Upload File

lac operon gene regulation in action. what is gene regulation expressing a gene –making the...

  • Home
  • Documents
  • Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The
27
Lac Operon Gene Regulation in action

Upload: collin-lyons

Post on 18-Dec-2015

216 views

Category:

Documents


0 download

Report

Tags:

TRANSCRIPT

Page 1: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Lac Operon

Gene Regulation in action

Page 2: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

What is gene regulation

• Expressing a gene– Making the protein for the gene

• Only making a protein when needed

• The process for determining when transcription occurs– or what factors determine that

Page 3: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Introns and Exons

• Eukaryotic DNA differs from prokaryotic DNA it that the coding sequences along the gene are interspersed with noncoding sequences

• The coding sequences are called

• EXONS

• The non coding sequences are called

• INTRONS

Page 4: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The
Page 5: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Lac Operon

• Found in E. Coli– Bacteria– Prokaryote

• Determines the balance between enzyme and substrate

• What really happens when we make protein?- requirements– Amino acids, transcription, translation- don’t

forget ATP

Page 6: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Lac Operon

• Waste of energy?– You bet!

• How do we make sure we can make proteins only when we need them– How do we get lights only when we need

them – How do we get electricity in this thing

Page 7: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Lac Operon

• Reminder about bacteria– Bacteria- 1 chromosome– Bacteria- one strand– DNA is circular

Page 8: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Lac Operon

• Many of our old buddies are still around– DNA– RNA– Factors– Helicase

- Polymerase

Page 9: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Video Time!

http://jeffersonbioballard.wikispaces.com/assignment2
Page 10: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

New Terms

• Promoter region– Place upstream important for binding in

DNA

• Controller/operator regions– Where Operon binds in

• Lactose– the sugar

Page 11: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Enzymes

• Permease– Protein allow items into the cell

• Beta-galactosidase– Breaks down glucose

• Transacetylase- ?

Page 12: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Look at the DNALook at the DNA

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

DNA DNA SequenceSequence

Page 13: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

Page 14: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

Page 15: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

No space for polymerase to reach where it needs to.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitor

Page 16: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

If there is no lactose present, the inhibitor is bound to the operator (Operon) sequence.

No space for polymerase to reach where it needs to.

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 17: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

No space for polymerase to reach where it needs to.

Lactose solution added

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 18: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

What’s Lactose again?

Page 19: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose solution added

Lactose binds to the inhibitor

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

InhibitorInhibitorRNA RNA POLPOL

Page 20: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose binds to the inhibitor

Lactose causes inhibitor no longer bind to the operator sequence

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 21: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose causes inhibitor no longer bind to the operator sequence

RNA Polymerase can now transcribe

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 22: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Lactose causes inhibitor no longer bind to the operator sequence

RNA Polymerase can now transcribe

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

CCCCCGCCCCCGCCCCCUAUCCCCCGCCCCCGCCCCCUAURNA

Page 23: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Three mRNA “recipes” are made

• Permease– Protein allow items into the cell

• Beta-galactosidase– Breaks down glucose

• Transacetylase

• They also get translated!

Page 24: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Transcription continues to occur until lactose levels get low in the solution

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

CCCCCGCCCCCGCCCCCUAUCCCCCGCCCCCGCCCCCUAURNA

Page 25: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

Promoter Promoter RegionRegion

Operator Operator SequenceSequence

Coding Coding RegionRegion

Terminator Terminator SequenceSequence

Lac Operon in actionLac Operon in action

Transcription continues to occur until lactose levels get low in the solution

Then the inhibitor binds back into the operator sequence

ATATATATATATATATATATATATAGGGGGCCGGGGCGGGGGATATCGCATACAGG

TATATATATATATATATATATATATCCCCCGGCCCCGCCCCCCTATAGCGTATGTCC

RNA RNA POLPOL

InhibitorInhibitor

Page 26: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

The End

Page 27: Lac Operon Gene Regulation in action. What is gene regulation Expressing a gene –Making the protein for the gene Only making a protein when needed The

DNA


12-5 GENE REGULATION. I. GENE REGULATION: AN EXAMPLE

Unit 7: Signal Transduction. Multi-Step Regulation of Gene Expression DNA Primary RNA transcript mRNA Degraded mRNA Protein Active Protein Degraded Proteinn

Current Major Advances in the Regulation of Milk Protein Gene Expression

Regulation of Gene Expression - Parkway Schools Bio Fall 2012/18... · Regulation of gene expression trpE gene trpD gene trpC gene trpB gene trpA gene (b) Regulation of enzyme production

Gene Regulation - Signalling. Efficiency Poor RBS Sequestering Riboswitches Stringent Response Transcription Replication Translation DNA mRNA Protein

Posttranscriptional Regulation of HIV-1 Gene …Posttranscriptional Regulation of HIV-1 Gene Expression during Replication and Reactivation from Latency by Nuclear Matrix Protein MATR3

Gene, genetic code and regulation of the gene expression ......•Lactose & tryptophan metabolism •Adjustment by bacteria •Regulates protein synthesis •Response to environment

REGULATION OF GENE EXPRESSION BY ENHANCER RNAs -eRNAs · gene regulation. The mechanisms underlying TAD formationare also complex and notyet fullyelucidated , though a numberof protein

Motif Finding. Regulation of Genes Gene Regulatory Element RNA polymerase (Protein) Transcription Factor (Protein) DNA

DNA & genetic information DNA replication Protein synthesis Gene regulation & expression DNA structure DNA as a carrier Gene concept Definition Models

Biology 10.2 Gene Regulation and Structure Gene Regulation and Structure

Gene Protein Chapter 17. Protein Synthesis / Gene Expression Gene expression: The translation of information encoded in a gene into protein or RNA. Expressed

Regulation of Gene Expression - WordPress.com · Gene Expression.notebook Regulation: the mechanism by which protein synthesis is increased, decreased, initiated or stopped •Prevents

Structure & concept of gene, One gene one enzyme hypothesis, Genetic Code PROTEIN SYNTHESIS, Regulation of gene expression Dr. Madhumita Bhattacharjee

REGULATION OF THE HUNTINGTIN INTERACTING PROTEIN 1 (HIP1) GENE

Gene regulation. Gene regulation NUCLEUS CYTOPLASM R. S. Winning, 2003

Chapter 17 From Gene to Protein (Protein Synthesis) From Gene to Protein (Protein Synthesis)

Gene Expression Overview Salwa Hassan Teama 1. Gene Expression The Gene Structure Transcription Genetic Code and Protein Synthesis Regulation

1 Gene Expression Overview. 2 Gene Expression Gene Expression The Gene Structure The Gene Structure Protein Synthesis Protein Synthesis

Gene Regulation. Regulation in Prokaryotes Gene Expression = gene to protein processing that functions within cells. Regulation = We are talking about

Molecular Genetics Protein Synthesis Gene Regulation Mutations Biotechnology

REGULATION OF GENE EXPRESSION Chapter 18. Gene expression A gene that is expressed is “turned on”. It is actively making a product (protein or RNA). Gene

Lecture 3: Models of gene regulation. DNA Replication RNA Protein TranscriptionTranslation

Eukaryotic Gene Regulation Chapter 18. Slide 2 of 25 Overview Eukaryotes can regulate gene expression at multiple stages from gene to functional protein

Chapter 10: Gene Expression and Regulationguralnl/gural/102Chapter 10 - Central Dogma.pdfChapter 10: Gene Expression / Regulation Gene Regulation: • Proper regulation of gene expression

Gene Expression From gene to protein

Gene regulation Lecture No 5: Protein folding and Ubiquitination

Chapter 18: Regulation of Gene Expression › userdata › brownst...Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene

Gene Expression: From Gene to Protein

Gene Structure, Protein Structure, and Regulation of the Synthesis of

Last Class: Gene Regulation 1. DNA-protein interaction, different motifs, techniques to study DNA-protein interaction 2. Gene regulation on DNAs, gene

MUC8 Protein Structure and Transcription Regulation Mechanism … · 2019-06-28 · MUC8 Protein Structure and Transcription Regulation Mechanism by the Analysis of MUC8 Gene and

Goal 3.01b: Protein Synthesis and Gene Regulation

Regulation of Gene Expression Bacterial Gene Regulation Eukaryotic Gene Regulation

Goal 3.01b: Protein Synthesis and Gene Regulation