ®ndings for any genomicregion in these studies have been clearly replicated, wedo not yet have a compelling candidate region toattempt positional cloning of the de®nitive contributinggene for autism. This situation is not atypical ofcomplex genetic diseases, which most likely involvemultiple, possibly interacting genes, each with manycommon alleles that have modest functional effects.Linkage methods may not have enough power to detectsuch small effects with the sample sizes used in moststudies (no more than several hundred nuclearfamilies). In this regard, an alternative method basedon candidate genes may be more fruitful. In thisapproach, one relies on available biological informationto postulate genes that may underlie the disease. Bycomparing sequences of these genes in a subset of cases(sometimes also controls), common DNA polymorph-isms are identi®ed, and these are usually subsequentlygenotyped in all individuals collected. These resultsare then analyzed for association between speci®cvariants of these genes with disease. For instance,one can compare allele or genotype frequencies betweenaffected and unaffected individuals at the populationlevel. Alternatively, for family collections that includeaffected children and their parents, one can comparethe frequency of transmission of alleles from hetero-zygous parents to affected children by using thetransmission disequilibrium test (TDT) [Spielmanet al., 1993].

Several studies have attempted to examine potentialcandidate genes for autism. These include investiga-tions of the neuro®bromatosis type 1 gene [Mbareket al., 1999], the c-Harvey-Ras gene [Herault et al.,1995; Comings et al., 1996], and the UBE3A gene[Veenstra-VanderWeele et al., 1999]. GABA and ser-otonin signaling systems, in particular, have attracteda great deal of attention. None of these studies,however, has produced signi®cant and widely replic-able ®ndings. For a serotonin transporter promotervariant, for example, different groups have variablyreported associations to the long allele [Cook et al.,1997], to the short allele [Klauck et al., 1997], or noassociation to either [Maestrini et al., 1999; Zhong et al.,1999]. A polymorphism in the GABAA b3 receptor hassimilarly generated one positive report and threenonreplications [Cook et al., 1998; Maestrini et al.,1999; Salmon et al., 1999; Martin et al., 2000].

Recently, HoxA1 and HoxB1 genes were proposed toplay a role in autism [Rodier, 1999; Ingram et al., 2000].There were two main reasons for this suggestion: theobserved anatomic defects in the brainstem of anindividual with autism are very similar to what hasbeen observed in the HoxA1 knockout mice [Carpenteret al., 1993; Mark et al., 1993; Rodier et al., 1996;Gavalas et al., 1998]; victims of in utero exposure ofthalidomide had a high rate of autism, and they oftenhave misshapen ears but lack other malformations inthe limbs [StroÈmland et al., 1994]. These physical

defects were similar to what has been observed inHoxA1 knockout mice and indicated a time window ofthalidomide injury at about 20 to 24 days after concep-tion, a time at which few neuron populations have beenformed. Because HoxA1 and HoxB1 genes are expres-sed at this time and are involved in patterning of thesection of the neural tube that later develops intobrainstem and hindbrain, Rodier [1999] proposed thatthey are good candidate genes for autism. In their morerecent report, the authors described an HoxA1 sub-stitution variant that segregates in 50 autism familiesin a pattern that deviates from the null hypothesis of noassociation [Ingram et al., 2000]. The authors alsoreported parent-of-origin effects in transmission andgender-speci®c effects among the offspring.

In the experiments we describe here, we searched forpolymorphisms in HoxA1 and HoxB1 by sequencingtheir coding regions (comprised of two exons each) and¯anking intronic regions in 24 genomic DNA samplesfrom individuals diagnosed with autism. We discoveredan A-to-G transition (A218G) in exon 1 of HoxA1 and anine-nucleotide insertion in exon 1 of HoxB1. We alsofound two additional single-base substitution variantsin exon 1 of HoxB1 that are in tight linkage disequili-brium with the nine-base insertion. All four of thesepolymorphisms were the same as those reported byIngram et al. [2000], and we did not identify anyadditional sequence variants in the 48 chromosomesthat we sequenced. We genotyped HoxA1-A218G andHoxB1 insertion on 110 multiplex families and ana-lyzed the data for association using the transmissiondisequilibrium test. We found no evidence of associa-tion of either polymorphism with autism with thismethod. Our ®ndings suggest that HoxA1 and HoxB1are unlikely to be susceptibility genes for the majorityof idiopathic autistic cases.

MATERIALS AND METHODS

Patient Samples

Families recruited in this study had at least twosiblings with a clinical diagnosis of pervasive develop-mental disorder. To arrive at a research diagnosis ofautism, the children were assessed by using the AutismDiagnostic Interview (ADI) [Le Couteur et al., 1989;Lord et al., 1994, 1997] and the Autism DiagnosisObservation Schedule (ADOS) [Lord et al., 1989]. Adetailed account of our procedures and inclusioncriteria has been published previously [Risch et al.,1999]. Brie¯y, we have considered as affected onlythose individuals who satis®ed the prespeci®ed cutoffscores in all three symptom areas of ADI (socialimpairment, language and communication impair-ment, and unusual and restricted interests), as wellas had an age of onset of less than 3 years. We haveexcluded families where all affected children wereseverely retarded (IQ<30, or mental age<18 months)or had signi®cant medical conditions likely to accountfor autism. For more details on our diagnostic protocols,see Spiker et al. [1994].

Of the 139 multiplex families included in our whole-genome linkage study [Risch et al., 1999], 24 have only

HoxA1 and HoxB1 Gene Variants and Autism 25

one parent recruited (17 fathers and 7 mothers). Inanother seven families, DNA samples from either oneor both parents were no longer available. Inferring thegenotype of a missing parent from those of affectedchildren is possible but often introduces sampling bias,so we eliminated these 31 families from the currentstudy. To the remaining 108 complete families, weadded two new complete families and performed ourTDT analysis in these 110 complete families.

Mutation Screening

Polymerase chain reaction (PCR). PCRassays were performed in a 10 ml volume containing25 ng genomic DNA, 2.5 mM of each dNTP, 1 mM of eachprimer, 0.35±0.5 units of AmpliTaq Gold DNA Poly-merase (Perkin-Elmer, Norwalk, CT), 1 ml 10X Gen-eAmp PCR Gold Buffer (Perkin-Elmer), and 1.5 mMMgCl2 unless speci®ed otherwise for each primer set.PCR assays were carried out in GeneAmp 9600 or 9700Thermocyclers (Applied Biosystems, Foster City, CA) orPTC-200 Thermocyclers (MJ Research, Waltham, MA)by denaturing for 10 min at 948C or 958C, then 35 cyclesof 30 sec at 948C, 30 sec at 608C, and 23±30 sec at 728C,followed by a ®nal extension step of 3.5 min at 728C.

Primers were designed by using the Primer3 pro-gram (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) with masking of repetitive sequ-ences in humans and with modi®cation of severalsearch parameters [Beasley et al., 1999]. All primerswere synthesized at Life Technologies (Gibco-BRL,Rockville, MD) and puri®ed with standard desalting.

For HoxA1, the exon 1 target region was ampli®edin two overlapping segments (A and B) with thefollowing primers: HoxA1-E1-A sense: GGAAGTG-AGAAAGTTGGCACAGT, HoxA1-E1-A antisense: TG-GGAGATGAGAGATTTCCAGAG (476 bp); HoxA1-E1-B sense: CTTACAGCCCCTACGCGTTAAAT, HoxA1-E1-B antisense: ACCCTCTCCATGCACTACAACAC(470 bp, 3 mM MgCl2). The exon 2 target region wasampli®ed with the following primers: HoxA1-E2 sense:AGCGTGTGGGGAATCTCAAGT; HoxA1-E2 anti-sense: CATGTGCTTTGGGTAAGAAGTCC (496 bp,3 mM MgCl2). For HoxB1, the exon 1 target regionwas ampli®ed in two overlapping segments (A and B)with the following primers: HoxB1-E1-A sense: TG-ACATACTGCCGAAAGGTTGTA, HoxB1-E1-A anti-sense: GATGAAAATAGCCTCCGTCTCCT (412 bp);HoxB1-E1-B sense: GTTTCAGCAGAACTCCGGCTAT,HoxB1-E1-B antisense: CACTGCAGGGGAAGCAGA-GAT (473 bp). The exon 2 target region was alsoampli®ed in two overlapping segments (A and B) withthe following primers: HoxB1-E2-A sense: TTGA-CAACTGTACTTGGGCAGAA, HoxB1-E2-A antisense:AGGTTCAGTTCAGGAGGTGACAG (459 bp, 3 mMMgCl2); HoxB1-E2-B sense: AACACAGGTCAAGATT-TGGTTCC, HoxB1-E2-B antisense: AAGCCCTTCCC-TCTACATTTGAC (429 bp).

Puri®cation of PCR products as sequencingtemplate. After DNA ampli®cation, unincorporateddNTPs were inactivated, and primers were digested byadding 2 ml exonuclease I (20 units/ml, New England

Biolabs, Beverly, MA) and 2 ml shrimp alkaline phos-phatase (10 units/ml, Amersham Life Science, ArlingtonHeights, IL) to each 10 ml PCR assay. The samples wereincubated for 1 hr at 378C, followed by inactivation ofenzymes at 758C for 15 min.

Sequencing. PCR products were sequenced fromboth directions by using the PCR primers as above.Cycle sequencing was performed in a 10 ml volumecontaining 2 ml exonuclease-treated PCR product asDNA template, 0.2 mM of sequencing primer, 2 ml ABIPRISM BigDye Terminator Ready Reaction Mix con-taining AmpliTaq DNA Polymerase, FS (AppliedBiosystems, Foster City, CA), and 2 ml 2.5X ABISequencing Buffer (Applied Biosystems). Sequencingreactions were carried out in GeneAmp 9700 Thermo-cyclers (Applied Biosystems) or PTC-200 Thermocy-clers (MJ Research) by denaturing for 5 min at 948C or968C, followed by 25 cycles of 10 sec at 968C, 5 sec at508C, and 4 min at 608C.

Excess dye-terminators were removed by isopropanolprecipitation followed by ethanol precipitation. Sequ-ence products were resuspended in 2 ml loading buffer(5:1 deionized formamide, 25 mM EDTA, 50 mg/ml BlueDextran), heated at 958C for 3 min and loaded onto theApplied Biosystems 377 DNA sequencer.

Sequence analysis. ABI sequence software Gen-escan 2.01 was used for lane tracking and ®rst-passbase-calling. Chromatograms were transferred to aUNIX workstation (Sun Microsystems), base-calledwith Phred [Ewing et al., 1998], assembled with Phrap[Ewing and Green, 1998], sequence variants scannedwith Polyphred [Nickerson et al., 1997], and resultsviewed in Consed [Gordon et al., 1998]. Polyphred hasbeen designed to aid in identi®cation of heterozygoussingle-nucleotide substitutions by color-coding poten-tial sites. Chromatogram peak patterns for variantpositions tagged by Polyphred were visually inspected,with special attention paid to verify that base-calls fromboth strands agreed with each other. As an indepen-dent con®rmation, the two polymorphisms that wediscovered in the 24 autistic subjects were all geno-typed again by a different method when we genotypedall of our samples and the results agreed with sequ-encing. For individuals heterozygous for the HoxB1insertion variant, the trace representing the insertionallele would shift by nine bases relative to the wild-typetrace downstream from the insertion site in thechromatogram. The superimposition of two traces canbe distinguished by visually subtracting the tracerepresenting the wild-type. In addition, the segmentdownstream of the insertion site is unambiguouslysurveyed by sequencing from the opposite direction.

Genotyping

HoxA1-A218G. A 174 bp DNA fragment encom-passing the A218G variant site was ampli®ed byprimers (sense) CTACCCCTCGGACCATAGGA and(antisense) TTCCCGGAAGTCTGGTAGGT using stan-dard PCR conditions as described above except that theannealing temperature was 648C. The PCR productswere digested with HphI (New England Biolabs) for 2 hr

26 Li et al.

at 378C in 20 ml volume containing 4 ml of the PCRreaction, 2 ml 10X buffer, and 2±3 units of HphI.Digested reactions were run on 2±3% agarose gels,yielding either a 46 bp � 128 bp band pattern for the A-allele, or a single 174 bp band for the G-allele. Resultsfrom HphI digest for the 24 sequenced samples agreedwith the sequencing results.

HoxB1 insertion. A fragment containing theinsertion was ampli®ed by the primers (sense) GACC-CAGCGCCTACAGCG and (antisense) CATAGCTGT-CAACCGCCTG. PCR was carried out at an annealingtemperature of 588C and with 10% DMSO in thereaction mix. The products were run on 3% Metaphoragarose gel (FMC Bioproducts, Rockland, ME), yieldingeither a 75 bp band for the wild-type (WT) allele or an84 bp band for the insertion (Ins) allele.

Statistical Analysis

Data were analyzed by using TDT [Spielman et al.,1993], where preferential transmission of alleles fromheterozygous parents to affected children is tested bythe (BÿC)2/(B�C) statistic and the McNemar chi-square test (where B is the total number of transmis-sions of allele 1 and C the total number of transmissionsof allele 2). We combined children in all familiesirrespective of number of affected in the family. Onlyfamilies with both parents genotyped were included inthe analysis. The analysis was performed with sib_tdtin the ASPEX program package (Hinds and Risch, ftp://lahmed.stanford.edu/pub/aspex).

RESULTS

Polymorphism Discovery and Genotyping

We sequenced all exons (two each for HoxA1 andHoxB1) and their ¯anking intronic sequences (at least70 bases into the introns) from the genomic DNA of 24autistic individuals chosen from our collection ofmultiplex families. In exon 1 of HoxA1, we identi®edan A218G polymorphism (numbered according toGenBank entry U10421), which results in an aminoacid change His73Arg. The genotype counts amongthe 24 samples were 18 A/A, 5 G/A, and 1 G/G. Thissame variant was reported by Ingram et al. [2000]. Wethen genotyped this polymorphism in all autismsamples by the restriction fragment length polymorph-ism (RFLP) analysis with the enzyme HphI as above.Among all individuals, the frequency of the G-allele was13%.

In exon 1 of HoxB1, we and Ingram et al. [2000]identi®ed a nine-base insertion (ACAGCGCCC) afterbase 88 (numbered according to X16666), which resultsin the insertion of amino acids His-Ser-Ala. Thisinsertion can also be viewed as a nine-base repeatexpansion (from two to three), because, in mostindividuals (which we designate wild-type), these ninebases are repeated twice at bases 71±88. The genotypecounts were 15 WT/WT, 8 WT/Ins, and 1 Ins/Ins. Therewere two other single-nucleotide polymorphisms inexon 1 of HoxB1: A315T (Gln102His) and G456A(synonymous). All of these variants were also reportedby Ingram et al. [2000]. At least among the 24 sampleswe sequenced, these 3 polymorphisms were in completelinkage disequilibrium with each other. The G456Apolymorphism was also con®rmed by RFLP analysiswith HindIII. We chose not to genotype A315T andG456A further. We genotyped the insertion polymorph-ism by distinguishing the nine-base size differencebetween the two alleles as above. Among all indivi-duals, the frequency of the Ins allele was 22.8%.

Transmission of HoxA1-A218G

The genotype counts for mothers, fathers, andunaffected children in the 110 complete families didnot deviate from Hardy-Weinberg equilibrium (HWE;Table I). For affected children, the number of observedGG genotypes (9) was greater than what was expectedunder HWE (4.2). The main reason for this result isthat there are 11 parent pairs belonging to the matingtype that could generate GG offspring (AG-AG, AG-GG,and GG-AG), more than what is expected (< 6.4) underrandom mating. Conditional on these mating types, theexpected number of affected GG offspring is 7.5, veryclose to the observed 9. Therefore, this result did notindicate an increased risk for the GG genotype. Becausewe genotyped the A218G polymorphism by assayingthe HphI-RFLP, in which G is the allele not digested bythe enzyme, we independently con®rmed all the GGgenotypes by direct DNA sequencing. This ensured thatnone of the GG results arose spuriously due to poordigestion by HphI.

Within these 110 families, heterozygous (A/G) par-ents transmitted the A-allele to affected children 50times (to boys, 42; to girls, 8) and the G-allele 54 times(to boys, 43; to girls, 11; Table II). None of these resultsdiffered signi®cantly from the expectation under thenull hypothesis of no association. A breakdown oftransmissions according to mating type revealed no

TABLE I. Genotype Counts for HoxA1-A218G in 110 Multiplex Autism Families

Observed (expected) Allele frequencies

AA AG GG A G

Mother 85 (84.7) 23 (23.7) 2 (1.7) 0.877 0.123Father 82 (82.0) 26 (25.9) 2 (2.0) 0.864 0.136

Total 167 (166.7) 49 (49.6) 4 (3.7) 0.870 0.130Affected siblings 176 (171.2) 44 (53.6) 9 (4.2) 0.865 0.135Unaffected siblings 24 (23.6) 7 (7.7) 1 (0.6) 0.859 0.141

Total 200 (194.8) 51 (61.3) 10 (4.8) 0.864 0.136

HoxA1 and HoxB1 Gene Variants and Autism 27

signi®cant deviation from expectation (Table II). Toaffected children, A/G fathers transmitted 23 A's and 21G's (TDT chi-square� 0.09; NS); while A/G motherstransmitted 17 A's and 23 G's (TDT chi-square�0.90;NS). Therefore, there was no signi®cant parent-of-origin effect. The number of transmissions to unaf-fected children was 12 A's and 9 G's (TDT chi-square�.43; NS). Therefore, TDT analysis did not support anassociation between HoxA1-A218G and autism.

Transmission of HoxB1 Insertion

The genotype counts for HoxB1 in mothers, fathers,affected and unaffected children agreed with Hardy-Weinberg equilibrium (Table III). Heterozygous (WT/Ins) parents transmitted the WT allele to affectedchildren 74 times (to boys, 59; to girls, 15) and the Insallele 86 times (to boys, 60; to girls, 26). None of theseresults differed signi®cantly from the expectationunder the null hypothesis of no association. WT/Insfathers transmitted 22 WTs and 28 Inses (TDT chi-square� 0.72; NS) to affected children; while WT/Insmothers transmitted 32 WTs and 38 Inses (TDT chi-square� 0.51; NS). A breakdown according to matingtype and relevant TDT statistics is shown in Table IV.The number of transmissions to unaffected childrenwas 11 WTs and 10 Inses. These results indicated thatTDT analysis did not support an association betweenHoxB1 Ins and autism.

DISCUSSION

In this study, we tested the hypothesis that sequencevariants in HoxA1 and/or HoxB1 genes play a role in

the pathogenesis of autism. We screened for commonpolymorphisms in exons and the immediately ¯ankingintronic regions of these genes by comparing thesequence among 24 autistic individuals. In agreementwith the report of Ingram et al. [2000], we found asingle substitution variant, A218G, in HoxA1, whichproduced a nonconservative change in amino acid (Histo Arg). We also found three coding changes in HoxB1that form a tightly linked haplotype. For this reason,we genotyped only one of the three polymorphisms, anine-base insertion that inserts three additional aminoacids (His-Ser-Ala) in the HoxB1 protein. Thesevariants were also reported by Ingram et al. [2000].For HoxA1, these authors observed only four of the sixpossible mating types in 50 simplex or multiplexfamilies, as they did not observe any GG genotypesamong parents. From AA-AG, AG-AA, and AG-AGmatings (34 families), there were 11 AA, 28 AG, and 1GG affected siblings, giving rise to 16 transmissions ofA and 30 of G, for a TDT chi-square of 4.3. This resultwas interpreted as supporting an increased risk for theAG genotype. Within that data set, there were alsodiscernible parent-of-origin effects, mating type-speci-®c effects, and gender imbalance among the offspring.For example, A/G parents transmitted to affected girls7 G's but no A's; A/G mothers transmitted to boys 6 A'sand 13 G's, while A/G fathers transmitted to boys 7 A'sand 7 G's.

By contrast, in our study transmission of alleles fromheterozygous parents to affected children did notdeviate from the null hypothesis for either variant.Various ways of subgrouping the transmission counts,such as maternal versus paternal alleles, to boysversus to girls, or within different mating types, also

TABLE II. Genotype Counts and TDT Results for HoxA1-A218G According to Mating Type in 110 Multiplex Autism Families

Mating type,father�mother

Numberof families

Number of affected siblings Number of unaffected siblings Affected Unaffected

AA AG GG AA AG GGNumber

transmittedNumber

transmitted

AA�AA 68 141 16AA�AG 14 14 16 3 1 14A/16G 3A/1GAG�AA 16 18 14 3 4 18A/14G 3A/4GAG�AG 8 3 10 5 2 2 1 16A/20G 6A/4GAA�GG 0 0 0GG�AA 1 2 0AG�GG 2 2 2 0 0 2A/2GGG�AG 1 0 2 0 0 0A/2GGG�GG 0 0 0

Total 110 176 44 9 22 7 1 50A/54G 12A/9G

TABLE III. Genotype Counts for HoxB1 Ins in 110 Multiplex Autism Families

Observed (expected) Allele frequencies

WW WI II W I

Mother 64 (65.7) 42 (38.6) 4 (5.7) 0.773 0.227Father 72 (71.2) 33 (34.6) 5 (4.2) 0.805 0.195

Total 136 (136.8) 75 (73.3) 9 (9.8) 0.789 0.211Affected siblings 134 (135.4) 85 (82.1) 11 (12.4) 0.767 0.233Unaffected siblings 19 (18.4) 9 (10.2) 2 (1.4) 0.783 0.217

Total 153 (153.8) 94 (92.3) 13 (13.8) 0.769 0.231

28 Li et al.

failed to support a signi®cant level of association.Therefore, our conclusion regarding the HoxA1-A218G does not agree with that in the report by Ingramet al. [2000].

For HoxA1-A218G, we did not observe deviation fromHardy-Weinberg equilibrium (de®cit of GG subjects) ineither the parents or offspring. This result also differsfrom the report by Ingram et al. [2000] of a decrease inGG frequency and an increase of AG frequency in theprobands, their unaffected relatives, or a ``conveniencepopulation'' control. Our data did not support theinterpretation that GG individuals have reducedviability. In our families, the allele frequencies incases and their parents were almost the same, as werethe genotype frequencies, thus demonstrating a lack ofassociation when comparing cases to parental controls.

The reason for the apparent discrepancy betweenthese two studies is not clear. Because there does notseem to be a major gene effect for HoxA1, thediscrepancy could be accounted for by statistical¯uctuations that suggest association when none ispresent, or by association that is too weak to detectexcept in a very large sample. Indeed, the level ofsigni®cance observed by Ingram et al. [2000] in theirtransmission test was not striking (P� 0.01). On theother hand, we also studied a larger number of subjects(110 families with 230 affected offspring) compared tothe 50 families with 66 affected offspring studied byIngram et al. [2000]. Therefore, we should have hadample power to detect effects of the magnitude thatthey reported. The sample studied by Ingram et al.[2000] adopted broader criteria that included Aspergersyndrome and pervasive developmental disorder (nototherwise speci®ed). Additionally, while their sample isa mixture of simplex and multiplex families (66 affectedoffspring in 50 families), our sample comprises entirelymultiplex families. Broader inclusion criteria are morelikely to produce a genetically heterogeneous sample.Simplex families are generally less enriched for thedisease-predisposition allele. The differences in diag-nosis and inclusion criteria therefore are not expectedto make our study underpowered.

At present, our understanding of how Hox genesfunction in humans is limited. We do not have directevidence about when, where, and how they are express-ed, how they interact with other genes, and to what

extent neurodevelopment in humans is susceptible tosequence variations in these genes. In additional, we donot have any indication as to whether the A218Gvariant causes any functional change in the HoxA1protein. The His-Arg change occurs in a series of10 histidines in the human HoxA1 gene, whereas thereare 9 histidines in the corresponding positions in the ratHoxA1 (GenBank accession number NM_013075), 11in mouse (NM_010449), 5 in Horn shark (AF224262).Because the human HoxA1 protein is> 92% identical toits rat and mouse counterparts, sequence comparison ofthe histidine stretch does not indicate an unusuallyhigh degree of conservation. One of the more directapproaches to gauge the functional effect of A218Gwould be to study the His-Arg variation in modelorganisms.

By the same token, our understanding of thepathogenesis of autism is also very limited. Currentlythere does not seem to exist a set of speci®c neurologicalor anatomical symptoms that is widely and consistentlyobserved in a high proportion of subjects with autism[Courchesne, 1997; Bailey et al., 1998]. Autism remainsa disease de®ned solely on behavioral terms, andthe search for its biological basis remains to beinformed by broader and more careful moleculargenetic studies.

In summary, while we cannot rule out the possibilityof the HoxA1 gene's involvement in autism, our resultsprovide no evidence for any role of the gene and anyeffect could be, at best, very small. This reaf®rms thenotion that autism has a complex genetic etiology andthat no single gene, probably not even a small set ofgenes, can account for the familial inheritance ofautism. As none of the candidate gene studies of autismreported to date has been satisfactorily replicated, it isimportant to underscore the need to search for othercategories of genes or functional pathways that areimportant in neurodevelopment.

ACKNOWLEDGMENTS

We thank Dr. Patricia Rodier for sharing her resultsprior to publication and members of the Myerslaboratory for helpful discussions and their support.We also thank the families who have been our partners

TABLE IV. Genotype Counts and TDT Results of HoxB1 Ins According to Mating Type in 110 Multiplex Autism Families

Mating type,father�mother

Number offamilies

Number of affected siblings Number of unaffected siblings Affected Unaffected

WW WI II WW WI IINumber

transmittedNumber

transmitted

WW�WW 45 92 9WW�WI 26 23 32 8 3 23W/32I 8W/3IWI�WW 16 10 22 2 2 10W/22I 2W/2IWI�WI 16 9 20 6 0 1 2 38W/32I 1W/5IWW� II 1 3 0II�WW 3 6 3WI� II 1 3 0 0 0 3W/0III�WI 0II�II 2 5 0

Total 110 134 85 11 19 9 2 74W/86I 11W/10I

HoxA1 and HoxB1 Gene Variants and Autism 29

in this research. J.L. and H.K.T. were supported byNIH Training Grant HG00044.

REFERENCES

Bailey A, Le Couteur A, Gottesman I, Bolton P, Simonoff E, Yuzda E,Rutter M. 1995. Autism as a strongly genetic disorder: evidence from aBritish twin study. Psychol Med 25:63±77.

Bailey A, Luthert P, Dean A, Harding B, Janota I, Montgomery M, RutterM, Lantos P. 1998. A clinicopathological study of autism. Brain121:889±905.

Beasley A, Myers RM, Cox DR, Lazzeroni LC. 1999. Statistical re®nementof primer design parameters. In: Innis MA, Gelfand DH, Sninsky JJ,editors. PCR applications. New York: Academic Press. p 55±72.

Bolton P, Macdonald H, Pickles A, Rios P, Goode S, Crowson M, Bailey A,Rutter M. 1994. A case-control family history study of autism. J ChildPsychol Psychiatry 35:877±900.

Carpenter EM, Goddard JM, Chisaka O, Manley NR, Capecchi MR. 1993.Loss of Hox-A1 (Hox-1.6) function results in the reorganization of themurine hindbrain. Development 118:1063±1075.

Collaborative linkage study of autism (CLSA). 1999. An autosomal genomicscreen for autism. Am J Med Genet (Neuropsychiatr Genet) 88:609±615.

Comings DE, Wu S, Chiu C, Muhleman D, Sverd J. 1996. Studies of the c-Harvey-Ras gene in psychiatric disorders. Psychiatry Res 63:25±32.

Cook EH Jr, Courchesne R, Lord C, Cox NJ, Yan S, Lincoln A,Haas R, Courchesne E, Leventhal BL. 1997. Evidence of linkagebetween the serotonin transporter and autistic disorder. Mol Psychia-try 2:247±250.

Cook EH Jr, Courchesne RY, Cox NJ, Lord C, Gonen D, Guter SJ, LincolnA, Nix K, Haas R, Leventhal BL, et al., 1998. Linkage-disequilibriummapping of autistic disorder, with 15q11-13 markers. Am J Hum Genet62:1077±1083.

Courchesne E. 1997. Brainstem, cerebellar and limbic neuroanatomicalabnormalities in autism. Curr Opin Neurobiol 7:269±278.

Ewing B, Green P. 1998. Base-calling of automated sequencer traces usingphred. II. error probabilities. Genome Res 8:186±194.

Ewing B, Hillier L, Wendl MC, Green P. 1998. Base-calling of automatedsequencer traces using phred. I. accuracy assessment. Genome Res8:175±185.

Feinstein C, Reiss AL. 1998. Autism: the point of view from fragile Xstudies. J Autism Dev Disord 28:393±405.

Gavalas A, Studer M, Lumsden A, Rijli FM, Krumlauf R and Chambon P.1998. Hoxa1 and Hoxb1 synergize in patterning the hindbrain, cranialnerves and second pharyngeal arch. Development 125:1123±1136.

Gordon D, Abajian C, Green P. 1998. Consed: a graphical tool for sequence®nishing. Genome Res 8:195±202.

Herault J, Petit E, Martineau J, Perrot A, Lenoir P, Cherpi C, BarthelemyC, Sauvage D, Mallet J, Muh JP. 1995. Autism and genetics: clinicalapproach and association study with two markers of HRAS gene. Am JMed Genet 60:276±281.

Ingram JL, Stodgell CJ, Hyman SL, Figlewicz DA, Weitkamp LR, RodierPM. 2000. Discovery of allelic variants of HOXA1 and HOXB1: Geneticsusceptibility to autism spectrum disorders. Teratology 62:393±405.

International Molecular Genetic Study of Autism Consortium (IMGSAC).1998. A full genome screen for autism with evidence for linkage to aregion on chromosome 7q. Hum Mol Genet 7:571±578.

Jorde LB, Hasstedt SJ, Ritvo ER, Mason-Brothers A, Freeman BJ, PingreeC, McMahon WM, Petersen B, Jenson WR, Mo A. 1991. Complexsegregation analysis of autism. Am J Hum Genet 49:932±938.

Klauck SM, Poustka F, Benner A, Lesch KP, Poustka A. 1997. Serotonintransporter (5-HTT) gene variants associated with autism? Hum MolGenet 6:2233±2238.

Lander ES, Kruglyak L. 1995. Genetic dissection of complex traits. NatGenet 11:241±247.

Le Couteur A, Rutter M, Lord C, Rios P, Robertson S, Holdgrafer M,McLennan J. 1989. Autism diagnostic interview: a standardizedinvestigator-based instrument. J Autism Dev Disord 19:363±387.

Lord C, Rutter M, Goode S, Heemsbergen J, Jordan H, Mawhood L,Schopler E. 1989. Autism diagnostic observation schedule: a standar-

dized observation of communicative and social behavior. J Autism DevDisord 19:185±212.

Lord C, Rutter M, Le Couteur A. 1994. Autism Diagnostic Interview±Revised: a revised version of a diagnostic interview for caregivers ofindividuals with possible pervasive developmental disorders. J AutismDev Disord 24:659±685.

Lord C, Pickles A, McLennan J, Rutter M, Bregman J, Folstein S,Fombonne E, Leboyer M, Minshew N. 1997. Diagnosing autism:analyses of data from the Autism Diagnostic Interview. J Autism DevDisord 27:501±517.

Maestrini E, Lai C, Marlow A, Matthews N, Wallace S, Bailey A, Cook EH,Weeks DE, Monaco AP. 1999. Serotonin transporter (5-HTT) andgamma-aminobutyric acid receptor subunit beta3 (GABRB3) genepolymorphisms are not associated with autism in the IMGSA families:the International Molecular Genetic Study of Autism Consortium. Am JMed Genet (Neuropsychiatr Genet) 88:492±496.

Mark M, Lufkin T, Vonesch JL, Ruberte E, Olivo JC, Dolle P, Gorry P,Lumsden A, Chambon P. 1993. Two rhombomeres are altered in Hoxa-1mutant mice. Development 119:319±338.

Martin ER, Menold MM, Wolpert CM, Bass MP, Donnelly SL, Ravan SA,Zimmerman A, Gilbert JR, Vance JM, Maddox LO, et al. 2000. Analysisof linkage disequilibrium in gamma-aminobutyric acid receptor subunitgenes in autistic disorder. Am J Med Genet (Neuropsychiatr Genet)96:43±48.

Mbarek O, Marouillat S, Martineau J, Barthelemy C, Muh JP, Andres C.1999. Association study of the NF1 gene and autistic disorder. Am JMed Genet (Neuropsychiatr Genet) 88:729±732.

Nickerson DA, Tobe VO, Taylor SL. 1997. PolyPhred: automating thedetection and genotyping of single nucleotide substitutions using¯uorescence-based resequencing. Nucl Acids Res 25:2745±2751.

Philippe A, Martinez M, Guilloud-Bataille M, Gillberg C, Rastam M,Sponheim E, Coleman M, Zappella M, Aschauer H, Van Maldergem L,et al. 1999. Genome-wide scan for autism susceptibility genes: ParisAutism Research International Sibpair Study. Hum Mol Genet 8:805±812.

Risch N, Spiker D, Lotspeich L, Nouri N, Hinds D, Hallmayer J,Kalaydjieva L, McCague P, Dimiceli S, Pitts T, et al. 1999. A genomicscreen of autism: evidence for a multilocus etiology. Am J Hum Genet65:493±507.

Rodier PM. 1999. The early origins of autism. Sci Am 282:56±63.

Rodier PM, Ingram JL, Tisdale B, Nelson S, Romano J. 1996. Embry-ological origin for autism: developmental anomalies of the cranial nervemotor nuclei. J Comp Neurol 370:247±261.

Salmon B, Hallmayer J, Rogers T, Kalaydjieva L, Petersen PB, Nicholas P,Pingree C, McMahon W, Spiker D, Lotspeich L, et al. 1999. Absence oflinkage and linkage disequilibrium to chromosome 15q11±q13 markersin 139 multiplex families with autism. Am J Med Genet (Neuropsy-chiatr Genet) 88:551±556.

Smalley SL. 1998. Autism and tuberous sclerosis. J Autism Dev Disord28:407±414.

Smalley SL, Asarnow RF, Spence MA. 1988. Autism and genetics: a decadeof research. Arch Gen Psychiatry 45:953±961.

Spielman RS, McGinnis RE, Ewens WJ. 1993. Transmission test forlinkage disequilibrium: the insulin gene region and insulin-dependentdiabetes mellitus (IDDM). Am J Hum Genet 52:506±516.

Spiker D, Lotspeich L, Kraemer HC, Hallmayer J, McMahon W, PetersonPB, Wong DL, Dimiceli S, Ritvo E, Cavalli-Sforza LL, Ciaranello RD.1994. Genetics of autism; characteristics of affected and unaffectedchildren from 37 multiplex families. Am J Med Gen 54:27±35.

Steffenburg S, Gillberg C, Hellgren L, Andersson L, Gillberg IC, JakobssonG, Bohman M. 1989. A twin study of autism in Denmark, Finland,Iceland, Norway and Sweden. J Child Psychol Psychiatry 30:405±416.

StroÈmland K, Nordin V, Miller M, Akerstrom B, Gillberg C. 1994. Autism inthalidomide embryopathy: a population study. Dev Med Child Neurol36:351±356.

Szatmari P, Jones MB, Zwaigenbaum L, MacLean JE. 1998. Genetics ofautism: overview and new directions. J Autism Dev Disord 28:351±368.

Veenstra-VanderWeele J, Gonen D, Leventhal BL, Cook EH Jr. 1999.Mutation screening of the UBE3A/E6-AP gene in autistic disorder. MolPsychiatry 4:64±67.

Zhong N, Ye L, Ju W, Brown WT, Tsiouris J, Cohen I. 1999. 5-HTTLPRvariants not associated with autistic spectrum disorders. Neuroge-netics 2:129±131.

30 Li et al.