jose carreras international leukemia foundation form 1 …

4

JOSE CARRERAS INTERNATIONAL LEUKEMIA FOUNDATION FORM 1 Jie Gao

Project Title A novel role of the ubiquitin ligase complex Cul4A-DDB1-DCAF1 in T cell leukemia

Applicant Name Jie Gao

Address

550 First Ave MSB 504 New York University School of Medicine New York, NY 10016 USA

e-mail [email protected] Telephone 1-212-263-5379 Fax 1-212-263-8211

Sponsor Name Iannis Aifantis

Address 550 First Avenue, MSB 504 New York University School of Medicine New York, NY 10016-6481 USA

e-mail [email protected] Telephone 1-212-263-5365 Fax 1-212-263-8211

Institutional Financial Officer Name Anthony Carna

Address 550 First Avenue, GHB SCI 81 New York University School of Medicine New York, NY 10016-6402 USA

e-mail [email protected] Telephone 212-263-8822 Fax 1-212-263-8201

Project will involve:

[_] Biohazards

[_] Human Subjects [_] Adults [_] Children [_] Fetal Material

[X] Laboratory Animals

5

Form 2 Applicant: Jie Gao

Abstract (limit 300 words) T-cell acute lymphoblastic leukemia (T-ALL) is a highly proliferative disease derived from T cell progenitors. We have identified Cul4A-DDB1-DCAF1 as an E3 ubiquitin ligase complex able to control expansion and survival of stem and progenitor populations in early adult and fetal hematopoiesis. DDB1 function is absolutely essential for cell cycle progression and progenitor survival. DDB1 is expressed significantly higher in T-ALL patient samples, and also expressed higher in mouse T-ALL. Strikingly, lymphocyte progenitors lacking DDB1 activity are unable to initiate and maintenance T-ALL. However, the mechanisms of DDB1 complex action in T-ALL are not clear. In this proposal, we will address the following specific aims. (1) Identifying substrates of the Cul4A-DDB1 ligase specifically in immune cells by tandem affinity purification for tagged DDB1 in a T-ALL cell line. (2) Characterizing the role of DCAF1, a substrate recognizing subunit of the complex, in HSCPs maintenance and differentiation using a DCAF1f/fCreERT2+ conditional knockout mouse model. (3) Determining the role of DCAF1 in T-ALL initiation and maintenance utilizing Notch1-IC driven T-ALL model combined with inducible deletion of DCAF1 in DCAF1f/fMx1Cre+ animals. Overall goal of our application is to identify a novel enzymatic pathway that can be targeted in future T-ALL therapy protocols.


6

BACKGROUND T cell acute lymphoblastic leukemia (T-ALL) is a disease induced by the transformation of T lymphocyte progenitors. T-ALL comprises approximately 20-25% of all ALL cases and has significantly poorer prognosis than other ALLs. It mainly afflicts children and adolescents. Although treatment outcome in T-ALL has improved in recent years, mechanisms of T-ALL initiation and progression are not clear. It is thus very important to identify and study the molecular pathways that control both disease induction and maintenance in this particular type of cancer. Ubiquitin-proteasome system has emerged as an important aspect of post-translational regulation in both hematopoietic stem cells (HSC)/progenitors and leukemic cells. The activity of Notch1, the most frequently mutated oncogene found in T-ALL (3), is tightly modulated in normal T cell development. Ubiquitin conjugation takes place at nearly every step of the Notch pathway. But so far only one E3 ligase, Fbw7, has been shown to specifically target nuclear Notch for degradation. We initially identified Fbw7 as a tumor suppressor in T-ALL (4), which controls the stability of oncogenes including Notch1 and cMyc. Recently we demonstrated Fbw7 governs quiescence of HSCs (5, 6). These findings underscore the important role of E3 ligases in HSC homeostasis and T-ALL pathogenesis. In an effort to screen novel E3 ubiquitin ligase family members critical in normal hematopoiesis and T-cell transformation, we identified DDB1 in a complex with Cullin4, as a potential important player. DDB1 is highly expressed in hematopoietic stem cells and progenitors as well as in T-ALL samples. DDB1 is a component of the Cul4A-DDB1 E3 ubiquitin ligase complex. DDB1 recruits Cul4A-DDB1

associated factors (DCAF), a family of WD40 repeat proteins which confer substrate specificity. The Cul4A-DDB1 ligase has been shown to target several substrates for ubiquitin dependent degradation. The list of substrates include the DNA replication licensing factor Cdt1(7, 8), the cell cycle inhibitor p27Kip1 (9) and p21Cip1

(10), and the histone methlytransferase PR-Set7 (11, 12). The numerous substrates of the Cul4A-DDB1 ligase suggest that it could affect a variety of cellular functions. SIGNIFICANCE Currently, Bortezomib, a general proteasome inhibitor, is used for treatment of blood malignancies including multiple myeloma and mantle cell lymphoma. We have previously demonstrated effects of the drug in T-ALL (13). However, to achieve higher specificity and to minimize off-target effects, it is desirable to generate inhibitors that selectively target specific ubiquitin ligase complexes active in tumors. Recently, the first inhibitor specific to an individual E3 ubiquitin ligase has been identified in budding yeast (14, 15), suggesting the possibility of generating drugs targeting human E3 ligases which were previously thought undruggable. In this proposal, we will characterize the role of a novel E3 ligase Cul4A-DDB1 in T-ALL pathogenesis and determine whether they can be new “druggable” therapeutic targets in future T-ALL treatment.

Recent identification of the first specific inhibitor to an individual E3 ubiquitin ligase makes E3 ligases promising therapeutic targets in cancer treatment. In an effort to screen novel E3 ubiquitin ligase members important for normal and malignant hematopoiesis, we identified the DDB1 E3 ligase as an essential player. Our preliminary studies have revealed DDB1 as a novel regulator for maintenance and differentiation of hematopoietic stem and progenitor cells. DDB1 deletion specifically targets transiently amplifying progenitor subsets but not quiescent cells and rapidly induces apoptosis and cell cycle defects. In addition, initiation and maintenance of T cell acute lymphoblastic leukemia (T-ALL) is absolutely dependent on DDB1. However mechanisms of the Cul4A-DDB1 complex action in T-ALL progression are not clear. We propose the following specific aims to study the role of Cul4A-DDB1 ubiquitin ligase in initiation and maintenance of this disease. AIM 1. Identifying specific substrates of the Cul4A-DDB1 ubiquitin ligase complex in leukemic cells. DDB1 is highly expressed in transiently amplifying progenitor cells. It is also expressed at higher levels in human and mouse T-ALL. Our data have demonstrated that silencing DDB1 completely blocked T-ALL initiation and progression, suggesting DDB1 function is essential for T-ALL development. We hypothesize that the role of DDB1 in T-ALL is mediated by degrading substrates important for T-ALL. To this end, we will use proteomic approaches to identify key substrates of the Cul4A-DDB1 ligase complex in leukemic cells. AIM 2. The role of DCAF1 in homeostasis of HSC and progenitor cells. The Cul4DDB1 complex recognizes substrates through a family of WD40-containing proteins named DCAFs. Based on our preliminary data, DCAF1 associates with DDB1, which suggests that DDB1 function could be mediated by DCAF1. To probe the role of DCAF1 in hematopoietic stem and progenitor cells, we will transplant DCAF1f/fERT2Cre+ bone marrow progenitors into lethally irradiated recipient mice, and induce the deletion of DCAF1 by injecting tamoxifen. We will study the HSC and progenitor compartments, apoptosis, DNA damage and cell cycle status upon the DCAF1 deletion, and compare to the phenotypes observed in DDB1-deleted models.

BACKGROUND

SPECIFIC AIMS


7

A B C

Figure 1. Specific DDB1 deletion in lymphocyte progenitors leads to development arrests. (A) Reduced size of DDB1-deficient thymus (B) Reduced cell number of total thymocytes and T-cell progenitor DN4 population. Image of thymi are shown. (C) Blockage at DN4 stage of T lymphocytes in DDB1-deficient animal

Figure 2. Impaired proliferation when DDB1 deficient mature T cells stimulated in vitro. (A) Normal resting peripheral T cells in thymus and spleen. (B) DDB1-deficient spleen CD4+ cells failed to incorporate BrdU or dilute CFSE die when stimulated with anti-CD3/CD28.

AIM 3. The role of DCAF1 in leukemia initiation and maintenance. We have revealed that DDB1 is critical for T-ALL initiation and maintenance. Since DDB1 recognizes substrates via DCAFs and we have shown that DCAF1 associates with DDB1 in leukemic cells, we will determine the importance of DCAF1 in the pathogenesis of T-ALL in vivo, both in the initiation and maintenance of T-ALL. We will use a well-established Notch1-IC (active mutant of Notch)-induced T-ALL disease model together with DCAF1f/fMx1Cre+ animal in which DCAF1 deletion can be induced either before or after the onset of the disease.

DDB1 is required for lymphocyte development and proliferation. In order to identify novel E3 ubiquitin ligases which are critical for hematopoiesis and T-ALL tumorgenesis, we found that damage-specific DNA binding protein 1 (DDB1), a component of Cul4-DDB1 E3 ubiquitin ligase complex, is highly expressed in hematopoietic stem cells and progenitors as well as in T-ALL tumor tissues (data not shown). To examine the role of DDB1 in hematopoiesis especially in lymphopoiesis, we generated DDB1F/FCD2Cre+ mice, in which DDB1 is deleted from the stage of common lymphoid progenitors and all later progeny including T and B lymphocytes. We found that DDB1F/FCD2Cre+ mice had tiny thyme. The total number of thymocytes was reduced about 100 fold compared to control (Figure 1A, B). Vast majority of thymocytes (80-90%) in DDB1F/FCD2Cre+ mice are CD4-CD8-. When the DN population was further analyzed according to CD44 and CD25 expression, DDB1F/FCD2Cre+ thymocytes showed a higher percentage of DN3 (CD25+CD44-) cells and lower percentage of DN4 (CD25lowCD44-) cells (Figure 1C). The absolute number of DN4 was greatly reduced in DDB1F/FCD2Cre+ animals (Figure 1B). These data revealed that T cell

development is blocked at DN3 to DN4 transition in DDB1F/FCD2Cre+ mice. Similar phenotype was observed in B cells. DDB1F/FCD2Cre+ mice had a development blockage from proB (CD19+IgM-cKit+CD25-) to preB (CD19+IgM-cKit-CD25+) transition (data not shown). Since at both DN4 and preB stages of lymphocyte development, extensive cell proliferation and expansion are needed, we hypothesize that DDB1 is required for proliferating cells but not for quiescent cells. In order to test this hypothesis, DDB1 was conditionally deleted in mature T cells of DDB1F/FCD4Cre+ mice. It was found that DDB1F/FCD4Cre+ mice had normal CD4 and CD8 profile in thymus and normal CD4+ and CD8+ cells in spleen as the control (Figure 2A). Next, peripheral CD4+ cells were purified from spleen and subjected to anti-CD3/CD28 stimulation in vitro. When stimulated, the control cells entered cell cycle, incorporated BrdU, an analogue of thymidine which is incorporated during DNA synthesis, and underwent several rounds of cell division as shown by CFSE labeling. However, the DDB1 deficient CD4+ cells failed to incorporate BrdU and to proliferate (Figure 2B). All these findings suggest that DDB1 is essential proliferating lymphocyte progenitors.

DDB1 is essential for Notch1 induced T-ALL initiation and maintenance. Initially, we noticed that tumor samples from Notch1-induced T-ALL mouse models expressed higher levels of DDB1 protein compare to wild type tissues (Figure 3A), suggesting DDB1 is involved in T-ALL progression. To directly test whether DDB1 is required for T cell leukemia

development where proliferation of cancer cells is necessary to establish the disease, we utilized Notch1-induced T-ALL model, in which cKit+ bone marrow cells from control or DDB1F/FCD2Cre+ mice were infected with retrovirus expressing Notch1 intracellular domain (NIC)-ires-GFP and

then transplanted into lethally irradiated mice. The control group developed T-ALL and died within 3 weeks as expected, with manifestation of CD4+CD8+ cells in peripheral blood and T cell infiltration into spleen and liver; whereas the DDB1 deficient group remained healthy, no CD4+CD8+ cells were detected in peripheral blood,

PRELIMINARY DATA

A B


8

Figure 4. (A) Interaction of endogenous DDB1 with DCAF1 in Jurkat. (B) Pull down of DCAF1 in 293T cells transfected with SF-DDB1 and immunoprecipitated with Strep-Actin and Flag sequentially. (C) Pull down in 293T cells with SF-DDB1 as bait and Strep-Tactin and Flag tandem affinity purification. 5% of pull down were subjected to silver staining.

and histology examination of spleen, liver and lung revealed these animals were healthy (Figure 3B and 3C). Our data demonstrate that DDB1 is essential for T-ALL initiation. Although these studies clearly show that initiation of the disease depends on DDB1 expression, they do not prove that DDB1 deletion can target already established disease, which could make this ligase complex an appealing therapeutic target. We thus used the DDB1F/FMx1Cre+ model, induced T-ALL, and deleted DDB1 gene using pI:C administration after detection of the disease initiation. Strikingly, DDB1 deletion suppressed disease progression and lead to the complete eradication of leukemic Notch1-ICGFP+CD4+8+ from the peripheral blood and peripheral lymphoid tissues (Fig. 3D,E). These combined studies demonstrate that DDB1 is essential for the initiation and progression of Notch1-induced T-ALL, suggesting that inhibition of Cul4ADDB1 expression or function could be a potent therapy for T cell leukemia.

AIM 1: Identifying specific substrates of the Cul4A-DDB1 ubiquitin ligase complex in leukemic cells. Rational: Our preliminary data showed that DDB1 was expressed at higher levels in human and mouse T-ALL. Importantly, silencing DDB1 inhibited both T-ALL initiation and maintenance in Notch1-IC model (Figure 3). These findings demonstrate that DDB1 expression or function is essential for the disease progression. We hypothesize that DDB1’s role in T-ALL pathogenesis is mediated through its substrates. To this end, we will use proteomic approaches to identify key substrates of the Cul4A-DDB1 ligase complex in leukemic cells. Approach: First, we have generated a retroviral expression vector in which DDB1 is tagged with 2x Strep-Tactin and 3x Flag at its N terminus and has a GFP marker, pMIG-SF-DDB1. We have tested this tandem affinity purification approach with SF-DDB1 as bait in 293T cells. We verified by Western blot that the tandem purification pulled down DCAF1, DDB1-Cul4A associated factor 1 (Fig. 4B). A number of protein bands were visible after tandem affinity purification (Fig. 4C). These results demonstrate that the tandem affinity purification with FS-DDB1 as bait is successful in 293T cells. To identify DDB1-associated proteins especially the

substrates in leukemic cells, we will generate a stable T-ALL cell line expressing SF-DDB1, Jurkat-SF-DDB1, by retroviral infection and FACS sorting GFP+ cells. Large scale culture of Jurkat-FS-DDB1 will be subjected to MG132 treatment, and then tandem-affinity purification will be performed, followed by mass spectrometer analysis. We expect the mass spec results will identify DDB1 associated proteins including its substrates. To confirm the mass spec results, (1) we will verify the interaction of substrates with DDB1 using reciprocal immunoprecipitation and Western blot. (2) We will also treat Jurkat cells with MG132 (10 uM for up to 6 hours) and expect

accumulation of substrates at the protein levels. (3) We will knockdown DDB1 using lentiviral method to deliver shDDB1 (we have already designed and verified the pLKO-shDDB1 lentiviral vector), and expect accumulation of the substrates at protein levels. Once the substrates are identified, we will study their biological function in T-ALL pathogenesis. We will knockdown the substrate(s) in T-ALL cell lines such as Jurkat and DND41 by designing shRNA sequences and generating pLKO-shRNA letiviral vector, and then monitor the cell cycle

EXPERIMENTAL DESIGN AND METHODS

Figure 3. DDB1 is required for T-ALL initiation and maintenance. (A) Western blot showing higher expression of DDB1 in T-ALL (NIC) mouse tissues. (B) Survival curves of host mice transplanted with either control or DDB1F/FCD2Cre+ cKit+ cells expressing Notch1-IC retrovirus. (C) CD4 vs CD8 profile of peripheral blood from host mice. And histology of tissues of host mice. (D-E) Representative FACS plot and quantification of leukemic cells (GFP+CD4+CD8+) in peripheral blood before and after DDB1 deletion.


9

status either by analyzing DAPI profile and/or by BrdU labeling assay. These experiments will identify DDB1 substrates critical for T-ALL development. AIM 2. The role of DCAF1 in homeostasis of HSC and progenitor cells. Rationale. Our preliminary data have identified DDB1 as a novel regulator for maintenance and differentiation of hematopoietic stem and progenitor cells. DDB1 deletion specifically targets transiently amplifying progenitor subsets. The Cul4DDB1 complex recognizes substrates through a family of WD40-containing proteins named DCAFs. Based on our preliminary data, DCAF1 associates with DDB1 in immune cells (Fig. 4A), which suggests that DDB1 function could be mediated by DCAF1. To test the putative role of DCAF1 in the development of the hematopoietic system, we will conditionally delete DCAF1 in hematopoietic cells and then study its effects on HSC and progenitor cells. Approach. We have generated an inducible allele of the DCAF1 gene (DCAF1f/fCreERT2+) (16). We will transplant DCAF1f/fERT2Cre+ bone marrow progenitors and control (Ly5.2+) into lethally irradiated recipient mice (Ly5.1+). Four weeks post transplantation we will induce the deletion of DCAF1 by injecting tamoxifen (0.2 mg per gram of body weight for five consecutive days). Four and eight weeks post the last injection of tamoxifen, bone marrow will be analyzed. Multi-color FACS analysis will be used to identify HSC and progenitor cell compartments, including lineage-cKit+Sca1+(LSK), a population enriched for HSC, and myeloid progenitors lineage-cKit+Sca1-. LSK population will be further analyzed by SLAM marker CD150 and CD48 to distinguish long-term HSC CD150+CD48-LSK, short-term HSC CD150+CD48+LSK, and multipotent progenitors CD150-CD48+LSK. These cell surface markers will identify phenotypic stem/progenitor cell defects associated with DCAF1 deletion. We will also couple AnnexinV/7AAD or DAPI staining to assay the effects of DCAF1 deletion on the apoptosis or cell cycle of stem/progenitor cells. We will assay whether DNA damage is induced upon DCAF1 deletion by performing intracellular γH2Ax staining, a marker for DNA breaks. To determine whether function of stem/progenitor cells are affected by the DCAF1 deletion, we will perform methylcellulose assay and competitive bone marrow transplant (BMT). We will flow sort DCAF1-deleted (Ly5.2+) cKit+ and control, culture them in cytokine-supplemented methylcellulose to determine their short-term differentiation ability. For BMT, we will flow sort Ly5.2+ bone marrow cells from tamoxifen injected animals, transplant 5x105 cells together with 5x105 Ly5.1+bone marrow cells into lethally irradiated C57B/6 Ly5.1+ hosts (10 mice per group). Peripheral blood will be collected and sampled for chimerism (Ly5.2%) at different time points (4, 8, 12 and 16 weeks post BMT). These experiments will reveal whether the DCAF1 deletion affects stem cells’ ability to repopulate hematopoietic systems. AIM 3. The role of DCAF1 in leukemia initiation and maintenance. Rational. Initially we have shown that DDB1 is essential for Notch1-induced T-ALL (Fig. 3). Since DDB1 does not recognize the substrates by itself, it utilizes DCAFs to bind substrates instead. We have identified DCAF1 interaction with DDB1 in T-ALL cells. We will test whether DCAF1 is essential for leukemia development. Approach. To directly address the importance of DCAF1 deletion in T-ALL initiation in vivo we will use the DCAF1f/f animal model. For these experiments we will use the generated IFNα-inducible Mx1Cre+DCAF1f/f

strain. As a T-ALL trigger we will use activated Notch1 mutant (Notch1-IC) initially described by Aster and colleagues(17). Bone marrow from either polyI:polyC injected Mx1Cre+DCAF1f/f or Mx1Cre+DCAFw/w littermates (expressing the marker Ly5.2) will be infected with Notch1-IC(Luciferase)-expressing viruses. Infected cells will be transferred in lethally irradiated C57B/6 recipients (Ly5.1+). Two weeks post-transplant we will monitor the onset of the disease using peripheral blood CD4/8 staining. It will be also coupled to the study of recipient survival (Kaplan-Meier), lymphocyte tissue infiltration and blood cell counts. To access the importance of DCAF1 deletion in T-ALL maintenance, we will delete DCAF1 in already established T-ALL disease. Bone marrow from Mx1Cre+DCAF1f/f or Mx1Cre+DCAFw/w littermates not injected with polyI:polyC will be infected with NotchIC(Luciferase)-expressing virus. Two weeks post-transplant we will verify the onset of the disease using peripheral blood CD4/8 staining. We will then inject (3 times, once every other day) the recipients with polyI:polyC to delete the DCAF1 locus specifically in leukemic cells. We will use groups of 10 mice per group. We will image tumor load using bioluminescence. Imaging will be performed at days -1 (one day before the first treatment), 7 (after one week from beginning of treatment), 14 (after two weeks of treatment), 21 (after three weeks of treatment) and at the point that the control animals show signs of disease (significant loss of weight, cachexia, crouching). Similarly, recipient survival (Kaplan-Meier), lymphocyte tissue infiltration and blood cell counts will be assayed. 1. C. Rathinam, L. E. Matesic, R. A. Flavell, Nat Immunol 12, 399 (May, 2011). 2. C. Rathinam, C. B. Thien, W. Y. Langdon, H. Gu, R. A. Flavell, Genes Dev 22, 992 (Apr 15, 2008). 3. A. P. Weng et al., Science 306, 269 (Oct 8, 2004). 4. B. J. Thompson et al., J Exp Med 204, 1825 (Aug 6, 2007). 5. B. J. Thompson et al., J Exp Med 205, 1395 (Jun 9, 2008). 6. S. Matsuoka et al., Genes Dev 22, 986 (Apr 15, 2008). 7. L. A. Higa, I. S. Mihaylov, D. P. Banks, J. Zheng, H. Zhang, Nat Cell Biol 5, 1008 (Nov, 2003). 8. J. Hu, C. M. McCall, T. Ohta, Y. Xiong, Nat Cell Biol 6, 1003 (Oct, 2004). 9. T. Bondar et al., Mol Cell Biol 26, 2531 (Apr, 2006).

10. H. Nishitani et al., J Biol Chem 283, 29045 (Oct 24, 2008). 11. H. Oda et al., Mol Cell 40, 364 (Nov 12, 2010). 12. M. Tardat et al., Nat Cell Biol 12, 1086 (Nov, 2010). 13. T. Vilimas et al., Nat Med 13, 70 (Jan, 2007). 14. S. Orlicky et al., Nat Biotechnol 28, 733 (Jul, 2010). 15. M. Aghajan et al., Nat Biotechnol 28, 738 (Jul, 2010). 16. C. M. McCall et al., Mol Cell Biol 28, 5621 (Sep, 2008). 17. M. Y. Chiang et al., Mol Cell Biol 26, 6261 (Aug, 2006)

10


BUDGET

12

Applicant: Jie Gao BUDGET JUSTIFICATION

PERSONNEL JUSTIFICATION: Iannis Aifantis, Ph.D. (P.I., 1.0 Cal. months effort). Dr. Aifantis will participate in the design of the proposed studies and supervise Dr. Ntziachristos as well as the bioinformatics team. He will be in daily contact with Dr. Ntziachristos, help hi interpret the data and troubleshoot. He will also be the driving force behind data presentation and preparation of publications. No salary is requested as Dr. Aifantis is an HHMI Early Career Scientist. Jie Gao, Ph.D. (Postdoctoral Fellow, 12.00 Cal. months effort). Dr. Gao is an experienced molecular biologist, with a focus on the study of lymphocyte transformation (coming from the lab of Dr. R. Dalla-Favera at Columbia University), who will perform all the experiments proposed in this application. In addition to the experimental part, she will also interact with the rest of the team, travel (together with Dr. Aifantis) to meetings and participate in data interpretation and manuscript preparation.

DETAILED PERSONNEL COSTS (including fringe benefits): Iannis Aifantis, Ph.D. (PI, 1.0. cal.mo): no salary requested Jie Gao, Ph.D. (12.00 cal.mo): $35,000 TOTAL PERSONNEL COSTS: $35,000 EQUIPMENT: N/A OTHER DIRECT COSTS: Materials and Supplies: The proposed projects require a significant amount of general and more specialized lab material and supplies including: antibodies, RNA/DNA pre kits, DNA sequencing, PCR polymerase, restriction enzymes, cell culture media, cytokines (for in vitro assays), pipettes, tips and other lab consumables. Moreover, we will need special supplies for experiments which include: animal dissection tools, mouse anesthesia reagents, antibiotics etc. Based on our experience we request $400/month ($4,800/year). NYU Flow Cytometry/FACS Sorting Facility: This project depends heavily on our ability to analyze cell populations by FACS and to sort populations to perform the proposed experiments. We anticipate 2 hours/month of cell sorting, which translates to $2,400/year ($100/hour). Also, 2 hours/week of FACS cell acquisition and analysis, which equals to $3,120/year ($30/hour). These are conservative estimates.

NYU Animal Facility Costs: Our project is heavily based on the utilization of mice, as genetic tools and the housing of these mice in a sterile animal facility (Smilow SPF Facility at NYU Medical School). The current per diem for our animals is $0.702/day/cage. We will be using an absolute minimum of 20 cages, which include both breeding and experimental cages. The total cost will be $5,124/year. TOTAL 1st Year Direct Cost Estimate: $15,000

13


Brief list of equipment and space available for the project. Limit 1 page.

FACILITIES Laboratory: The Aifantis lab is located in the Medical Science Building of the NYU School of Medicine. The space occupies a newly renovated 2000 sq. foot area containing 6 bays, making 12 benches each with a connected desk. There are two more desks in the lab that are separate from the bench space. This makes enough room to comfortably fit 14 researchers. The laboratory has three common equipment benches creating a gel electrophoresis, a Western Blot and a radiation area. There are three sink areas, three common -20° C freezers, 2 common 4° C fridges and several mini fridges and mini freezers underneath the personal benches. The lab contains all necessary equipment for molecular biology and biochemistry, such as: balances, a pH meter, several water baths, mini centrifuges, a liquid nitrogen tank, heat blocks, rockers, isotemp rotisserie, a chemical hood, common restriction enzymes, antibodies for cell sorting and FACS-mediated identification of cell types, and common chemicals and reagents. There is also capital equipment in the laboratory, including high-speed centrifuges, plate readers, PCR and qPCR machines, cell counters, and hematology analyzers. There is a separate tissue culture room of approximately 115 sq. feet with 4 hoods, 3 incubators, two 4° C fridges and one -20° C freezer, a water bath, a centrifuge, two light microscopes and fluorescence scope. The shared resources includes a common equipment space that holds the lab’s -80° C freezer and the common nanodrop machine, shaker, ice machine and nonsterile incubator, a cold room, several microscope rooms, and imaging rooms. Animal: The Division of Laboratory Animal Resources maintains three AAALAC-accredited rodent facilities. A modern specific pathogen-free facility is available in the Smilow building and Skirball Institutes. In the latter, there is a fully staffed Transgenic Animal and Embryonic Stem Cell Facility under the supervision of Dr. Mary Jean Sunshine (Dr. Aifantis is a member of the Steering Committee). In addition, the Department of Pathology has established a rodent histology/pathology core service under the supervision of Dr. Cindy Loomis. The Skirball facility houses a sterile bioluminescence camera. Both cores are suitable for in vivo animal imaging experiments. There is an irradiator located in the Smilow building. There are several procedure rooms and accredited veterinarians available for procedural aid. The laboratory maintains 2 rooms within Smilow to house mice. Each room has a capacity for approximately 600 cages with the possibility to request additional space. Computer: The laboratory has fourteen Macintosh desktops, one Dell desktop, two Dell laptops, and one Macintosh laptop for personal use. This use includes image analysis, database searching, data processing and graphic and manuscript preparation. There is also a common Dell desktop and one laptop connected to a qPCR machine and plate reader, respectively. There is a black and white printer and two scanners available in the lab for lab personnel use. In the common space on the floor, there is also a common black and white and color printer. The IT department dedicated to the building maintains all computers. The School of Medicine has software licenses that allow for on-site use of Illustrator, Adobe Pro, Photoshop, Word, Excel, Powerpoint, Endnote and other programs integral to research and data presentation. Office: The PI holds a 90 sq foot office connected at one end of the lab. At the other end of the lab there is a separate office of equal size occupied by three lab members intended for office work. These spaces have 4 computers altogether. The Department also maintains an administrative office providing secretarial and grants account support on the floor. Other: The proposed research benefits from several shared resources of the School of Medicine, all found in close proximity to the Aifantis laboratory. There are several facilities for: cell sorting, flow cytometry, sequencing, karyotyping, molecular pathology, confocal and specialized microscopy, transgenic mouse, all available from the institution’s cores. All of these facilities are directed by the School of Medicine personnel accredited with PhD degrees. Equipment: Within the space of the laboratory, the major includes the following: a Berthold microplate reader, a lightcycler qPCR machine, both of the preceding instruments connected to two separate computers for data processing; a CASY cell counter; a MindRay hematology analyzer; four BioRad myCycler PCR machines; a ThermoFisher hybridization oven; an Eppendorf refrigerated benchtop centrifuge; an Eppendorf refrigereated 5810R table top centrifuge; a liquid nitrogen storage tank; high voltage power supplies and electrophoresis equipment, including a UV transilluminator; equipment for Western Blotting; three -20ºC freezers and two 4ºC fridges. In the laboratory’s personal tissue culture room, there are two light microscopes, one Zeiss Axio Observer brightfield, phase and fluorescence microscope, three sterile incubators and a Centra GP8R tabletop centrifuge.A common equipment room houses a superspeed centrifuge, ultracentrifuge, a scintillation counter, -80° C freezers, irradiator, shaking and drybath incubators, gel imager, fluorescence microscope, dark-room imager and NanoDrop spectrophotomter. In a separate laboratory on the floor of the Department, there is a Fortessa FACS analyzer, which belongs to the Aifantis laboratory. A flow cytometer, FC500 (five colours from DAKO) and a FACS-Calibur, a FACS-LSR2 (four and six colours respectively from BD) are available to the lab within the department and there is a Moflo high-speed cell sorter in the Skirball Institute. Phosphorimagers and flourimagers are maintained in core resources areas of the Medical Center.

14


List the name, address phone number and Fax number, if available for the two persons you have requested to supply letters of recommendation in addition to your sponsor. Name Adolfo Ferrando

Address Institute for Cancer Genetics 1130 St. Nicholas Avenue New York, NY 10032 USA

e-mail [email protected] Telephone 212-851-4611 Fax 212-851-5256

Name Ross Levine

Address 1275 York Avenue, Box 20 New York, NY 10021 USA

e-mail [email protected] Telephone 646-888-2767 Fax 646-422-0856

15


List all current and pending support for the applicant.

PENDING

NAME OF INDIVIDUAL (PRINCIPAL INVESTIGATOR) Jie Gao SOURCE Life Sciences Research Foundation Postdoc Fellowship

TITLE OF PROJECT OR SUBPROJECT A novel role of the ubiquitin ligase complex Cul4A-DDB1-DCAF1 in T cell leukemia

DATES OF PROPOSED PROJECT 06/2012-05/2013

CV Applicant: Jie Gao Jie Gao, Ph.D.

Howard Hughes Medical Institute and NYU School of Medicine Department of Pathology 550 First Avenue, MSB 504, New York, NY 10016

Ph. (212) 263 5379 Fax. (212) 263 8211 [email protected]

DOB: Nov 19, 1977 SSN: 119-90-1558 Citizenship: China

PROFESSIONAL EXPERIENCE New York University Helen & Martin S. Kimmel Stem Cell Center New York, NY Post-doctoral Research Fellow 03/2007-present

• Characterize the role of Hedgehog signaling and ubiquitin E3 ligases in growth and differentiation of hematopoietic stem cells and lymphoid progenitors.

• Design projects and perform experiments. Analyze and interpret data. Work closely with principle investigator, collaborators, and technicians.

• Apply basic science of lymphoid development to study leukemia transformation. Model leukemia in mice. • Supervise a technician. Teach her biology techniques. Lead her to conduct experiments.

Columbia University Institute for Cancer Genetics New York, NY Graduate Research Assistant 06/2002-02/2007

• Studied molecular mechanisms of B lymphocyte development and immune response, and pathogenesis of B cell lymphomas.

• Employed extensively molecular and cellular biology techniques. • Presented results weekly to and discussed project progresses with principle investigator and senior scientists.

Fudan University Institute of Genetics Shanghai, China Student/Research Assistant 09/1998-06/2001

• Published 9 papers in Chinese and internal journals as the first author or coauthor. • Assisted the patent application of novel human genes. • Taught Microbiology Lab to 30 college students. Oversaw class progress, wrote course design documents and

evaluated student performance.

EDUCATION Columbia University New York, NY Ph.D. in Genetics & Development, GPA: 4.0/4.0 02/2007

Fudan University Shanghai, China M.S. in Genetics, GPA: 3.7/4.0 06/2001 B.S. in Biochemistry, GPA: 3.7/4.0 06/1998

SKILLS Technical skills:

• Immunology: Flow Cytometry (FACS), Immunohistochemistry, Immunoflourescence Microscopy, ELISA • Mice techniques: Mouse Husbandry, Intraperitoneal Injection, Retro-orbital Injection and Bleeding • Molecular biology: Cloning, RT-PCR, Northern Blotting, Southern Blotting, Western Blotting,

Immunoprecipitation, Chromatin Immunoprecipitation, Gene Chip and Microarray Analysis, RNAi • Cell biology: Cell Culture, Transient and Stable Transfection, Retroviral and Lentiviral Transduction • Biology software: FlowJo, GraphPad Prism, Image J, Vector NTI, GeneSpring, MeV, EndNote

Computer skills: MS Word, Excel, PowerPoint, Outlook, Photoshop, Adobe Illustrator Languages: English (fluent), Mandarin Chinese (native)

HONORS and AWARDS • Lady Tata Memorial Trust International Awards for Research in Leukemia (2010-2011) • Member of Sigma Xi Society (2009- present) • Research Fellowship, Columbia University (2003-2007) • Keystone Symposia Scholarship (2005) • Deans Fellowship, Columbia University (2001-2003) • First Class Scholarship every semester, Fudan University (1995-2001)

CV Applicant: Jie Gao • Graduation with Distinction, Fudan University (1998) • Member of Talented Youth Class, Fudan University (1995-1997)

EDITORIAL EXPERIENCE Ad Hoc Frequent Reviewer for 2010-present

• Cellular Immunology • Medical Oncology • DNA and Cell Biology

• Molecular and Cellular Biochemistry • Stem Cells and Cloning • Cell Biochemistry and Function

ACTIVITIES Columbia Presbyterian Medical Center Chinese Students and Scholars Association New York, NY Member of Executive Committee 2001-2005

• Organized and coordinated semiannual party of 300 people to celebrate traditional Chinese festivals. • Oriented new students and scholars to the life in New York City.

Keystone Symposia of B cell Development, Function and Disease Steamboat, CO Conference Assistant 04/2005

• Monitored the progress of conference sessions and reported program changes. • Summarized main points addressed by 80 speakers into three pages.

SELECTED PUBLICATIONS

• Gao J, Song G, Mulligan CG, Cang Y, Goff SP, and Aifantis I. The E3 ubiquitin ligase DDB1 controls homeostasis of hematopoietic stem and progenitor cells. Submitted to Cell Stem Cell.

• Reavie L, Gatta GD, Crusio K, Aranda-Orgilles B, Buckley SM, Thompson B, Lee E, Gao J, Bredemeyer AL, Helmink BA, Zavadil J, Sleckman BP, Palomero T, Ferrando A, Aifantis I. (2010) Regulation of hematopoietic stem cell differentiation by a single ubiquitin ligase-substrate complex. Nature Immunol. 11(3):207-15.

• Gao J, Graves S, Koch U, Liu S, Jankovic V, Buonamici S, El Andaloussi A, Nimer S, Kee B, Taichman R, Radtke F and Aifantis I. (2009) Hedgehog signaling is dispensable for adult hematopoietic stem cell function. Cell Stem Cell. 4(6):548-58.

• Gao J, Aifantis I. (2009) Hedgehog and Hematopoietic Stem Cell Differentiation: Don't Believe the Hype! Cell Cycle. 8(23):3789-90.

• Thompson BJ, Jankovic V, Gao J, Buonamici S, Vest A, Lee JM, Nimer S and Aifantis I. (2008) Control of hematopoietic stem cell self-renewal by the E3 ubiquitin ligase Fbw7. Journal of Experimental Medicine. 205(6):1395-408.

• Saito M, Gao J, Basso K, Kitagawa Y, Smith PM, Bhagat G, Pernis A, Pasqualucci L, Dalla-Favera R. (2007) A signaling pathway mediating downregulation of BCL6 in germinal center B cells is blocked by BCL6 gene alterations in B cell lymphoma. Cancer Cell. 12:280-292.

• Gao J, Yu L, Zhang P, Jiang J, Chen J, Peng J, Wei Y, Zhao S. (2001) Cloning and characterization of human and mouse mitochondrial elongation factor G, GFM and Gfm, and mapping of GFM to human chromosome 3q25.1-q26.2. Genomics. 74:109-14.

• Li Z, Yu L, Zhang Y, Gao J, Zhang P, Wan B, Chen C, Zhao S. (2001) Identification of human, mouse and rat PPP1R14A, protein phosphatase-1 inhibitor subunit 14A, & mapping human PPP1R14A to chromosome 19q13.13-q13.2. Mol Biol Rep. 28:91-101.

• Zhang J, Yu L, Fu Q, Gao J, Xie Y, Chen J, Zhang P, Liu Q, Zhao S. (2001) Mouse phosphoglycerate mutase M and B isozymes: cDNA cloning, enzyme activity assay and mapping. Gene. 264:273-9.

• Zhang P, Yu L, Gao J, Fu Q, Dai F, Zhao Y, Zheng L, Zhao S. (2000) Cloning and characterization of human VPS35 and mouse Vps35 and mapping of VPS35 to human chromosome 16q13-q21. Genomics. 70:253-7.

• Liu Q, Yu L, Gao J, Fu Q, Zhang J, Zhang P, Chen J, Zhao S. (2000) Cloning, tissue expression pattern and genomic organization of latexin, a human homologue of rat carboxypeptidase A inhibitor. Mol Biol Rep. 27:241-6.

• Zheng L, Yu L, Tu Q, Zhang M, He H, Chen W, Gao J, Yu J, Wu Q, Zhao S. (2000) Cloning and mapping of human PKIB and PKIG, and comparison of tissue expression patterns of three members of the protein kinase inhibitor family, including PKIA. Biochem J. 349:403-7.

1

BIOGRAPHICAL SKETCH Provide the following information for the key personnel and other significant contributors in the order listed on Form Page 2.

Follow this format for each person. DO NOT EXCEED TWO PAGES.

NAME

Iannis Aifantis eRA COMMONS USER NAME

IAIFANTI

POSITION TITLE:

Associate Professor of Pathology, Early Career Scientist, Howard Hughes Medical

Institute (HHMI)

EDUCATION/TRAINING (Begin with baccalaureate or other initial professional education, such as nursing, and include postdoctoral training.)

INSTITUTION AND LOCATION DEGREE

(if applicable) YEAR(s) FIELD OF STUDY

University of Crete, Iraklion, Greece B.Sc 1990-1994 Biology University of Crete, Iraklion, Greece M.Sc 1994-1996 Molec Biol & Genetics University of Paris V (Necker Institute), Paris, France

Ph.D 1996-1999 Immunology (Mentor: H. von Boehmer)

Harvard University, (Dana Farber Cancer Institute) Boston, MA

Post-Doc 1999-2003 Immunology (Mentor: H. von Boehmer)

POSITIONS AND HONORS Positions and Employment 1999-2003 Research Associate, Cancer Immunology and AIDS, Dana-Farber Cancer Institute 2003-2006 Assistant Professor, Department of Medicine, University of Chicago 2006-2008 Assistant Professor, Department of Pathology, NYU School of Medicine 2007- Investigator, NYU Cancer Institute 2008-2010 Associate Professor, Department of Pathology, NYU School of Medicine 2008- Co-Director (with Dr. Ruth Lehmann), Cancer Stem Cell Program, NYU Cancer Institute 2009- Howard Hughes Medical Institute (HHMI), Early Career Investigator 2010- Tenured Associate Professor, Department of Pathology, NYU School of Medicine Honors 2003 Cancer Research Institute Young Investigator Award 2004 Leukemia Research Foundation Award 2004 Cancer Research Foundation Young Investigator Award 2004 “V” Foundation in Cancer Research Scholar Award 2005 Sidney Kimmel Foundation Scholar Award 2005 Ad Hoc Reviewer, National Science Foundation (NSF) 2006 Ad Hoc Reviewer, Welcome Trust UK 2006- Editorial Board, Immunology and Cell Biology, Nature Publishing Group 2006 G&P Foundation for Cancer Research Scholar Award 2007-8 Ad Hoc Reviewer, NIH Cellular and Molecular Immunology Study Section (CMI-A) 2007 American Cancer Society Research Scholar 2008 Leukemia and Lymphoma Scholar Award 2008 Dana Foundation Neuro-Immunology Award 2009 The Irma T. Hirschl Career Scientist Award 2010 Ad Hoc Reviewer, NIH Cancer Molecular Pathobiology and Hematopoiesis Study Sections 2010 Editorial Board, Oncogene, Nature Publishing Group 2010 The Vilcek Award for Creative Promise, Finalist 2010- Member, Faculty of 1000, Stem Cells and Regeneration Section 2011- Permanent Member, Molecular Oncogenesis (MONC) Study Section, NIH 2011 McCulloch & Till Award, International Society for Hematology and Stem Cell Biology

nature immunology VOLUME 11 NUMBER 3 MARCH 2010 207

A rt i c l e s

The self-renewal and quiescence of hematopoietic stem cells (HSCs) are controlled by a highly orchestrated integration of environmental signals, most of which originate from the stem cell niche1,2. Long-term HSCs (LT-HSCs) reside at the top of the developmental pyramid, as they are able to self-renew and sustain hematopoiesis3. This fraction of HSCs remains largely quiescent or even dormant throughout the lifetime of an organism. Cells that receive differentiation-promoting niche signals are able to generate multipotent progenitors (MPPs), which are cells with diminished self-renewal that can enter further differentiation routes that will lead them to generate progenitors of the myeloerythroid or lymphoid lineages.

Intense experimentation during the past two decades has suggested that tight control of HSC differentiation is controlled by the interaction of a handful genetic and epigenetic regulators of gene transcription4,5. However, transcriptional control will probably not provide the complete answer to the puzzle of stem cell differentiation. We suggest here that post-transcriptional or even post-translational regulation has an essential role. The emergence of microRNA function in both embryonic and adult stem cell biology is one example6. Another emerging paradigm of post-translational modification is mono- or polyubiquitination of protein substrates, leading to alteration of target half-life or modification of activation status. Ubiquitination is performed by large enzymatic complexes that include ubiquitin-activating and ubiquitin-conjugating components, as well as adaptors that dictate substrate specificity7,8. One of the most important and well-characterized outcomes of protein ubiquitination is targeting

to and subsequent degradation by the proteasome. By controlling protein stability and abundance, ubiquitin ligases regulate distinct biological processes, including cell-cycle entry and progression9.

Published studies have suggested that ubiquitination, proteosomal degradation and protein stability could also control stem cell function in different organisms10–13. These studies introduced the hypothesis that fine tuning of the half-life, stability and abundance of key regulators by the ubiquitin-proteasome machinery could control HSC function, specifically, self-renewal and differentiation. Testing this hypothesis in vivo is a challenging task, as it requires quantitative assessment of substrate abundance in small stem cell and progenitor subsets. To over-come this limitation, we have used gene-targeted mice in which relative protein abundance can be studied in vivo by flow cytometry and micro-scopy. As a model ubiquitin substrate, we selected the transcription factor c-Myc, a well-known oncogene and developmental regulator14,15. The expression and function of c-Myc are important for HSC differenti-ation and, more specifically, for the survival of HSCs and their retention in the niche16,17. However, the molecular mechanism by which c-Myc controls HSC function is largely unknown. For example, similar amounts of Myc mRNA are detected in HSCs and differentiated pro-genitors16. That finding introduces the hypothesis that the functions of c-Myc in stem and progenitor cells are more likely controlled post-translationally than at the level of transcription. Moreover, several stud-ies have shown that the stability of c-Myc protein is controlled by the ubiquitin system. At least three distinct E3 ligases (Skp2, Huwe1 and Fbw7)18–20 are involved in its regulation.

1Howard Hughes Medical Institute and Department of Pathology, and 2New York University (NYU) Cancer Institute and Helen & Martin S. Kimmel Stem Cell Center, NYU School of Medicine, New York, New York, USA. 3Institute for Cancer Genetics, Columbia University, New York, New York, USA. 4Department of Pathology and Immunology, Washington University School of Medicine, St. Louis, Missouri, USA. 5Center for Health Informatics and Bioinformatics, NYU School of Medicine, New York, New York, USA. Correspondence should be addressed to I.A. ([email protected]).

Received 24 June 2009; accepted 17 December 2009; published online 17 January 2010; doi:10.1038/ni.1839

Regulation of hematopoietic stem cell differentiation by a single ubiquitin ligase–substrate complexLinsey Reavie1,2, Giusy Della Gatta3, Kelly Crusio1,2, Beatriz Aranda-Orgilles1,2, Shannon M Buckley1,2, Benjamin Thompson1,2, Eugine Lee1,2, Jie Gao1,2, Andrea L Bredemeyer4, Beth A Helmink4, Jiri Zavadil2,5, Barry P Sleckman4, Teresa Palomero3, Adolfo Ferrando3 & Iannis Aifantis1,2

Hematopoietic stem cell (HSC) differentiation is regulated by cell-intrinsic and cell-extrinsic cues. In addition to transcriptional regulation, post-translational regulation may also control HSC differentiation. To test this hypothesis, we visualized the ubiquitin-regulated protein stability of a single transcription factor, c-Myc. The stability of c-Myc protein was indicative of HSC quiescence, and c-Myc protein abundance was controlled by the ubiquitin ligase Fbw7. Fine changes in the stability of c-Myc protein regulated the HSC gene-expression signature. Using whole-genome genomic approaches, we identified specific regulators of HSC function directly controlled by c-Myc binding; however, adult HSCs and embryonic stem cells sensed and interpreted c-Myc-regulated gene expression in distinct ways. Our studies show that a ubiquitin ligase–substrate pair can orchestrate the molecular program of HSC differentiation.

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.

http://www.nature.com/natureimmunology/

http://www.nature.com/doifinder/10.1038/ni.1839

208 VOLUME 11 NUMBER 3 MARCH 2010 nature immunology

A rt i c l e s

We demonstrate here that the abundance of nuclear c-Myc protein was indicative of HSC quiescence and self-renewal status, and c-Myc stability in HSC was controlled by a single E3 ubiquitin ligase, Fbw7. Deletion of the gene encoding Fbw7 (Fbxw7; called Fbw7 here) led to overexpression of c-Myc protein in single HSCs, and lower c-Myc abundance ‘rescued’ the Fbw7−/− HSC phenotype. Moreover, we demonstrate that the HSC gene-expression signature was con-trolled by fine changes in the stability of c-Myc protein and identify specific gene regulators of HSC quiescence and self-renewal. Whole-genome chromatin immunoprecipitation (ChIP) experiments identi-fied genes directly regulated by the binding of c-Myc to their promoter and c-Myc transcriptional activity. Finally, we contrast adult HSCs with in vitro self-renewing embryonic stem cells (ESCs). We demon-strate that each stem cell type was able to sense and interpret c-Myc abundance and c-Myc-regulated gene expression in distinct ways. Our studies offer an example of a ubiquitin ligase–substrate pair able to orchestrate the molecular program of the differentiation of adult mammalian stem cells.

RESULTSAbundance of c-Myc protein in single HSCs and progenitorsTo visualize c-Myc protein abundance in vivo, we took advantage of a published animal model in which an enhanced green fluorescent protein (eGFP) reporter replaces the start codon of Myc in the second exon in the Myc locus (MyceGFP), which generates a functional c-Myc protein with an amino-terminal tag that faithfully mirrors the expression of endogenous protein21. Homozygous MyceGFP/eGFP mice were viable, with no alterations in the kinetics of hematopoietic differentiation or

immune function. We found that c-Myc–eGFP was not expressed in lineage-positive (Lin+), mature bone marrow cells, but its expression became evident when we focused on Lin− progenitors (Fig. 1a–c). We detected the highest expression of c-Myc (c-Myc–eGFP) in the myelo-erythroid progenitor fraction, a cell population that originates directly from Lin−Sca-1+c-Kit+ (LSK) cells and is actively proliferating. To further confirm the faithful expression of the c-Myc–eGFP fusion, we purified wild-type Lin−c-Kit+ progenitors and Lin+ cells from whole bone marrow. Endogenous c-Myc protein was expressed only in the progenitor fraction (Fig. 1c). These experiments showed that c-Myc protein expression was detectable in the LSK fraction and peaked at the myeloerythroid progenitor stage in adult bone marrow.

Correlation of c-Myc protein with HSC differentiationWe noticed that LSK cells, a population containing HSCs and multi-potential progenitors, included both a c-Myc–eGFP+ fraction and a c-Myc–eGFP− fraction (Fig. 1d). HSCs differentiate through inter-mediate stages, generating at least two subsets of multipotential progenitors (MPP1 and MPP2)22. Only LT-HSCs have the ability to self-renew and are largely quiescent or even dormant22. Therefore, we sub-divided the LSK fraction using both signaling lymphocytic-activation molecule markers (CD150 and CD48; Fig. 1e and Supplementary Fig. 1) and the cytokine receptor Flt3 plus CD34 (data not shown). Much higher c-Myc protein expression (Fig. 1e) correlated per-fectly with differentiation stage, as LT-HSCs were almost exclusively c-Myc–eGFP− (>95%), whereas the MPP1 fraction was the first sub-set with detectable c-Myc protein and there were further increases in c-Myc protein abundance in more differentiated CD150−CD48+

100

a

b

d

e

f g

c

Lin+ Lin– MPMyc+/+

Myc+/eGFP

– +c-Kit

c-K

it

Eve

nts

(% o

f max

)

c-Myc

α-tubulin

MyceGFP/eGFP

MyceGFP/eGFP

control

c-Myc–eGFPlo c-Myc–eGFPhi

0.1 50

80

60

40

Eve

nts

(% o

f max

)E

vent

s (%

of m

ax)

20

100

80

60

40

100

80

60

40

20

20

101

101

101 102 103 104

101

1.2

1.0

0.8

0.6

0.4

0.2

0

1.2

1.0

0.8

0.6

0.4

0.2

0LT

Myc

exp

ress

ion

(fol

d)

Fbw

7 ex

pres

sion

(fo

ld)

MPP1

MPP2

CMP LT

MPP1

MPP2

CMP

DNA content (DAPI)

102 103

104

103

102

101

Ki6

7

020

040

060

080

01,

000

104

102

103

104

102

eGFP

eGFP

eGFP

0.8 3 36 38

LT(CD150+CD48–)

LT CD150+CD48–

MPP1(CD150+CD48+)

MPP1 CD150+CD48+LT CD150+CD48–

MPP2 CD150–CD48+

MPP2(CD150–CD48+)

103 104

101 102

DAPI

LSK;Gated on Lin–

Anti-eGFP Merged

103 104

eGFP

Myc+/+

MyceGFP/eGFP

Figure 1 Abundance of c-Myc protein in early hematopoiesis. (a) Expression of c-Myc–eGFP during early hematopoiesis in Lin+, Lin− and myeloerythroid progenitor (MP; Lin−c-Kit+Sca-1−) bone marrow subsets (n = 6 mice). max, maximum. (b) Immunofluorescence tracing of nuclear expression of c-Myc–eGFP in Lin− bone marrow progenitors. DAPI, nuclear stain; Anti-eGFP, antibody to eGFP. Original magnification, ×40. (c) Immunoblot analysis of c-Myc in c-Kit+ and c-Kit− subsets of adult bone marrow. (d) Expression of c-Myc–eGFP protein in LSK cells. (e) Expression of c-Myc–eGFP in Myc-eGFP−/− control, LT-HSC (LT) and MPP populations. Numbers in top right quadrants indicate percent c-Kit+eGFP+ cells. (f) Quantitative RT-PCR analysis of the expression of Myc and Fbw7 mRNA during HSC differentiation, presented (as average and s.d.) relative to the expression of Actb (encoding β-actin) and then normalized to the LT-HSC subset. (g) Abundance of c-Myc–eGFP protein and cell cycle status of sorted c-Myc–eGFPhi or c-Myc–eGFPlo LSK cells, analyzed by Ki67 and DAPI staining. Numbers in top right quadrants indicate percent Ki67+DAPI+ cells. Data are representative of at least three independent experiments.

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.


A rt i c l e s

MPP2 cells. To determine whether the c-Myc expression changes we observed were independent of transcriptional control, we compared Myc mRNA expression in the various populations. Myc transcription did not increase as LT-HSCs differentiated (Fig. 1f), which suggested that the protein changes we identified were due mainly to post- transcriptional mechanisms. These data connect relative c-Myc protein abundance to specific stages of HSC differentiation.

Effects of extrinsic stress signals on c-Myc expressionWe then sought to determine whether environmental cues such as stress or tissue injury could feed back on LSK cell proliferation and c-Myc protein abundance. Initially, we discovered that the abundance of c-Myc protein not only was suggestive of the differentiation stage but also dictated cell-cycle status. Indeed, c-Myc–eGFPlo LSK cells were exclusively in the G0-G1 phases and c-Myc–eGFPhi cells were actively cycling (Fig. 1g). Moreover, as tissue injury can induce the exit of HSCs from quiescence, we used the chemotherapeutic agent 5-fluorouracil (5-FU) to induce myeloablation, a process that nor-mally activates quiescent HSCs23. Consistent with that idea, two- to threefold more LSK cells from 5-FU-treated MyceGFP/+ mice had entered cell cycle 2 d after treatment than cells from untreated con-trol mice. Most notably, these cells purified from 5-FU-treated mice had substantially more c-Myc protein (Supplementary Fig. 2). These experiments show that extrinsic stress signals can affect c-Myc protein expression in primitive hematopoietic progenitors, which illustrates feedback regulation.

Prediction of self-renewal status by c-Myc protein expressionThe observations reported above suggested that c-Myc protein abun-dance (but not Myc mRNA) could dictate the potential of HSCs to self-renew and influence their ability to differentiate. To test this hypothesis, we used fluorescence-activated cell sorting to divide the LSK population into c-Myc–eGFPhi and c-Myc–eGFPlo cells (Fig. 2a). To achieve an estimate of the differentiation capacity of these two populations, we used colony-forming unit assays, seeding each subset on cytokine-supplemented methylcellulose media. The first plating showed that the c-Myc–eGFPhi fraction had a two- to threefold greater capacity to generate colonies; however, replating of the sorted c-Myc–eGFPhi LSK cells yielded a total inability to form colonies, reflecting a putative loss of in vitro self-renewing capacity. In contrast, the c-Myc–eGFPlo population efficiently generated colonies after the

first replating, retaining characteristics of true self-renewing HSCs (Fig. 2b). To support those observations with in vivo studies, we did competitive reconstitution with 1,000 LSK cells purified from both fractions (expressing the marker CD45.2). In agreement with the in vitro studies, c-Myc–eGFPlo cells were able to efficiently compete with (50:50) and generate all mature lineages as well as stem and progenitor cells 25 weeks after transplantation (Fig. 2c,d). In contrast, c-Myc–eGFPhi cells were less efficient in generating long-term chimerism (6–10% as efficient as the c-Myc–eGFPlo population; Fig. 2c,d), which suggested that this population was largely devoid of LT-HSC activity. A published study has suggested that aging could affect the differentiation ability of HSCs because of aberrant DNA repair24. As all the experiments described above used mice 6–10 weeks of age, we sought to determine whether the c-Myc-dependent regulation of HSC self-renewal is a central control mechanism in HSCs from adult mice independently of HSC age. We repeated these experiments with aged HSCs (from mice >60 weeks old). We found that old and young HSCs demonstrated identical c-Myc–eGFP profiles (Supplementary Fig. 3a). Colony assays and bone marrow–transplantation assays further proved that the relative abundance of c-Myc protein dictated the long-term reconstitution ability of LSK cells (Supplementary Fig. 3b and data not shown). These findings support the idea that the abun-dance of c-Myc protein expression can be used to predict the HSC stage and that after c-Myc protein stabilization, HSCs lose their ability to self-renew.

Fbw7 regulates c-Myc protein abundance in adult HSCsThe observations reported above suggested that c-Myc-regulated self-renewal of HSCs from adults could be controlled by a post- transcriptional and probably a post-translational mechanism of regulation. To start probing this hypothesis, we studied the expres-sion pattern of three enzymes, members of the ubiquitin-proteasome system that have been suggested to be putative regulators of c-Myc protein stability (Huwe1, Skp2 and Fbw7)25. One of these, Fbw7, demonstrated a gene-expression pattern reciprocal to that of c-Myc–eGFP protein expression (Fig. 1f). To further determine whether Fbw7 controls the stability of c-Myc protein in HSCs, we generated Mx1-Cre+Fbw7flox/floxMyceGFP/eGFP mice. Mx1 has a type I interferon–inducible promoter26 that can be activated by intraperi-toneal injection of polyinosinic-polycytidylic acid (poly(I:C)), resulting in inducible expression of Cre recombinase and subsequent deletion

104 104

103

102

101

104103

CD45.1

CD

45.2

102101

104

103

102

101

101 102 103

CD45.1

CD

45.2

43

47 2

90

104

100 120100806040200

Gro

wth

(C

FU

)

80

60

40

20

Eve

nts

(% o

f max

)

c-Myc–eGFPloc-Myc–eGFPloGated on LSK

c-Myc–eGFPhi c-Myc–eGFPhic-Myc–eGFPlo c-Myc–eGFPlo

LSK

Thymus

Spleen

c-Myc–eGFPhi c-Myc–eGFPhi

c-M

yc–

eGFP

lo

c-M

yc–

eGFP

hi

103

a b c d

102

101

104103102101

eGFP

c-K

it

Figure 2 Correlation between the amount of c-Myc protein and loss of HSC self-renewal. (a) Flow cytometry–dependent separation of c-Myc–eGFPhi and c-Myc–eGFPlo LSK populations. (b) In vitro culture of sorted c-Myc–eGFPhi and c-Myc–eGFPlo cells: black, first plating of LSK cells; gray, second plating. CFU, colony-forming unit. (c) Peripheral blood chimerism in competitive reconstitution assays at 25 weeks after transplantation (n = 3 mice). Numbers in plots indicate percent CD45.2+CD45.1− cells (top left) or CD45.2−CD45.1+ cells (bottom right). (d) Chimerism of sorted c-Myc–eGFPhi and c-Myc–eGFPlo LSK cells (CD45.2+) in the bone marrow (LSK subset), thymus and spleen 17 weeks after transplantation (n = 3 mice). Data are representative of at least three experiments (a,c,d) or are from three independent experiments (b; error bars, s.d. of three mice).

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.


A rt i c l e s

of a loxP-flanked Fbw7 locus (Fbw7flox/flox). We reasoned that if c-Myc were a true substrate of Fbw7 in HSCs, then deletion of Fbw7 should substantially stabilize the c-Myc protein, an effect that would correspond to greater eGFP mean fluorescence intensity. Consistent with our hypothesis, the abundance of c-Myc–eGFP in Mx1-Cre+Fbw7flox/floxMyceGFP/eGFP LSK cells was substantially greater than that of cells from the control, poly(I:C)-injected Mx1-Cre+Fbw7+/+ MyceGFP/eGFP counterpart mice (Fig. 3a). More notably, c-Myc protein was more stable in the LT-HSC compartment, as defined by the sig-naling lymphocytic-activation molecule markers CD150 and CD48, after deletion of Fbw7 (Fig. 3b). Such stabilization was also evident in both the myeloerythroid progenitor subset and in thymic CD4−CD8− double-negative (DN) T cell progenitors. Moreover, there were no substantial differences between the different genotypes in the abun-dance of Myc mRNA expression (data not shown). Thus, these data provide in vivo support for the idea of an interaction between c-Myc protein stability and Fbw7 enzymatic function in HSCs.

Decrease in c-Myc rescues Fbw7−/− HSC phenotypesTo further prove the relevance of c-Myc stabilization to Fbw7−/− LSK cells, we attempted to rescue the Fbw7 deficiency–induced HSC phenotype by decreasing c-Myc protein expression14. As total c-Myc deficiency completely abrogates HSC differentiation16,17, we generated Fbw7−/− LSK cells lacking a single copy of c-Myc (Mx1-Cre+Fbw7flox/floxMycflox/+). Deletion of a single Myc allele restored LSK numbers, cell-cycle status and in vitro self-renewal capacity (Fig. 3c–e). The combined data (Figs. 2 and 3) suggested that c-Myc protein stability in HSCs is controlled mainly by the activity of the Fbw7 ligase. These results are consistent with studies unable to detect stabi-lization of additional Fbw7 substrates (Notch1 and Notch3, c-Jun and cyclin E) in Fbw7−/− hematopoietic progenitors12 (data not shown).

The Fbw7–c-Myc interaction controls LT-HSC differentiationThe observations reported above led us to predict that Fbw7 deletion should result in lower absolute LT-HSC numbers and, conversely, the Myc deletion should, at least phenotypically, expand the HSC subset. To test our hypothesis, we initially induced Fbw7 deletion using the Mx1-Cre model (Mx1-Cre+Fbw7flox/flox mice). Deletion of Fbw7

rapidly led to substantially lower LSK frequency (Supplementary Fig. 4a). Likewise, in the LSK subset, there was an obvious lower fre-quency and total cell number of the CD150+CD48− LT-HSC subset (Supplementary Fig. 4b,c), which suggested that deletion of Fbw7 promoted the developmental transition from LT-HSC to MPP and explained the loss of LT-HSCs activity observed in Fbw7−/− mice. In contrast, inducible deletion of Myc led to an opposite phenotype characterized by the accumulation of CD150hiFlt3−CD34− LT-HSC-like cells (Supplementary Fig. 4d–g). These results further support in vivo the idea of a role for antagonistic interaction between the ubiquitin ligase Fbw7 and substrate in the differentiation and self-renewal capacity of HSCs.

Abundance of c-Myc controls the molecular program of HSCsTo further understand the mechanistic effect of c-Myc protein stabilization in HSCs, we purified c-Myc–eGFPhi and c-Myc–eGFPlo subsets and used whole-genome transcriptome analysis to define the gene-expression signatures of each population. A substantial altera-tion in the gene-expression program accompanied the transition from c-Myc–eGFPlo to c-Myc–eGFPhi (Fig. 4a). Indeed, stabilization of c-Myc protein correlated with the upregulation of genes encoding cell-cycle regulators (including Ccnd1, CcnA2, Bub1, Aurka, Skp2 and Cdk2), transcription regulators (including Narg1, Tcerg1, Ilf3, E2F2 and E2F3) and epigenetic regulators (including Ezh1 and Suv39h2). Consequently, many genes encoding molecules known to regulate HSC self-renewal (including Evi1, Eya1, Meis1, Hoxa5/9, Hoxb3, Cdkn1c and Egr1) were substantially downregulated in the c-Myc–eGFPhi subset. Further analysis showed a striking overlap of gene-expression signatures in c-Myc–eGFPhi and Fbw7−/− LSK cells (Fig. 4a), which emphasizes the close biological connection between the two molecules and further explains the loss of self-renewal capacity of Fbw7−/− HSCs.

Further studies with the Gene Set Enrichment Analysis (GSEA) tool27 provided additional information about gene clusters shared by the c-Myc–eGFPlo and c-Myc–eGFPhi signature and publicly available data sets. There was a sizable correlation between the c-Myc–eGFPlo gene signature and several published HSC-related data sets (Fig. 4b). Conversely, data sets presenting genes encoding molecules that

100

a

c

d

eb

LSK MP DNThymusBM: gated on Lin– Gated on LSKs

Gated on Lin–

Control2 1 4 2

020

040

060

080

01,

000

Sca-1

Fbw7 –/–Myc+/+

Fbw7 –/–Myc+/+ Fbw7 –/–Myc+/– Fbw7 –/–Myc–/–

Fbw7 –/–Myc+/– Fbw7 –/–Myc–/–

BM: gated on LT–HSCs (LSK, CD150+, CD48–)

Eve

nts

(% o

f max

)

c-K

it Gro

wth

(C

FU

)

Cel

ls

80

60

eGFP

WT Myc+/+

Fbw7 –/– MyceGFP/eGFP

101 102 103 104

101 102

eGFP103

WT Myc+/eGFP

Fbw7 –/– Myc+/eGFP

104101 102 103 104

40

20

100

104

120

Sorted CD150+ LSKs

10080604020

0

22

Contro

l

Fbw7–/

–

Mx1

-Cre+

Fbw7–/

– Myc+/

–

Mx1

-Cre+

Fbw7–/

– Myc–/

–

Mx1

-Cre+

Control

40

DNA content (DAPI)

30 19

103

102

101

Eve

nts

(% o

f max

)

80

60

40

20

Figure 3 Fbw7 controls the stability of c-Myc protein in HSCs. (a) Flow cytometry of c-Myc–eGFP in LSK, myeloerythroid progenitor and thymic DN (CD4−CD8−) subsets of progenitor populations. BM, bone marrow; WT, wild-type. (b) Flow cytometry analysis of c-Myc–eGFP protein in an LT-HSC subset (LSK, CD150+, CD48−). (c–e) Flow cytometry of bone marrow LSK cells (c), cell-cycle status of LSK cells (d) and methylcellulose assay of CD150+ LSK cells (e). (c) Numbers above outlined areas indicate percent c-Kit+Sca-1+ cells. (d) Numbers above bracketed lines indicate percent dividing cells. (e) Black, first plating; gray, second plating (n = 5 mice). Control (c–e), wild-type. Data are representative of at least three independent experiments (error bars (e), s.d.).

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.


A rt i c l e s

that positively control cell-cycle progression, DNA replication and c-Myc-induced genes in various cell types showed substantial enrich-ment for the c-Myc–eGFPhi signature28–30. Similarly, analysis of the Kyoto Encyclopedia of Genes and Genomes pathway and the Database for Annotation, Visualization, and Integrated Discovery showed substantial enrichment for genes associated with the cell cycle, DNA replication and metabolism in the c-Myc–eGFPhi population (data not shown). Notably, further GSEA showed substantial enrich-ment for genes regulated by the transforming growth factor-β and Wnt–β-catenin pathways in the c-Myc–eGFPlo signature (Fig. 4c and Supplementary Fig. 5). Both pathways have been linked to the regulation of HSC differentiation and self-renewal31,32. These studies correlate the abundance of a single transcription factor to the gene-expression signature that defines HSC quiescence and self-renewal.

Identification of genes directly controlled by c-MycThe results reported above are of unique importance, as they suggest that the stability of c-Myc protein is a central regulator of gene-expression programs that influence HSC self-renewal, trans-cription and cell-cycle entry. To further explore the mechanism of c-Myc-controlled gene regulation, we compared the identified

microarray signatures to our whole-genome ChIP-plus-microarray data sets containing loci occupied by c-Myc factors in c-Myc-expressing leukemia cells (T-ALL cells)33. This comparison demonstrated sub-stantial enrichment of genes overexpressed in the c-Myc–eGFPhi sub-set in the T-ALL ChIP-plus-microarray data set (Fig. 5a). Most of these genes also belonged to functional categories related to cell-cycle progression, transcription, translation and epigenetic control (Fig. 5 and Supplementary Fig. 6). To demonstrate the validity of these whole-genome–wide ChIP-plus-microarray studies, we selected ten genes suggested to be important in the regulation of cell-cycle pro-gression, gene translation and transcription. Using this model-gene subset, we did conventional ChIP. As predicted, the c-Myc-binding sites on the promoters of all these genes were indeed occupied by the c-Myc factor (Fig. 5b).

As the database presented here was generated with human c-Myc-expressing hematopoietic tumor (leukemia) cells, we sought to further confirm these results with mouse c-Kit-expressing stem and progenitor cells. We were able to demonstrate that the genes bound by c-Myc noted above (Fig. 5b) were also transcriptionally regu-lated by c-Myc in bone marrow HSCs and progenitor cells (Fig. 5b,c and Supplementary Fig. 7). These genes were expressed in wild-type HSCs, had high expression in the c-Myc–eGFPhi subset and were silenced in HSCs purified from compound Myc−/− mice (with deletion of Myc and Mycn, which encodes n-Myc)16. To further rule out the possibility that our present findings were biased because of the ChIP database used, we selected a group of genes overexpressed in the c-Myc–eGFPhi LSK subset that also have putative c-Myc-binding sites highly conserved between mice and humans. We did conventional ChIP with highly purified bone marrow Lin− c-Myc–eGFPhi progenitors and found that a substantial portion of these gene promoters were indeed bound by c-Myc factors (Fig. 5c). Collectively, these studies demonstrate a mechanistic correlation among c-Myc protein abun-dance, binding on regulatory DNA sites and transcriptional control of HSC differentiation.

Fbw7–c-Myc axis in fetal liver hematopoietic cellsWe next sought to test the importance of c-Myc stability in a stem cell population closely related to adult HSCs: fetal liver HSCs. Although they are phenotypically and functionally very similar to adult HSCs, fetal HSCs actively expand in number in the fetal liver during embry-onic days 12.5–14.5 (E12.5–E14.5)34. Thus, we hypothesized that fetal HSCs would have more c-Myc protein than their adult counterparts. Our results confirmed our hypothesis (Fig. 6). Initially, almost threefold more fetal LSK cells were in cycle at any given moment, in agreement with published data (Fig. 6b). Also, the abundance of c-Myc protein was substantially greater in fetal total LSK cells and CD150+ LSK cells (in E13.5–14.5 MyceGFP/+ embryos) than in adult LSK cells (Fig. 6c–d).

Notably, in vitro colony-forming unit assays with purified c-Myc–eGFPhi and c-Myc–eGFPlo fetal HSCs showed no difference in the ability to generate hematopoietic colonies in primary, secondary or tertiary plating assays (Fig. 6e). These findings were consistent with transcriptome studies showing very similar gene-expression signatures

WT c-Myc–eGFPlo

WT c-Myc–eGFPhi

a

1.00–1.0

Fbw7 –/–

Enr

ichm

ent

scor

eR

anke

d m

etric

sign

al/n

oise

Enr

ichm

ent

scor

eR

anke

d m

etric

sign

al/n

oise

50.0

c

30.0

0

5.0

0

–5.0

–0.2–0.4–0.6–0.8

–5.0c-Myc–eGFP

5.0

0

TGF-β

Wnt

50.0

30.0

0

0

Enr

ichm

ent

scor

eR

anke

d m

etric

sign

al/n

oise

Enr

ichm

ent

scor

eR

anke

d m

etric

sign

al/n

oise

5.0

0

–5.0

–0.2–0.4–0.6–0.8

5.0

b

0

–5.0

Change in expression (fold)

Cell cycle and DNA replication

HSC

c-Myc–eGFP expression

Figure 4 The abundance of c-Myc protein directly controls the molecular program of stem cell differentiation, cell-cycle entry and self-renewal. (a) Heat map of the gene-expression signatures of c-Myc–eGFPhi and c-Myc–eGFPlo subsets and Fbw7−/− LSK cells. (b) GSEA profiles of the correlation of the c-Myc–eGFPlo signature to stem cell gene sets (HSC; top) and to cell cycle and DNA replication gene sets (bottom). (c) GSEA profiles of the correlation between the transforming growth factor-β (TGF-β) and Wnt signaling pathways with the c-Myc–eGFPlo gene-expression data set. Data are representative of two replicates of three mice.

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.


A rt i c l e s

in the c-Myc–eGFPhi and c-Myc–eGFPlo fetal LSK subsets, in contrast to the well-defined and largely distinct signatures of their adult counterparts (Fig. 6e and Supplementary Fig. 8). However, long-term competitive reconstitution assays with the fetal liver c-Myc–eGFPhi and c-Myc–eGFPlo LSK subsets demonstrated that when introduced into an adult environment, c-Myc–eGFPhi cells were unable to produce long-term chimerism, in agreement with the results obtained with their adult counterparts (Fig. 6f).

Dynamic regulation of Fbw7 and c-Myc in ESCsTo further probe the universality of the Fbw7–c-Myc interaction in stem cell self-renewal, we turned to the study of ESCs, a stem cell type with properties fundamentally distinct from those of adult and quiescent HSCs. ESCs are unique among stem cells as they can differentiate into all three germ layers and self-renew extensively in culture35. In terms of cell-cycle regulation, ESCs proliferate rapidly, show a shortened G1 phase

and have constitutively active cyclin E (CDK2). Furthermore, ESCs have low expression of the D-type cyclins and have almost no CDK4 kinase activity36. We were thus tempted to suggest that Fbw7 could be dispen-sable for the self-renewal of ESCs. Indeed, our initial expression studies supported this idea, as Fbw7 had lower expression in self-renewing ESCs and was upregulated as differentiation was induced (Fig. 7a). To further prove the results of those quantitative PCR studies, we used a trapped ESC line in which a lacZ reporter cassette was introduced in the Fbw7 locus, disrupting expression monoallelically (Fig. 7b). Expression of the Fbw7 locus containing the lacZ reporter cassette was almost undetect-able in self-renewing ESCs and was subsequently induced after ESC dif-ferentiation (Fig. 7c). Although there were minimal differences between

0

a

c

b

70Bcat1

Cdca7Suv39h2

Pa2g4Narg1

Tcerg 1Mad2l1Bub1b

Cks2

llf3

Input control

c-Myc–eGFPLo Hi

IgG ChIPMyc ChIP (1)Myc ChIP (2)60

50403020

Bcat1

Cdca7

Suv39

h2

Pa2g4

Narg1

Tcerg

1

Mad

2l1

Bub1b

Cks2 llf3

100

Enr

ichm

ent

scor

e

5.00

1,200

c-Myc–eGFP

c-M

yc b

indi

ng to

Suv

39h2

c-M

yc b

indi

ng to

Bca

t1

c-M

yc b

indi

ng to

Cdc

a7

c-M

yc b

indi

ng to

Nar

g1

c-M

yc b

indi

ng to

mR

PL1

9

c-M

yc b

indi

ng to

mR

PS

28

c-M

yc b

indi

ng to

Bub

1b

1,000800600

1086420

201612840

20

Bcat1

Cdca7Narg1

mRPL19mRPL28

Suv39h2

Lo Hi1612840

Inpu

tIg

GM

yc

Inpu

tIg

GM

ycIn

put

IgG

Myc

Inpu

tIg

GM

yc

Inpu

tIg

GM

ycIn

put

IgG

Myc

Inpu

tIg

GM

yc

840

1,200 140 1.00.80.60.40.2

0

120100806040200

1,000800600

840

–0.1

–0.3–0.4

–5.0

Ran

ked

met

ricsi

gnal

/noi

se

c-M

yc b

indi

ng

Figure 5 Genes overexpressed in c-Myc-EGFPhi cells are directly bound by the c-Myc transcription factor. (a) GSEA profile of the correlation of c-Myc–eGFPhi gene expression profiles to a direct c-Myc target ChIP–and– microarray analysis data set. (b) ChIP assay (left) and heat map (right) of selected genes overexpressed in c-Myc–eGFPhi T-ALL cells. Red, upregulation; blue, downregulation. Data are representative of two individual experiments (error bars, s.d.). (c) ChIP assay of genomic DNA from purified Lin−c-Kit+c-Myc–eGFP+ bone marrow progenitor cells. IgG, immunoglobulin G. Right, heat map of the overexpression of selected genes in the c-Myc–eGFPhi LSK subset. Data are from three independent experiments (error bars, s.d.).

Figure 6 The role of the c-Myc–Fbw7 interaction in fetal liver stem cells and progenitor cells. (a) Flow cytometry of LSK cells in fetal liver (E14.5) and adult bone marrow (6 weeks old). Numbers above outlined areas indicate percent c-Kit+Sca-1+ cells. (b) Cell-cycle status of fetal and adult LSK cells. Numbers above bracketed lines indicate percent dividing cells. (c) Expression of c-Myc–eGFP protein in fetal and adult LSK cells. Far right, induction of c-Myc protein expression in fetal LSK cells. (d) Expression of c-Myc–eGFP protein in CD150+ LSK cells. Numbers adjacent to outlined areas (c,d) indicate percent c-Kit+eGFP+ cells. (e) Methylcellulose culture of cell populations purified from fetal liver (Fetal) or bone marrow (Adult). Black, first plating; gray, second plating. (f) Peripheral blood chimerism of c-Myc–eGFPlo and c-Myc–eGFPhi fetal liver LSK subsets in competitive reconstitution assays 20 weeks after transplantation (n = 6 mice). CD45.2+ cells are donor-derived cells. Numbers in plots indicate percent CD45.2+CD45.1− cells (top left) or CD45.2−CD45.1+ cells (bottom right). Data are representative of at least three independent experiments (error bars (e), s.d. of six mice).

Gated on Lin– Gated on LSK

Gated on CD150+ LSK

Myc+/+

eGFP

eGFP

Fetal livera c

d e

b104

104

Sca-1

103

103

4 0.5

1

860

Gated on LSKFetal liver Adult

eGFP–/– control

41 11

40

Cel

ls

20

00

200

100

80

60

Eve

nts

(% o

f max

)

40

20

400

600

8001,

000

DNA content (DAPI)

Adult Myc+/+

Fetal MyceGFP/eGFPAdult

102

102

c-K

it

101

104

103

102

c-K

it

101

104

103

102

c-K

it

101

101 104103102101

104103102101

104

103

102

101

104

CD45.1

CD

45.2 0.04

8367

28

103102101

1601401201008060

Gro

wth

(C

FU

)

40200

Adult

c-M

yc–e

GFPlo

Adult

c-M

yc–e

GFPhi

Fetal

c-M

yc–e

GFPlo

c-Myc–eGFPlo

Fetal

c-M

yc–e

GFPhi

c-Myc–eGFPhif

65

Fetal liver

17

Adult

51Fetal liver

16Adult©

201

0 N

atu

re A

mer

ica,

Inc.

All

rig

hts

res

erve

d.


A rt i c l e s

self-renewing and differentiating ESCs in Myc transcript abundance (Fig. 7a), c-Myc protein expression was readily detectable in self-renewing ESCs and became downregulated after induction of differentiation (Fig. 7d), which confirmed the results of many published studies connecting

1.8a

b

d e

c

Fbw

7 (r

elat

ive

expr

essi

on)

Myc

(rel

ativ

e ex

pres

sion

)

–LIF+RA

c-M

yc b

indi

ng

+LIF

Nan

og(r

elat

ive

expr

essi

on)

1.4

1.2

0.8

0 2 4

ATG

MG132

c-Myc

Actin

Actin

p-c-Myc

Day 0

– – –+ +ESC Diff

Day 4

Exon1

Exon3

Exon5

Exon6

Exon8

Exon1

0

SA Poly(A) Stop

6 0Time (d)Time (d) Time (d)2 4 6

Day 0

18Inputc-MycIgG

16141210

Tcerg

1

Suv39

H2

Cdca7

Narg1

Pa2g4

Nme1

Dis3 Ipo7llf3

86420

Day 2 Day 4 Day 6

0 2 4 6

0.40

1.2

1.6

2.0

0.8

0.4

0 0

1.21.00.80.60.40.2

LTR

LTRβ-GEO

1,000

800

600

400SS

C

200

0101 102 103

1 24 24 65

104

1,000

800

600

400SS

C

200

0101 102 103

18 9 9 34

104

101 102 103 104

W4 mouse ESCa

c d e

f g

bUntreated

Nonsilencing

Nonsilencing shFbw7

c-Myc–eGFP

shNanogNo siRNA

H-S

SC

36 43 18 21 44 40Nontargeting siGFP

Nanog-GFP

siOct4

c-Myc

W4 ESC

W4 mouse ESC

dapiα-GFP

DMSO MG132 (3 h)

Myc+/eGFP mouse ESC

Nonsil

shFbw

7

Actin

Actin

p-c-Myc

siMyc siFbw7

siGFP siMyc siFbw7

Nonsil shFbw7

6543210

Fbw

7/A

ctb

Untreated DMSO

Myc+/eGFP mouse ESC

c-Myc–eGFP

20 µM MG132 (3 h)

shNanog

c-Myc expression to ESC pluripotency37,38. ChIP studies showed that c-Myc was not only expressed but also detectable on the promoters of selected predicted gene targets (Fig. 7e).

Fbw7 is dispensable for the self-renewal of ESCsTo address whether c-Myc stability could also be regulated by the ubiquitin-proteasome system in ESCs, we treated self-renewing and differentiating ESCs with the proteasome inhibitor MG132. We found

Figure 7 Expression patterns of Fbw7 and c-Myc in mouse ESCs. (a) Expression of Fbw7, Myc and Nanog mRNA transcripts in self-renewing (day 0) and differentiating (days 1–6) mouse ESCs on days 0–6 of differentiation, presented relative to Actb expression. (b) Fbw7 gene-trap cassette. SA, splice acceptor; βGEO, β-galactosidase–neomycin; LTR, long terminal repeat. (c) Analysis of Fbw7 expression by lacZ staining of self-renewing (+LIF) and differentiating (+LIF–RA) mouse ESCs containing the Fbw7 gene-trap cassette. RA, retinoic acid. Original magnification, ×10. (d) Immunoblot analysis of total c-Myc and c-Myc phosphorylated at Tyr58 (p-c-Myc) in self-renewing (ESC) and differentiating (Diff) mouse ESCs left untreated (−) or treated (+) with 20 µM MG132 (proteasome inhibitor). (e) ChIP assay (with the specific regulators in Fig. 6) after c-Myc immunoprecipitation in mouse ESCs. Data representative of at least three independent experiments (error bars (a), s.d.).

Figure 8 Fbw7 is dispensable for the self-renewal of mouse ESCs. (a) Accumulation of c-Myc protein in W4 and MyceGFP/− mouse ESCs left untreated or treated with dimethyl sulfoxide (DMSO) or MG132. Numbers in plots indicate percent eGFP+ cells. SSC, side scatter. (b) Visualization of c-Myc–eGFP in W4 and MyceGFP/− mouse ESCs with and without treatment with MG132. Green, GFP; blue, nuclear staining (DAPI). Original magnification, ×20. (c) Accumulation of c-Myc protein in MyceGFP/− ESCs expressing nonsilencing siRNA or siRNA specific for GFP (siGFP), c-Myc (siMyc) or Fbw7 (siFbw7). Numbers in plots indicate percent c-Myc–eGFP+ cells. (d) Quantitative RT-PCR analysis of Fbw7 mRNA expression in ESCs expressing nonsilencing shRNA (Nonsil; control) or shRNA specific for Fbw7 (shFbw7) or Nanog (shNanog). (e) Immunoblot analysis of the accumulation of total c-Myc protein and c-Myc phosphorylated at Tyr58 in W4 ESCs expressing nonsilencing shRNA or shRNA specific for Fbw7. (f) Alkaline phosphatase staining of mouse ESCs expressing nonsilencing shRNA or shRNA specific for Fbw7 or Nanog. Original magnification, ×10. (g) Nanog-eGFP expression in a Nanog-eGFP reporter ESC line expressing no siRNA, nonsilencing siRNA (Nontargeting) or siRNA specific for GFP (siGFP), the transcription factor Oct4 (siOct4), c-Myc (siMyc) or Fbw7 (siFbw7). Numbers in plots indicate percent cells expressing Nanog. H-SSC, side-scatter height. Data are representative of at least three independent experiments (error bars (d), s.d.).

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.


A rt i c l e s

that both total and phosphorylated c-Myc protein accumulated in both self-renewing and differentiating culture conditions (Fig. 7d). Complementary to that finding, we also treated MyceGFP/+ ESCs with MG132 and observed stabilization of c-Myc–eGFP by flow cytometry as well as by immunofluorescence with an antibody that detects eGFP (Fig. 8a,b). To begin to assess the role of Fbw7 in ESC self-renewal and its regulation of c-Myc, we used gene silencing mediated by small interfering (siRNA). ESC cell–specific knockdown of Fbw7 resulted in the accumulation of c-Myc–eGFP (Fig. 8c), which suggested that Fbw7 regulates the stability of c-Myc protein in self-renewing ESCs. Knockdown of Fbw7 was very efficient, as measured by quantitative PCR (Fig. 8d). We obtained similar results with another mouse ESC line (W4) using short hairpin (shRNA) specific for Fbw7, in which knockdown resulted in the accumulation of both total and phos-phorylated c-Myc protein (Fig. 8e). However, there were no pheno-typic changes (Fig. 8f) or changes in expression of germline markers, which demonstrated that ESCs retain characteristics associated with the molecular effects of ESC self-renewal (data not shown). In contrast, silencing of Nanog, which encodes a pluripotency regula-tor, led to rapid cell differentiation and loss of self-renewal (Fig. 8f). To further assess the dispensability of Fbw7 in ESCs, at least in this in vitro system, we used a transgenic ESC line that reports self-renewal because of the expression of GFP driven by Nanog regulatory elements39. Fbw7 silencing was unable to affect Nanog-GFP expres-sion and ESC self-renewal in this system (Fig. 8g). Overall, these observations show that Fbw7 expression is upregulated during ESC differentiation and that Fbw7 silencing is dispensable for the in vitro self-renewal of ESCs. They also identify a substantial molecular distinction between ESCs and quiescent adult stem cells (HSCs; Supplementary Fig. 9).

DISCUSSIONOur observations have identified a specific ubiquitin ligase–substrate pair as a central regulator of stem cell differentiation. We have demon-strated in vivo that slight changes in the stability and abundance of c-Myc protein expression had the role of a rheostat controlling adult stem cell quiescence and self-renewal. Our work has also explained the mechanism by which c-Myc carries out its function in the HSC population. We have identified, by whole-genome transcriptional analysis and ChIP-plus-microarray approaches, a constellation of genes directly regulated by the relative abundance of this transcription factor during these early stages of hematopoiesis. Most notably, our studies suggest differences between adult stem cells and ESCs in the need for c-Myc stability, which suggests that different stem cell types sense and interpret c-Myc-regulated gene expression in distinct ways. All of our studies prove the hypothesis that the ubiquitin-proteasome system can control stem cell differentiation by directly controlling important regulators of cell-cycle entry, self-renewal and/or lineage commitment. Further studies are needed to define the extent of the involvement of the ubiquitin system in different aspects of stem and progenitor cell biology.

Our findings explain the discrepancy between Myc mRNA expres-sion and function that has been demonstrated before. Indeed, c-Myc-deletion studies have suggested that c-Myc expression is essential for the exit of HSCs from the osteoblastic niche by regulating the expression of essential adhesion molecules, including N-cadherin17. However, those same investigators have shown that Myc mRNA stability remains stable from the LT-HSC stage to the common myeloid progenitor stage, which calls into question the HSC-specific function of this transcription factor16. Those findings were verified by our own independent analysis. We have demonstrated here that

Fbw7 expression was high at the LT-HSC stage and was almost unde-tectable at subsequent MPP and myeloerythroid progenitor stages of differentiation. Similarly, c-Myc protein abundance increased as HSCs differentiated and reached its peak at the myeloerythroid progenitor and common myeloid progenitor stages. These observations explain the reported discrepancy and emphasize the importance of ubiquitin-mediated protein stability in these early stages of hematopoiesis.

We have also demonstrated a difference in the dependence of ESCs and adult HSCs on c-Myc stability and Fbw7 activity. Indeed, adult HSCs were characterized by high Fbw7 expression and rapid c-Myc turnover, whereas self-renewing ESCs demonstrated only basal Fbw7 activity and very stable c-Myc protein. Few such factors with distinct functions in the two stem cell types have been identified thus far, most of them being members of the machinery that initiates the cell cycle, including cyclin D and cyclin E, cell-cycle inhibitors (CDKI) and retinoblastoma protein (pRb). The differences in Fbw7 expression are probably tightly linked to the cell cycle–entry machinery. Indeed, studies of embryonic fibroblasts have shown that Fbw7 expression is cell cycle dependent, with the highest expression recorded at the G0-G1 stages (B.A.-O. and I.A., unpublished observations). The Fbw7 activity during ESC differentiation is consistent with c-Myc availability and its essential role in the regulation of pluripotency; however, at this point, we cannot exclude the possibility of a role for additional ESC Fbw7 substrates that could control cell-cycle progression, including cyclin E. Finally, as c-Myc has been proven to be one of the factors that control adult cell reprogramming38, we propose that the ubiquitin system and more specifically Fbw7 could be a key regulator of this process. Our data also fit perfectly with other studies showing that the kinase GSK3β, which phosphorylates c-Myc on Thr58 and triggers Fbw7-mediated degradation in other cell systems40, is largely excluded from the nucleus in self-renewing ESCs. GSK3β enters the nucleus after ESC differentiation because of the absence of activation of the kinase Akt induced by the cytokine LIF41. We have demonstrated here that both proteasome inhibition and Fbw7 knockdown led to stabili-zation and overexpression of c-Myc phosphorylated on Thr58, which connects ESC differentiation, kinase activation, recruitment of the Fbw7 complex and c-Myc degradation.

Our work has also suggested that the ubiquitin complex is a regula-tor of stem cell differentiation and function. Indeed, the activity of ubiquitin ligases (such as Fbw7) or opposing deubiquitinases could control both the abundance and activation of central stem cell regula-tors. This close connection seems to be conserved among species, as a report has shown a requirement for the deubiquitinase Scrawny in the epigenetic control of gene expression in Drosophila melanogaster stem cells10. All these observations propose an additional layer of stem cell regulation and also suggest that genetic or chemical target-ing of specific ubiquitin enzyme activity could affect somatic cell reprogramming, adult stem cell population expansion and, putatively, cancer stem cell differentiation and oncogenicity.

METHODSMethods and any associated references are available in the online version of the paper at http://www.nature.com/natureimmunology/.

Accession codes. GEO: microarray data, GSE19502.

Note: Supplementary information is available on the Nature Immunology website.

ACKnOwLEDGMEnTSWe thank the members of the Aifantis Lab and specifically B. King for advice as well as time and effort spent on this manuscript; P. Lopez and the NYU Flow Cytometry Facility for cell sorting; the NYU Cancer Institute Genomics Facility for help with

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.

http://www.nature.com/natureimmunology/


A rt i c l e s

microarray processing; M. Gostissa (Harvard University) and F. Alt (Harvard University) for Mycflox mice; and I. Lemischka and his laboratory (Mount Sinai) for the Nanog-GFP line and technical advice. Supported by the National Institutes of Health (RO1CA133379, RO1CA105129, R21CA141399, R56AI070310 and P30CA016087 to I.A.; RO1AI41428 and RO1AI072039 to B.P.S.; and R01CA120196 to A.F.), the American Cancer Society (RSG0806801 to I.A.), the Edward Mallinckrodt Jr. Foundation, the Irma T. Hirschl Trust, the Alex’s Lemonade Stand Foundation (I.A.), the Alexander von Humboldt Foundation (B.A.-O.), the NYU Hematology/Oncology Program (S.M.B.), an NYU Molecular Oncology and Immunology Training Grant (5T32CA009161 to K.C.), the Leukemia & Lymphoma Society (I.A. and A.F.) and the Howard Hughes Medical Institute (I.A.).

AUTHOR COnTRIBUTIOnSL.R. did most of the experiments and participated in preparing the manuscript; G.D.G., T.P., A.F. and B.A.-O. designed and did the ChIP-plus-microarray and ChIP experiments; K.C., E.L. and B.T. did the ESC experiments; B.P.S., B.T., A.L.B. and B.A.H. generated and did initial studies with the c-Myc–eGFP mice; J.Z. analyzed microarray data; and I.A. designed the study and prepared the manuscript.

COMPETInG InTERESTS STATEMEnTThe authors declare no competing financial interests.

Published online at http://www.nature.com/natureimmunology/. reprints and permissions information is available online at http://npg.nature.com/reprintsandpermissions/.

1. Adams, G.B. & Scadden, D.T. The hematopoietic stem cell in its place. Nat. Immunol. 7, 333–337 (2006).

2. Kiel, M.J. & Morrison, S.J. Uncertainty in the niches that maintain haematopoietic stem cells. Nat. Rev. Immunol. 8, 290–301 (2008).

3. Kondo, M. et al. Biology of hematopoietic stem cells and progenitors: implications for clinical application. Annu. Rev. Immunol. 21, 759–806 (2003).

4. Yoshida, T. et al. The role of the chromatin remodeler Mi-2β in hematopoietic stem cell self-renewal and multilineage differentiation. Genes Dev. 22, 1174–1189 (2008).

5. Moore, K.A. & Lemischka, I.R. Stem cells and their niches. Science 311, 1880–1885 (2006).

6. Gangaraju, V.K. & Lin, H. MicroRNAs: key regulators of stem cells. Nat. Rev. Mol. Cell Biol. 10, 116–125 (2009).

7. Cardozo, T. & Pagano, M. The SCF ubiquitin ligase: insights into a molecular machine. Nat. Rev. Mol. Cell Biol. 5, 739–751 (2004).

8. Harper, J.W. & Schulman, B.A. Structural complexity in ubiquitin recognition. Cell 124, 1133–1136 (2006).

9. Yamasaki, L. & Pagano, M. Cell cycle, proteolysis and cancer. Curr. Opin. Cell Biol. 16, 623–628 (2004).

10. Buszczak, M., Paterno, S. & Spradling, A.C. Drosophila stem cells share a common requirement for the histone H2B ubiquitin protease scrawny. Science 323, 248–251 (2009).

11. Matsuoka, S. et al. Fbxw7 acts as a critical fail-safe against premature loss of hematopoietic stem cells and development of T-ALL. Genes Dev. 22, 986–991 (2008).

12. Thompson, B.J. et al. Control of hematopoietic stem cell quiescence by the E3 ubiquitin ligase Fbw7. J. Exp. Med. 205, 1395–1408 (2008).

13. Whetton, A.D. et al. The time is right: proteome biology of stem cells. Cell Stem Cell 2, 215–217 (2008).

14. Dalla-Favera, R., Martinotti, S., Gallo, R.C., Erikson, J. & Croce, C.M. Translocation and rearrangements of the c-myc oncogene locus in human undifferentiated B-cell lymphomas. Science 219, 963–967 (1983).

15. O’Neil, J. & Look, A.T. Mechanisms of transcription factor deregulation in lymphoid cell transformation. Oncogene 26, 6838–6849 (2007).

16. Laurenti, E. et al. Hematopoietic stem cell function and survival depend on c-Myc and N-Myc activity. Cell Stem Cell 3, 611–624 (2008).

17. Wilson, A. et al. c-Myc controls the balance between hematopoietic stem cell self-renewal and differentiation. Genes Dev. 18, 2747–2763 (2004).

18. Zhao, X. et al. The HECT-domain ubiquitin ligase Huwe1 controls neural differentiation and proliferation by destabilizing the N-Myc oncoprotein. Nat. Cell Biol. 10, 643–653 (2008).

19. von der Lehr, N. et al. The F-box protein Skp2 participates in c-Myc proteosomal degradation and acts as a cofactor for c-Myc-regulated transcription. Mol. Cell 11, 1189–1200 (2003).

20. Welcker, M. et al. The Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphorylation-dependent c-Myc protein degradation. Proc. Natl. Acad. Sci. USA 101, 9085–9090 (2004).

21. Huang, C.Y., Bredemeyer, A.L., Walker, L.M., Bassing, C.H. & Sleckman, B.P. Dynamic regulation of c-Myc proto-oncogene expression during lymphocyte development revealed by a GFP-c-Myc knock-in mouse. Eur. J. Immunol. 38, 342–349 (2008).

22. Wilson, A. et al. Hematopoietic stem cells reversibly switch from dormancy to self-renewal during homeostasis and repair. Cell 135, 1118–1129 (2008).

23. Arai, F. et al. Tie2/angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 118, 149–161 (2004).

24. Rossi, D.J. et al. Deficiencies in DNA damage repair limit the function of haematopoietic stem cells with age. Nature 447, 725–729 (2007).

25. Eilers, M. & Eisenman, R.N. Myc’s broad reach. Genes Dev. 22, 2755–2766 (2008).

26. Kuhn, R., Schwenk, F., Aguet, M. & Rajewsky, K. Inducible gene targeting in mice. Science 269, 1427–1429 (1995).

27. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550 (2005).

28. Georgantas, R.W. III et al. Microarray and serial analysis of gene expression analyses identify known and novel transcripts overexpressed in hematopoietic stem cells. Cancer Res. 64, 4434–4441 (2004).

29. Ivanova, N.B. et al. A stem cell molecular signature. Science 298, 601–604 (2002).

30. Goldrath, A.W., Luckey, C.J., Park, R., Benoist, C. & Mathis, D. The molecular program induced in T cells undergoing homeostatic proliferation. Proc. Natl. Acad. Sci. USA 101, 16885–16890 (2004).

31. Reya, T. et al. A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423, 409–414 (2003).

32. Karlsson, S. Is TGF-β a stemness regulator? Blood 113, 1208 (2009).33. Margolin, A.A. et al. ChIP-on-chip significance analysis reveals large-scale binding

and regulation by human transcription factor oncogenes. Proc. Natl. Acad. Sci. USA 106, 244–249 (2009).

34. Morrison, S.J., Hemmati, H.D., Wandycz, A.M. & Weissman, I.L. The purification and characterization of fetal liver hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 92, 10302–10306 (1995).

35. Ivanova, N. et al. Dissecting self-renewal in stem cells with RNA interference. Nature 442, 533–538 (2006).

36. Orford, K.W. & Scadden, D.T. Deconstructing stem cell self-renewal: genetic insights into cell-cycle regulation. Nat. Rev. Genet. 9, 115–128 (2008).

37. Silva, J. et al. Nanog is the gateway to the pluripotent ground state. Cell 138, 722–737 (2009).

38. Takahashi, K. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872 (2007).

39. Schaniel, C. et al. Delivery of short hairpin RNAs–triggers of gene silencing–into mouse embryonic stem cells. Nat. Methods 3, 397–400 (2006).

40. Welcker, M. & Clurman, B.E. FBW7 ubiquitin ligase: a tumour suppressor at the crossroads of cell division, growth and differentiation. Nat. Rev. Cancer 8, 83–93 (2008).

41. Bechard, M. & Dalton, S. Subcellular localization of glycogen synthase kinase 3beta controls embryonic stem cell self-renewal. Mol. Cell. Biol. 29, 2092–2104 (2009).

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.

nature immunology doi:10.1038/ni.1839

ONLINE METHODSAnimals. Mycflox mice42 were a gift from F. Alt. All mice were housed in a pathogen-free animal facility at the NYU School of Medicine. All animal procedures were carried in compliance with Institutional Animal Care and Use Committee of the NYU School of Medicine.

Genotyping and in vivo animal studies. Tails were clipped from mice 1–2 weeks after birth and were incubated for 24 h at 55 °C in tail-lysis buffer contain-ing proteinase K. NaCl was added and cellular debris were pelleted by ultra-centrifugation. DNA was precipitated by the addition of isopropanol, then DNA was pelleted and washed with 70% ethanol. DNA pellets dissolved in water were used for PCR analysis. Primers were designed to amplify both wild-type and loxP-flanked Myc and Fbw7 alleles, or were designed to detect both wild-type and Myc-eGFP knock-in alleles (Supplementary Table 1). Mice received five intraperitoneal injections of poly(I:C) at a dose of 20 µg per gram body weight 2 weeks after birth and were analyzed 2 weeks after injection. Deletion of targeted alleles and transcripts were measured by genomic PCR and quantitative RT-PCR.

Quantitative real-time PCR. RNA was isolated with an RNeasy-Plus Mini Kit (Qiagen), then cDNA was synthesized with a SuperScript III First-Strand Synthesis System reverse transcription kit (Invitrogen) and used for quanti-tative RT-PCR with iQ SYBR Green Supermix and an iCycler (BioRad; primer sequences, Supplementary Table 1). Relative expression was deter-mined by the cycle threshold method (CT) and was normalized to the internal control Actb.

Flow cytometry and antibodies. Flow cytometry was carried out as described12. In experiments with the Myc-eGFP knock-in mouse, a ‘fluo-rescence minus one’ littermate control was analyzed in parallel to set eGFP gates (Supplementary Fig. 9). Antibodies used for flow cytometry were as follows: anti-Sca-1 (D7), anti-IL-7R (RAM34), anti-CD4 (L3T4) and anti-CD44 (IM7; all from eBioscience); anti-c-Kit (2B8), anti-Mac-1 (M1/70), anti-Gr-1 (RB6-8C5), anti-NK1.1 (PK136), anti-Ter119 (553673), anti-CD3 (145-2C11), anti-CD19 (1D3), anti-CD8 (53-6.7) and anti-CD25 (PC61; all from BD Biosciences); and anti-CD150 (TC-15-12F2.2) and CD48 (HM48-1; both from Biolegend). Anti-Ki67 (556027), for cell cycle analysis, was from BD Biosciences. The bone marrow lineage antibody ‘cocktail’ included anti-Mac-1, anti-Gr-1, anti-NK1.1, anti-Ter119, anti-CD3, anti-IL-7R and anti-CD19.

Immunoblot analysis. Immunoblot analysis was done as described12. Both c-Kit+ and c-Kit− bone marrow cells were isolated with a magnetic bead–based positive selection kit with a biotinylated primary antibody to c-Kit (EasySep Positive Biotin Selection kit; Stem Cell Technologies). After selection, cells were lysed with RIPA lysis buffer and were incubated for 20 min at 0 °C, and cellular debris were pelleted by ultracentrifugation. Total cell lysates were separated by SDS-PAGE on a 4–20% Tris-HCl gradient gel and were transferred to nitro-cellulose membranes. Membranes were probed with anti-c-Myc (sc-764; Santa Cruz Biotechnology) and anti-tubulin (Santa Cruz Biotechnology).

Immunofluorescence. These experiments were done as described43. First, c-Kit+ bone marrow cells were purified as described above (immunoblot analysis). Cells were separated into aliquots onto charged glass slides and were fixed with 4% (vol/vol) paraformalydehyde, then cell membranes were made permeable by 0.1% (vol/vol) Triton-X, and samples were incubated overnight at 4 °C with GFP-specific rabbit polyclonal antibodies (ab290; Abcam). Subsequently, washed slides were incubated with Alexa Fluor 488–conjugated secondary anti-body to rabbit IgG (Invitrogen) and were counterstained with DAPI nuclear stain (4,6-diamidino-2-phenylindole; Sigma).

GSEA. Normalized expression data were assessed by GSEA as described44. Gene-expression profiles of c-Myc–eGFPlo and c-Myc–eGFPhi cell populations were used as the background data set and the following two gene sets were used as the foreground: C2-curated gene sets from the Broad Institute, and gene set constructed in-house by consideration of c-Myc ChIP-and-microarray data with a P value of less than 0.005 (ref. 33). Genes with differences in expression are ranked by a signal-to-noise metric.

Microarray analysis. A portion of total RNA (5 ng) from target cell populations was amplified and then labeled with the Ovation RNA Amplification System v2 and Ovation cDNA Biotin System (Nugen). The resulting cDNA was hybrid-ized to GeneChip MG 430 2.0 arrays according to the array manufacturer’s recommendations (Affymetrix). Raw data were processed with GeneSpring 7.2 software (Agilent). The Affymetrix CEL files were normalized with robust multiarray average expression measure and baseline scaling44. For the identifi-cation of mRNA with differences in abundance in various replicate experimental conditions, abundance had to be identified as significantly different by at least one of three statistical algorithms available from the TIGR Microarray Suite TM4: t-test (P < 0.05, α correction), significance analysis of microarray (false-discovery rate, 5%) and Pavlidis template matching (P < 0.05)45. The Kyoto Encyclopedia of Genes and Genomes pathway and the Database for Annotation, Visualization, and Integrated Discovery were accessed online for pathway-enrichment analyses.

ChIP. ChIP-plus-microarray and ChIP assays were done as described33 with T-ALL cell lines, Lin−c-Kit+ selected bone marrow cells and mouse ESCs (W4; 129 SJ). Quantitative RT-PCR was done on chromatin immunoprecipitates and the corresponding whole-cell extracts to confirm promoter occupancy of ten hand-selected genes by c-Myc with an ABI 7300 Real-Time PCR system (Applied Biosystems); β-actin was used as input reference (primer sequences, Supplementary Table 2).

In vitro colony-forming assays. Total LSK cells from control, Mx1-Cre+Fbw7−/− Myc+/− and Mx1-Cre+Fbw7−/−Myc−/− mice or the upper 30% of Myc+/eGFP LSK cells and lower 30% of Myc+/eGFP LSK cells were sorted from MyceGFP/eGFP knock-in adult mice or embryos at E14.5. Cells (300 per subset) were seeded in duplicate and were cultured in cytokine-supplemented methylcellulose medium (MethoCult 3434; Stem Cell Technologies). Subsequently, colonies were counted on day 7, then were isolated, replated and cultured for another 7 d (total, 14 d).

ESC culture, lentivirus transduction and siRNA transfection. All ESC lines were maintained on mouse embryonic fibroblasts cultured on gelatin-coated plates in the presence of DMEM (Cellgro) supplemented with 15% (vol/vol) FBS. The Fbw7 ESC LacZ-trapped line was from the Texas Institute for Genomic Medicine. MyceGFP/− ESCs and Nanog-GFP ESCs were reverse-transfected by a mixture of 30 nM siRNA (siGENOME SMARTpool; Dharmacon) with Lipofectamine 2000 (Invitrogen) in supplemented DMEM media (Cellgro). The siRNA mixture was added to a gelatin-coated 96-well plate, and ESCs were plated at a density of 1,500 cells per well in DMEM and LIF (Chemicon). For differentiation experiments, ESC cells were preplated for 1 h (to remove MEFs) and seeded at low density, and at 24 h after initial plating (Day 0), either only LIF was removed or LIF was removed and retinoic acid was added. The eGFP fluorescence was measured with an LSRII (BD Biosciences) 48 h after transfec-tion. Nanog-GFP ESC cells (a gift from I. Lemischka) were transduced with pLKO.1-PIG lentivirus35 (a gift from I. Lemischka; Supplementary Table 3) containing the appropriate shRNA 1 h after preplating. Then, 2 d after trans-duction, transduced cells were selected by puromycin (2 µg/ml) and were subsequently used for self-renewal and differentiation experiments.

Bone marrow transplantation. Freshly dissected femurs and tibias were flushed with PBS supplemented with 3% (vol/vol) FBS injected by a 1-cc insulin syringe. Cells were spun for 2.5 min at 200g and red blood cells were lysed for 3 min at 25 °C with ammonium chloride–potassium bicarbonate lysis buffer. Cells were then washed in 3% (vol/vol) FBS in PBS and were spun. Then the cells were passed through a cell strainer and counted, and cells were stained with phycoerythrin-conjugated antibodies to lineage markers, allophycocyanin-conjugated anti-c-Kit and phycoerythrin-indotricarbocyanine– conjugated anti-Sca-1. Finally, bone marrow–derived CD45.2+ c-Myc–eGFPhi or c-Myc–eGFPlo LSK subsets (from adult mice and E14 fetal livers) were purified by flow cytometry and 1.0 × 103 cells from each subset were mixed with 1.0 × 106 wild-type CD45.1+ bone marrow cells and the mixture was injected into the ocular cavity of lethally irradiated (two doses of 600 rads) CD45.1 host mice. Chimerism in peripheral blood was analyzed at 7, 12, 17 and 25 weeks after transplantation. Chimerism in bone marrow, thymus and spleen was measured at 17 weeks.

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.

nature immunologydoi:10.1038/ni.1839

Treatment with 5-FU. Experiments with 5-FU were done as described16. MyceGFP/− mice were injected one time with 75 µg fluorouracil per gram body weight and the LSK population in the bone marrow was analyzed 2 d after treatment by flow cytometry.

Statistical analysis. An unpaired two-tailed Student’s t-test with assumption of experimental samples of equal variance was used for all statistical analyses, unless otherwise specified.

42. de Alboran, I.M. et al. Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity 14, 45–55 (2001).

43. Demuth, T. et al. MAP-ing glioma invasion: mitogen-activated protein kinase kinase 3 and p38 drive glioma invasion and progression and predict patient survival. Mol. Cancer Ther. 6, 1212–1222 (2007).

44. Bolstad, B.M., Irizarry, R.A., Astrand, M. & Speed, T.P. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 19, 185–193 (2003).

45. Saeed, A.I. et al. TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374–378 (2003).

© 2

010

Nat

ure

Am

eric

a, In

c. A

ll ri

gh

ts r

eser

ved

.

2

SELECTED PUBLICATIONS (last 10 years, out of 55 total) (*authors have contributed equally)

*Martin CH, *Aifantis I, Scimone ML, von Andrian UH, Reizis B, von Boehmer H, Gounari F. B220+, CD19- precursors represent a missing link between bone marrow and intra-thymic lymphoid committed progenitors. Nature Immunology 4:866-873, 2003.

Mandal M, Borowski C, Palomero T, Ferrando AA, Oberdoerffer P, Meng F, Ruiz-Vela A, Ciofani M, Zuniga-Pflucker J-C, Screpanti I, Look AT, Korsmeyer SJ, Rajewsky K, von Boehmer H, Aifantis I. The BCL2A1 gene, as a pre-TCR-induced regulator of thymocyte survival and T cell leukemia. The Journal of Experimental Medicine 201:603-614, 2005.

El Andaloussi A, Graves S, Meng F, Mashayekhi M, Aifantis I. The Hedgehog signaling network controls lymphoid progenitor differentiation in the thymus. Nature Immunology 7:418-426, 2006.

Aifantis I, Mandal M, Sawai K, Vilimas T. Regulation of T cell progenitor survival and cell cycle entry by the pre-T Cell Receptor. Immunological Reviews 209:159-169, 2006.

Cooper A, Sawai K, Powers S, Sicinska E, Sicinski P, Clark M, Aifantis I. Regulation of pre-B cell proliferation by Cyclin D3. Nature Immunology, 7: 489-497, 2006.

Aifantis I, Bassing C, Garbe A, Sawai K, Alt F, von Boehmer H. The Eδ enhancer controls the generation of DN αβ-TCR expressing T cells that can give rise to different lineages of αβ T cells. The Journal of Experimental Medicine, 203(6):1543-50, 2006.

Vilimas T, Mascarenhas J, Palomero T, Mandal M, Buonamici S, Meng F, Thompson B, Spaulding C, Macaroun S, Alegre ML, Kee B, Ferrando A, Miele L, Aifantis I. Targeting the NF-κB signaling pathway in Notch1-induced T cell leukemia. Nature Medicine, 13(1): 70-77, 2007.

Thompson B, Buonamici S, Sulis M-L, Palomero T, Vilimas T, Basso G, Ferrando A, and Aifantis I. The SCFFBW7 ubiquitin ligase complex as a tumor suppressor in T cell leukemia. The Journal of Experimental Medicine, 204(8): 1825-35, 2007.

Johnson K, Hashimshony T, Sawai C, Pongubala J, Skok J, Aifantis I, and Singh H. Convergent signaling pathways synergistically induce immunoglobulin light-chain recombination. Immunity, 28(3): 335-45, 2008.

Aifantis I, Raetz E, Buonamici S. Molecular pathogenesis of T cell leukemia and lymphoma. Nature Reviews Immunology, 8 (5): 380-390, 2008.

Thompson B, Jankovic V, Gao J, Buonamici S, Nimer S, and Aifantis I. The ubiquitin ligase Fbw7 as a regulator of hematopoietic stem cell self-renewal. The Journal of Experimental Medicine, 205(6):1395-408, 2008.

Mandal, M, Moran K, Meng F, Liu S, Kinsella M, Clark MR, Tacheuchi O, and Aifantis I. Regulation of lymphocyte survival by the pro-apoptotic activities of Bim and Bid. PNAS, 105(52): 20840-5, 2008.

Buonamici S, Trimarchi T, Klinakis A, Sen F, Reavie L, Meruelo D, Dustin M, Efstratiadis A, Zagzag D, Bromberg J. and Aifantis I. Leukemic cell CNS infiltration is controlled by Notch-induced chemotaxis. Nature, 459(7249): 1000-4, 2009.

Gao J, Graves S, Koch U, Liu S, Jancovic V, El Andaloussi A, Nimer A, Kee B, Taichman R, Radtke F, and Aifantis I. Hedgehog signaling is dispensable for adult hematopoietic stem cell function. CELL Stem Cell, 4(6): 548-58, 2009.

Reavie L, Della Gatta G, Thomson B, Palomero T, Bredemeyer AL, Helmink BA, Zavadil J, Sleckman BP, Ferrando A and Aifantis I. Hematopoietic Stem Cell Quiescence Regulated by a Single Ubiquitin Ligase: Substrate Complex. Nature Immunology, 11:207-215, 2010.

Crusio KM, King B, Reavie LB, and Aifantis I. The ubiquitous nature of cancer: The role of the SCF(Fbw7) complex in development and transformation. Oncogene, 29(35): 4865-73, 2010.

Espinosa L, Cathelin S, D’Altri T, Trimarchi T, Statnikov A, Guiu J, Rodilla V, Ingles-Esteve J, Nomdedeu J, Bellosillo B, Kucine N, Sun S-C, Song G, Mullighan C, Levine RL, Rajewsky K, Aifantis I*, Bigas A*. The Notch/Hes1 pathway sustains NF-kB activation through CYLD repression in T cell leukemia. Cancer CELL, 18(3): 268-81, 2010. (*Dr. Aifantis is the corresponding author and equal senior author).

Klinakis* A, Lobry* C, Abdel-Wahab, Oh P, Haeno H, Buonamici S, van de Walle I, Cathelin S, Trimarchi T, Araldi E, Liu S, Ibrahim S, Beran M, Zavadil J, Efstratiadis A, Taghon T, Michor F, Levine R, and Aifantis I. A novel tumor suppressor function for the Notch pathway in myeloid leukemia. Nature, 473 (7346):230-3, 2011.

Moran-Crusio, K, Reavie L, Shih A, Abdel-Wahab O, Ndiaye-Lobry D, Lobry C, Figueroa ME, Vasanthakumar A, Patel J, Zhao X, Perna F, Pandey S, Song C, He C, Madzo J, Dai C, Ibrahim S, Beran M, Zavadil J, Nimer SD, Melnick A, Godley LA, Aifantis I*, Levine RL*. Tet2 loss leads to increased hematopoietic stem cell self-renewal and myeloid transformation. Cancer CELL, 20(1): 11-24, 2011. (*Dr. Aifantis is the corresponding author and equal senior author).

Cimmino L, Levine RL, and Aifantis I. TETs, regulation of DNA methylation and its role in hematopoietic stem cell differentiation and transformation. CELL Stem Cell, (in press), 2011.

The

Journ

al o

f Exp

erim

enta

l M

edic

ine

ARTICLE

© 2008 Thompson et al.

The Rockefeller University Press $30.00

J. Exp. Med. Vol. 205 No. 6 1395-1408 www.jem.org/cgi/doi/

139510.1084/jem.20080277

All mature blood cells arise from primitive pro-

genitor cells in the BM. These rare and special-

ized cells, called hematopoietic stem cells (HSCs),

exist mostly in a quiescent state ( 1 ). Cell division

of HSCs results in both their progressive prolifer-

ation and diff erentiation into increasingly lineage-

restricted mature blood cells, as well as maintenance

of a small pool of HSCs that do not diff erentiate,

but rather carry out hematopoiesis throughout

the life of an organism ( 2 ). Much work has been

done to elucidate the nature of the signals that

govern the balance between self-renewal and dif-

ferentiation of HSCs. The BM microenviron-

ment in which these cells reside, called the HSC

niche, is thought to nurture this balance by pro-

viding the appropriate signals ( 3, 4 ), but the iden-

tities and precise coordination of these signals

have only recently begun to be understood.

As the entire life of an HSC revolves around

the decisions of whether or not and when to

divide, it is no surprise that several molecules

and signaling pathways that could regulate cell

cycle have been implicated in HSC biology

( 5 – 10 ). For example, the proto-oncogene c-

Myc has been shown to be essential for regulat-

ing both HSC self-renewal and diff erentiation

( 11 ). The eff ects of c-Myc deletion in the BM

are alleviated by simultaneous deletion of the

cell cycle inhibitor p21 ( 12 ), underscoring the

requirement for strict cell cycle regulation to

ensure proper HSC function. Both p21 and c-

Myc are regulated at the transcriptional level

by the Rho GTPase Cdc42, and deletion of

Cdc42 from hematopoietic cells results in in-

creased and decreased levels of c-Myc and p21,

respectively, and allows quiescent HSCs to en-

ter the cell cycle and diff erentiate ( 13 ).

In addition to c-Myc, the Notch pathway has

also been suggested to infl uence HSC function.

Notch1 signaling is essential during hemato-

poiesis for the development of T lymphocytes

( 14, 15 ), but studies of its role in HSCs have

yielded a mixture of results and interpretations. For

example, inhibition of Notch1 signaling in vivo

CORRESPONDENCE

Iannis Aifantis:

[email protected]

Abbreviations used: DN, double

negative; ES, embryonic stem;

ETP, early T cell progenitor;

HSC, hematopoietic stem cell;

LSK, lineage � Sca-1 + c-Kit + ;

LT-HSC; long-term HSC; MP,

myeloid progenitor; SCF, Skp1/

Cul1/F-box protein; T-ALL,

T cell – acute lymphoblastic

leukemia.

The online version of this article contains supplemental material.

Control of hematopoietic stem cell

quiescence by the E3 ubiquitin ligase Fbw7

Benjamin J. Thompson , 1,2,3 Vladimir Jankovic , 4 Jie Gao , 1,2 Silvia Buonamici , 1,2 Alan Vest , 1,2 Jennifer May Lee , 4 Jiri Zavadil , 1,2 Stephen D. Nimer , 4 and Iannis Aifantis 1,2

1 Department of Pathology and 2 NYU Cancer Institute, New York University School of Medicine, New York, NY 10016

3 Medical Scientist Training Program, University of Chicago, Chicago, IL 60637

4 Molecular Pharmacology and Chemistry Program, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center,

New York, NY 10021

Ubiquitination is a posttranslational mechanism that controls diverse cellular processes. We focus here on the ubiquitin ligase Fbw7, a recently identifi ed hematopoietic tumor suppres-sor that can target for degradation several important oncogenes, including Notch1, c-Myc, and cyclin E. We have generated conditional Fbw7 knockout animals and inactivated the gene in hematopoietic stem cells (HSCs), progenitors, and their differentiated progeny. Deletion of Fbw7 specifi cally and rapidly affects hematopoiesis in a cell-autonomous manner. Fbw7 � / � HSCs show defective maintenance of quiescence, leading to impaired self-renewal and a severe loss of competitive repopulating capacity. Furthermore, Fbw7 � / � progenitors are unable to colonize the thymus, leading to a profound depletion of T cell progenitors. Deletion of Fbw7 in bone marrow (BM) stem cells and progenitors leads to the stabilization of c-Myc, a transcription factor previously implicated in HSC self-renewal. On the other hand, neither Notch1 nor cyclin E is visibly stabilized in the BM of Fbw7-defi -cient mice. Gene expression studies of Fbw7 � / � HSCs and hematopoietic progenitors indi-cate that Fbw7 regulates, through the regulation of HSC cycle entry, the transcriptional “ signature ” that is associated with the quiescent, self-renewing HSC phenotype.

1396 HSC REGULATION BY FBW7 | Thompson et al.

lineage � Sca-1 + c-Kit + (LSK) fraction as well as more diff eren-

tiated myeloid progenitors (MPs; lineage � Sca-1 � c-Kit + ), B

cell progenitors (B220 + CD43 + ), and thymic T cell (lineage �

CD44 + 25 + ) progenitors. As shown in Fig. S1 A (available at

http://www.jem.org/cgi/content/full/jem.20080277/DC1),

Fbw7 mRNA expression was high at the LSK stage and de-

creased as the cells diff erentiated into the myeloid lineage

(MP: lineage � c-kit + Sca-1 � ). B cell progenitors expressed

moderate amounts of Fbw7 message, whereas in the thymus,

the fi rst T cell – committed progenitors (CD44 + 25 + ) expressed

high amounts of Fbw7. There was no signifi cant expression

diff erence during CD4 � 8 � to CD4 + 8 + transition. However,

single positive (CD4 or CD8) T cells appear to express lower

levels of Fbw7 message (Fig. S1 B). The levels of Cullin 1,

a partner of Fbw7 for the formation of the SCF complex,

follow similar — although not identical — expression patterns.

Finally, to gain further insight in the putative function of

Fbw7 during early hematopoiesis, we have generated PCR

primers specifi c for the three distinct Fbw7 isoforms. We

were surprised to see that mouse hematopoietic cells express

only the Fbw7 � isoform that is exclusively localized in the

cell nucleoplasm (Fig. S1 C). These studies suggested a dy-

namic control of Fbw7 expression at diff erent stages of hema-

topoietic diff erentiation.

Generation of a conditional Fbw7 allele (Fbw7 f/f ) As the early lethality of the Fbw7 � / � embryos precludes any

study of hematopoietic diff erentiation, we generated an Fbw7-

conditional allele targeting exons 5 and 6, as they encode for

the F-box domain that is essential for SCF assembly ( Fig. 1 A ).

We have used standard embryonic stem (ES) cell – targeting

techniques and “ fl oxed ” these two exons with LoxP sites. We

have also inserted an Frt- “ fl oxed ” Neo mini-gene that was

later deleted ( Fig. 1 B ) from the germline of the generated

chimeric progeny (see Materials and methods). Fbw7 f/f (NEO � )

mice were crossed to the IFN- � (and polyI-polyC) – inducible

Mx1-cre transgenic mouse stain ( 33 ) to generate a model of

inducible Fbw7 deletion (Mx-cre + Fbw7 f/f ). As shown in

Fig. 1 (B and C) , three polyI-polyC intraperitoneal injections

are suffi cient to induce total Fbw7 locus deletion and effi -

ciently silence Fbw7 expression in several lymphoid tissues,

including the BM, the thymus, and the spleen. The deletion

was also total in the BM LSK fraction (see Fig. 8 ).

Deletion of Fbw7 severely affects hematopoietic progenitor maintenance in the BM We focused our initial analysis on the early stages of BM he-

matopoiesis. As early as 2 wk after the end of the polyI-polyC

treatment, there was a signifi cant reduction in the absolute

number of total BM cells ( Fig. 2 A ). We should note here

that control littermates were either Mx-cre + Fbw7 wt/wt or

Mx-cre � Fbw7 f/f mice and were also polyI-polyC injected.

As our goal was to study the potential eff ects of Fbw7 dele-

tion on HSC homeostasis, we turned our attention to the

lineage � compartment. It was immediately obvious that Fbw7

deletion rapidly (at 2 wk after polyI-polyC) and signifi cantly

can deplete the HSC compartment, possibly by promoting their

diff erentiation into more mature, lineage-restricted cells ( 7 ).

Also, Stier et al. ( 16 ) suggested that Notch pathway activa-

tion increases HSC self-renewal in vivo. On the other hand,

several genetic studies questioned the importance of Notch1

signaling at this stage. Initially, deletion of the central Notch

eff ector RBP-J (signal binding protein-J) caused no signifi cant

HSC or progenitor-specifi c phenotypes ( 17 ). Similarly, no gross

hematopoietic defects were reported when either the Notch

ligand Jagged1 or the Notch regulators Numb and Numblike

were conditionally deleted ( 18, 19 ).

Although it is clear that the expression of numerous cell

cycle regulators must be tightly controlled in HSCs to permit

both their self-renewal and diff erentiation, the molecular

pathways that provide such control are mostly unclear. Notch1

and c-Myc, as well as other cell cycle regulators like cyclin E

and c-Jun, are targeted for proteasomal degradation by the E3

ubiquitin ligase, Fbw7 ( 20, 21 ). Fbw7 (also called Fbxw7,

hCDC4, Ago, and SEL-10) is an F-box protein that serves as

a receptor molecule for the Skp1/Cul1/F-box protein (SCF)

ubiquitination complex. Fbw7 binds substrates (e.g., Notch1

and c-Myc) by recognizing a phosphorylated motif (a degron)

via its WD40 repeat domain ( 22 ). Fbw7 is simultaneously

bound via its F-box domain to the adaptor protein Skp1,

which in turn is bound to the RING fi nger protein Rbx1 via

the scaff old protein Cul1, which allows recruitment of target

proteins for poly ubiquitination by an Rbx1-associated ubiq-

uitin-conjugating enzyme (E2) ( 23 ); this marks the target pro-

tein for degradation by the 26S proteasome ( 24 ).

Our laboratory and others have recently shown that inac-

tivating mutations in Fbw7 contribute to the accumulation

of Notch1 and c-Myc in T cell – acute lymphoblastic leuke-

mia (T-ALL) ( 25 – 27 ), and several other studies have estab-

lished Fbw7 as an important tumor suppressor in various tissues

( 28, 29 ). Furthermore, growing evidence suggests that the

ubiquitin – proteasome system plays diverse and essential roles

in stem cell biology ( 30 ). The ability of Fbw7 to antagonize

cell cycle progression via the ubiquitin – proteasome system

prompted us to study the eff ects of deleting it from hemato-

poietic cells. As germline Fbw7 knockout mice die in utero

around day E10.5 due to defects in vascular development

( 31, 32 ), we have generated a conditional allele to allow tis-

sue-specifi c inactivation of Fbw7 on expression of Cre re-

combinase. We report here that loss of Fbw7 function leads

to a severe depletion of the HSC pool and HSC self-renewal

capacity due to the loss of stem cell quiescence. This func-

tional phenotype coincides with a perturbed expression of

critical molecular regulators of cell cycle entry in HSCs and a

profound decrease in the expression of gene transcripts asso-

ciated with the HSC self-renewal phenotype.

RESULTS Fbw7 expression patterns during early hematopoietic differentiation To study the pattern of Fbw7 expression during early hema-

topoiesis, we have initially purified the HSC-containing

JEM VOL. 205, June 9, 2008

ARTICLE

1397

( Fig. 2 C ) was also decreased. Further subdivision of the LSK

fraction to long-term HSC (LT-HSC), short-term HSC, and

multipotential progenitors (using a combination of CD34

and c-kit staining) did not reveal any subset-specifi c eff ects but

suggested a more general eff ect on LSK homeostasis ( Fig. 2 D ).

As a consequence of the HSC defect, absolute numbers of all

BM-mature lineages, including the numbers of immature

(B220 + IgM + ) and mature B cells, were also signifi cantly de-

creased ( Fig. 2 F ). These fi ndings strongly suggested that

Fbw7 deletion could aff ect LSK cell self-renewal and/or dif-

ferentiation in the BM.

Deletion of Fbw7 severely affects progenitor maintenance in the thymus As LSKs have been shown to represent the major thymus-

colonizing population, we analyzed the thymus after Fbw7

deletion and found no signifi cant change in total thymocyte

numbers 2 wk after polyI-polyC deletion ( Fig. 3 A ). How-

ever, at later time points (4 wk after polyI-polyC) Mx-cre +

Fbw7 f/f thymocyte numbers were signifi cantly decreased

( Fig. 3 A ). Notch1 appeared to be the main Fbw7 substrate in

the thymus, as its deletion led to a signifi cant accumulation

of intracellular Notch1 protein as detected by two diff erent

Notch1-specifi c antibodies (Fig. S2 A, available at http://

www.jem.org/cgi/content/full/jem.20080277/DC1). This

fi nding was consistent with our recent identifi cation of Notch1

as a substrate of Fbw7 in T cells. Supporting this observation,

Deltex1 transcription, a reliable Notch1 reporter, was signifi -

cantly up-regulated in Mx-cre + Fbw7 f/f thymi (Fig. S2 B). On

the other hand, other putative Fbw7 substrates like c-Myc or

cyclin E were not signifi cantly stabilized in total Mx-cre +

Fbw7 f/f thymocytes at this specifi c time point (Fig. S2 A).

As evident from Fig. 3 B , Fbw7 deletion appeared to sig-

nifi cantly aff ect the most immature (CD4 � 8 � ) thymocytes as

both their frequency and their absolute numbers decreased

two- to sixfold ( Fig. 3, B and C ). As this CD4 � 8 � double

negative (DN) population includes the most immature T cell

progenitors, we have further subdivided this subset using an-

tibodies against CD25, CD44, and c-kit. This analysis re-

vealed an almost complete absence of both DN2 (CD25 + 44 + )

and DN3 CD44 � 25 + thymocytes ( Fig. 3, D and E ). These

phenotypes depended on the timing of the deletion mediated

by the Mx1 promoter that is active both in thymocytes and

their immediate BM progenitors. Indeed, when we deleted

Fbw7 only in developing thymocytes using the Lck promoter

( 34 ) (Lck-cre + Fbw7 f/f ), none of these DN cell – specifi c phe-

notypes were obvious ( Fig. 3 F and Fig. S3 A). This could be

explained by the later Fbw7 gene deletion in the Lck-cre model

(Fig. S3 B). 4-wk-old Lck-cre + Fbw7 f/f mice had thymocyte

numbers similar to Lck-cre + Fbw7 wt/wt control littermates, and

almost 50% of them developed T cell lymphomas later in life

(unpublished data and reference 35 ). Both Notch1 and c-Myc

appeared to be stabilized in the thymi of these mice. Notch1

was also stabilized in immature CD4 � 8 � thymocytes (not de-

picted). To further investigate the hypothesis that the thymic

phenotype was at least partially due to the decreased number

aff ected LSK frequency. Most importantly, absolute num-

bers of LSK cells decreased three- to fi vefold ( Fig. 2 B ). A

signifi cant decrease in the numbers of the fi rst MPs (lineage �

Sca-1 � c-Kit + ) was also seen, but there were no signifi cant

diff erences in the relative abundance of common, mega-

karyocyte-erythrocyte, and granulocyte-monocyte progeni-

tors ( Fig. 2 E ). In agreement with these fi ndings, the LSK

frequency in the peripheral blood (not depicted) and spleen

Figure 1. Generation of a conditional Fbw7 allele. (A) Targeting

strategy showing exons 4 – 7 of the mouse genomic Fbw7 locus before

targeting (WT allele) and after homologous recombination in C57BL/6 ×

129 ES cells (targeted allele), which introduces an FRT- and LoxP-fl anked

PGK-Neo cassette between exons 6 and 7, and fl anks exons 5 and 6 with

LoxP sites. Germline removal of the PGK-Neo cassette using the FLPe-

deleter strain and subsequent exposure to Cre recombinase results in exci-

sion of exons 5 and 6 and generates the conditional knockout (CKO) allele.

Arrows show locations of primers (A – D) used to genotype resulting mice.

(B) Before crossing to the FLPe-deleter strain, PCR using primers C and D

were used to confi rm transmission of the targeted allele (not depicted).

After removal of the PGK-Neo cassette, primers B and C were used to

detect both the “ fl oxed ” and WT alleles (497 and 315 bp, respectively).

After induction of Mx-Cre with polyI-polyC injections, the fl oxed band was

lost from the BM and thymus, and excision of exons 5 and 6 in these tis-

sues was confi rmed by PCR using primers A and C, which amplify 662 bp

from the CKO allele. (C) Loss of WT Fbw7 expression was confi rmed by

quantitative RT-PCR using the same primers as in panel A, which are lo-

cated in exons 4 and 5. Error bars show the SD of duplicate wells.


the BM HSC niche), we have tested whether the reported

phenotypes were cell autonomous. We used a competitive

transplantation assay mixing Mx-cre + Fbw7 f/f or Mx-cre +

Fbw7 wt/wt CD45.2 + BM cells (from polyI-polyC – injected

mice) with CD45.1 + WT cells. At the time of the injec-

tion, we had normalized for absolute numbers of LSK cells

and injected � 10 3 LSK cells from each genotype. These cells

were transplanted in irradiated CD45.1 hosts, and chimerism

was studied 5 wk later. We should note here that in this as-

say we expected < 50% CD45.2 chimerism due to the exis-

tence of endogenous, host-derived CD45.1 + cells. The exact

CD45.2 chimerism depended on the injection effi ciency and

in our hands varied from 10 to 45%. Indeed, although Mx-

cre + Fbw7 wt/wt cells effi ciently competed (generating > 40%

of entering BM stem and progenitor cells, we have quantifi ed

the absolute number of the fi rst thymic immigrants (early T

cell progenitors [ETPs], defi ned as lineage � CD25 � c-kit high

cells) in the thymi of control and mutant mice 2 and 4 wk af-

ter polyI-polyC injection. As shown in Fig. 3 G , ETP num-

bers were signifi cantly decreased upon Fbw7 deletion at both

time points. Our studies demonstrated that deletion of Fbw7

using the Mx-cre + Fbw7 f/f model severely aff ects lymphocyte

development in the thymus.

Loss of Fbw7 leads to a cell-autonomous defect of stem cell self-renewal As the Mx1 promoter is IFN- � responsive and can drive cre-

recombinase expression in nonhematopoietic lineages (e.g.,

Figure 2. Fbw7 deletion leads to a depletion of BM hematopoietic progenitors. (A) Absolute numbers of BM cells in polyI-polyC – injected control

(Fbw7 f/f , MxCre � ) and CKO (Fbw7 f/f , MxCre + ) mice 2 wk after polyI-polyC deletion are shown. (B) Lin � BM cells were stained for c-kit and Sca-1 to mark the

LSK population (dot plot), and absolute LSK numbers (histogram) were calculated (also at 2 wk after polyI-polyC). (C) Quantitation of peripheral (spleen)

LSKs 2 wk after polyI-polyC injection. P < 0.05. (D and E) Absence of enhanced rates of apoptosis as defi ned by a combination of 7-AAD/annexin V staining

in either total BM of LSK cells (3 wk after polyI-polyC injection). (F) LSK cells were analyzed by FACS for CD34 expression to separate long-term (LT, CD34 � )

from short-term (ST, CD34 + ) HSCs. (G) MPs (Lin � /Sca-1 � /c-kit + ) were analyzed by FACS for CD34 and Fc � RII/III expression to show common MPs (CMP,

CD34 + / Fc � RII/III � ; bottom right gate), granulocyte/macrophage progenitors (GMP, CD34 + / Fc � RII/III + ; top right gate), and megakaryocyte/erythroid pro-

genitors (MEP, CD34 lo / Fc � RII/III � ; bottom left gate). (H) Absolute number of mature (IgM + /B220 hi ) and immature (IgM + /B220 + ) BM B cells are shown (2 wk

after polyI-polyC). Error bars show the SD. Numbers indicate the percentage of cells in each gate. *, P < 0.05; **, P < 0.005. For all experiments, n = 8.

JEM VOL. 205, June 9, 2008

ARTICLE

1399

into irradiated CD45.1 hosts and documented chimerism 3 wk

later. Only after transplant did we inject the recipients with

polyI-polyC (three times) to delete the Fbw7 locus. 7 wk af-

ter polyI-polyC injection, we found no (or very few) mature

donor-derived Fbw7 � / � cells (thymocytes, B cells, Mac1 + ,

NK1.1 + , and Gr-1 + cells), including BM LSK (Fig. S4, available

at http://www.jem.org/cgi/content/full/jem.20080277/DC1).

These combined transplantation results strongly demonstrated

that the Fbw7 deletion-induced phenotype is cell autonomous

and is not due to the inability of Fbw7 LSK to home to the

marrow niche.

Deletion of Fbw7 leads to defective HSC quiescence and self-renewal To begin understanding the molecular mechanism behind the

HSC defect caused by the deletion of Fbw7, we initially stud-

ied LSK survival in the BM of polyI-polyC – injected animals

(at 2, 3, and 4 wk after injection). No signifi cant diff erences

in the percentage of apoptotic LSK in polyI-polyC – injected

littermate mice (Mx-cre + Fbw7 f/f , Mx-cre + Fbw7 wt/wt , or Mx-

cre + Fbw7 f/w ) were observed at 3 wk after polyI-polyC ( Fig. 2 ),

chimerism) with CD45.1 BM, Mx-cre + Fbw7 f/f cells gener-

ated only minimal chimerism in the spleen, thymus, and BM

of the recipient animals, suggesting a very severe defect in

their ability to diff erentiate and replenish the hematopoietic

and immune systems ( Fig. 4 A ). Interestingly, when we stud-

ied chimerism in the LSK compartment we found almost no

Fbw7 � / � LSK cells ( Fig. 4 B ). Similarly, in the BM, < 3% of

total BM mononuclear cells derived from Fbw7 � / � progen-

itors. Very few of these cells managed to properly diff erenti-

ate toward the myeloid (not depicted) or B cell lineage ( Fig.

4 C ). Moreover, < 0.1% of total donor-derived thymocytes

originated from Fbw7 � / � BM. Once more, these cells failed

to diff erentiate to the CD4 + 8 + stage, and the vast majority

belonged to the early CD44 + 25 + DN1 stage ( Fig. 4, D and E ).

These experiments demonstrated that Fbw7 � / � stem cells were

unable to compete with WT counterparts.

As the previous results could also be explained by altered

the homing ability of HSCs upon Fbw7 deletion, we altered our

transplantation protocol so that we transplanted 0.5 × 10 6 non-

polyI-polyC – injected (Mx-cre + Fbw7 f/f or Mx-cre + Fbw7 wt/wt )

CD45.2 + BM cells with an equal number of CD45.1 + WT cells

Figure 3. Loss of Fbw7 severely impairs early T cell development. (A) Absolute numbers of thymocytes (left, 2 wk after polyI-polyC; right, 4 wk

after polyI-polyC) were counted from control ( n = 8) and CKO ( n = 8) mice and analyzed by FACS for CD4 and CD8 expression (B). (C) Absolute numbers

of CD4 � 8 � DN cells (2 wk after polyI-polyC). (D) DN cells were separated into DN1 – 4 populations by staining for CD44 and CD25. (E) Absolute numbers

of DN2 (CD44 + /CD25 + ) and DN3 (CD44 � /CD25 + ) (2 wk after polyI-polyC). (F) DN thymocytes were analyzed as in D in control (Fbw7 f/f , LckCre � ) and CKO

(Fbw7 f/f , LckCre + ) mice. Error bars show the SD. Numbers indicate the percentage of cells in each gate. **, P < 0.005. n = 6. (G) Absolute numbers of ETP

(Lin � CD25 � CD44 + c-kit + ) cells 2 and 4 wk after polyI-polyC injection. *, P < 0.05. n = 4.


We then asked whether this loss of quiescence translates to

defective HSC self-renewal or diff erentiation. We used colony-

forming cell assays and initially plated total BM from polyI-

polyC – treated Mx-cre + Fbw7 wt/wt or Mx-cre + Fbw7 f/f animals

and incubated them in semi-solid methylcellulose medium

in the presence of a suitable cytokine cocktail. As shown in

Fig. 5 C , Mx-cre + Fbw7 f/f cells generated only half the number

of colonies compared with Mx-cre + Fbw7 wt/wt progenitors.

Also, these colonies were signifi cantly smaller in size ( Fig. 5 E ).

We then performed similar experiments using highly enriched

CD34 � LT-HSCs. Interestingly, during the initial plating no

diff erences in the absolute numbers of colonies were recorded.

However, the replating of colonies that originated from Mx-

cre + Fbw7 f/f LT-HSCs showed a complete loss of self-renewal

capacity ( Fig. 5 D ) in agreement with our in vivo competitive

reconstitution assays ( Fig. 4 ). These observations clearly showed

that Fbw7 deletion promotes aberrant cell cycle entry and loss

of self-renewal.

BM Fbw7 deletion leads to c-Myc protein stabilization As Fbw7 is able to ubiquitinate and degrade several target

proteins, we performed an initial protein expression screening

of three well-characterized substrates, Notch1, c-Myc, and

cyclin E ( Fig. 6 ). We were unable to detect signifi cant ex-

pression and stabilization of either Notch1 or cyclin E in total

BM cells. This result was not surprising, as Notch1 mRNA is

arguing against the involvement of the SCF Fbw7 complex in

LSK survival.

To address the eff ect of Fbw7 deletion on stem cell pro-

liferation, we used Ki67 and DAPI labeling to determine

the cell cycle status of LSK cells. The percentage of Mx-

cre + Fbw7 f/f LSK cells that passed the G0-G1 checkpoint

and entered cycle was consistently and signifi cantly elevated

when compared with Mx-cre + Fbw7 wt/wt counterparts ( Fig. 5 A ).

Interestingly, these eff ects appear to be LSK specifi c, as more

diff erentiated cell populations (MPs, T cell progenitors, CD4 + 8 +

thymocytes) do not show similar cell cycle acceleration

(Fig. S5, available at http://www.jem.org/cgi/content/full/

jem.20080277/DC1). To further support these fi ndings, we

have used a short (42-h) pulse of BrdU to mark cells that

escape quiescence and enter the cell cycle, and subdivided

the LSK compartment into CD34 � (self-renewing LT-HSC)

and CD34 + (non-self – renewing short-term – HSC and MPP)

subsets. As evident from Fig. 5 B , Fbw7 � / � LT-HSCs showed

a dramatic loss of quiescence, as almost 80% of them en-

tered cell cycle during the 42 h from the initiation of the

BrdU pulse. CD34 + LSK cells also showed a signifi cantly

elevated fraction of BrdU + cells. We should also note here

that LSK cycle deregulation was evident even in marrows with

less signifi cant alterations in LSK or total cell numbers, suggest-

ing that the functional changes preceded the phenotypic ones

(not depicted).

Figure 4. Loss of Fbw7 leads to a cell-autonomous defect of HSC self-renewal. (A) 0.5 × 10 6 WT CD45.1 BM cells were injected into lethally ir-

radiated WT Ly 5.1 + host mice ( n = 3 for each experiment) with the same number of either control CD45.2 or CKO (Mx1-cre + Fbw7 f/f ) CD45.2 BM cells.

The mice were analyzed 5 wk later for reconstitution of the BM, thymus, and spleen by staining cells from each tissue for both CD45.1 and CD45.2.

The percent contribution of each donor to those organs is shown. CD45.2-gated cells from recipient mice were analyzed by FACS for expression of CD4,

CD8, CD44, and CD25 in the thymus (D and E), B220/IgM (C), and LSK markers (B) in the BM. The cells in E are gated on the thymic Lin � population.

Numbers indicate the percentage of cells in each gate.

JEM VOL. 205, June 9, 2008

ARTICLE

1401

cells from polyI-polyC – injected Mx-cre + Fbw7 f/f mice (and

Mx-cre + Fbw7 wt/wt controls). We placed these cells in a liquid

culture in the presence of cytokines as shown in Fig. 7 . Once

more, we have detected no stabilization of either Notch1

or cyclin E (not depicted). On the other hand, c-Myc pro-

tein was substantially overexpressed (almost threefold). Also,

the accumulated c-Myc protein was phosphorylated on the

T58 and S62 residues, in agreement with the idea that phos-

pho species of the c-Myc substrate should accumulate in

the absence of proteasomal degradation ( Fig. 6 B ). Further

quantitative RT-PCR experiments have proven that the

c-Myc stabilization was due to posttranslational modifi cation

( Fig. 6 C ). This c-Myc stabilization was persistent between

diff erent experiments. These results ( Fig. 6 C ) suggested that

Fbw7 deletion in stem cell and progenitor populations led to

a signifi cant stabilization of c-Myc but not Notch1 or cyclin

E proteins.

Dynamic regulation of Fbw7 expression during HSC cycle entry and differentiation Previously presented results suggest that Fbw7 is an HSC

cycle entry “ brake ” and that its deletion aff ects HSC quies-

cence. In agreement with this scenario, Fbw7 expression is

signifi cantly down-regulated as LSKs diff erentiate to become

not expressed in mature myeloid/erythroid/B cells that com-

prise the vast majority of the marrow. Also, cyclin E is ex-

pressed in a small fraction of actively cycling progenitors ( 36 ).

Similarly, c-Myc expression was diffi cult to detect ( Fig. 6 A ).

Once more, this was an anticipated fi nding, as c-Myc is only

expressed in a small fraction of BM cells (unpublished data).

These observations suggested that we should focus our

attention on the small fraction of BM cells that includes puta-

tive stem cells and progenitors. We have thus sorted LSK

Figure 5. Deletion of Fbw7 leads to defective HSC quiescence and self-renewal. (A) LSK control and Mx1-cre + Fbw7 f/f (CKO) mice were fur-

ther analyzed for DNA content (DAPI) and intracellular Ki-67 expression

(2 wk after polyI-polyC). Quadrants correspond to cell cycle stages as shown

in the left panel. The percentage of LSK cells in G0 stage is also shown

( n = 6), (B) BrdU labeling of the CD34 � and CD34 + LSK subsets ( n = 4)

(2 wk after polyI-polyC). (C) 25,000 total BM cells from control or CKO mice

were plated in methylcelluose medium containing a multilineage cytokine

cocktail. The number of colonies and their qualitative morphologies were

determined 8 d later. (D) The same experiment as in C was performed,

except plating 500 fl ow-purifi ed LT-HSCs per plate. After 7 d, the colonies

were counted (fi rst plating). The colonies from each plate were pooled

and resuspended in PBS, and 2,000 of those cells were replated for an

additional 7 d before counting colonies again (second plating). Numbers

indicate the percentage of cells in each gate. (E) Photographs of repre-

sentative colonies from C (fi rst plating) show the relative size difference

between control- and CKO-derived colonies. Bar, 0.5 mm. These are

representatives of at least three individual experiments. *, P < 0.05;

**, P < 0.005.

Figure 6. Effects of Fbw7 deletion on target protein stabilization in the BM. (A) Western blot detecting expression of Notch1-IC, un-

cleaved membrane Notch1 (Notch1-TM), c-Myc, cyclin E, and b-actin in

total BM extracts. (B) Expression of c-Myc in cytokine-stimulated BM

progenitors. Lineage � IL-7R � � Sca-1 high c-kit high cells from control and CKO

(Mx-cre + Fbw7 fl ox/fl ox ) mice were cultured for 48 h in the presence of cyto-

kines. c-Myc expression was quantifi ed using densitometry and actin

normalization. Phospho – c-Myc (T58/S62) and actin levels are also shown.

A representative of three experiments is shown. (C) Quantitative RT-PCR

quantifying expression of Fbw7 and c-Myc in the cells used in B. Ex-

pression is normalized using b-actin.


Fbw7 controls a gene program that correlates with HSC quiescence and self-renewal To further characterize the molecular mechanism of Fbw7

function in the diff erentiation and homeostasis of HSCs, we

have performed a whole transcriptome analysis. We have used

FACS-purifi ed lineage � IL7R � � c-kit high Sca-1 high stem/multi-

lineage progenitors (LSK) and lineage � IL7R � � c-kit high Sca-1 �

MPs from polyI-polyC – injected pooled Mx-cre + Fbw7 f/f and

Mx-cre + Fbw7 wt/wt littermate mice, extracted total RNA, and

used it for microarray analysis. Both the array analysis (not

depicted) and quantitative RT-PCR ( Fig. 8 A ) showed that

deletion of the Fbw7 locus and silencing of its expression in

the LSK and MP compartments used for these experiments

were complete.

We have performed an analysis of genes that showed a

greater than or equal to threefold diff erence in expression be-

tween the control and Fbw7 � / � LSK cells. This analysis dem-

onstrated that Fbw7 � / � LSK cells were more closely related

to the diff erentiated MP populations than the control LSK

subset (not depicted). The combination of published studies

( 37 – 40 ) and our own results (Table S1, available at http://

www.jem.org/cgi/content/full/jem.20080277/DC1, and

unpublished data) suggested a partial transcriptional “ signa-

ture ” associated with the LT-HSC phenotype. These tran-

scripts are enriched in LT-HSCs and down-regulated upon

the loss of self-renewal properties. We thus hypothesized

that the transcriptional signature of Fbw7 deletion in HSCs

contains the features of the physiological loss of stem cell phe-

notype associated with the commitment to the transiently

amplifying progenitor fate. Such a hypothesis was supported

by the identities of genes specifi cally aff ected by Fbw7 dele-

tion in the LSK compartment (not depicted), including Evi1 ,

Mpl , p57 , Agpt , Eya1/2 , Pbx3 , and Meis1 , which were all

previously shown to be enriched in self-renewing HSCs

(Table S1). These results were further verifi ed using quantitative

RT-PCR analysis of distinct biological samples ( Fig. 8 B ) and

were perfectly in line with the presented phenotypic results,

which suggested a loss of HSC quiescence and self-renewal

capacity upon Fbw7 deletion. Importantly, the observed global

loss of HSC-specifi c transcriptional signature was not an artifact

from contaminating Sca-1 low/ � cells, as the Ly6A (Sca-1) – spe-

cifi c signal was even slightly higher in the Fbw7 � / � compared

with the control LSK sample (not depicted).

This loss of “ LT-HSC – specifi c ” gene expression was ac-

companied by the activation of a more diff erentiated gene

expression program in cells that lose Fbw7 expression. In-

deed, several genes suggesting an erythro-myeloid and lym-

phoid priming ( 38 ) were up-regulated upon Fbw7 loss (i.e.,

glycophorin A, CD36, neutrophil elastase, Rag-1, etc.; not

depicted). This is consistent with the presented expression

analysis data that show that Fbw7 mRNA expression decreases

during the transition of undiff erentiated LSK cells to the

committed progenitor stage, which could be a functional part

of the early HSC diff erentiation program.

Finally, we have searched for genes that could explain the

loss of stem cell quiescence upon Fbw7 deletion. As shown in

MPs (Fig. S1). To further understand the role of Fbw7 dur-

ing physiological HSC proliferation and diff erentiation, we

purifi ed LSK cells and placed them in cytokine-driven in

vitro cultures. Before the cytokine stimulation (day 0), al-

most 60% of the cells were in G0. Upon stimulation, cells

rapidly entered cycle with only 2 – 3% of cells in G0 at day 2

( Fig. 7 A ). Fbw7 expression declined signifi cantly in response

to cytokine stimulation, and Cul1 expression followed an

identical pattern ( Fig. 7 B ). Although these results suggested

that Fbw7 expression is dynamically regulated at the HSC

stage, it is diffi cult to uncouple proliferation from diff eren-

tiation-triggered eff ects. We further quantifi ed cell diff eren-

tiation by measuring the proportion of cells that lost Sca-1

expression. As shown in Fig. 7 C , at day 1 almost 80% of the

cells retained their c-kit + Sca-1 + phenotype, whereas Fbw7

expression was decreased three- to fourfold. Although eff ects

of diff erentiation are not excluded, this observation suggested

that Fbw7 message expression is down-regulated as HSCs

enter cell cycle.

Figure 7. Dynamic regulation of Fbw7 expression during HSC cycle entry and differentiation. (A) Flow-purifi ed LSK cells were cultured with

cytokines for 0, 1, or 2 d and were stained for intracellular Ki-67 and DNA

content (DAPI). (B) Fbw7 and Cul1 mRNA expression were analyzed by

quantitative RT-PCR on each day. (C) Quantifi cation of Sca-1 expression

(loss of Sca-1 indicates differentiation of LSK cells) after each day of cul-

ture. On day 0, all cells are Sca-1 + .

JEM VOL. 205, June 9, 2008

ARTICLE

1403

been previously suggested to be targets of c-Myc, supporting

our view that c-Myc overexpression could be an important

regulator of cell cycle entry downstream of Fbw7 ( 41 – 43 ).

The presented expression studies provide a very strong mecha-

nistic basis that explains the phenotypic and functional eff ects

of Fbw7 deletion on HSC quiescence and self-renewal.

DISCUSSION In this report we demonstrate that a single E3 ubiquitin li-

gase, Fbw7, is an essential regulator of HSC quiescence and

Fig. 8 C , several cell cycle regulators, including p27, p21, and

Ccnd2/3, were unaff ected by the deletion of Fbw7. However,

the expression of three cell cycle – related genes was altered in

response to Fbw7 silencing. The cyclin kinase inhibitor p57 kip2 ,

previously implicated in loss of quiescence of stem cells ( 38 ),

was down-regulated in Mx-cre + Fbw7 f/f LSK cells. On the

other hand, the cell cycle regulator E2F2 was signifi cantly up-

regulated upon Fbw7 loss. Finally, the D-type cyclin Ccnd1

was up-regulated after Fbw7 gene excision, in agreement with

its role in HSC cycle entry. Interestingly, all three genes have

Figure 8. Fbw7 controls genes that correlate with HSC quiescence and self-renewal. (A) Effi cient silencing of Fbw7 expression in LSK cells and

MPs in response to polyI-polyC treatment (at 2 wk after treatment). (B) Quantitative RT-PCR validation of genes selected from the microarray using

mRNA from a different sorting experiment. The plotted expression values represent the relative mRNA level of each sample normalized to the median

expression across all samples. (C) Quantitative RT-PCR analysis of the expression of multiple cell cycle – related genes in control (Mx-cre + Fbw7 +/+ ) and CKO

(Mx-cre + Fbw7 fl /fl ) LSK cells.


ligases on HSC function is scarce and indirect. Studies using

a panel of chemical proteasome inhibitors have shown that

suppression of proteasome function induced cell death in

human CD34 + hematopoietic progenitors ( 48 ). Moreover,

primary CD34 + leukemic stem cells also enter apoptosis in

response to treatment with the MG-132 proteasome inhibi-

tor ( 49 ). However, these were crude experiments that cannot

address the complexity of regulation of proteasome function

in HSCs by the diff erent ubiquitin ligase complexes. Experi-

ments similar to the ones described in this report, which

include E3 ligase expression mapping and gene-targeting ex-

periments, are thus essential for the detailed understanding of

the importance of ubiquitination in HSC function.

Multiple protein substrates of Fbw7 have been identifi ed.

These include the cell cycle regulator cyclin E and transcrip-

tion factors such as c-Myc and Notch ( 50 ) that could directly

or indirectly regulate stem cell function. Our protein expres-

sion analyses showed no stabilization of Notch1 in the BM of

Mx-cre + Fbw7 f/f mice. In fact, we were unable to detect any

Notch1-IC protein expression at all. This was not due to any

technical obstacle, as Notch1 was signifi cantly stabilized and

overexpressed in the thymus of these mice. Also, we were

unable to detect CD4 + 8 + cells in the Fbw7 � / � BM (not

depicted), usually a reliable and rapid indicator of aberrant

Notch activation ( 51, 52 ). However, we cannot exclude that

Notch stabilization occurs in a small fraction of LSK cells, and

this change in protein expression is below the sensitivity of

the experimental method used. Indeed, Matsuoka et al. ( 44 )

detected Notch1 overexpression using confocal microscopy

of individual Fbw7 � / � LSK cells. In agreement with these

results, our RT-PCR analysis of Fbw7 � / � LSK cells has re-

vealed a persistent overexpression of Hes-1 and Deltex-1, both

well-characterized targets of the Notch pathway ( Fig. 8 C ).

Similar studies excluded a role for stabilization of another

Fbw7 substrate, cyclin E. Indeed, we were unable to detect

any signifi cant cyclin E stabilization in response to Fbw7

deletion in either total BM cells or purifi ed stem cell and

progenitor populations. These fi ndings are consistent with

genetic experiments reported by Loeb et al. ( 51 ). These in-

vestigators have generated “ knock-in ” mice that express a

mutated cyclin E, cyclin E T393A . T393 falls within a canonical

Fbw7 recognition degron, and its phosphorylation allows

Fbw7 to bind and ubiquitinate cyclin E. Mutated cyclin E

was stabilized and expressed at levels several-fold higher in

several tissues, including lymphocytes and thymocytes. De-

spite this overexpression, cyclin E T393A – homozygous mice

showed no phenotypic abnormalities in all tissues examined,

including the immune system. They also displayed a normal

life span with no signifi cant predisposition to autoimmune

disease or tumor induction. Together with our protein ex-

pression analyses, these elegant genetic studies argue against a

role of cyclin E stabilization in HSC function in response to

Fbw7 deletion.

On the other hand, our studies suggested that c-Myc

could be an attractive target, especially because it was pre-

viously shown to be involved in HSC diff erentiation ( 11 ).

self-renewal. Fbw7 is expressed in quiescent HSCs, and its

expression is down-regulated upon the loss of their self-

renewing capacity. These eff ects are cell autonomous, as

Fbw7 � / � LSKs are unable to compete with WT counterparts

both in vitro and in vivo. The loss of LSK absolute numbers

and self-renewal abilities are also refl ected at the early stages

of lymphopoiesis, as Mx-cre + Fbw7 f/f mice have lower num-

bers of B cell, and almost no T cell, progenitors. To mecha-

nistically explain these LSK phenotypes, we have performed

comparative gene expression studies using Fbw7 � / � stem

cells and MPs. These studies demonstrated that Fbw7 dele-

tion targets specifi c cell cycle regulators and suppresses the ex-

pression of several genes previously suggested to control HSC

function. Thus, we have identifi ed a novel function for the

proteasome – ubiquitin ligase complex as a genetic “ switch ”

that controls HSC cycle entry and self-renewal.

Our studies are in agreement with a recent report by

Matsuoka et al. ( 44 ). These investigators also demonstrate

that Fbw7 is essential to maintain HSC quiescence and self-

renewal, and suggest that c-Myc is a key Fbw7 substrate in

HSCs. They also report that Fbw7 � / � animals die by either

extreme pancytopenia at 12 wk after polyI-polyC injection

or by T-ALL. Development of T-ALL was a later event,

as disease appeared only after 16 wk after treatment. Only

very few ( n = 2) of our polyI-polyC – injected Fbw7 f/f ani-

mals were allowed to reach these time points, and all devel-

oped pancytopenia. Thus, we cannot directly compare rates

of T-ALL induction, as all other polyI-polyC – injected ani-

mals presented in this study were analyzed at very early time

points. However, both Fbw7-targeted animals developed T-

ALL with similar kinetics when crossed to the Lck-cre strain

(unpublished data and reference 35 ). A discrepancy between

the two studies exists over the detection of apoptosis in

Fbw7 � / � LSK cells. However, Matsuoka et al. ( 44 ) reported

elevated percentages of apoptosis only in HSCs purifi ed

from the marrows of severely cytopenic mice 12 wk after

deletion. In the studies presented here, the analysis was per-

formed using LSK cells purifi ed from noncytopenic Fbw7 � / �

mice 3 wk after polyI-polyC deletion. At that time point

there was a signifi cant alteration of HSC quiescence and a

reduction of LSK (and LT-HSC) absolute cell numbers. In

agreement with our fi ndings, Matsuoka et al. ( 44 ) failed to

detect an increased frequency of apoptosis in HSCs puri-

fi ed from the BM of noncytopenic animals, even at 12 wk

after deletion.

There are few other examples of stem cell function or

diff erentiation being regulated by specifi c E3 ubiquitin ligases

( 30 ). Initially, the UBR1/2 E3 ligases were shown to be es-

sential for neurogenesis due to their eff ects on the diff erentia-

tion and survival of neural stem cells and progenitors ( 45 ).

Also, in the neural system, the Mindbomb1 ligase regulates

expression of Notch ligands and consequently controls dif-

ferentiation of neural stem cells ( 46 ). Finally, DDB1, an E3

ligase member of the cullin4A complex, is important for the

viability, genomic integrity, and maintenance of neural stem

cells ( 47 ). Information on the role of any of the multiple E3

JEM VOL. 205, June 9, 2008

ARTICLE

1405

clone using homologous recombination. The region was designed such that

the short homology arm extends 2.4 kb 5 � to loxP/FTR-fl anked NEO cas-

sette. The long homology arm ends on the 3 � side of the loxP/FRT NEO

cassette and was � 8-kb long. A single lox P site was inserted upstream of

exon 5. The target region was 2.1 kb and included exons 5 and 6. The back-

bone vector was � 2.1 kb and contained an ampicillin selection cassette. The

total size of the targeting construct (including the vector backbone) was

� 16 kb. The targeting vector was linearized using NotI and electroporated

into 129 Sv/En × C57BL6 hybrid ES cells. After G418 selection, surviving

clones were expanded for PCR analysis to identify recombinant ES cell

clones. Oligos for ES cell screening and PCR conditions are available upon

request. Five correctly targeted ES cell clones were expanded for microin-

jection into blastocysts. Strong chimeras were identifi ed and crossed to

C57BL6 females to verify germline transmission. The F1 generation was

PCR screened and crossed to FLP recombinase – expressing mice (Jax mice)

to delete the Frt-fl anked Neo Cassette. Fbw7 fl ox/Neo � mice were conse-

quently crossed to Mx1-cre and Lck-cre mice.

For our polyI-polyC experiments, we injected 20 μ g polyI-polyC per

gram of body weight. We initiated injections 2 wk after birth. Mice were

injected once every other day for a total of three injections. They were ana-

lyzed 1, 2, and 4 wk after injection. All animal experiments were approved

by the IACUC of the NYU School of Medicine.

Transplantation assays. For the experiment shown in Fig. 4 , we have

mixed BM from either CD45.2 Mx-cre + Fbw7 wt/wt or CD45.2 Mx-cre + Fbw7 f/f

mice (2 wk after the end of polyI-polyC treatment) with WT CD45.1 cells.

We normalized for absolute numbers of LSK cells in each marrow such that

we injected 1,000 LSK cells from each genotype. The cells were injected in

lethally (900 rad) irradiated CD45.1 congenic H57BL6 recipients. We ana-

lyzed chimerism 5 wk after transplant.

For the experiment shown in Fig. S4, we mixed (50:50) nonpolyI-

polyC – injected whole BM cells (CD45.2 Mx-cre + Fbw7 wt/wt or CD45.2

Mx-cre + Fbw7 f/f with WT CD45.1 cells). After we verifi ed chimerism from

both CD45.1/2 donors (using peripheral blood FACS analysis), we began

polyI-polyC injections (three). Chimerism was studied 7 wk after the end of

the polyI-polyC treatment.

Genotyping and genomic PCR. Mouse tails were clipped at 1 – 2 wk

of age and incubated in tail lysis buff er for 12 – 24 h at 55 ° C. 6M NaCl was

added, insoluble debris was pelleted, and DNA was precipitated with iso-

propanol. The resulting DNA pellets were washed with 70% ethanol and

dissolved in water for PCR analysis. Genomic DNA from BM and thymo-

cytes was prepared by lysing the cells in a solution containing 0.03% NP-40,

0.03% Tween 20, and 7 μ g/ml proteinase K for 30 min at 55 ° C, followed

by 10 min at 100 ° C. This solution was used directly for PCR. Primers were

designed to selectively amplify WT, targeted (Neo+), targeted (Neo � ), and

CKO Fbw7 alleles as shown in Fig. 2 . The sequences are as follows: A F,

5 � -GGCTTAGCATATCAGCTATGG; B F, 5 � -ATTGATACAAACTG-

GAGACGAGG; C R, 5 � -ATAGTAATCCTCCTGCCTTGGC; and D

F, 5 � -TGCGAGGCCAGAGGCCACTTGTGTAGC. MxCre and LckCre

transgenes were detected using the following primers: Cre F, 5 � - GCG-

GTCTGGCAGTAAAAACTATC; Cre R, 5 � - AAGTGACAGCAAT-

GCTGTTTCAC; and LckF, 5 � - GGTTTGCCCATCCCAGGTG . All

PCRs used a T m = 58 ° C for 35 cycles, except for Cre PCRs, which used

a T m = 52 ° C.

Antibodies and FACS analysis. Antibody staining and FACS analysis was

performed as described previously ( 11 ). All antibodies were purchased from

BD Biosciences or eBioscience. We used the following antibodies: c-kit

(2B8), Sca-1 (D7), Mac-1 (M1/70), Gr-1 (RB6-8C5), NK1.1 (PK136),

TER-119, CD3 (145-2C11), CD19 (1D3), IL7R � (A7R34), CD34

(RAM34), Fc � II/III (2.4G2), Flk-2/Flt-3 (A2F10.1), CD4 (RM4-5), CD4

(H129.19), CD8 (53 – 6.7), CD25 (PC61), and CD44 (IM7). BM lineage

antibody cocktail includes the following: Mac-1, Gr-1, NK1.1, TER-119,

CD3, TCR- � , TCR- � � , and CD19.

Indeed, both total and phosphorylated c-Myc protein was

consistently up-regulated in Fbw7 � / � BM stem cells and

progenitors. These observations were consistent with the

confocal microscopy studies reported by Matsuoka et al. ( 44 ),

strongly suggesting that c-Myc is indeed an important Fbw7

substrate. Putative targets of c-Myc, including p57 kip2 , E2F2,

and Ccnd1, were also up-regulated in Fbw7 � / � LSK cells. In

agreement with this hypothesis, Wilson et al. ( 11 ) have per-

formed experiments in which they have overexpressed c-

Myc specifi cally in LSK cells. Despite proper homing and

inhibition of apoptosis, c-Myc – overexpressing HSCs failed

to self-renew, a phenotype similar to the one reported here

( 11 ). We should add here that although c-Myc appears to

represent an important Fbw7 target, it is possible that there

are other yet-unidentifi ed Fbw7 substrates that are important

for the hematopoietic phenotypes reported here.

Our presented studies identify Fbw7 as a novel essential

regulator of HSC quiescence and self-renewal. Initially, dele-

tion of Fbw7, which was normally expressed at high levels in

noncycling HSCs, aff ects the expression of key regulators of

cell cycle entry, including the D-type cyclin Ccnd1, the cell

cycle inhibitor p57 kip2 , and the downstream transcriptional

eff ector E2F2. The combined action of these regulators could

induce exit from quiescence and cell cycle entry, as the BrdU

incorporation experiments convincingly demonstrated that

upon Fbw7 deletion > 80% of LT-HSCs have entered cell

cycle. It is tempting to hypothesize that aberrant cell cycle

entry forces Fbw7 � / � HSCs to exit the quiescent niche and

lose their self-renewing ability. Once more, our expression

studies provide mechanistic support to this hypothesis. Fbw7

deletion dramatically suppresses the expression of several

genes ( Mpl , Pbx3 , p57 , Meis1 , Evi1 , Eya1/2 , Angpt , Thy1 ,

and Ndn ) that defi ne a partial “ LT-HSC ” transcriptional sig-

nature (Table S1 and unpublished data).

The identifi cation of Fbw7 as a key regulator of HSC

quiescence and self-renewal may have very signifi cant bio-

logical repercussions. Initially, Fbw7 function could be im-

portant for self-renewal of cancer stem cells with important

implications in the therapeutic targeting of their maintenance.

In agreement with this notion, Fbw7 deletion suppresses the

expression of several genes involved in hematopoietic trans-

formation ( Ccnd1 , Evi1 , Pbx3 , and Meis1 ). It is intriguing to

mention here that Fbw7 can also function as a tumor sup-

pressor when deleted in T cells using the Lck-cre + Fbw7 f/f

model (reference 35 and unpublished data), suggesting that

Fbw7 function in oncogenesis could diff er between uncom-

mitted stem cells, committed progenitors, and mature lym-

phocytes. For all these reasons, the identifi cation of regulators

of Fbw7 activity, including specifi c deubiquitinating enzymes

or substrate-specifi c priming kinases, could be valuable for

both the development of HSC transplantation protocols and

the suppression of transformation.

MATERIALS AND METHODS Generation of the Fbw7 fl ox mice. An � 11.5-kb region used to generate

the targeting vector was subcloned from a positively identifi ed C57B6 BAC


In vitro LSK culture. LSK cells were sorted from 4 – 8-wk-old C57/B6

mice and plated in 96-well plates (5,000 LSK per well) in OPTI-MEM sup-

plemented with 10% fetal bovine serum, 50 ng/ml Flt3 ligand, 50 ng/ml

SCF, 10 ng/ml IL-6, and 10 ng/ml IL-3 ( 53 ). Cells were harvested at diff er-

ent time points for cell cycle analysis and quantitative PCR. For cell cycle

analysis, cells were fi xed and permeabilized according to the manufacturer ’ s

instructions (Fix and Perm; Invitrogen) and stained with PE-conjugated

anti – Ki-67 (BD Biosciences) or control anti-IgG antibody. Cells were then

resuspended in PBS containing 5 μ g/ml RNaseA and 2 μ g/ml DAPI, and

analyzed by fl ow cytometry.

Statistical analysis. The means of each dataset were analyzed using the Stu-

dent ’ s t test, with a two-tailed distribution and assuming equal sample variance.

Data were considered statistically signifi cant when P < 0.05. Signifi cant data

are noted in the manuscript as follows: *, P < 0.05; **, P < 0.005.

Online supplemental material. Fig. S1 shows Fbw7 expression in diff er-

ent blood subsets. Fig. S2 shows stabilization of Notch1 in the thymus.

Fig. S3 shows the phenotype of Lck-Cre + Fbw7 f/f thymi. Fig. S4 demon-

strates that the Fbw7 � / � phenotype is cell autonomous. Fig. S5 shows that

the cell cycle defect is specifi c to HSC. The online supplemental material is

available at http://www.jem.org/cgi/content/full/jem.20080277/DC1.

We would like to thank Steve Yu for help with the generation of the Fbw7 fl ox mice,

Peter Lopez for excellent FACS support, and Barry Sleckman for c-Myc protein

expression advice and the sharing of reagents.

The Aifantis laboratory is supported by a generous donation by the Helen L.

and Martin S. Kimmel Stem Cell Center. This work is supported by the National

Institutes of Health (R56AI070310 and RO1CA105129 to I. Aifantis), the American

Cancer Society (RSG0806801 to I. Aifantis), the Leukemia and Lymphoma Society

(Scholar Award to I. Aifantis), the Chemotherapy Foundation, the G & P Foundation

for Cancer Research, and the Edward Mallinkcrodt, Jr. Foundation (to I. Aifantis).

S.D. Nimer was supported by NIHRO1 DK52208 and a Leukemia Lymphoma Society

SCOR Award. S. Buonamici was supported by an NYU Molecular Oncology and

Immunology training grant (T32 CA-09161) and by an American Society of

Hematology Scholar Award.

The authors have no confl icting fi nancial interests.

Submitted: 11 February 2008 Accepted: 18 April 2008

REFERENCES 1 . Passegue , E. , and A.J. Wagers . 2006 . Regulating quiescence: new in-

sights into hematopoietic stem cell biology. Dev. Cell . 10 : 415 – 417 .

2 . Aguila , H.L. , K. Akashi , J. Domen , K.L. Gandy , E. Lagasse , R.E.

Mebius , S.J. Morrison , J. Shizuru , S. Strober , N. Uchida , et al . 1997 .

From stem cells to lymphocytes: biology and transplantation. Immunol.

Rev. 157 : 13 – 40 .

3 . Adams , G.B. , and D.T. Scadden . 2006 . The hematopoietic stem cell in

its place. Nat. Immunol. 7 : 333 – 337 .

4 . Yin , T. , and L. Li . 2006 . The stem cell niches in bone. J. Clin. Invest.

116 : 1195 – 1201 .

5 . Trowbridge , J.J. , M.P. Scott , and M. Bhatia . 2006 . Hedgehog modu-

lates cell cycle regulators in stem cells to control hematopoietic regen-

eration. Proc. Natl. Acad. Sci. USA . 103 : 14134 – 14139 .

6 . Trowbridge , J.J. , A. Xenocostas , R.T. Moon , and M. Bhatia . 2006 .

Glycogen synthase kinase-3 is an in vivo regulator of hematopoietic

stem cell repopulation. Nat. Med. 12 : 89 – 98 .

7 . Duncan , A.W. , F.M. Rattis , L.N. DiMascio , K.L. Congdon , G.

Pazianos , C. Zhao , K. Yoon , J.M. Cook , K. Willert , N. Gaiano , and T.

Reya . 2005 . Integration of Notch and Wnt signaling in hematopoietic

stem cell maintenance. Nat. Immunol. 6:314 – 322.

8 . Blank , U. , G. Karlsson , and S. Karlsson . 2008 . Signaling pathways gov-

erning stem-cell fate. Blood. 111:492 – 503.

9 . Karlsson , G. , U. Blank , J.L. Moody , M. Ehinger , S. Singbrant , C.X.

Deng , and S. Karlsson . 2007 . Smad4 is critical for self-renewal of hema-

topoietic stem cells. J. Exp. Med. 204 : 467 – 474 .

Microarray analysis and quantitative PCR validation. For gene ex-

pression profi ling of primary HSC and progenitor cell subsets, we pooled

hind limb BM cells from three mice. Freshly isolated cells were sorted by

surface marker expression, and total RNA was extracted using the RNAEasy

kit (QIAGEN). To generate suffi cient sample quantities for oligonucleotide

gene chip hybridization and quantitative PCR experiments, we used the

GeneChip Two-Cycle cDNA Synthesis kit (Aff ymetrix) for cRNA ampli-

fi cation and labeling. The amplifi ed cRNA was labeled and hybridized to

the MOE430 Plus 2 oligonucleotide arrays (Aff ymetrix) or reverse-tran-

scribed using the First Strand cDNA Synthesis kit (Invitrogen) for quantita-

tive PCR experiments. The Aff ymetrix gene expression profi ling data were

normalized using the previously published Robust Multi-array Average al-

gorithm using the GeneSpring 7 software (Agilent Technologies). Messen-

ger RNA expression levels for critical regulators of HSC proliferation and

self-renewal were verifi ed by quantitative PCR using the 7900 Real Time

PCR system (Applied Biosystems). Primers and probes used were pur-

chased from Applied Biosystems. The relative expression of target genes

was calculated using the delta – delta Ct method and normalized to the

HPRT mRNA content. Two biological duplicates were used for each

quantitative RT-PCR experiment. Each duplicate included a mixture of

cells (LSK or MP) sorted from two mice with the same genotype for each

experiment. Microarray data were deposited in the GEO database under

accession numbers GSE11178 , GSM281722 , GSM281723 , GSM281724 ,

and GSM281725 .

RT-PCR. Total RNA was isolated using the RNeasy Plus Mini kit

(QIAGEN) and used to synthesize cDNA with the SuperScript First-

Strand kit (Invitrogen). Real-time quantitative PCR was performed us-

ing iQ SYBR Green Supermix and an iCycler (Bio-Rad Laboratories)

using the following primer sequences (T m = 60 ° C for all primers): Fbw7

F, 5 � -GTGATAGAGCCCCAGTTCCA and Fbw7 R, 5 � -CCTCAGC-

CAAAATTCTCCAG; Deltex1 F, 5 � -GAGGTCCACCAGCGTCAG

and Deltex1 R, 5 � - GCCAGTGCCATTCAAGTTCT; Cul1 F, 5 � -G G A-

AGACCGCAAACTACTGA and Cul1 R, 5 � -GTGTCCTTCTCAC-

CATCGAC; and Actin F, 5 � -TGGAATCCTGTGGCATCCATGAAAC

and Actin R, 5 � -TAAAACGCAGCTCCAGTAACAGTCCG. Expression

levels for each transcript were normalized to Actin expression. For Fbw7

isoform PCR, cDNA was prepared as described above and amplifi ed (T m =

55 ° C, 38 cycles) using each of the following forward primers: Fbw7 �

F, 5 � -GGAGATGGACCAGGAGAGTG; Fbw7 � F, 5 � -TTGTCAGAGA-

CTGCCAAGCA; and Fbw7 � F, 5 � -ATGGCTTGGTTCCTGTTGAT

paired with a common reverse primer: Fbw7exon3 R, 5 � -GTTGGTGTT-

GCTGAACATGG. PCR products were separated on 2% agarose gels and

visualized with ethidium bromide staining.

BrdU incorporation. Mice received an intraperitoneal injection of 3 mg

BrdU (Becton Dickinson), and 1 mg/ml BrdU (Sigma-Aldrich) was added

to the drinking water for 42 h. BrdU detection in LSK cells was performed

as described previously ( 52 ).

Western blotting. Total cell lysates were prepared as described previously

( 25 ), separated on 4 – 15% gradient Tris-HCl gels (Bio-Rad Laboratories),

and transferred to nitrocellulose or PVDF. Membranes were probed with

the following antibodies: Notch1-IC (Notch1 Val1744; Cell Signaling

Technology), pan-Notch1 (C-20; Santa Cruz Biotechnology, Inc.), c-Myc

(no. 06-340; Millipore), phospho-c-Myc (T58/S62; Cell Signaling Tech-

nology), Cyclin E (M-20; Santa Cruz Biotechnology, Inc.), and Actin

(MAB1501R; Millipore).

Methylcellulose assays. LSK cells were sorted from control (Fbw7 f/f

Mx1-Cre � ) or CKO (Fbw7 f/f Mx1-Cre + ) mice 2 wk after polyI:C injec-

tion. LSK cells were plated in duplicate (500 LSK/35-mm dish) into cyto-

kine-supplemented methycellulose medium (MethoCult 3434; Stem Cell

Technologies), and the number and morphology of colonies were scored

7 d later.

JEM VOL. 205, June 9, 2008

ARTICLE

1407

29 . Maser , R.S. , B. Choudhury , P.J. Campbell , B. Feng , K.K. Wong , A.

Protopopov , J. O ’ Neil , A. Gutierrez , E. Ivanova , I. Perna , et al . 2007 .

Chromosomally unstable mouse tumours have genomic alterations sim-

ilar to diverse human cancers. Nature . 447 : 966 – 971 .

30 . Naujokat , C. , and T. Saric . 2007 . Concise review: role and function of

the ubiquitin-proteasome system in mammalian stem and progenitor

cells. Stem Cells . 25 : 2408 – 2418 .

31 . Tsunematsu , R. , K. Nakayama , Y. Oike , M. Nishiyama , N. Ishida , S.

Hatakeyama , Y. Bessho , R. Kageyama , T. Suda , and K.I. Nakayama .

2004 . Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation dur-

ing vascular development. J. Biol. Chem. 279 : 9417 – 9423 .

32 . Tetzlaff , M.T. , W. Yu , M. Li , P. Zhang , M. Finegold , K. Mahon , J.W.

Harper , R.J. Schwartz , and S.J. Elledge . 2004 . Defective cardiovascular

development and elevated cyclin E and Notch proteins in mice lacking

the Fbw7 F-box protein. Proc. Natl. Acad. Sci. USA . 101 : 3338 – 3345 .

33 . Kuhn , R. , F. Schwenk , M. Aguet , and K. Rajewsky . 1995 . Inducible

gene targeting in mice. Science. 269 : 1427 – 1429 .

34 . El Andaloussi , A. , S. Graves , F. Meng , M. Mandal , M. Mashayekhi ,

and I. Aifantis . 2006 . Hedgehog signaling controls thymocyte pro-

genitor homeostasis and diff erentiation in the thymus. Nat. Immunol.

7 : 418 – 426 .

35 . Onoyama , I. , R. Tsunematsu , A. Matsumoto , T. Kimura , I.M. de

Alboran , K. Nakayama , and K.I. Nakayama . 2007 . Conditional in-

activation of Fbxw7 impairs cell-cycle exit during T cell diff erentiation

and results in lymphomatogenesis. J. Exp. Med. 204 : 2875 – 2888 .

36 . Passegue , E. , A.J. Wagers , S. Giuriato , W.C. Anderson , and I.L.

Weissman . 2005 . Global analysis of proliferation and cell cycle gene

expression in the regulation of hematopoietic stem and progenitor cell

fates. J. Exp. Med. 202 : 1599 – 1611 .

37 . Terskikh , A.V. , T. Miyamoto , C. Chang , L. Diatchenko , and I.L.

Weissman . 2003 . Gene expression analysis of purifi ed hematopoietic

stem cells and committed progenitors. Blood . 102 : 94 – 101 .

38 . Jankovic , V. , A. Ciarrocchi , P. Boccuni , T. DeBlasio , R. Benezra , and

S.D. Nimer . 2007 . Id1 restrains myeloid commitment, maintaining the

self-renewal capacity of hematopoietic stem cells. Proc. Natl. Acad. Sci.

USA . 104 : 1260 – 1265 .

39 . Forsberg , E.C. , S.S. Prohaska , S. Katzman , G.C. Heff ner , J.M. Stuart ,

and I.L. Weissman . 2005 . Diff erential expression of novel potential reg-

ulators in hematopoietic stem cells. PLoS Genet . 1 : e28 .

40 . Mansson , R. , A. Hultquist , S. Luc , L. Yang , K. Anderson , S. Kharazi ,

S. Al-Hashmi , K. Liuba , L. Thoren , J. Adolfsson , et al . 2007 . Molecular

evidence for hierarchical transcriptional lineage priming in fetal and

adult stem cells and multipotent progenitors. Immunity . 26 : 407 – 419 .

41 . Dauphinot , L. , C. De Oliveira , T. Melot , N. Sevenet , V. Thomas , B.E.

Weissman , and O. Delattre . 2001 . Analysis of the expression of cell

cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2 and

c-Myc expression. Oncogene . 20 : 3258 – 3265 .

42 . Daksis , J.I. , R.Y. Lu , L.M. Facchini , W.W. Marhin , and L.J. Penn .

1994 . Myc induces cyclin D1 expression in the absence of de novo pro-

tein synthesis and links mitogen-stimulated signal transduction to the

cell cycle. Oncogene . 9 : 3635 – 3645 .

43 . Leone , G. , R. Sears , E. Huang , R. Rempel , F. Nuckolls , C.H. Park ,

P. Giangrande , L. Wu , H.I. Saavedra , S.J. Field , et al . 2001 . Myc re-

quires distinct E2F activities to induce S phase and apoptosis. Mol. Cell .

8 : 105 – 113 .

44 . Matsuoka , S. , Y. Oike , I. Onoyama , A. Iwama , F. Arai , K. Takubo ,

Y. Mashimo , H. Oguro , E. Nitta , K. Ito , et al . 2008 . Fbxw7 acts as a

critical fail-safe against premature loss of hematopoietic stem cells and

development of T-ALL. Genes Dev. 22 : 986 – 991 .

45 . An , J.Y. , J.W. Seo , T. Tasaki , M.J. Lee , A. Varshavsky , and Y.T. Kwon .

2006 . Impaired neurogenesis and cardiovascular development in mice

lacking the E3 ubiquitin ligases UBR1 and UBR2 of the N-end rule

pathway. Proc. Natl. Acad. Sci. USA . 103 : 6212 – 6217 .

46 . Barsi , J.C. , R. Rajendra , J.I. Wu , and K. Artzt . 2005 . Mind bomb1 is a

ubiquitin ligase essential for mouse embryonic development and Notch

signaling. Mech. Dev. 122 : 1106 – 1117 .

47 . Cang , Y. , J. Zhang , S.A. Nicholas , A.L. Kim , P. Zhou , and S.P. Goff .

2007 . DDB1 is essential for genomic stability in developing epidermis.

Proc. Natl. Acad. Sci. USA . 104 : 2733 – 2737 .

10 . Kozar , K. , M.A. Ciemerych , V.I. Rebel , H. Shigematsu , A. Zagozdzon ,

E. Sicinska , Y. Geng , Q. Yu , S. Bhattacharya , R.T. Bronson , et al .

2004 . Mouse development and cell proliferation in the absence of D-

cyclins. Cell . 118 : 477 – 491 .

11 . Wilson , A. , M.J. Murphy , T. Oskarsson , K. Kaloulis , M.D. Bettess ,

G.M. Oser , A.C. Pasche , C. Knabenhans , H.R. Macdonald , and A.

Trumpp . 2004 . c-Myc controls the balance between hematopoietic

stem cell self-renewal and diff erentiation. Genes Dev. 18 : 2747 – 2763 .

12 . Baena , E. , M. Ortiz , A.C. Martinez , and I.M. de Alboran . 2007 .

c-Myc is essential for hematopoietic stem cell diff erentiation and regu-

lates Lin(-)Sca-1(+)c-Kit(-) cell generation through p21. Exp. Hematol.

35 : 1333 – 1343 .

13 . Yang , L. , L. Wang , H. Geiger , J.A. Cancelas , J. Mo , and Y. Zheng .

2007 . Rho GTPase Cdc42 coordinates hematopoietic stem cell quies-

cence and niche interaction in the bone marrow. Proc. Natl. Acad. Sci.

USA . 104 : 5091 – 5096 .

14 . Radtke , F. , A. Wilson , G. Stark , M. Bauer , J. van Meerwijk , H.R.

MacDonald , and M. Aguet . 1999 . Defi cient T cell fate specifi cation in

mice with an induced inactivation of Notch1. Immunity . 10 : 547 – 558 .

15 . Zuniga-Pfl ucker , J.C. 2004 . T-cell development made simple. Nat.

Rev. Immunol. 4 : 67 – 72 .

16 . Stier , S. , T. Cheng , D. Dombkowski , N. Carlesso , and D.T. Scadden .

2002 . Notch1 activation increases hematopoietic stem cell self-renewal

in vivo and favors lymphoid over myeloid lineage outcome. Blood .

99 : 2369 – 2378 .

17 . Han , H. , K. Tanigaki , N. Yamamoto , K. Kuroda , M. Yoshimoto ,

T. Nakahata , K. Ikuta , and T. Honjo . 2002 . Inducible gene knock-

out of transcription factor recombination signal binding protein-J

reveals its essential role in T versus B lineage decision. Int. Immunol.

14 : 637 – 645 .

18 . Mancini , S.J. , N. Mantei , A. Dumortier , U. Suter , H.R. Macdonald ,

and F. Radtke . 2005 . Jagged1-dependent Notch signaling is dispens-

able for hematopoietic stem cell self-renewal and diff erentiation. Blood .

105 : 2340 – 2342 .

19 . Wilson , A. , D.L. Ardiet , C. Saner , N. Vilain , F. Beermann , M. Aguet ,

H.R. Macdonald , and O. Zilian . 2007 . Normal hemopoiesis and lym-

phopoiesis in the combined absence of numb and numblike. J. Immunol.

178 : 6746 – 6751 .

20 . Nakayama , K.I. , and K. Nakayama . 2006 . Ubiquitin ligases: cell-cycle

control and cancer. Nat. Rev. Cancer . 6 : 369 – 381 .

21 . Minella , A.C. , and B.E. Clurman . 2005 . Mechanisms of tumor suppres-

sion by the SCF(Fbw7). Cell Cycle . 4 : 1356 – 1359 .

22 . Ye , X. , G. Nalepa , M. Welcker , B.M. Kessler , E. Spooner , J. Qin ,

S.J. Elledge , B.E. Clurman , and J.W. Harper . 2004 . Recognition of

phosphodegron motifs in human cyclin E by the SCF(Fbw7) ubiquitin

ligase. J. Biol. Chem. 279 : 50110 – 50119 .

23 . Orlicky , S. , X. Tang , A. Willems , M. Tyers , and F. Sicheri . 2003 .

Structural basis for phosphodependent substrate selection and orienta-

tion by the SCFCdc4 ubiquitin ligase. Cell . 112 : 243 – 256 .

24 . Koepp , D.M. , L.K. Schaefer , X. Ye , K. Keyomarsi , C. Chu , J.W. Harper ,

and S.J. Elledge . 2001 . Phosphorylation-dependent ubiquitination of

cyclin E by the SCFFbw7 ubiquitin ligase. Science. 294 : 173 – 177 .

25 . Thompson , B.J. , S. Buonamici , M.L. Sulis , T. Palomero , T. Vilimas ,

G. Basso , A. Ferrando , and I. Aifantis . 2007 . The SCFFBW7 ubiquitin

ligase complex as a tumor suppressor in T cell leukemia. J. Exp. Med.

204 : 1825 – 1835 .

26 . O ’ Neil , J. , J. Grim , P. Strack , S. Rao , D. Tibbitts , C. Winter , J.

Hardwick , M. Welcker , J.P. Meijerink , R. Pieters , et al . 2007 . FBW7

mutations in leukemic cells mediate NOTCH pathway activation and

resistance to � -secretase inhibitors. J. Exp. Med. 204 : 1813 – 1824 .

27 . Malyukova , A. , T. Dohda , N. von der Lehr , S. Akhondi , M. Corcoran ,

M. Heyman , C. Spruck , D. Grander , U. Lendahl , and O. Sangfelt .

2007 . The tumor suppressor gene hCDC4 is frequently mutated in hu-

man T-cell acute lymphoblastic leukemia with functional consequences

for Notch signaling. Cancer Res. 67 : 5611 – 5616 .

28 . Akhoondi , S. , D. Sun , N. von der Lehr , S. Apostolidou , K. Klotz , A.

Maljukova , D. Cepeda , H. Fiegl , D. Dofou , C. Marth , et al . 2007 .

FBXW7/hCDC4 is a general tumor suppressor in human cancer. Cancer

Res. 67 : 9006 – 9012 .


48 . Daino , H. , H. Shibayama , T. Machii , and T. Kitani . 1996 . Extracellular

ubiquitin regulates the growth of human hematopoietic cells. Biochem.

Biophys. Res. Commun. 223 : 226 – 228 .

49 . Naujokat , C. , O. Sezer , H. Zinke , A. Leclere , S. Hauptmann , and

K. Possinger . 2000 . Proteasome inhibitors induced caspase-dependent

apoptosis and accumulation of p21WAF1/Cip1 in human immature

leukemic cells. Eur. J. Haematol. 65 : 221 – 236 .

50 . Welcker , M. , and B.E. Clurman . 2008 . FBW7 ubiquitin ligase: a tu-

mour suppressor at the crossroads of cell division, growth and diff eren-

tiation. Nat. Rev. Cancer . 8 : 83 – 93 .

51 . Loeb , K.R. , H. Kostner , E. Firpo , T. Norwood , D.K. Tsuchiya,

B.E. Clurman, and J.M. Roberts. 2005 . A mouse model for cyclin E-

dependent genetic instability and tumorigenesis. Cancer Cell . 8 : 35 – 47 .

52 . Lacorazza , H.D. , T. Yamada , Y. Liu , Y. Miyata , M. Sivina , J. Nunes ,

and S.D. Nimer . 2006 . The transcription factor MEF/ELF4 regu-

lates the quiescence of primitive hematopoietic cells. Cancer Cell .

9 : 175 – 187 .

53 . Ciarrocchi , A. , V. Jankovic , Y. Shaked , D.J. Nolan , V. Mittal , R.S.

Kerbel , S.D. Nimer , and R. Benezra . 2007 . Id1 restrains p21 expression

to control endothelial progenitor cell formation. PLoS ONE . 2 : e1338 .

Cell Stem Cell

Article

Hedgehog Signaling Is Dispensablefor Adult Hematopoietic Stem Cell FunctionJie Gao,1,2 Stephanie Graves,3 Ute Koch,4 Suqing Liu,1,2 Vladimir Jankovic,5 Silvia Buonamici,1,2

Abdeljabar El Andaloussi,6 Stephen D. Nimer,5 Barbara L. Kee,3 Russell Taichman,7 Freddy Radtke,4

and Iannis Aifantis1,2,*1Department of Pathology and NYU Cancer Institute2Helen and Martin S. Kimmel Stem Cell Center

New York University School of Medicine, New York, NY 10016, USA3Department of Pathology, University of Chicago, Chicago, IL 60637, USA4Ecole Polytechnique Federale de Lausanne/Swiss Institute for Experimental Cancer Research, 1066 Epalinges, Switzerland5Molecular Pharmacology and Chemistry Program, Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, New York,

NY 10021, USA6Faculte de Medecine, Universite de Sherbrooke, Quebec J1K 2R1, Canada7Department of Periodontics and Oral Medicine, University of Michigan School of Dentistry, Ann Arbor, MI 48109, USA*Correspondence: [email protected]

DOI 10.1016/j.stem.2009.03.015

SUMMARY

The Hedgehog (Hh) signaling pathway is a develop-mentally conserved regulator of stem cell function.Several reports suggested that Hh signaling is animportant regulator of hematopoietic stem cell(HSC) maintenance and differentiation. Here we testthis hypothesis in vivo using both gain- and loss-of-function Hh genetic models. Surprisingly, our studiesdemonstrate that conditional Smoothened (Smo)deletion or overactivation has no significant effectson adult HSC self-renewal and function. Moreover,they indicate a lack of synergism between the Notchand Hh pathways in HSC function, as compoundRBPJ and Smo deficiency does not affect hemato-poiesis. In agreement with this notion, detailedgenome-wide transcriptome analysis reveals thatsilencing of Hh signaling does not significantly alterthe HSC-specific gene expression ‘‘signature.’’ Ourstudies demonstrate that the Hh signaling pathwayis dispensable for adult HSC function and suggestthat Hh inhibition on leukemia-initiating cell mainte-nance can be targeted in future clinical trials.

INTRODUCTION

Hematopoietic stem cells (HSCs) are able to self-renew as well

as give rise to all blood lineages. HSCs mainly reside in special-

ized bone marrow microenvironments, called HSC niches. The

niche is thought to provide appropriate signals that maintain

the balance between self-renewal and differentiation of HSCs

(Adams and Scadden, 2006; Lessard et al., 2004; Moore and

Lemischka, 2006; Morrison and Spradling, 2008; Wilson and

Trumpp, 2006; Yin and Li, 2006). However, the identity of these

signals and the molecular mechanisms governing HSC fate

largely remain elusive. Thus, identification of regulators of HSC

function is a central issue in stem cell biology.

The roles of developmentally imprinted signaling pathways—

more specifically Notch, Wingless (Wnt), and Hedgehog (Hh)—

in HSC homeostasis have been studied extensively (Maillard

et al., 2008; Stier et al., 2002; Cobas et al., 2004; Reya et al.,

2003).Hh isa secretedprotein familywith threemembers inhigher

vertebrates (Shh, Ihh, Dhh). In the absence of Hh, the Patched

(Ptch) receptor acts as a negative regulator of signaling as it

inhibits the action of Smoothened (Smo) (Hammerschmidt et al.,

1997). Hh protein binds and inhibits Ptch action, inducing

signaling transduction through Smo. This signaling cascade

results in the nuclear localization and activation of the Gli family

of transcription factors. Although Hh is a major regulator of cell-

fate decision and body segment polarity (Nusslein-Volhard and

Wieschaus, 1980), its role in HSC homeostasis and differentiation

remains controversial. Several reports have suggested that Hh

signaling is critical forHSCandhematopoieticprogenitordifferen-

tiation. A study of zebrafish hematopoiesis revealed that embryo

mutants of theHhpathwaydisplay defects inHSC formation (Ger-

ing and Patient, 2005), indicating that Hh is required for definitive

hematopoiesis. Consistent with these data, in vitro studies found

that antibodies to Hh inhibited the cytokine-induced proliferation

of human primitive HSCs, whereas Shh induced the expansion of

humanhematopoietic repopulatingcells (Bhardwaj et al., 2001). In

addition, analysis of Ptch1+/� mice showed that Hh activation

expanded primitive bone marrow cells, but continued Hh activa-

tion led toHSCexhaustion (Trowbridge et al., 2006). Furthermore,

a recent study using an in vivo model of Hh deficiency suggested

that HSCs require Smo-mediated signals for their homeostasis

(Zhao et al., 2009). In contrast to these studies, it was proposed

that Hh signaling is involved at the level of lymphocyte lineage

commitment, as a defect in the common lymphoid progenitor

(CLP) population was observed upon deletion of Ptch1 (Uhmann

et al., 2007). Moreover, Hh signaling has been demonstrated to

be important for thedifferentiation andproliferation of hematopoi-

etic progenitors in the thymus (Crompton et al., 2007; El Anda-

loussi et al., 2006). Finally, a recent report suggested that Hh

signaling is essential for the differentiation of leukemia-initiating

cells, introducing Hh inhibitors in clinical trials targeting BCR-

ABL+ leukemia (Dierks et al., 2007, 2008).

548 Cell Stem Cell 4, 548–558, June 5, 2009 ª2009 Elsevier Inc.

As none of these studies directly targeted Hh function specifi-

cally in adult HSCs, we decided to address HSC-specific Hh

function in vivo. To this end, both gain- and loss-of-function

conditional Smo genetic models were used, as the Smo receptor

is the only nonredundant element of the Hh pathway. Surpris-

ingly, and contrary to the consensus view, Hh signaling appeared

to be dispensable for the self-renewal and differentiation of adult

bone marrow HSCs. Indeed, neither conditional deletion of the

Smo signal transducer nor hyperactivation of the Hh pathway

had an affect in adult HSC maintenance and function. Interest-

ingly, Hh signaling also appeared to be dispensable for the func-

tion of putative leukemia-initiating cells in T cell leukemia, as

induction and progression of the disease was unaffected by

silencing of the pathway.

RESULTS

Conditional Deletion of Smo Failsto Affect HSC Maintenance In VivoTo study the role of Hh signaling in adult HSCs, we generated

a Cre-regulated conditional model of Smo deletion (SmoF/F

Mx1-Cre+, Figure 1A) in which expression of the Cre recombi-

nase is under the control of myxovirus-resistance 1 (Mx1) gene

promoter (Mx1-Cre) (Gu et al., 1994) and is induced by inter-

feron-a (via stimulation with polyI:polyC). In these mice, the first

exon of the Smo locus is flanked by loxP sites and is deleted

upon Cre-mediated recombination (Long et al., 2001). SmoF/F

Mx1-Cre� (control) and SmoF/FMx1-Cre+ littermate mice were

treated with polyI:polyC. This treatment resulted in the efficient

deletion of Smo floxed alleles, and the generation of a recom-

bined Smo deleted (D) alleles (Figure 1B, lane 4). At the mRNA

level, Smo was not detectable in SmoD/D bone marrow cells,

and the expression of Ptch1, a key target gene of Hh activation,

was significantly reduced compared to the control mice

(Figure 1C).

Initial analysis of control and Smo-deficient mice at 4 weeks

post-polyI:polyC injection demonstrated no significant alteration

in the overall bone marrow cellularity (p = 0.10). Further analysis

showed that Smo deletion had no effect on the relative frequency

(p = 0.35) or the absolute number of Lin�Sca1+cKit+ (LSK), a

cell population enriched for HSCs (p = 0.49) (Figure 1D). HSCs

differentiate and give rise to myeloid progenitors (MP, Lin�

Sca1�cKit+), which can be subdivided into common myeloid

progenitors (CMP, Lin�Sca1�cKit+CD34+FcgRlow), granulocyte-

monocyte progenitors (GMP, Lin�Sca1�cKit+ CD34+FcgRhi),

and megakaryocyte/erythrocyte progenitors (MEP, Lin�Sca1�

cKit+CD34�FcgRlow). Our analysis showed that CMP, GMP,

and MEP compartments were comparable between Smo-defi-

cient and control mice (Figure 1E). Moreover, the percentages

of terminally differentiated B- and T-lymphocytes appear normal

in Smo-deficient spleen and bone marrow (see Figure S1 avail-

able online). In the thymus, the distribution of mature (CD4+,

CD8+) and immature (CD4+8+,CD4�8�) compartments appeared

similar to controls. Further subdivision of the CD4�8� compart-

ment using the CD25 and CD44 surface antigen expression

also revealed a normal distribution (Figure S1). The lack of

a perturbation of the hematopoietic compartment was not due

to early time point analysis, as Smo-deficient mice at 16 weeks

post-polyI:polyC injection also displayed normal populations of

LSK, progenitors, and lymphocytes despite the complete

absence of Smo mRNA (Figure S2).

We further examined the LSK population, which can be subdi-

vided into long-term (LT)-HSC (LSKCD34�Flt3/Flk2�), short-

term (ST)-HSC (LSKCD34+Flt3/Flk2�), and multipotent progeni-

tors (MPP, LSKCD34+Flt3/Flk2+). We observed comparable

numbers of LT-HSCs, ST-HSCs, and MPPs between control

and Smo-deficient mice (Figure 1E). Also, similar analysis using

CD150 and CD48 as markers of LT-HSC (LSKCD48�CD150+)did not reveal any abnormalities in Smo-deficient mice

(Figure 1E). Additionally, we investigated the prosurvival and pro-

proliferative functions of the Hh pathway. Staining for the proa-

poptotic marker AnnexinV did not reveal abnormal induction of

cell death in Smo-deficient LSKs. Furthermore, cell-cycle anal-

ysis of the marker for proliferation Ki67 in conjunction with

DAPI to measure DNA content did not reveal any differences in

the cell-cycle profiles between control and Smo-deficient LSKs

(Figure 1E). These findings strongly suggested that Smo-medi-

ated Hh signaling is dispensable for adult HSC and progenitor

homeostasis and differentiation. To further test this hypothesis,

we analyzed Gli1lacZ/lacZ mice (Bai et al., 2002) in which Gli1,

a key transcription activator of the Hh pathway, is deleted and

replaced by a lacZ allele. We did not detect any defects in the

HSC compartment or in T and B lymphopoiesis in the bone

marrow and the thymus ofGli1lacZ/lacZmice (Figure S3), suggest-

ing that Gli1 function is dispensable for hematopoiesis.

Smo Deletion Does Not Alter Differentiation Abilityof Progenitor CellsTo test functionality of Smo-deficient stem cells and progenitors,

LSKs were flow purified from either control or Smo-deficient

bone marrows, and methylcellulose assays were performed in

the presence of the appropriate cytokines. Both types of LSK

cells generated similar numbers of colony-forming units (CFUs)

in both primary and secondary platings (Figures 2A and 2B).

The deletion of Smo was confirmed by colony-specific PCR.

The results showed that 14 out of the 15 studied colonies derived

from Smo-deficient LSKs deleted the Smo allele. The expression

ofSmomRNAwas not detectable by quantitative RT-PCR;more-

over, the expression of Ptch1mRNA was significantly reduced in

Smo-deficient LSK-derived colonies (Figures 2C and 2D). These

results suggest that Smo is dispensable for short-term differenti-

ation ability of hematopoietic progenitor cells.

ST-HSCcellsareable togive rise rapidly tocolonies in thespleen

when transplanted into lethally irradiated hosts. To study the effect

of Smo deletion in this process, CFU-spleen (CFU-S) units were

scored after transplanting either control or Smo-deficient bone

marrow cells. We obtained identical CFU-S scores for the two

groups (Figure S4), again indicating that Smo function is dispens-

able for rapid progenitor differentiation. To test the capability of

Smo-deficient progenitors to expand and replenish the immune

system, control and Smo-deficient mice were challenged weekly

with a dose of 5-fluorouracil (5-FU) to eradicate cycling cells

(Berardi et al., 1995), and the survival of thesemicewas observed.

Similar survival percentages in the two groups (Figure 2E) sug-

gested that the Smo-deficient progenitor cells were able to enter

into cell cycle at a comparable level aswild-type cells.Collectively,

these results demonstrate that Smo is dispensable for short-term

differentiation of adult progenitor cells both in vitro and in vivo.

Cell Stem Cell

Hedgehog in Adult HSC Function

Cell Stem Cell 4, 548–558, June 5, 2009 ª2009 Elsevier Inc. 549

Smo Deletion Does Not Affect HSC Self-Renewaland Reconstitution AbilityOne explanation for the lack of an overt effect of Smo loss on

HSC maintenance or function is that the potential Hh function

is masked due to the nature of the analysis utilized and that it

can be revealed only in a competitive setting. To test the recon-

stitution capacity of Smo-deficient HSCs, competitive bone

marrow transplantations (BMTs) were performed. Bone marrow

cells from either control or Smo-deficient mice (CD45.2+/Ly5.2+)

were competed with an equal number of bone marrow cells from

isogenic CD45.1+/Ly5.1+ mice and transplanted into lethally irra-

diated Ly5.1+ recipients (Figure 3A). Peripheral blood analysis of

chimerism of the recipients showed that Smo-deficient HSCs

were able to compete with wild-type HSCs in a manner similar

to control HSCs (Figure 3B). Similar assays were performed by

mixing flow-purified LSKs from either control or Smo-deficient

mice with competing Ly5.1 bone marrow cells. Once more, no

significant differences were observed between control and

Smo-deficient LSKs 14 weeks after BMT (Figure 3C). This lack

of phenotype was not due to partial or inefficient deletion of

the Smo, as quantitative RT-PCR in flow-purified Ly5.2+Lin�

bonemarrow cells of recipient mice 16 weeks after BMT showed

a complete loss of SmomRNA expression (Figure 3D). Indeed, at

week 16 after BMT, Ly5.2+ Smo-deficient donor-cell-derived

LSK cells were present in the bone marrow, B220+ B cells, and

CD3+ T cells in the spleen of recipients (Figure 3E), demon-

strating the repopulation ability of Smo-deficient HSCs.

To more rigorously test the repopulation ability of Smo-defi-

cient HSCs, a secondary competitive BMT was performed using

donor-derived Ly5.2+ bone marrow cells isolated from the recip-

ients of the primary transplant. We observed that the reconstitu-

tion ability of Smo-deficient HSCs was identical to that of control

HSCs even in this sensitive serial transplantation setting. As

shown in Figure 3F, at 12weeks postsecondary BMT, the chime-

rism in peripheral bloodwas comparable between recipients that

had received control or Smo-deficient cells, and donor-derived

A C

D

B

E

Figure 1. Phenotypically Normal HSCs and Progenitors in Smo-Deficient Mice

(A) Schematic representation of Smo-floxed allele (upper lane) and Mx1-Cre allele (lower lane).

(B) PCR of genomic DNA extracted from mouse tails or lineage-negative bone marrow cells to detect the Smo floxed, deleted (D), or Cre allele. Lanes 1 and 3,

SmoF/FMx1-Cre�; lanes 2 and 4, SmoF/FMx1-Cre+.

(C) RT-PCR and quantification of Smo and Ptch1 mRNA in lineage-negative bone marrow cells from polyI:polyC-injected SmoF/FMx1-Cre� (lane 5) and SmoF/F

Mx1-Cre+ (lane 6) mice. The expression levels were normalized against b-actin.

(D) Total number of bone marrow cells and LSK cells in control and SmoD/D mice. Each diamond represents a single mouse, and the bar indicates the average

numbers.

(E) FACS plots of bone marrow from control and SmoD/D mice. Representative plots (from at least 20 individual experiments) are shown.

Cell Stem Cell



B220+, CD3+, and Mac1+ cells were present at similar percent-

ages. Taken together, these data indicate that deletion of Smo

has no significant effect on HSC repopulation ability.

Smo Deletion Does Not Alter HSC-Specific GeneExpression SignatureThe absence of a phenotypic defect in HSCs that lackSmo led us

to search for a putative role for Hh signaling in stem cell and

progenitor gene expression patterns. To examine whether the

loss of Smo results in changes at themolecular level in HSCs,mi-

croarray analysis was performed using flow-purified LSK andMP

populations from either control or Smo-deficient mice. The array

analysis (Figure S5C) and qRT-PCR studies (data not shown)

showed a complete loss of Smo expression in both LSK and

MP compartments. When control LSKs were compared with

control MPs in duplicate experiments, 739 genes changed

expression levels by 2-fold or greater (Figure S5A). For the

purpose of this analysis, these 739 genes were regarded as an

HSC-enriched gene expression ‘‘signature.’’ As a proof of prin-

cipal, it was shown that this specific gene ‘‘signature’’ was lost

upon deletion of Fbw7, a ubiquitin ligase that is essential for the

maintenanceofHSCquiescence (Thompsonetal., 2008). Indeed,

43% (315 out of 739) of these selected genes were significantly

deregulated in Fbw7-deficient LSKs. In contrast, less than 10%

(70 out 739) of these genes changed (up- or downregulated) in

response to Smo deletion (Figure S5B), suggesting that the

HSC gene signature is largely preserved in Smo-deficient LSKs.

Previous reports (Forsberg et al., 2005; Jankovic et al., 2007;

Mansson et al., 2007; Terskikh et al., 2003; Thompson et al.,

2008) have defined a list of genes closely associated with

LT-HSC activity. These genes are highly expressed in LT-HSCs

but are downregulated as HSCs lose their self-renewal abilities.

These genes include transcription factors/cofactors important

for HSC self-renewal and differentiation (Meis1, Egr1, Eya1/2),

surface receptors (Mpl, Thy1, Agpt), and regulators of HSC

survival (Mcl1). Our array analyses showed that the expression

of these genes was not altered by the inducible deletion of

Smo (Figure S5C). These data demonstrate that Smo is not

required for the maintenance of adult HSC properties at the

molecular level and support our findings that HSCs are pheno-

typically normal in the absence of Smo.

Absence of Functional Redundancy betweenthe Notch and Hh Pathways in HematopoiesisThe possibility remains that redundancy between signaling path-

ways masked a potential function for Hh in the early stages of

hematopoiesis. We have shown previously that the Hh and

Notch pathways share similar expression patterns and putative

functions. Also, Smo mRNA expression appears to be signifi-

cantly induced in response to Notch activation in Linneg bone

marrow progenitors (El Andaloussi et al., 2006; Vilimas et al.,

2007). These observations suggest a functional redundancy

between the two pathways in adult HSC function. To test this

hypothesis, we generated mice deficient for both Smo and

RBPJ, a DNA-binding factor required for canonical Notch

signaling, and performed competitive BMT. We injected polyI:

polyC into RBPJF/FSmoF/FMx1-Cre+ mice and confirmed the

excision of Smo- and RBPJ-floxed alleles as well as the recom-

bination of both alleles in the bone marrow (Figure 4A). Next we

performed competitive BMT and found thatRBPJ/Smo-deficient

(DKO) cells were able to efficiently reconstitute irradiated hosts.

Analysis of chimerism in the peripheral blood 6–10 weeks after

BMT did not reveal any defects for DKO cells (Figure 4B). In

fact, donor cells derived from DKO bone marrow were able to

give rise to LSKs in bone marrow (Figure 4C) and B220+ cells

in the spleen (Figure 4F). There were no significant differences

in the number of donor-derived LSKs between the two groups

12 weeks post-BMT (Figure 4D). As expected, donor-derived

T cells (CD4+CD8+ T cells in thymus, and TCRb+ cells in spleen)

(Figures 4E and 4F) and marginal zone B cells (B220+CD21high

CD23low/� cells in spleen) (Figure 4F) were reduced in recipients

transplanted with DKO bone marrow, since Notch signaling is

required for the development of these two lineages. Collectively,

these results show that neither Notch nor Hh signaling is

A

D E

B C

Figure 2. Physiological Differentiation of Smo-Deficient Progenitors

(A) The number of colonies was scored on day 7 of methylcellulose assay, and images of plates are shown on right panel.

(B) The number of colonies was scored on day 7 after replating cells from (A).

(C) PCR on genomic DNA of colonies formed from (A). The Smo D allele and a loading control genomic allele are shown.

(D) Quantitative RT-PCR of Smo and Ptch1 on colonies formed from (A). The expression levels were normalized against b-actin.

(E) Survival curve of control (gray) or SmoD/D (black) mice after weekly 5-FU injection (n = 5).

Cell Stem Cell



necessary for adult HSC maintenance and differentiation.

Furthermore, these data suggest that these two pathways are

not redundant in governing HSC fate.

Mapping of Hh Signaling Component Expressionin HSCs and Their NicheThe absence of a phenotype in Smo-deficient HSCs suggested

that the Hh signalingmight not be active or of low activity in these

cells. To determine whether elements of the Hh signaling

network can be detected in either HSCs or the HSC ‘‘niche,’’

the expression of the components of this pathwaywas examined

in flow-purified LSKs and differentiated MPs. We found that both

the Smo transducer and Ptch1 receptor mRNAs (which is also

a target gene of Hh signaling) were expressed in LSKs and

MPs (Figure S6A). In contrast, the members of Hh ligand family,

Ihh and Dhh, but not the Shh mRNA, were detected in primary

preparations of calvarial osteoblasts, cells that comprise the

osteoblastic HSC niche (Figure S6B), demonstrating that Hh

ligands are available to HSCs. Several mouse and human oste-

oblastic lines showed similar Hh expression profiles (data not

shown). However, the expression of the downstream transcrip-

tion factors Gli1, Gli2, and Gli3 was not detectable in either

LSKs or MPs by quantitative PCR (Figure S6C) and microarray

analysis (data not shown), a result that suggested low levels of

Hh activity in both LSK and MP populations. Therefore, these

data indicate that HSCs and progenitors have the ability to

receive Hh signaling, since they express both the Smo and

Ptch1 receptors and Hh ligands are present in the niche. Never-

theless, there is little ongoing Hh activity as the transcription

factors are not expressed, which is consistent with the described

lack of HSC phenotype in Smo-deficient mice.

Hh Pathway Activation Does Not Expand HSCsor Enhance Their Engrafting AbilityIt has been proposed previously that Hh morphogens could be

used for in vitro expansion of primitive stem cell and progenitor

populations and thus could be beneficial in transplantation

protocols (Bhardwaj et al., 2001). Our results have shown an

A

B

E F

C D

Figure 3. Physiological Competitive Ability of Smo-Deficient Hematopoietic Progenitors

(A) Scheme of primary and secondary BMT.

(B) Percentage of chimerism in peripheral blood of recipientmice at different time points after primary competition BMT. Donor cells were total bonemarrow cells.

Mean ± SD are shown (n = 8).

(C) Chimerism of peripheral blood of recipient mice 14 weeks after primary competition BMT. Donor cells were flow-purified LSK cells. Mean ± SD are shown

(n = 4).

(D) Quantitative RT-PCR of Smo in flow-purified Ly5.2+Lin� bone marrow of recipients 16 weeks after BMT. Grey, control; black, SmoD/D. The expression levels

were normalized against b-actin.

(E) Representative FACS plot of bone marrow and spleen of primary recipient mice 16 weeks after BMT.

(F) Representative FACS plot of peripheral blood in the recipient (n = 4 for each genotype) 12 weeks after secondary competition BMT.

Cell Stem Cell



incomplete Hh activation in HSCs, suggesting that Hh pathway

activation could either expand HSCs or provide them with

competitive advantage in transplantation settings. To directly

test this hypothesis, we used a Hh gain-of-function model

(R26SmoM2) in which enhanced yellow fluorescent protein

(EYFP) was fused with the constitutively active W539L point

mutation of the mouse smoothened homolog gene (SmoW539L)

and ‘‘knocked’’ into the ubiquitously expressed ROSA26 locus

(Jeong et al., 2004). The expression of SmoM2/EYFP fusion

gene is blocked by a loxP-flanked STOP fragment inserted

between the ROSA26 promoter and the SmoW539L/EYFP

sequence (Figure 5A). We crossed these mice to the Mx1-Cre

stain and generated R26SmoM2/SmoM2Mx1-Cre+ (referred to here-

after as Cre+) or R26SmoM2/SmoM2 Mx1-Cre� (referred to as Cre�)and induced SmoW539L/EYFP expression by injecting polyI:po-

lyC. As shown in Figure 5B, YFP expression was detected by

flow cytometry in LSKs of Cre+ mice after polyI:polyC adminis-

tration. At the mRNA level, both Smo and Ptch1 expression

were significantly increased in the LSKs of Cre+ compared to

Cre� mice (Figure 5C), demonstrating the overexpression of

Smo and activation of the Hh pathway. Also, it was found that

elements of the Hh pathway (Ptch, Gli1) were aberrantly ex-

pressed in differentiated hematopoietic cells (thymic CD4+8+

cells) in which the pathway is normally silent (data not shown).

An additional indication of nonphysiological Hh activation was

that themajority of Cre+ mice died later in life due to the develop-

ment of tumors (primarily medulloblastomas and skin tumors,

data not shown). However, Cre+ mice did not show any increase

in absolute numbers of LSKs (Figure 5D), illustrating that the

hyperactivation of Hh signaling was unable to result in expansion

of the LSK compartment. Moreover, LSKs of Cre+ mice did not

show any signs of enhanced (or suppressed) apoptosis or aber-

rant cell-cycle profiles, as shown by AnnexinV or Ki67 staining.

Finally, no major defects in lymphopoiesis were detected

(Figure 5E).

To further examine whether hyperactivation of Hh influences

the ability of LSKs to differentiate, CFU methylcellulose-based

assays were performed. We observed that Smo mutant LSKs

A

D E F

B C

Figure 4. Physiological Competitive Ability of RBPJ and Smo Double-Deficient Progenitors

(A) PCR of genomic DNA extracted from bone marrow cells of polyI:polyC-injected RBPJF/FSmoF/FMx1-Cre� mice (control) and RBPJF/FSmoF/FMx1-Cre+ mice

(DKO). Smo and RBPJ floxed and deleted (D) alleles were detected.

(B) Chimerism of total peripheral blood (upper panel) or Mac1+Gr1+ cells in peripheral blood (lower panel) of recipient mice at different time points after primary

competition BMT. Donor cells weremixed of 1:2 ratios of Ly5.1+ cells and Ly5.2+ cells. Ly5.2+ cells were either from control (gray) or DKOmice (black). Mean ± SD

are shown (n = 2 for control, n = 6 for DKO).

(C) Representative FACS plot of bone marrow in the recipient mice 12 weeks after competitive BMT.

(D) Number of donor-derived LSK cells in bone marrow 12 weeks after BMT. Mean ± SD are shown (n = 10 for control, n = 4 for DKO).

(E) Representative FACS plot of thymus in the recipient at 12 weeks after competition BMT.

(F) Representative FACS plot of spleen in the recipient 12 weeks after competitive BMT.

Cell Stem Cell



gave rise to similar number of colonies as controls. Moreover, re-

plating of the colonies that originated from the Hh hyperactive

LSKs also generated an identical number of colonies as controls

(Figure 5F).

To directly test the reconstitution ability of Hh hyperactive

HSCs, we transplanted bone marrow cells from polyI:polyC-

treated Cre+ mice (Ly5.2+) mixed with Ly5.1+ competing bone

marrow into lethally irradiated Ly5.1+ hosts. Bone marrow cells

used for competitive BMT were confirmed to express YFP as

shown in Figure 5G. The chimerism in the peripheral blood

4–12 weeks after transplant was similar between Cre� and

Cre+ groups (Figure 5H), indicating that overexpression of an

activated Smo does not provide a competitive advantage to

HSCs. These observations argued against the suggestion that

Hh hyperactivation affects HSC expansion and in vivo fitness.

Hedgehog Signaling Is Dispensable for the Inductionor Maintenance of Lymphoblastic LeukemiaOur studies so far do not support a role for Hh signaling in phys-

iological adult HSC function. Recent reports (Dierks et al., 2008;

Zhao et al., 2009) suggested that Hh could affect BCR-ABL+

leukemia stem cell function and disease progression. These

conclusions led us to study the potential role of Hh in the induc-

tion andmaintenance of a different leukemia type, acute lympho-

blastic leukemia (ALL). It has been shown that the majority of

primary cases of T cell ALL (T-ALL) carry activating NOTCH1

mutated alleles (Weng et al., 2004). The study of these tumors

has revealed that the Hh pathway was active in T-ALL, since

both GLI1 and PTCH1 were highly expressed in many Notch1

mutant T-ALL cell lines (J.G., unpublished data) and PTCH1

were expressed in majority (38 out of 48) of primary T-ALL cases

A

E

F G H

B C D

Figure 5. Hyperactivation of the Hh Pathway Does Not Expand HSC Compartment

(A) Schematic representation of R26SmoM2 locus (upper panel) and Mx1-Cre locus (lower panel).

(B) Histogram of YFP gated on LSKs. Grey line, Rosa26SmoM2/SmoM2Mx1-Cre�; black line, R26SmoM2/SmoM2Mx1-Cre+.

(C) Quantative RT-PCR of Smo and Ptch1 in LSKs. The expression levels were normalized against b-actin.

(D) Frequency of LSK cells. Each diamond represents a single mouse, and the bar indicates the average number.

(E) Representative FACS plots of bone marrow from R26SmoM2/SmoM2Mx1-Cre� and R26SmoM2/SmoM2Mx1-Cre+ mice.

(F) Number of colonies was scored on first and secondary plating of methylcellulose assay.

(G) Histogram of YFP gated on lineage-negative cells of bone marrow, which were used for BMT in (H). Grey line, Rosa26SmoM2/SmoM2Mx1-Cre�; black line,

R26SmoM2/SmoM2Mx1-Cre+.

(H) Percentage of peripheral blood chimerism in recipient mice after competitive BMT of R26SmoM2/SmoM2Mx1-Cre� (gray) and R26SmoM2/SmoM2Mx1-Cre+ (black)

at different time points. One line represents one mouse (n = 4).

Cell Stem Cell



(Figure 6A). Thus, to test whether Hh signaling is required for the

transformation of hematopoietic progenitors in T-ALL, a well-

characterized transplantation model (Vilimas et al., 2007) was

used. Lineage-depleted bonemarrow from either polyI:polyC-in-

jected SmoF/FMx1-Cre� or SmoF/FMx1-Cre+ mice was isolated

and infected with a bicistronic retroviral vector expressing the

intracellular domain of Notch1 (Notch-IC), and green fluorescent

protein (GFP). As expected, peripheral blood analysis of recipi-

ents of Notch-IC-infected control cells revealed that the majority

of cells were GFP+, a marker of Notch-IC expression, most of

which were CD4+8+, a manifestation of T-ALL (Figure 6B). Exam-

ination of recipients that had received Notch-IC-infected Smo-

deficient cells showed similar percentages of GFP+CD4+CD8+

cells in the peripheral blood as well as kinetics of leukemogen-

esis (Figures 6B and 6C). We further confirmed that T-ALL cells

developed from Smo-deficient progenitors deleted the Smo-

floxed and harbored a SmoD allele (Figure 6D), which demon-

strated that Hh signaling is dispensable for T-ALL generation.

To address the ability of Smo-deficient tumors to regenerate,

we performed secondary BMTs using Notch1-transformed

(GFP+) leukemic cells. No significant differences in the induction

of secondary leukemia were noted, in opposition to a role for Hh

signaling in the regulation of putative ‘‘leukemia-initiating’’ cells

(Figure 6E). To further demonstrate that Hh signaling is not

essential for the maintenance of the transformed cells, several

T-ALL lines (PTCH1 and GLI1 positive) were incubated with the

potent and specific Smo inhibitor cyclopamine. In agreement

with our in vivo data, the presence of cyclopamine did not affect

the leukemic cell line survival or the rate of proliferation (data not

shown). Taken together, these results indicate that Hh activation

is dispensable for the transformation of hematopoietic progeni-

tors and the progression of Notch-induced T-ALL.

DISCUSSION

In this study, we demonstrate that inducible genetic deletion of

the only nonredundant element of the Hh cascade, Smo, was

unable to affect adult hematopoiesis, specifically at the level of

the HSC. Smo-deficient HSCs display normal abilities to differ-

entiate, self-renew, and regenerate the immune system. In

agreement with these phenotypic and functional studies, gene

expression profiling analysis demonstrated that HSC-specific

gene expression ‘‘signature’’ was preserved in Smo-deficient

HSCs. Interestingly, the simultaneous ablation of both the Hh

and Notch pathways was also unable to affect HSC differentia-

tion and function. Moreover, using a gain-of-function model,

we found that Hh hyperactivation did not lead to expansion of

the HSC compartment. Finally, Smo deletion had no effect on

the ability of the Notch1 oncogene to transform early HSCs

and progenitors and to induce T-ALL. All of these findings are

of unique importance, as they directly question the current

consensus on the role of Hh signaling in adult hematopoiesis.

Our studies are in contrast to a recent report by Zhao et al. that

also used a conditional Smo allele deletion (Zhao et al., 2009).

One possible explanation for this discrepancy is the utilization

of a distinct mode of deletion. Zhao et al. use the Vav-cre deleter

strain that appears to be hematopoietic specific; however, it is

able to delete the Smo alleles in both adult and fetal

A

B E

C D

Figure 6. Leukemia (T-ALL) Induction and Maintenance Is Not Altered by Smo Deficiency

(A) RT-PCR of PTCH1 in primary T-ALL samples. GAPDH served as a loading control.

(B) Representative FACS plots for CD4 and CD8 staining of peripheral blood from the recipients 2 weeks following transplantation with Notch-IC-infected control

or SmoD/D lineage-negative bone marrow cells. Notch-IC-infected cells were identified by gating on GFP+ cells.

(C) Survival curve of host mice transplanted with Notch-IC-infected control (black) or SmoD/D lineage-negative bone marrow cells (gray) (n = 5).

(D) PCR of Smo-floxed and D alleles on genomic DNA purified from GFP+CD4+CD8+ peripheral blood of host mice in (B).

(E) Representative FACS plots for CD4 andCD8 staining of peripheral blood from the recipients (n = 5) 3 weeks after secondary BMT. GFP+ (53 106) bonemarrow

cells from primary recipients were used for secondary BMT.

Cell Stem Cell



hematopoiesis. Indeed, it was previously shown that the Vav

promoter can efficiently drive Cre-recombinase expression in

E13.5 fetal liver HSC (Stadtfeld and Graf, 2005). It is possible

that the reportedHSCdefects in the Vav-creSmoF/Fmodel reflect

Hh signaling functioning not in adult but in fetal HSC function and

hematopoiesis. Although future work is required to identify puta-

tive Hh roles in fetal hematopoiesis, our data clearly demonstrate

that Hh signaling is dispensable for adult HSC function.

Our observations suggest that Hh hyperactivation is unable to

expand bone marrow stem cells and progenitors, a conclusion

that is inconsistent with a report by Trowbridge and colleagues

(Trowbridge et al., 2006). A potential reason for this discrepancy

could be the utilization of different animal models. In the germline

Ptch+/� model, HSC and/or the HSC ‘‘niche’’ could contribute to

phenotype, whereas in the inducible SmoM2 model, expression

of the activated allele is largely restricted to the hematopoietic

compartment. Moreover, putative differences on the effect of

Hh hyperactivation on HSC/LSK cell-cycle progression could

be explained by the differential analysis performed. Indeed,

Trowbridge et al. study the cell-cycle status ofPtch+/� LSKs after

transplantation, while we study steady-state LSKs shortly after

SmoM2 activation. Finally, it is important to note that the gain-

of-function of a pathway effector (SmoM2) may well engender

a different hematopoietic phenotype than the loss-of-function

of a negative regulator (Ptch) that may have effects on other

signaling pathways that could influence hematopoiesis.

Our analyses also failed to demonstrate a significant effect of

Smo deletion on T cell differentiation, as proposed previously by

several studies including one from our own laboratory, in which

Smowasdeleted inearlyTcell progenitorsusing theLck-cre strain

(Crompton et al., 2007; El Andaloussi et al., 2006). This discrep-

ancy could be due to the differential mode of Cre-recombinase

activation and pathway deletion. Indeed, Lck-cre is only active in

early thymocytes, and it ensures deletion in both fetal and adult

thymus, suggesting again that fetal and adult hematopoiesis

have unique and distinct Hh signaling requirements. Another

reason for the phenotypic discrepancy could be that the Lck-

cre-driven thymic effect was only partial. It is thus possible that

our current studies, aimedmainly at HSC function, were not quan-

titative enough to reveal slight alterations of early T cell differenti-

ation. It ismore difficult to explain the differential effects on thymic

size andprogression of T cellmaturation of theMx1-cre-mediated

Smo deletion reported by El Andaloussi et al. The timing of the

analysis could provide a potential explanation. In this study, thymi

wereanalyzedatweeks4and16postdeletion,whileEl Andaloussi

et al. analyzedmiceonly 1weekafter the last polyI:polyC injection.

It is thus possible that the outcome of these studies was dictated

by the timing of the analysis, especially as the thymus is a tissue

with enormous regenerative capacity. Additional explanations

could also include background differences, as the mice studied

here (and by Hofmann et al., 2009 [this issue of Cell Stem Cell])

are C57Bl/6 SmoF/F, while El Andaloussi et al. utilized 129X1/SvJ

SmoF/null animals. It is thuspossible that the effects onTcell devel-

opment were influenced by the genetic background of the

analyzed mice. Future studies that directly compare T cell devel-

opment in the different Hh-deficient strains are necessary to

address the extent of Hh function in T cell development.

Is there any role for Hh in hematopoiesis? The strongest

evidence supporting a pivotal role of Hh signaling in hematopoi-

esis came from the study of zebrafish embryo Hh mutants (Ger-

ing and Patient, 2005). As zebrafish hematopoiesis shares

striking similarities to the mammalian fetal blood development,

it is possible that the Hh pathway, as previously suggested, plays

a more prominent role during fetal blood development. More-

over, it is possible that Hh function is masked by the synergistic

function of other signaling pathways. Indeed, pathways such as

Notch and Wnt, which have been previously shown to be

capable of interacting with Hh (Hallahan et al., 2004; Mak

et al., 2006; Yang and Niswander, 1995; Yokota et al., 2004),

could collaborate with each other to ensure self-renewal and

specify differentiation (Duncan et al., 2005). In this report, we

showed that deletion of both RBPJ and Smo did not affect

HSC function, suggesting Notch and Hh signaling do not play

synergistic roles. However, we cannot exclude potential redun-

dancy with other signaling cues.

Two recent reports (Dierks et al., 2008; Zhao et al., 2009) have

identified Smo as a drug target for the targeting of BCR-ABL+

human leukemic stem cells, introducing the notion that the Hh

pathway could be important for malignant hematopoiesis and

themaintenanceof leukemia. In the lightof theseseminal findings,

our results areof further importance as theyprove that pharmaco-

logical targetingofHh in leukemia is feasible asphysiologicalHSC

function and progression of hematopoiesis remains unaffected.

They also suggest that not all blood malignancies can be treated

using similar therapeutic protocols, as the progression of T-ALL is

not affected by the silencing of Hh function.

EXPERIMENTAL PROCEDURES

Animals

SmoF/F mice (Long et al., 2001) were a gift of Dr. A. McMahon (Harvard Univer-

sity, Boston). Genotyping of SmoF/F (Long et al., 2001; Zhang et al., 2001) and

RBPJF/F mice (Han et al., 2002; Tanigaki et al., 2004) was performed as previ-

ously reported. SmoF/FMx1-Cre animals were injected with 20 mg polyI:polyC

per gram of body weight for a total of three injections. The injections were initi-

ated 14 days after birth and done every 2 days. Animals were analyzed

4–6 weeks after the last injection unless indicated otherwise. All animal exper-

iments were done in accordance to the guidelines of the NYU School of

Medicine. Gli1lacZ mice were a gift of Dr. A. Joyner (Memorial Sloan Kettering

Cancer Center, New York). ROSA26SmoM2 mice (Jeong et al., 2004) were

purchased from Jackson Laboratory. For 5-FU experiments, 150 mg of 5-FU

per gram of body weight were intraperitoneally injected every week.

Antibodies and FACS Analysis

Antibody staining and FACS analysis were performed as previously described

(Aifantis et al., 1999). All antibodies were purchased from BD Pharmingen or

e-Bioscience. We used the following antibodies: c-kit (2B8), Sca-1 (D7),

Mac-1 (M1/70), Gr-1 (RB6-8C5), NK1.1 (PK136), TER-119, CD3 (145-2C11),

CD19 (1D3), IL7Ra (A7R34), CD34 (RAM34), FcgII/III (2.4G2), Flk-2/Flt-3

(A2F10.1), CD4 (RM4-5), CD4 (H129.19), CD8 (53-6.7), CD25 (PC61), CD44

(IM7), CD45.1 (A20), CD45.2 (104), CD150 (9D1), CD48 (HM481), Ki67, Annex-

inV, and 7-AAD. Bone marrow lineage antibody cocktail includes Mac-1, Gr-1,

NK1.1, TER-119, CD3, and CD19. For Ki67 and DAPI staining, briefly, the cells

were first treated with Fix and Perm reagents according to the manufacturer’s

instruction (Invitrogen), stained with Ki67 for 20 min at room temperature, and

then washed and resuspended in PBS with 5 mg/ml RNaseA and 2 mg/ml DAPI.

RT-PCR

Total RNA was isolated using the RNeasy Plus Mini Kit (QIAGEN), and cDNA

was synthesized using the SuperScript First-Strand Kit (Invitrogen). Quantita-

tive PCR was performed using iQ SYBR Green Supermix and an iCycler

(Bio-Rad) using the primer sequences (Tm = 60�C used for all primers)

Cell Stem Cell



provided in Table S1. T-ALL patient samples were provided by collaborating

institutions in the United States (St. Jude Children’s Research Hospital,

Memphis, TN) and Canada (Hospital for Sick Children, Toronto, Canada)

(Thompson et al., 2007).

Methylcellulose Assay

LSKcellswereflowpurified frompolyI:polyC-injectedmice.LSKcellswereplated

in duplicate (500 LSK/35mm dish) into cytokine-supplemented methylcellulose

medium (MethoCult 3434, Stem Cell Technologies), and the number and

morphologyofcolonieswerescored7days later. Forsecondaryplating,cell colo-

nies were pooled from the first plating, and 4000 cells were plated in duplicate.

Bone Marrow Transplantation

Bonemarrow cells (53 105) (Ly5.2+) or 500 LSKs (Ly5.2+) were transplanted by

retro-orbital i.v. injections into lethally irradiated (960 cGy) BL6SJL (Ly5.1+)

recipient mice in competition with 5 3 105 B6SJL (Ly5.1+) bone marrow cells.

Peripheral blood of recipient mice was collected at 4, 8, and 12 weeks after

transplant. For secondary transplants, recipient mice were sacrificed 16

weeks after primary transplant. Ly5.2+ bone marrow cells were flow purified,

and 5 3 105 cells were transplanted by retro-orbital i.v. injections into lethally

irradiated (960 cGy) BL6SJL (Ly5.1+) recipient mice in competition with 53 105

B6SJL (Ly5.1+) bone marrow cells.

Microarray Analysis

A group of four mice was pooled for each condition. Microarray analysis was

performed as previously described (Thompson et al., 2008). Briefly, freshly

isolated cells were sorted by surface marker expression, and total RNA was

extracted using the RNeasy kit (QIAGEN). In order to generate sufficient

sample quantities for oligonucleotide gene chip hybridization experiments,

we used the GeneChip Two-Cycle cDNA Synthesis Kit (Affymetrix, San

Jose, CA) for cRNA amplification and labeling. The amplified cRNA was

labeled and hybridized to the MOE430 Plus 2 oligonucleotide arrays (Affyme-

trix). The Affymetrix gene expression profiling data were normalized using the

previously published Robust Multi-Array Average (RMA) algorithm using the

GeneSpring 7 software (Agilent, Palo Alto, CA). The gene expression intensity

presentation was generated with MeV software (http://www.tm4.org).

Retroviral Infection of Lineage-Negative Bone Marrow Cells

Bone marrow cells were enriched for lineage-negative cells using EasySep kit

(StemCell Technology) and were cultured in OPTI-MEM supplemented with

10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml streptomycin, 50 ng/

ml SCF and Flt3l, and 10 ng/ml IL6 and IL7. For retroviral production, phoenix

cells were transfected with pMigNotch-IC by calcium phosphate method.

Virus supernatant was collected 48 hr posttransfection and used directly for

spin infection of lineage-depleted bone marrow cells at 2500 rpm for 90 min.

Forty-eight hours after infection, 1 3 105 lineage-negative GFP-positive cells

were i.v. injected into one lethally irradiated (960 cGy) C57BL/6J host mouse.

Statistical Analysis

The means of each data set were analyzed by using the Student’s t test with

a two-tailed distribution and assuming equal sample variance.

ACCESSION NUMBERS

Microarray data were deposited at the Gene Expression Omnibus (GEO) data-

base under the accession number GSE15194.

SUPPLEMENTAL DATA

Supplemental Data include one table and six figures and can be found with

this article online at http://www.cell.com/cell-stem-cell/supplemental/S1934-

5909(09)00151-9.

ACKNOWLEDGMENTS

We would like to thank Dr. A. McMahon for the SmoF/F animals, Dr. A. Joyner

for Gli1lacZ animals, Jiri Zavadil for advice on microarray analysis, Peter Lopez

for excellent cell-sorting support, Drs. T. Reya and G. Gilliland for sharing

unpublished observations, and C.W. Brains for constructive discussions.

The Aifantis laboratory is supported by a generous donation from the Helen

L. and Martin S. Kimmel Stem Cell Center, the National Institutes of Health

(NIH) (R56AI070310, RO1CA105129, and RO1CA133379 to I.A.; RO1

DK52208 to S.D.N.; and CA099978 to B.L.K.), the American Cancer Society

(RSG0806801 to I.A.), the Leukemia and Lymphoma Society (Scholar Award

to I.A. and a SCORAward to S.D.N.), the New York State Department of Health

(CO23058), the Irma T. Hirchl Trust, and the E. Mallinckrodt Foundation

(to I.A.). F.R. is supported by the Swiss National Science Foundation

(F3100A0-119725) and the Swiss Cancer League (KLS-01840-02-2006).

S.G. is supported by the Medical Student Training Program (MSTP) program

of the University of Chicago.

Received: January 26, 2009

Revised: March 3, 2009

Accepted: March 26, 2009

Published: June 4, 2009

REFERENCES

Adams, G.B., and Scadden, D.T. (2006). The hematopoietic stem cell in its

place. Nat. Immunol. 7, 333–337.

Aifantis, I., Feinberg, J., Fehling, H.J., Di Santo, J.P., and von Boehmer, H.

(1999). Early T cell receptor beta gene expression is regulated by the pre-T

cell receptor-CD3 complex. J. Exp. Med. 190, 141–144.

Bai, C.B., Auerbach, W., Lee, J.S., Stephen, D., and Joyner, A.L. (2002). Gli2,

but not Gli1, is required for initial Shh signaling and ectopic activation of the

Shh pathway. Development 129, 4753–4761.

Berardi, A.C., Wang, A., Levine, J.D., Lopez, P., and Scadden, D.T. (1995).

Functional isolation and characterization of human hematopoietic stem cells.

Science 267, 104–108.

Bhardwaj, G., Murdoch, B., Wu, D., Baker, D.P., Williams, K.P., Chadwick, K.,

Ling, L.E., Karanu, F.N., and Bhatia, M. (2001). Sonic hedgehog induces

the proliferation of primitive human hematopoietic cells via BMP regulation.

Nat. Immunol. 2, 172–180.

Cobas, M., Wilson, A., Ernst, B., Mancini, S.J., MacDonald, H.R., Kemler, R.,

and Radtke, F. (2004). Beta-catenin is dispensable for hematopoiesis and

lymphopoiesis. J. Exp. Med. 199, 221–229.

Crompton, T., Outram, S.V., and Hager-Theodorides, A.L. (2007). Sonic

hedgehog signalling in T-cell development and activation. Nat. Rev. Immunol.

7, 726–735.

Dierks, C., Grbic, J., Zirlik, K., Beigi, R., Englund, N.P., Guo, G.R., Veelken, H.,

Engelhardt, M., Mertelsmann, R., Kelleher, J.F., et al. (2007). Essential role of

stromally induced hedgehog signaling in B-cell malignancies. Nat. Med. 13,

944–951.

Dierks, C., Beigi, R., Guo, G.R., Zirlik, K., Stegert, M.R., Manley, P., Trussell,

C., Schmitt-Graeff, A., Landwerlin, K., Veelken, H., et al. (2008). Expansion

of Bcr-Abl-positive leukemic stem cells is dependent on Hedgehog pathway

activation. Cancer Cell 14, 238–249.

Duncan, A.W., Rattis, F.M., DiMascio, L.N., Congdon, K.L., Pazianos, G.,

Zhao, C., Yoon, K., Cook, J.M., Willert, K., Gaiano, N., et al. (2005). Integration

of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat.

Immunol. 6, 314–322.

El Andaloussi, A., Graves, S., Meng, F., Mandal, M., Mashayekhi, M., and

Aifantis, I. (2006). Hedgehog signaling controls thymocyte progenitor homeo-

stasis and differentiation in the thymus. Nat. Immunol. 7, 418–426.

Forsberg, E.C., Prohaska, S.S., Katzman, S., Heffner, G.C., Stuart, J.M., and

Weissman, I.L. (2005). Differential expression of novel potential regulators in

hematopoietic stem cells. PLoSGenet. 1, e28. 10.1371/journal.pgen.0010028.

Gering, M., and Patient, R. (2005). Hedgehog signaling is required for adult

blood stem cell formation in zebrafish embryos. Dev. Cell 8, 389–400.

Gu, H., Marth, J.D., Orban, P.C., Mossmann, H., and Rajewsky, K. (1994).

Deletion of a DNA polymerase beta gene segment in T cells using cell type-

specific gene targeting. Science 265, 103–106.

Cell Stem Cell



Hallahan, A.R., Pritchard, J.I., Hansen, S., Benson, M., Stoeck, J., Hatton,

B.A., Russell, T.L., Ellenbogen, R.G., Bernstein, I.D., Beachy, P.A., et al.

(2004). The SmoA1 mouse model reveals that notch signaling is critical for

the growth and survival of sonic hedgehog-induced medulloblastomas.

Cancer Res. 64, 7794–7800.

Hammerschmidt, M., Brook, A., andMcMahon, A.P. (1997). The world accord-

ing to hedgehog. Trends Genet. 13, 14–21.

Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K., Yoshimoto,M., Nakahata, T.,

Ikuta, K., and Honjo, T. (2002). Inducible gene knockout of transcription factor

recombination signal binding protein-J reveals its essential role in T versus B

lineage decision. Int. Immunol. 14, 637–645.

Hofmann, I., Stover, E.H., Cullen, D.E., Mao, J., Morgan, K.J., Lee, B.H., Kha-

ras, M.G., Miller, P.G., Cornejo, M.G., Okabe, R., et al. (2009). Hedgehog

signaling is dispensable for adult murine hematopoietic stem cell function

and hematopoiesis. Cell Stem Cell 4, this issue, 559–567.

Jankovic, V., Ciarrocchi, A., Boccuni, P., DeBlasio, T., Benezra, R., and Nimer,

S.D. (2007). Id1 restrains myeloid commitment, maintaining the self-renewal

capacity of hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 104, 1260–

1265.

Jeong, J., Mao, J., Tenzen, T., Kottmann, A.H., and McMahon, A.P. (2004).

Hedgehog signaling in the neural crest cells regulates the patterning and

growth of facial primordia. Genes Dev. 18, 937–951.

Lessard, J., Faubert, A., and Sauvageau, G. (2004). Genetic programs regu-

lating HSC specification, maintenance and expansion. Oncogene 23, 7199–

7209.

Long, F., Zhang, X.M., Karp, S., Yang, Y., and McMahon, A.P. (2001). Genetic

manipulation of hedgehog signaling in the endochondral skeleton reveals

a direct role in the regulation of chondrocyte proliferation. Development 128,

5099–5108.

Maillard, I., Koch, U., Dumortier, A., Shestova, O., Xu, L., Sai, H., Pross, S.E.,

Aster, J.C., Bhandoola, A., Radtke, F., et al. (2008). Canonical notch signaling

is dispensable for the maintenance of adult hematopoietic stem cells. Cell

Stem Cell 2, 356–366.

Mak, K.K., Chen,M.H., Day, T.F., Chuang, P.T., and Yang, Y. (2006). Wnt/beta-

catenin signaling interacts differentially with Ihh signaling in controlling endo-

chondral bone and synovial joint formation. Development 133, 3695–3707.

Mansson, R., Hultquist, A., Luc, S., Yang, L., Anderson, K., Kharazi, S.,

Al-Hashmi, S., Liuba, K., Thoren, L., Adolfsson, J., et al. (2007). Molecular

evidence for hierarchical transcriptional lineage priming in fetal and adult

stem cells and multipotent progenitors. Immunity 26, 407–419.

Moore, K.A., and Lemischka, I.R. (2006). Stem cells and their niches. Science

311, 1880–1885.

Morrison, S.J., and Spradling, A.C. (2008). Stem cells and niches: mechanisms

that promote stem cell maintenance throughout life. Cell 132, 598–611.

Nusslein-Volhard, C., and Wieschaus, E. (1980). Mutations affecting segment

number and polarity in Drosophila. Nature 287, 795–801.

Reya, T., Duncan, A.W., Ailles, L., Domen, J., Scherer, D.C., Willert, K., Hintz,

L., Nusse, R., and Weissman, I.L. (2003). A role for Wnt signalling in self-

renewal of haematopoietic stem cells. Nature 423, 409–414.

Stadtfeld, M., and Graf, T. (2005). Assessing the role of hematopoietic plas-

ticity for endothelial and hepatocyte development by non-invasive lineage

tracing. Development 132, 203–213.

Stier, S., Cheng, T., Dombkowski, D., Carlesso, N., and Scadden, D.T. (2002).

Notch1 activation increases hematopoietic stem cell self-renewal in vivo and

favors lymphoid over myeloid lineage outcome. Blood 99, 2369–2378.

Tanigaki, K., Tsuji, M., Yamamoto, N., Han, H., Tsukada, J., Inoue, H., Kubo,

M., and Honjo, T. (2004). Regulation of alphabeta/gammadelta T cell lineage

commitment and peripheral T cell responses by Notch/RBP-J signaling.

Immunity 20, 611–622.

Terskikh, A.V., Miyamoto, T., Chang, C., Diatchenko, L., and Weissman, I.L.

(2003). Gene expression analysis of purified hematopoietic stem cells and

committed progenitors. Blood 102, 94–101.

Thompson, B.J., Buonamici, S., Sulis, M.L., Palomero, T., Vilimas, T., Basso,

G., Ferrando, A., and Aifantis, I. (2007). The SCFFBW7 ubiquitin ligase complex

as a tumor suppressor in T cell leukemia. J. Exp. Med. 204, 1825–1835.

Thompson, B.J., Jankovic, V., Gao, J., Buonamici, S., Vest, A., Lee, J.M.,

Zavadil, J., Nimer, S.D., and Aifantis, I. (2008). Control of hematopoietic

stem cell quiescence by the E3 ubiquitin ligase Fbw7. J. Exp. Med. 205,

1395–1408.

Trowbridge, J.J., Scott, M.P., and Bhatia, M. (2006). Hedgehogmodulates cell

cycle regulators in stem cells to control hematopoietic regeneration. Proc.

Natl. Acad. Sci. USA 103, 14134–14139.

Uhmann, A., Dittmann, K., Nitzki, F., Dressel, R., Koleva, M., Frommhold, A.,

Zibat, A., Binder, C., Adham, I., Nitsche, M., et al. (2007). The Hedgehog

receptor Patched controls lymphoid lineage commitment. Blood 110, 1814–

1823.

Vilimas, T., Mascarenhas, J., Palomero, T., Mandal, M., Buonamici, S., Meng,

F., Thompson, B., Spaulding, C., Macaroun, S., Alegre, M.L., et al. (2007).

Targeting the NF-kappaB signaling pathway in Notch1-induced T-cell

leukemia. Nat. Med. 13, 70–77.

Weng, A.P., Ferrando, A.A., Lee, W., Morris, J.P., 4th, Silverman, L.B.,

Sanchez-Irizarry, C., Blacklow, S.C., Look, A.T., and Aster, J.C. (2004). Acti-

vating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia.

Science 306, 269–271.

Wilson, A., and Trumpp, A. (2006). Bone-marrow haematopoietic-stem-cell

niches. Nat. Rev. Immunol. 6, 93–106.

Yang, Y., and Niswander, L. (1995). Interaction between the signaling mole-

cules WNT7a and SHH during vertebrate limb development: dorsal signals

regulate anteroposterior patterning. Cell 80, 939–947.

Yin, T., and Li, L. (2006). The stem cell niches in bone. J. Clin. Invest. 116,

1195–1201.

Yokota, N., Mainprize, T.G., Taylor, M.D., Kohata, T., Loreto, M., Ueda, S.,

Dura, W., Grajkowska, W., Kuo, J.S., and Rutka, J.T. (2004). Identification of

differentially expressed and developmentally regulated genes in medulloblas-

toma using suppression subtraction hybridization. Oncogene 23, 3444–3453.

Zhang, X.M., Ramalho-Santos, M., and McMahon, A.P. (2001). Smoothened

mutants reveal redundant roles for Shh and Ihh signaling including regulation

of L/R asymmetry by the mouse node. Cell 105, 781–792.

Zhao, C., Chen, A., Jamieson, C.H., Fereshteh, M., Abrahamsson, A., Blum, J.,

Kwon, H.Y., Kim, J., Chute, J.P., Rizzieri, D., et al. (2009). Hedgehog signalling

is essential for maintenance of cancer stem cells in myeloid leukaemia. Nature

458, 776–779.

Cell Stem Cell



Ross Levine, M.D. Geoffrey Beene Junior Chair

Associate Attending Physician, Leukemia Service Associate Member, Human Oncology and Pathogenesis Program

1275 York Avenue, Box 20 New York, NY 10021

Phone (646) 888-2767 Fax (646) 422-0856 [email protected]

Wednesday, September 28, 2011 To the Jose Carreras International Leukaemia Foundation Study Section: It is my great pleasure to write this letter to support Dr. Jie Gao’s application for a Jose Carreras International Leukaemia Foundation award. I have followed her research closely during the last 3 years as my laboratory closely collaborates with her and with the lab of his advisor, Dr. Aifantis. We share joint lab meetings every other week, have submitted multiple joint grant applications (including some of Jie’s work) and had multiple joint papers together with the Aifantis lab. It is in these contexts I have had the chance to learn about her work in one of these meetings. In addition, Dr. Gao has been a key collaborator recently as she is helping us define the in vivo role of ASXL1 in hematopoiesis and myeloid leukemia. She is closely interacting with my laboratory and has been key in the generation and study of ASXL1-/- mice, which is currently a major focus in my laboratory in collaboration with Jie and Iannis. Dr. Gao’s research interest and expertise is in the field of hematology. Dr. Gao obtained her Ph.D. in Genetics from Columbia University under the supervision of Dr. Riccardo Dalla-Favera, one of the leaders in B cell lymphoma field. Dr. Gao studied the regulation of BCL6, a proto-oncogene associated with 40% Diffuse Large B cell Lymphoma. She and her colleague discovered that the CD40 signaling pathway led to downregulation of BCL6 physiologically in normal lymphoid cells. However, they found this pathway was unresponsive in a subset of DLBCL tumors consistent with constitutive BCL6 activity. This finding reveals a direct relevance for understanding the pathogenesis of DLBCL. This result was published in Cancer Cell 2007. After her graduation Dr. Gao joined Dr. Aifantis’s lab at NYU for postdoctoral training, where she has focused on the study of hematopoietic stem cell differentiation and transformation. Initially, she played a key role in the characterization of the role of the E3 ubiquitin ligase Fbw7 in HSC self-renewal and differentiation (J Exp Medicine 2008). Subsequently, she and her colleagues in the Aifantis Lab demonstrated that Fbw7 governs the HSC quiescence by targeting and degrading its substrate c-Myc (Nature Immunology 2010). This was the first report to show that a single pair of ligase-substrate Fbw7-cMyc is able to regulate HSC quiescence. This work was featured as cover in the issue of Nature Immunology and highlighted in News and Views in the same journal. Dr. Gao’s initial major project was to determine the role of Hedgehog (Hh) signaling pathway in HSC differentiation. The Hh pathway (together with Notch and Wnt) is one of the most developmentally conserved pathways essential for tissue homeostasis and cancer. Previous to Jie’s work there were controversial data about the function of Hh in

mammalian HSCs. To directly address Hh function, Dr. Gao set up loss- and gain-of-function Hedgehog mouse models. Her work showed definitively that Hh activity is dispensable for adult HSC maintenance (Gao et al. Cell Stem Cell 2009), suggesting that Hh, which is often hyper-activated in certain types of leukemia, represents a novel therapeutic target in leukemia patients. Dr. Gao’s work had great impact on the stem cell and cancer fields and was broadly discussed in articles in Nature Reviews Cancer, Nature Reports Stem Cell, and Cell Stem Cell. Dr. Gao’s current research is focusing on the role of a E3 ubiquitin ligase, called DDB1 in normal and malignant hematopoiesis. She has shown in preliminary data that DDB1 is essential for transiently expanding progenitor cell populations. Interestingly, DDB1 also plays an important role in T-cell leukemia (T-ALL) induction and progression. Silencing DDB1 completely blocks initiation and maintenance of this type of leukemia. The aims in her proposal are designed to determine how DDB1 function contributes to leukemia pathogenesis. Dr. Gao’s future work will not only illustrate mechanisms of the leukemia development and identify therapeutic targets in future cancer treatment since E3 ligases can be specifically targeted by small molecules. Dr. Gao is a talented young investigator, as evidenced by her multiple publications, and evidenced by her receipt of an award from the Lady Tata Memorial Trust. She has now entered the latest, critical part of her training, which will lead to her transition to an independent investigator. According to Dr. Aifantis, Jie is one of the best fellows that has trained in his lab and I have no doubt that she will successfully complete the proposed studies and embark on an independent career in the field of hematopoiesis. We are delighted to continue to work with her now and in the future! In summary, I strongly support Dr. Gao’s application for the Jose Carreras International Leukaemia Foundation Award. She would be an outstanding recipient who will make important contributions to the leukemia field. Sincerely,

Ross L. Levine, M.D

September 26th, 2011 To Whom It May Concern,

I am writing this letter to express my enthusiastic support for the renewal application of

Dr. Jie Gao for the Jose Carreras International Leukaemia Foundation Fellowship. I have interacted

extensively with Dr. Gao, first during her PhD training in the Dalla-Favera Lab at the Institute

for Cancer Genetics at Columbia University, and then through our long-standing collaboration

with the Aifantis Lab, where she is currently working as postdoctoral fellow.

Dr. Gao, is a very skilled young researcher with a solid background in Biochemistry and

Molecular Biology, and an outstanding training in the use of genetically modified mouse models

in the characterization of hematopoiesis and lymphoid transformation. After her graduation from

the Dalla-Favera lab, where she published a high-impact paper on the role of BCL6 in B cell

lymphoma, Jie applied for a postdoctoral position in the Aifantis lab at NYU, which I thought

was a perfect fit for her skills. Dr. Aifantis, a close collaborator, asked me for references about

her and I strongly supported her application.

During her initial period in the Aifantis Lab, Jie has done spectacular work focusing on

the function of the Hedgehog signaling pathway in the differentiation of stem cells of the

immune system. She was able to prove the pre-existing ideas in the field wrong, and show that

Hedgehog signaling was dispensable for stem cell self-renewal and differentiation. Her work is

significant from a clinical point of view, as Hedgehog inhibitors are currently being introduced

in clinical trials for the treatment of CML. This work was published at Cell Stem Cell and

contained very elegant genetic and biochemical experiments underlining, once more, Jie’s

technical and intellectual proficiency. This work was highly cited and discussed in the fields of

hematopoiesis and leukemia. After this period, Jie and her mentor focused on a novel mode of

ADOLFO FERRANDO, MD, PHD Assistant Professor of Pediatrics and Pathology Institute for Cancer Genetics 1130 St. Nicholas Avenue New York, NY 10032 212.851.4611 Tel 212.851.5256 Fax [email protected]

regulation of stem cell differentiation and transformation, the ubiquitin-proteasome system. She

initially helped the Aifantis lab characterize the role of the ubiquitin ligase Fbw7 and its

interaction with the Notch oncogene in leukemia (a project that my laboratory was also

involved). She went further, assisting the Aifantis lab generating Fbw7 conditional knock-out

mice and reporting that Fbw7 is also essential for adult hematopoietic stem cell self-renewal.

This was a very elegant study (published in a series of papers at the Journal of Experimental

Medicine and Nature Immunology) that involved utilization of novel cancer models and in vitro

embryonic stem cells assays. This was seminal work in the field of hematology, identifying the

first ubiquitin ligase:substrate pair controlling adult stem cell differentiation and transformation.

The project proposed here stems from this earlier work, as it was initiated by an

expression screen identifying novel Ubiquitin ligases able to control hematopoiesis. Jie identified

DDB1, generated a series of targeted mice and was able to show that DDB1 expression is

essential for both normal lymphocyte progenitor differentiation and well as for the initiation and

progression of acute lymphoblastic leukemia (ALL). Based on these exciting preliminary studies

I expect that Jie will be once more able to identify a novel exciting pathway essential for

leukemia progression. The clinical importance of these studies is significant as also suggested by

the recent introduction and FDA approval of Velcade, a general proteasome inhibitor, for the

treatment of multiple myeloma.

Jie is a skilled young scientist at a very critical turn of her career. I am convinced that the

leadership and rich scientific environment of the Aifantis lab and NYU are the perfect setting for

Jie’s skillful and enthusiastic research. I also believe that Jie has the requisite talent and drive to

successfully lead the project. In summary, Dr. Gao is a brilliant young researcher working in the

lab of a highly dynamic and productive investigator and one that the Foundation should support.

Sincerely,

Adolfo Ferrando, M.D., Ph.D.

Iannis Aifantis, Ph.D. NYU School of Medicine Early Career Scientist Department of Pathology Associate Professor 550 First Avenue, MSB 504, New York, NY 10016 212.253.5365, Fax 212 263 8211, [email protected] http://www.aifantislab.com

Jose Carreras International Leukemia Foundation September 28th, 2011

Dear Members of the JCILF Board of Directors, With this letter I would like to support the application of Dr. Jie Gao, currently a postdoctoral scientist working in my laboratory for a JCILF Postdoctoral Fellowship. I would like to clearly state that I would be her direct supervisor and she will perform her work in my laboratory at the NYU School of Medicine. Jie started her career in Shangai where she received he B.Sc. and her Masters Degree. Her accomplishments and publications brought her to Columbia University as a graduate student. There she performed her Ph.D. thesis work under the supervision of Dr. Riccardo Dalla-Favera, a leader in the fields of leukemia/lymphoma and lymphocyte function. There she studied the role of two transcription factors BCL6 and BCL7 in the transformation of B cells and in B cell leukemia. Jie has joined my laboratory mid-2007. In these almost two and a half years she has been simply spectacular. Initially she was involved in a very challenging project and helped us to identify Fbw7, a novel tumor suppressor, as a ubiquitin ligase with essential functions in the differentiation of hematopoietic stem cells. She has also shown that Fbw7 is mutated in almost 20% of pediatric T cell leukemia (T-ALL). These studies were published, with Jie as a co-author, at the Journal of Experimental Medicine (Thompson et al. 2008). Jie continued to help us study the role of Fbw7 and she has recently identified the oncogene c-Myc as an Fbw7 substrate in hematopoiesis. These studies resulted in another high-impact publication that appeared last year at Nature Immunology (Reavie et al. 2010). The main focus of her research was however another signaling pathway with oncogenic activity in pediatric blood tumors, the Hedgehog signaling network (Hh). The starting point was the existence of several publications that suggested that Hh is essential for self-renewal and differentiation of hematopoietic stem cells (HSC). However, none of these studies were performed in vivo. Jie has set up a beautiful genetic experiment that included conditional knock-out of the Hh receptor Smoothened, the Gli1 downstream transcription factor and –at the same time- she established a genetic overexpression system and she used a conditional gain-of-function Smoothened allele. So for the first time we were able to address the question using both loss- and gain-of-function models of study. Using this system Jie went against the dogmas and proved that Hedgehog signaling was dispensable for HSC self-renewal and differentiation. She didn't stayed there though. She combined the Hh deficiency with the deficiency on the Notch signaling pathway addressing a putative cooperation of the two developmental master regulators. She also addressed the activation and essential function of Hh activity in leukemia as recent reports suggested that Hh could be a promising therapeutic target in CML. Her work was published in the summer of 2009 at CELL Stem Cell (Gao et al. 2009) and was reviewed and discussed widely in the field (there were reviews of the work in Nature Reviews Cancer, Cell Cycle, Cell Stem Cell, Nature Reports Stem Cells, between others). For all these accomplishments Jie was awarded a one year Lady Tata Memorial Trust Postdoctoral Award (ending September 2011).

For this current application, Jie builds on her unique experience in the field of protein stability and leukemia and is proposing to directly test the role of a novel enzyme, the Ubiquitin ligase DDB1 in the induction and progression of T cell acute lymphoblastic leukemia (T-ALL), a devastating pediatric tumor. Jie identified DDB1 in leukemia-specific expression screens (searches for ubiquitin enzymes that can putatively affect leukemia induction), generated hematopoietic specific DDB1 conditional knock-out animal models and shows (in her preliminary data) that DDB1 is essential for early T cell development and the induction/maintenance of T cell leukemia (T-ALL). In her project she proposes to identify the mechanisms of DDB1 action in leukemic cells, and to test whether DDB1 is a good target for targeted leukemia stem cell therapies. The importance (both basic and clinical) of these studies is obvious, especially as DDB1 is an enzyme that can be targeted pharmacologically. I believe that with the help of your foundation Jie can complete these and use them to launch a successful future career as an independent investigator. I would like to mention here that none of these studies are supported by any other funding source. As evident from her previous work, Jie is both an impressive project planner and an excellent experimentalist. She is hard working and meticulous but at the same time very social and open to new ideas and stimuli. Also, as obvious by the breath of work that Jie is involved, she is an essential part of my laboratory and research program. Jie’s character and social skills make her indeed an important member in the lab. For her proposed project she will have total freedom to experiment. She will also interact with the other members of the lab and myself to help her with troubleshooting and result interpretation. To make sure that Jie will succeed and have a great future in science I have committed all resources available in the NYU scientific community and beyond. She will have technical support from the different NYU cores including the ES cell targeting, pathology, genomics, biostatistics, flow cytometry facilities. I have also established collaborations essential for the progression of her project with leader in the fields. Finally as a part of the NYU and HHMI families will have the chance to present her work and interact with several investigators, exchange ideas and receive criticism. Jie is a skilled and dynamic young investigator and I am delighted to host her in my laboratory. The work that she has done so far was phenomenal and will have significant impact in the field of hematopoietic stem cell research and leukemia. I believe that she is in a very critical juncture of her career as the next couple of years will be important for the establishment of her future as an independent researcher. I strongly believe that she has the background and intellectual strength to become a future leader in the field and strongly support her application. Please don’t hesitate to contact me for more details.

Sincerely,

Iannis Aifantis, Ph.D.

jose carreras international leukemia foundation form 1 …

Documents