l zhang et al . nature 000 , 1 - 7 (2011) doi:10.1038/nature10690

1

L Zhang et al. Nature 000, 1-7 (2011) doi:10.1038/nature10690 NleE is a SAM-dependent methyltransferase that specifically modifies Cys673/692 in TAB2/3-NZF domains.

Upload: eugenia-klein

Post on 31-Dec-2015

14 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

NleE is a SAM-dependent methyltransferase that specifically modifies Cys673/692 in TAB2/3-NZF domains. L Zhang et al . Nature 000 , 1 - 7 (2011) doi:10.1038/nature10690. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: L Zhang et al . Nature 000 , 1 - 7 (2011) doi:10.1038/nature10690

L Zhang et al. Nature 000, 1-7 (2011) doi:10.1038/nature10690

NleE is a SAM-dependent methyltransferase that specificallymodifies Cys673/692 in TAB2/3-NZF domains.

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

GI Motility online (May 2006) | doi:10.1038/gimo12

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Nature Biotechnology: doi:10.1038/nbt

GI Motility online (May 2006) | doi:10.1038/gimo48

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

1 November 2007 doi:10.1038/nature06221 LETTERS

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

doi:10.1038/nature05150 LETTERS

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NPHYS3211 Supplementary Information for

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo6

doi:10.1038/nature12886 Neanderthal from the Altai

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Structural and Molecular Biology: doi:10.1038/nsmb · Nature Structural and Molecular Biology: doi:10.1038/nsmb.2938 Supplementary Figure 1 Characterization of designed leucine-rich-repeat