laboratory diagnosis of avian influenza

8/6/2019 Laboratory Diagnosis of Avian Influenza

http://slidepdf.com/reader/full/laboratory-diagnosis-of-avian-influenza 1/12

Laboratory diagnosis of Avian Influenza

Highly pathogenic avian influenza (HPAI) is classified as select agent and must be

worked with under biosafety level 3 or more laboratory conditions. Virus isolation

remains the gold standard of diagnosis. Rapid laboratory confirmation of suspectedinfluenza is usually performed by immunochromatographic or immunofluorescent

detection of influenza viral antigens or RT-PCR detection of viral nucleic acids. In

addition serum antibodies are detected by agar gel immunodiffusion test (AGID) and

haemagglutination inhibition (HI) tests. In addition, rapid diagnostic tests based on

antigen capture enzyme immunoassay are also commercially available.

1. Isolation of AIV:

The isolation of the virus must be carried out as per the method recommended by

WHO (2002). The tissue processing and isolation procedures must be carried out in Class

II laminar flow apparatus under negative pressure (-20 mm water) to prevent escape of the

organism into the environment. Protective clothing should be worn while handling

HPAIV. All the animal experiments must be carried out in isolators to avoid exposure to

researchers, technicians and workers.

1.1 Materials required:

1. Pestle and Morter

2. Antibiotic and antimycotic mixture – 100X

3. 1.5 – 2 ml Eppendorf tubes

4. 0.45µM filter

5. Micropipette and barrier tips – 1 ml and 200 ul

6. Embryonated chicken eggs, 9 - 11 days old

7.

Egg Candler8. 70 % Ethanol

9. Needle, 22 gauge, 1.5 inch

10. Syringe, 2 ml

11. Egg hole punch

12. Paraffin wax or Fevicol

13. 15 ml tubes & racks

14. Sterile individually packed pasteur pipettes

15. Forceps (Sterile).

1.2 Collection of pathological samples

In cases of suspected avian influenza outbreak, the following pathological samples

must be collected and sent to the laboratory:

At least 5 diseased birds (for post mortem examination),

Pooled tracheal and lung samples from at least 5 diseased birds,

Pooled intestine samples from at least 5 diseased birds,

Cloacal, pharyngeal and tracheal swabs from healthy birds,

Cloacal swabs must be collected from at least 30 birds, this will allow the

detection of infection with a confidence level of 95% if the prevalence of faecal

excretors is >0.1. Swabs must be collected ensuring that at least one gram of

faecal material is actually on the swab, and must be subsequently immersed in

virology transport medium.

At least 10 blood samples (acute sera).



For details of collection and dispatch of samples to HSADL, please refer to

Annexure II.

1.3 Storage of samples:

The samples should be placed in isotonic phosphate buffered saline (PBS), pH7.0 – 7.4, containing antibiotics. The antibiotics can be varied according to local

conditions, but could be, for example, penicillin (2000 units/ml), streptomycin (2 mg/ml),

gentamycin (50µg/ml) and mycostatin (1000 units/ml) or Amphotericin B (5 µg/ml) for

tissues and tracheal swabs, but at five-fold higher concentrations for faeces and cloacal

swabs. It is important to readjust the pH of the solution to pH 7.0 – 7.4 following the

addition of the antibiotics. Faeces and finely minced tissues should be prepared as 10 –

20% (w/v) suspensions in the antibiotic solution. Suspensions should be processed as

soon as possible after incubation for 1 – 2 hours at room temperature. When immediate

processing is impracticable, samples may be stored at 4°C for up to 4 days. For prolonged

storage, diagnostic samples and isolates should be kept at – 80°C.

1.4 Processing of clinical and pathological specimen:

A maximum of five samples received from same geographical area can be pooled

into a single sample. If the samples were positive for AIV, then the samples in the pools

should be processed individually to identify the positive sample.

Tissues:

One hundred milligram of tissue is to be ground with 1ml of 1X PBS in a sterile

mortar and pestle, making a 10% suspension.

Transfer the suspension to an eppendorf tube and centrifuge at 400 x g for 10 min

to remove extraneous materials.

Collect the supernatant and incubate at 37

o

C for 1 hr after the addition of 5Xantibiotics and antimycotic mixture. Alternatively, the supernatant may be filtered

through with 0.45 µM filter.

Store an aliquot of the supernatant at -70oC until used.

Dead birds:

Conduct post mortem on the dead birds.

Various tissues such as liver, spleen, kidney, brain, trachea, proventriculus, heart,

lung, intestine, pancreas, sciatic nerve, skeletal muscle, harderian gland,

testis/ovary, bursa, duodenum and caecal tonsil are to be collected and processed

as mentioned above.

Swabs:

If the fecal samples, cloacal swab, throat swab, nasal swab, oro-pharyngeal swaband tracheal swab samples received in transport medium may be pooled as such.

Otherwise, 1X PBS could be added to make 10% suspension and then pooled.

Transfer the suspension to an eppendorf tube and centrifuge at 400 x g for 10 minto remove extraneous materials.

Collect the supernatant and add 1/10 volume of 100X antibiotic solution (to give a

final concentration of 10X), incubated at 37oC for 1 hr. Alternatively, the

inoculum may be filtered through 0.45 µM filter.

Store an aliquot of the inoculum at -70oC until used.

3.1.5 Embryo inoculation:

The embryo inoculation is carried out as per the protocol recommended by WHO

(2002).



3.1.7 Harvesting of inoculated chicken eggs:

Chill the eggs at 4oC overnight before harvesting.

Label one plastic tube (15 ml) with the specimen number.

Wipe the egg with 70% ethanol.

Break the shell over the air sac with a sterile forceps and push the allantoic

membrane aside. Using a 10 ml pipette aspirate the allantoic and amniotic fluid into the labeled

plastic tube.

Centrifuge the harvested fluids at 3000 rpm / 5 min to remove blood and cells.

Aseptically transfer the clear supernatant into sterile labeled vials and store at -70

oC until further use.

Precaution:

Never use -200

C for storage of isolates. Influenza viruses are very unstable at this

temperature.

Be aware of contamination of clinical specimens with laboratory strains.

Note:o Never process clinical specimens for virus isolation and laboratory adapted

Influenza strains at the same time.

o Never process clinical specimens from Humans and from swine or birds in

the same laboratory.

2. Characterization of AIV:

2.1 Hemagglutination inhibition test:

In this test, a panel of reference positive H1 – H16 subtype specific sera are used to

determine the subtype of the virus. Make two fold serial dilution of the serum from 1:2 to

1:4096 and the subtype of serum which specifically inhibits the hemagglutination is thesubtype of the virus (WHO, 2002).

2.2 Neuraminidase inhibition assay (NAI)

Please refer to WHO (2002) for the protocol.

3. Influenza Type A or H5 antigen Test Kits:

These are rapid immunochromatographic in-vitro assays designed to aid in the

qualitative detection of Influenza type A virus or identify presence of H5 subtype in

tracheal and cloacal specimen from symptomatic birds or flocks. They are based on Rapid

Immuno-Migration (RIM) technology. The test strip uses two antibodies that are specific

to Influenza type A or H5 virus. The anti-Influenza A/H5 subtype specific antibody bound

to the specific antigen present in the sample forms a complex which migrates along a stripand is captured on a sensitized reaction line by the second antibody. The accumulation of

the complex causes the formation of a clearly visible pink/purple band. The presence of a

control band, located above the reaction line, ensures that the test was performed

correctly.

Precautions:

1. Protocol recommended by the manufacturer should be strictly followed.

2. Use swabs provided with the kit to collect tracheal, oropharyngeal and/or cloacal

specimens from avian species. Tracheal or oropharyngeal samples should be taken

from behind the tongue and into the trachea or oropharyngeal area (not just from

the mouth). Cloacal samples should be taken from within the cloacal area avoiding



excess solid fecal material or visible blood as it may partly obscure a weak

positive band (due to haemoglobin background).

3. Samples obtained early in the course of infection will contain the highest detectable

amount of virus and hence preferred.

4. If samples will not be tested immediately they should be stored at 40C for up to 24

hours. For prolonged storage, samples should be kept frozen (-200

C). Do not storesamples in a self-defrosting freezer to avoid multiple freeze-thaw cycles.

5. Allow samples to come to room temperature (15 to 250

C) before testing.

6. The vial holding the test strips contains a desiccant and should be kept tightly

closed when not in use.

7. Use a separate swab for each sample. Swabs with wooden handles or containing

calcium alginate may interfere with the test and cannot be used.

8. The positive samples should be submitted to a reference lab for confirmation and

subtype determination.

4. Reverse transcription – Polymerase chain reaction (RT-PCR)

4.1 Extraction of RNA:Any kit recommended by international agencies such as WHO/OIE for diagnosis

can be used to extract viral RNA from allantoic fluids. The protocol described by the

manufacturer should be followed.

4.2 RT-PCR

At HSADL, one step RT-PCR is carried out used with 2mM Mg++, 200 M of

dNTPs, 20 pmol of both forward and reverse primers using the primers already reported

(Lee et al., 2001, WHO, 2005). The cycling conditions for Access one step RT-PCR kit

(M/s. Promega, USA) are as follows:

Step I Reverse Transcription : 48oC for 45 min (1 cycle)

Step II Initial denaturation : 94oC for 2 min (1 cycle)

Step III Denaturation : 94oC for 30 seconds

Annealing of primer : 50oC for 30 seconds (35 cycles)

Extension : 68oC for 30 seconds

Step IV Final extension : 68oC for 10 min (1 cycle)

4.3 Agarose gel electrophoresis:

Prepare the gel (1% w/v) by melting 1 gram of agarose in 100ml of 1X TAE in a

microwave oven and add ethidium bromide to a final concentration of 0.5 g /

ml.

Pour in a gel casting tray and then allow to solidify at 10oC for 20 min.

Mix ten l of each PCR product with 2 l of 6X loading dye and load in the gel.Run a 100 bp DNA molecular size marker (M/s. Fermentas, USA) along with the

products.

Run the electrophoresis at 60 Volts/cm.

After the run, observe the gel under long range UV light.

5. Real-Time PCR (TaqMan Assay)

TaqMan assay targeting ‗M‘ (matrix) gene and H5 gene must be conducted on

each RNA sample.

Sybr Green assay targeting HA cleavage site must be done to assess pathogenicityof the virus at molecular level.

5.1 Taq Man assay for AIV type A diagnosis.



Any one of NP or matrix genes could be targeted for identification of Type

A influenza viruses. Any combination of the primers and probes published can be

used (Spackman et al., 2003, Payungporn et al., 2006).

5.2 TaqMan assay for H5 sub typing.

This assay targets HA gene of H5 subtype and the following two sets of primer-probe as recommended by CDC, USA and commercially supplied by Operon (Product

Number SPH5N1) may be used. These primer and probes are as follows:

First set of primer-probe:

Forward primer H5-1F : 5‘ TGCCGGAATGGTCTTACATAGTG 3‘

Probe H5-1P : 5‘FAM-AGAAGGCCAATCCAGTCAATG-TAMRA 3‘

Reverse primer H5-1R : 5‘ TCTTCATAGTCATTGAAATCCCCTG 3‘

Second set of primer-probe:

Forward primer H5-2F : 5‘ GTGGCGAGCTCCCTAGCA 3‘

Probe H5-2P : 5‘ FAM- TGGCAATCATGGTAGCTGGTC-TAMRA 3‘

Reverse primer H5-2R : 5‘ TCTGCATTGTAACGACCCATTG 3‘

5.3 TaqMan assay set up:

Each RNA sample has to be tested using the type A primer-probe as well

as subtype specific primer-probes.

1. QRT-PCR kits from any standard manufacturer can be used.

2. All reactions in 25 l volumes (Addition of ROX dye to a final concentration of

30nm is optional depending upon the type of real time PCR machine used), 9 pmol

forward primer, 6 pmol reverse primer, 5 pmol probe and 1.5 l test RNA, in

addition to QPCR master mix and RTase as recommended by the manufacturer.

3. Positive control in the form of viral RNA or HA-H5 recombinant plasmid has to

be included in each test batch

4. Negative controls in the form of no template control, no probe control and nuclease

free water (in place of RNA template) control are also to be included in each test

batch.

5. The program for real-time PCR reaction may vary depending upon the kit

(whether fast kit or normal kit) and also the manufacturer. Generally the program

recommended by the manufacturer is followed or the same can be standardized atthe laboratory.

5.4 Result and interpretation:

o All positive controls must have a Ct value of <18.

o All negative controls must not show any amplification signal till the last

cycle.

o Test RNA samples showing amplification signals with type A primer-probe

as well as both the H5 primer-probes are to be diagnosed as H5 influenza

virus.

o Test RNA samples showing amplification signal with type A primer-probe

and one of the H5 primer-probe sets should be interpreted with caution and

should be repeated.



o Test RNA samples showing amplification signal only with type A primer-

probe (not with H5 primer-probes) are to be interpreted as type A influenza

virus only (certainly not of subtype H5).

6. Serological diagnosis: The infection yields positive antibody test as early as four to ten days post

infection. Rising antibody response can be detected by AGID, HI or ELISA tests for thepurpose of serological diagnosis. However, before the antibodies are produced birds die

due to infection.

6.1. Agar Gel Immunodiffusion (AGID) test:

The avian influenza (AI) agar gel immunodiffusion (AGID) test is used to detect

circulating antibodies to type A influenza group specific antigens, namely the

ribonucleoprotein (RNP) and matrix (M) proteins. Therefore, AGID test can be used as a

group specific test to identify isolates as Type A influenza viruses.

6.1.1 Materials

Refrigerator (40 C) Freezer (-20

0C)

Incubator or closed plastic container for room temperature (250

C) incubation.

Autoclave

Hot plate

Microscope illumination

Template cutter, 7-well pattern — a center well surrounded by 6 evenly spaced

wells. Wells are 5.3 mm in diameter and 2.4 mm apart.

Top loading balance (capable of measuring 0.1 gm)

Micropipette

Sodium Phosphate monobasic (NaH2PO4) and dibasic (Na2HPO4)

Agarose (Type II Medium grade) agar (Sigma Chemical Co. cat. Number A-6877)

Sodium Chloride (NaCl)

Avian Influenza AGID antigen (current version of AVRPP0100) and antiserum

(current version of AVRPP0101)

Water – distilled or deionized water or water of equivalent purity. Heat sterilized.

Common laboratory supplies and glasswares – Erlenmeyer flasks, graduated

cylinders, pipettes, 100 × 15 – mm and or 60 × 15 – mm disposable plastic Petri

flask (500 ml or larger), and a 12 – to 14 – gauge blunt ended canula.

Note: All glassware and disposable labwares should be sterile unless otherwise stated.

6.1.2 Preparation of AGID agar Weigh 7.2 gm of NaCl and add 70 ml of 1X PBS (pH 7.2) in a flask to dissolve.

Then make up the volume to 100ml with 1X PBS (pH 7.2) to prepare 1X PBS

(Avian).

Weigh 1 gm of agarose and add 99 ml of 1X PBS (Avian). Dissolve the mixture

by bringing to a boil on a hot plate. Shake in between while heating to mix the

contents in the flask. After dissolving, make up the volume to 100 ml with 1X

PBS (Avian) to give 1% (w/v) agarose gel. Cool the agarose gel to 37oC and add

25 µl of 10% sodium azide.

6.1.3 Protocol:

The method described by OIE (2008) is as follows.

Approximately 15-18 ml of the agarose gel is poured in a petri dish (90 mmdiameter) to get a 3 mm thickness of agar gel.



A set of 7 wells (1 central well + 6 surrounding wells) is made using atemplate and a cutter. Wells should be 5 mm in diameter and 3 mm apart.

The central well is dispensed with 30 l of known H7N7 or H9N2 avian

influenza virus antigen.

30 l of known positive antiserum is dispensed in alternate wells and known

negative serum is dispensed in one well. The field sera are dispensed in theremaining two wells.

Cover the petri dish with a lid and incubate in a humid chamber at 37oC for

overnight to observe for precipitation lines.

The samples can be discarded negative if no precipitation line develops till 72

hrs.

6.1.4 Interpretation of test results

The type of reaction will vary with the concentration of antibody in the sample

being tested. The positive control serum line is the basis for reading the test, and if the

line is not distinct, the test is not valid and must be repeated. An extreme variation in the

concentration of antigen or antibodies will alter the location of the line or cause it to be

dissolved. Electrolyte concentration, buffer, pH and temperature also affect precipitation.

Following types of reaction are observed;

Negative reaction – the control lines continue into the test sample well without

bending or with a slight bend away from the antigen well and towards the positive

control serum well.

Positive reaction – Control lines join with and form a continuous line (line of

identity) between the test sera and antigen. The location of line will depend on the

concentration of antibodies.. Weakly positive samples may not produce a complete

line between the antigen and test serum but only cause the tip or end of the control

line to bend inward toward the test well.

Non-specific lines – These lines occasionally are observed between the antigenand test serum well. The control lines will pass through the non-specific line and

continue on into the test serum well. The non-specific line does not form a

continuous line (line of identity) with the positive control line.

6.2. Hemagglutination (HA) and hemagglutination Inhibition (HI) test:

6.2.1 Materials:

Single and multi channel micro pipettes.

Microtiter plate shaker

Freezer

Centrifuge

Various size test tube racks

Microplate centrifuge carriers for 96 well plates.

6.2.2 Reagents/Supplies

V-bottom microtiter plate, 96 well

Microtiter plate sealing tape

Phosphate buffer saline (PBS)

Common laboratory chemicals

Alsever‘s solution (Citric Acid -0.55 g; Dextrose-20.50 g; Nacl-4.20 g; Sodium

citrate-8.00 g; Make volume upto 1 litre and sterilize by filtration through 0.22 µ

membrane. (DO NOT AUTOCLAVE)

Poultry blood

Antibody positive and negative serum.



6.2.3. Preparation of 1% (v/v) Chicken RBCs:

The method described by WHO (2002) was used.

Collect 5 ml of chicken blood in 5 ml of Alsever‘s solution in a 10 ml syringe.

Dilute 0.5 ml of this blood up to 10 ml with 1X PBS (pH 7.2) in 15 ml tubeand centrifuge at 1000 rpm for 10 min.

Discard the supernatant and resuspend the pellet in 10 ml of 1X PBS. Repeat the washing thrice and suspend the RBC pellet in 1X PBS, so as to

make 1% (v/v).

6.2.4. Hemagglutination (HA) Test:

The method as per OIE (2008) was used.

Dispense 25 µl of 1X PBS in to each well of a plastic V bottomed microtitre

plate.

Add 25 µl of amnio-allantoic fluid in the first well and make serial two fold

dilutions from 1:2 to 1:4096.

Then dispense 25 µl PBS into each well. Then dispense 25 µl of 1% (v/v) chicken RBCs into each well.

Keep the last row of the microtitre plate as RBC control by dispensing 50 µl of

PBS and 25 µl of 1% chicken RBCs only.

Mix by tapping the plate gently and incubate the plate for 30 min at the room

temperature (20-25oC).

The HA titer is determined by tilting the plate and observing the presence orabsence of tear shaped streaming of the RBCs against the RBC control. The

reciprocal of the highest dilution giving complete HA (no streaming) is taken

as HA titer. One HA unit is the amount of Hemagglutinin contained in the end

point dilution of the HA titration. The ―unit‖ of Hemagglutinin is not a

measure of absolute amount of virus but is an operational definition dependenton the method used for the HA titration. A unit should therefore be defined as

the amount of the virus in 0.25 μl of AAFs.

6.2.5. Hemagglutination (HA) Inhibition Test:

The method described by OIE (2008) was used.

Dispense 25 µl of 1X PBS into each well of a plastic V bottomed microtitre

plate.

Dispense 25 µl of test serum sample into the first well and make two foldserial dilutions from 1:2 to 1:4096.

Add 4 HAU of virus into each well.

Mix by tapping the plate gently and incubate at room temperature for 30 min.

Add 25 µl of 1% chicken RBCs into each well and incubate at room

temperature for 30 min after gentle tapping.

Four controls viz., RBC control, positive serum control, negative serum control

and virus control should be kept while performing HI test.

RBC/cell control: Add 50 µl of 1X PBS into all the rows along with 25 µl of

1% chicken RBCs.

Positive serum control: Same protocol as for HA test is to be used but instead

of virus add positive serum.

Negative serum control: Dispense 25 µl of both 1X PBS and negative serum

followed by 25 µl of 1% chicken RBCs.



Virus control: Add 25 µl of PBS into all the wells of any selected row. Thendispense 25 µl of 4 HAU virus in the first well and make two fold serial

dilution across the row. Further 25 µl of PBS was added to each well. Then 25

µl of 1% chicken RBCs was added to the all the wells of the row.

The hemagglutination Inhibition titer is the highest dilution of serum causing complete

inhibition of 4 HAU of antigen. The agglutination was assessed by tilting the plates.Wells with complete inhibition should form a “tear drop” at the same rate as the

positive control wells. Wells with incomplete inhibition that show a delay “tear

drop” as compared to the positive control should not be interpreted as inhibition.

Interpretation of test results

1. Serum/plasma/yolk extract samples are considered positive (indication of

exposure) if inhibition of hemagglutination is observed at the 1:16 dilution or

higher.

2. A test is considered as valid if

ii. The virus control confirms 4 HAUs.

iii. The serum control (serum + PBS) does not show hemagglutination.

iv. The negative control serum does not give a titer > 4 and the positivecontrol serum gives a titer within one dilution of the known titer.

If these conditions are not met the test should be repeated.

3. If erythrocytes in the cell control wells do not settle into a well defined button,

check the following as possible causes:

PBS incorrect formulation

Excessive evaporation from plates during the test

Erythrocytes too old

Incorrect concentration of erythrocyte

4. Chicken sera rarely give nonspecific positive reactions in this test and any

pretreatment of the sera is unnecessary. Sera from species other than chickensmay sometimes cause agglutination of chicken RBCs, so this property should

first be determined and then removed by adsorption of the serum with chicken

RBCs. This is done by adding 0.025 ml of packed chicken RBCs to each 0.5

ml of antisera, shaking gently and leaving for at least 30 minutes; the RBCs

are then pelleted by centrifugation at 800 g for 2 – 5 minutes and the adsorbed

sera are decanted. Alternatively, RBCs of the avian species under investigation

could be used.

5. The meaning of a minimum positive titre should not be misinterpreted; it does

not imply, for example, that immunised birds with that titre will be protected

against challenge or that birds with lower titres will be susceptible to

challenge.

6.3 ELISA for Detection of AIV antibodies

Competitive Enzyme Linked Immunosorbent Assay (cELISA) is commonly used

for the qualitative detection of antibody to the most common and prevalent AIV in

chicken, duck, turkey, quail, goose, guinea partridge, red partridge, pheasant, swan, horse,

or swine samples. Similarly cELISA is also available for detection of group specific (NP)

and subtype specific (HA) antigens of influenza A virus.

6.3.1 Specimen Collection and Storage:

Fresh serum, plasma, or egg yolk samples can be used for this assay. The whole

blood should be allowed to clot naturally and completely. Any visible particulate



matters in the sample should be removed by centrifugation at 3000rpm for at least

20 minutes.

For egg yolk samples, mix 2ml of egg yolk with 2ml of PBS (pH 7.2) by vortexingand collect the supernatant for testing after centrifuging at 3000 rpm for 30 minutes.

If specimens are not immediately tested, refrigerate at 2-8ºC. For keeping samples

more than 3 days, freeze the specimen at -20ºC or below (serum, plasma and eggyolk). They should be brought to room temperature prior to use.

Specimens containing precipitate may yield inconsistent test results. Specimens

must be clarified before assaying.

6.3.2 Limitations and Interferences

1) The test procedure, precautions and interpretation of results as recommended by

manufacturer must be strictly followed when testing.

2) Samples

1. Samples containing sodium azide may affect the test result.

2. Pasteurized samples (no less than 10 hours at 60ºC) may lead to diminished

reactivity and therefore should not be used.

3. Anticoagulants such as heparin, EDTA, and citrate do not affect the test result.

4. Hemolytic samples or bacteria contaminated samples may elicit the false

positive reaction.

5. Lipaemic and icteric samples do not impair the test results.

3) Failure to add specimen in the procedure could result in a falsely negative test. Repeat

testing should be considered where there is clinical suspicion of infection.

7. Nucleotide Sequencing:

Sanger‘s dideoxy method is followed for nucleotide sequencing (Sanger et al.,

1977). Appropriate chemical reactions are used to generate DNA fragments that end atfour bases (A, T, C and G) with radioactive label at 5‘ end. The mixture o f fragments is

then electrophoresed on PAGE so that DNA fragments with one molecule difference in

length are separated by gel. This electrophoresis procedure involves four separate lanes,

one each for fragment ending with one of the four bases i.e. T, C, G and A.

7.1 Purification of PCR Products

PCR amplified products are purified using any standard gel extraction kit. The

basic protocol is as follows:

The PCR products are electrophoresed in 1.5% agarose gel and the DNA fragments

of appropriate size are excised from agarose gel with a clean, sharp BP blade.

Gel slices are put in 1.5 ml pre-weighed microtubes which are then weighed to findout the weight of gel slice.

Follow the instructions of the manufacturer.

Store the products at – 400C until further use.

7.2 Nucleotide sequencing of PCR products using BigDye Terminator cycle

sequencing kit

In dye-terminator chemistry, each of the four dideoxy terminators (ddNTPs) is

tagged with a different fluorescent dye. During cycle sequencing reactions, the extending

chain is simultaneously terminated and labeled with the dye that corresponds to the base.

For each reaction, add the following reagents to a separate 0.2 ml microamp tube:

Reagents Quantity

Terminator Ready Reaction Mix 1.0 ul



BigDye sequencing buffer 1.5 ul

Template* up to 4 ul

Primer (at 3.2 pmole) 1.0 ul

ddH2O q.s.

Total volume 10 ul

Mix well and spin briefly*Template - 500-1000bp PCR product: 5-20 ng

200-500bp PCR product: 3-10 ng

1000-2000bp PCR product: 10-40ng

Double stranded plasmid: 150-300ng

Place the tubes in the thermal cycler, and begin temperature cycling protocol as follows:

Initial denaturation at 960C for 1 min and then 25 cycles of [96

0C for 10 sec, 50

0C for 10

sec, 600C for 4 min], then ramp to 4

0C. Purify extension products as below.

Briefly, the reaction product was transferred onto 1.5 ml tube.

Twelve µl of master mix- I (10 µl of Milli-Q and 2 µl of 125 mM EDTA) per

reaction was added to each reaction containing 10 µl of reaction, ensuring that the

contents were mixed properly.

After that master mix-II (2µl of 3M NaOAc and 50 µl of ethanol) per reaction was

added to each reaction. The contents were mixed properly and incubated at room

temperature for 15 min.

After incubation the tubes are centrifuged at 1200g for 20 min at room temperature.

The supernatant were then decanted.

To the tube 250 µl of 70% ethanol were added and centrifuged at 1200g for 10 min

at room temperature. The supernatant was discarded.

To the above sample, 12-15 µl of HI-DI formamide was added to each reaction andthe transferred to the sequencing plate and covered with septa, denature, snap chilled

and preceded for electrophoresis on ABI 3130 Genetic analyzer.

8. Pathotyping of AI isolates: The pathotype of the isolate is determined on the basis of intravenous pathogenicity

index done in 4 - 6 week old chickens. The assessment of the ability of the isolate to produce

cytopathic effect with or without trypsin and the determination of the amino acid sequence in

the HA gene cleavage site are also essential to determine the pathogenic potential of the

isolate.

8.1 Intravenous Pathogencity index test:

The IVPI test is carried out as per the WHO protocol (WHO, 2002). Briefly,

The infective AAFs free from Newcastle disease virus harvested frompreviously inoculated eggs with a HI titer of AAFs >1/16 should be used for

IVPI test.

Dilute the confirmed AAFs to 1:10 with sterile 1X PBS (pH 7.2 – 7.4). Anysuspicion of bacterial contamination in AAF was checked by bacterial culture on

nutrient agar plates prior to IVPI test. The following in vivo procedures were

done in isolators inside a BSL 4 high security animal facility.

Inoculate 0.1ml of the diluted virus intravenously into each of eight six-week-old

chickens. These birds should be either AIV antibody negative or Specific pathogen

free (SPF) chickens. Inoculate eight chicks with 0.1ml of the 1X PBS to act as

controls.

Observe for clinical signs at 24 hr intervals over a ten days period.



At each observation, each bird is scored 0 if normal, 1 if sick, 2 if severely sick, 3 if dead. (The judgment of sick and severely sick birds is a subjective clinical

assessment. Normally, ‗sick‘ birds would show one of the following signs and

‗severely sick‘ more than one of the following signs: respiratory involvement,

depression, diarrhea, cyanosis of the exposed skin and wattles, edema of the face

and/or head, nervous signs. Dead birds were scored as 3 at each of the remainingdaily observations after death.)

Any bird unable to feed or drink was killed and recorded as dead at thefollowing day‘s observation time.

The intravenous pathogenicity index (IVPI) is calculated as the mean score per

bird per observation over the 10-day period. An index of 3.00 meant that all

birds died within 24 h, an index of 0.00 meant that no bird showed any clinical

sign.

As per the latest OIE guidelines (OIE, 2005) viruses which kill six, seven or

eight of the eight chickens with an IVP index of more than 1.2 are considered as

highly pathogenic and all other viruses are considered as low pathogenic.

laboratory diagnosis of avian influenza

Documents