JMed Genet 1996;33:655-660

PAX genes and human neural tube defects: anamino acid substitution in PAX1 in a patient withspina bifida

F A Hol,M P A Geurds, S Chatkupt, Y Y Shugart, R Balling, C T RMSchrander-Stumpel, W G Johnson, B C J Hamel, E C M Mariman

Department ofHumanGenetics, UniversityHospital Nijmegen,PO Box 9101,6500 HB Nijmegen,The NetherlandsF A HolM P A GeurdsB C J HamelE C M Mariman

Department ofNeurosciences andPediatrics,UMDNJ-New JerseyMedical School,Newark, New Jersey,USAS Chatkupt

Department ofGenetics andDevelopment,Colombia University,New York, NY, USAY Y Shugart

Institut fuirSaugetiergenetik,GSF-ForschungszentrumNeuherberg,Oberschleissheim,GermanyR Balling

Department of ClinicalGenetics, UniversityHospital Maastricht,Maastricht,The NetherlandsCTRMSchrander-Stumpel

Department ofNeurology,UMDNJ-Robert WoodJohnson MedicalSchool, NewBrunswick, New Jersey,USAW G Johnson

Correspondence to:Dr Hol.

Received 27 October 1995Revised version accepted forpublication 22 March 1996

AbstractFrom studies in the mouse and from theclinical and molecular analysis of patientswith type 1 Waardenburg syndrome, par-ticular members of the PAX gene familyare suspected factors in the aetiology ofhuman neural tube defects (NTD). Toinvestigate the role ofPAXI, PAX3, PAX7,and PAX9, allelic association studies wereperformed in 79 sporadic and 38 familialNTD patients from the Dutch population.Sequence variation was studied by SSCanalysis of the paired domain regions ofthe PAXI, PAX7, and PAX9 genes and ofthe complete PAX3 gene. In one patientwith spina bifida, a mutation in the PAXIgene was detected changing the conservedamino acid Gln to His at position 42 in thepaired domain of the protein. The muta-tion was inherited through the maternalline from the unaffected grandmother andwas not detected in 300 controls. In thePAX3 gene, variation was detected at sev-eral sites including a Thr/Lys amino acidsubstitution in exon 6. All alleles werepresent among patients and controls inabout the same frequencies. However, anincreased frequency of the rare allele of asilent polymorphism in exon 2 was foundin NTD patients, but no significant associ-ation was observed (p=0.06). No sequencevariation was observed in the paireddomain of the PAX7 and PAX9 genes.Our findings so far do not support a majorrole of the PAX genes examined in theaetiology of NTD. However, the detectionof a mutation in PAXI suggests that, inprinciple, this gene can act as a risk factorfor human NTD.(JMed Genet 1996;33:655-660)

Key words: neural tube defects; spina bifida; PAXgenes.

Neural tube defects (NTD) constitute a majorgroup of congenital malformations with anincidence of approximately 1/1000 pregnan-cies. It is generally accepted that they representmultifactorial traits with genetic and environ-mental factors contributing to the aetiology.Information about the identity of the geneticfactors involved is scarce. Induction of NTDby anti-epileptic drugs' and prevention ofNTD by folic acid2 suggest that genes for drugreceptors or metabolic enzymes may play a

role. Pedigree analysis and linkage data suggestthat the human X chromosome contains one ormore contributing genetic factors.3 Morespecifically, several members of the PAX genefamily, encoding a class of related embryonictranscription factors,4 have been proposed ascandidate genes for NTD.5 6 At present ninemembers have been identified and studies inthe mouse have shown that they are allexpressed in the developing brain, the neuraltube, or the paraxial mesoderm.

Mutations in the gene for Pax-1 are respon-sible for the phenotype of the mouse strainundulated with various vertebral anomalies.7 8Interestingly, litters resulting from a crossbetween undulated (un) and Patch (Ph) micehave a high incidence of lumbar spina bifidaocculta' indicating that Pax-1 can be involvedin specific forms of NTD.From the association between spina bifida

and Waardenburg syndrome type 1 (WS1),9-6the PAX3 gene can be regarded as a risk factorfor human NTD. Mutations in this gene havebeen detected in various patients with bothspina bifida and WS 1.17-1 Moreover, mutationsin the murine homologue of this gene cause theSplotch phenotype. Homozygous Splotch miceexhibit severe NTD6 whereas heterozygousPax-3 mutations seem to increase the inci-dence of NTD in other predisposed strains.20Linkage analysis has not provided geneticevidence for a major role of PAX3 in humanNTD.2'The above findings prompted us to investi-

gate further the role of PAX1 and PAX3, andtheir paralogues PAX9 and PAX7, respectively,by searching for mutations and sequence vari-ants in association with non-syndromic NTD.

Materials and methodsASCERTAINMENT OF PATIENTSPatients with non-syndromic NTD were se-lected from the Dutch population in collabora-tion with the Dutch patient organisationBOSK and from the records of our institute.Multiple case families were selected accordingto the criteria described previously.22 In short,there had to be two or more affected membersin each family with a close degree of relation-ship (s

Hol et al

1 2 3 4 5 6 7 8

PAX3 ; _' . . I. . . . 4.

2 3 4

PAX7I.- .

PAX1 r~~* 4

i=

PAX9

Figure1 Schematic representation ofparts of the different PAXgenes that were subjected to SSC analysis. Arrowheadswith connecting bars represent the amplification primers and amplifiedfragments. The filled region, the hatched region, andthe double hatched region represent the paired domain, the octapeptide sequence, and the homeodomain, respectively.

79 sporadic patients was also analysed, whichincluded patients with spina bifida (75), withanencephaly (2), and with encephalocele (2).Unaffected and unrelated subjects were ran-domly chosen from the Dutch population andused as a control group in the present study.Blood was sampled and DNA was extractedaccording to the procedure of Miller et al.23

SSC ANALYSISPCR amplification was performed to producethe appropriate DNA fragments (fig 1). Ampli-fication was carried out in a total volume of 25il containing 50 ng of genomic DNA, 0.45mmol/l of each primer (table 1; IsogenBioscience, The Netherlands), 0.1 mmol/ldCTP, 0.4 mmol/l dATP, 0.4 mmol/l dGTP,0.4 mmol/l dTTP, 0.1 j1l [a[32]P]dCTP(Amersham) in PCR buffer (50 mmol/l KC1,10 mmol/l TRIS-HCG, pH 8.3, 1 mmol/l DTE,0.001% gelatine, 1.5 - 6 mmol/l MgCl2) with0.5 U of Taq DNA polymerase (Boehringer,Mannheim). Samples were denatured at 92°C

for five minutes and then subjected to 35 cyclesof amplification: 92°C for 50 seconds, 55°C for50 seconds, 72°C for one minute 30 seconds.Aliquots of the amplified. DNA were mixedwith 1 volume formamide dye buffer, dena-tured at 95°C for five minutes, and placed onice. Samples (4 ,l) were loaded on a 5%non-denaturing polyacrylamide gel containing10% glycerol and on a similar gel without glyc-erol. Electrophoresis was for 3-6 hours at 40Wand 4°C. The gels were dried and exposedovernight on Kodak X-omat S film.

SEQUENCING OF NORMAL AND VARIANT ALLELESTo determine the molecular nature of theshifted bands observed by SSC analysis, bandsrepresenting wild type and variant alleles werecut out of the gel. DNA was eluted from eachof the gel slices in 50 gl aquadest for one hourat 37°C and reamplified under the conditionsdescribed above. Subsequently, the amplifiedDNA fragments were purified by electrophore-sis on a 1% agarose gel (one hour, 10 V/cm),

Table 1 Primers usedfor SSC analysis'8 28-31

Size (bp) Forward primer Reverse primer

PAX31 138 5'-CCTGGATATAATTTCCGAGCG-3' 5'-CGCTGAGGCCCTCCCTTA-3'2A 266 5'-GAAGACTGCGAAATTACGTGCTGC-3' 5'-ACAGGATCTTGGAGACGCAGCC-3'2B 208 5'-AACCACATCCGCCACAAGATCG-3' 5'-GACCACAGTCTGGGAGCCAGGAGG-3'3 237 5'-CACCTGGCCCAGGGTACCGGGTAC-3' 5'-CGGGGTAATAGCGACTGACTGTC-3'4 252 5'-AGCCCTGCTTGTCTCAACCATGTG-3' 5'-TGCCCTCCAAGTCACCCAGCAAGT-3'5 304 5'-GACTTGGATCAATCTCAGT1--13' 5'-TAGGACACGGAGGTlTTGG-3'6 250 5'-TTCATCAGTGAAATCCTTAAA1TT-3' 5'-CGCCTGGAAGTTACTTTCTA-3'7 320 5'-GAACTTTCTCTGCTGGCCTA-3' 5'-TGGTTCTGGTATACAGCAAATC-3'8 313 5'-GCTCGl-F-l--l-l-lAGGTAATGGGA-3' 5'-TGAGTTTATCTCCCTTCCAGG-3'PAX72A 188 5'-TCCATCCTCACCCTGCACCT-3' 5'-CGGGAGATGACACAGGGCCG-3'2B 214 5'-GCGACCCCTGCCTAACCACA-3' 5'-AAGCCAGCTGCCAGCCTCTGTG-3'3 200 5'-CCCCATCCCATCTTTCCACTC-3' 5'-TGCCGGCTCAGCTGCC-TTCTCA-3'4 189 5'-TTGCTCTTTGGCCTTTGAATTTCT-3' 5'-GCCTCGCAGCCCAGGGAA-3'PAXI1 194 5'-TCCGGCTCACTCTTGTCTGG-3' 5'-ATCTTGCTCACGCAGCCGTG-3'2 201 5'-ACGCCATCCGCTTGCGCA1TT-3' 5'-AGTCCCGGATGTGCTTGACC-3'3 200 5'-CCTGGCGCGCTACAACGAGA-3' 5'-TGGAGCTCACCGAAGGCACA-3'4 200 5'-CTGGCATCTTTGCCTGGGAG-3' 5'-AGGGGTACTGGTAGATGTGG-3'PAX91 200 5'-ATTTTGCAGAGCCAGCCTTC-3' 5'-CGAGCCCGTCTCGTTGTATC-3'2 188 5'-GGCCCAACTGGGCATCCGAC-3' 5'-GGTCTCTCTGCTTGTAGGTC-3'3 202 5'-ATCTTGCCAGGAGCCATCGG-3' 5'-TGCCGATCTTGTTGCGCAGAAT-3'4 200 5'-ATCTTCGCCTGGGAGATCCGG-3' 5'-GGGTACGAGTAGATGTGGTTGT-3'5 222 5'-ATTACGACTCATACAAGCAGCACC-3' 5'-CCCTACCTTGGTCGGTGATGG-3'

656

on June 27, 2021 by guest. Protected by copyright.

http://jmg.bm

j.com/

J Med G

enet: first published as 10.1136/jmg.33.8.655 on 1 A

ugust 1996. Dow

nloaded from

http://jmg.bmj.com/

PAX genes and human NTD

allowed to migrate into ultra low gellingtemperature agarose (Sigma), and sliced out ofthe gel. This material served as substrate fordirect sequencing using a cycle sequence kitaccording to the protocol of the manufacturer(BRL). Sequences were determined in twodirections with the forward and reverse ampli-fication primers after 5' end labelling with[32] P. Whenever the resolution was too poor tocut the allelic bands out of the SSC gelseparately, non-radioactive PCR was per-formed on genomic DNA. Amplification prod-ucts were purified on an agarose gel and clonedinto the SmaI site of plasmid vector BluescriptSK+ (Stratagene). Dideoxy DNA sequencingwas conducted on double stranded DNA frompositive clones using the T7 sequencing kit(Pharmacia) with T7 and T3 primers. Se-quences were obtained from at least threeindependent clones.

ResultsSSC ANALYSIS OF THE PAXI AND PAX9 GENESDouble mutant mice with the genotype {un/un;Ph/+} exhibit an occult form of spinabifida5 indicating that mutations in Pax-1 caninfluence the development of the vertebralarches. In order to assess the relevance ofPAXI for human NTD, the paired domainregion, which is the only part of the gene thathas been cloned to date, was subjected to SSCanalysis. DNA from 79 sporadic and 38 famil-ial NTD patients from the Dutch populationwas screened for the presence of sequence vari-ation (fig 1). This resulted in the detection of ashifted band in a single sporadic patient withspina bifida (fig 2A). Direct sequencing of theshifted fragment showed a nucleotide substitu-tion (G-*C, fig 3A) leading to the exchange ofglutamine at position 42 of the paired domainby histidine. This nucleotide substitutiondisrupts an AluI restriction site in the gene.Therefore, the presence of the base changecould be confirmed by AluI restriction diges-tion of the PCR product leaving the DNA fromthis patient intact (fig 4). In the same way itwas shown that the base change was absent

PAX1

AP C C

BP C C

C

from 300 unaffected controls suggesting thatthis alteration is aetiologically related to theNTD of this person. Moreover, the functionalimportance of the Gln residue at this positionis corroborated by the fact that it has been con-served between several human PAX genes aswell as the murine Pax-I gene (fig 5). Finally,the predicted structure of the mutant peptideshowed the loss of a beta sheet conformationsurrounding the displaced amino acid (fig 6).Together, these results argue for a contributionof the PAXI mutation to the development ofspina bifida in one patient. However, the samemutation was also found in the unaffectedmother and grandmother showing that thisfactor alone is not sufficient to induce a NTDduring embryogenesis.

In addition, we have examined all patientsfor sequence variation in the paired domain ofthe PAX9 gene (fig 1), which is highly homolo-gous to the PAXl gene. No band shifts weredetected.

SSC ANALYSIS OF THE PAX3 AND PAx7 GENESAlthough linkage studies have not provided anyindication for PAX3 being a major aetiologicalfactor for familial NTD," a less prominent rolecannot be excluded in this way, in particular forsporadic cases. Therefore, a similar strategywas applied as performed for the PAXl gene,that is, using SSC analysis to search for muta-tions or rare sequence variants primarilyoccurring among patients. The complete cod-ing sequence of the PAX3 gene contained inexons 1 to 8, together with their flanking intronsequences, were analysed (fig 1). The mostdramatic change in the banding patterns wasobserved for exon 5 in a familial patient. Thedetailed analysis of this case, which turned outto be a 5 bp deletion causing spina bifida andWSl, has been described elsewhere.'9 Besidesthe normal band pattern, shifted bands weredetected for exons 2, 6, and 7 (fig 2). Thenature of the observed shifts was determined asdescribed in Materials and methods. One ofthe shifts observed for the exon 2 fragment (fig2B) and the shift observed for the exon 7 frag-

- PAX3

P C CD

P C CE

P C C

_

Paireddomainexon

Exon 2fragment

Exon 2fragment

Exon 6fragment

Exon 7frag inietit

Figure 2 Allelic band pattern obtained through SSC analysis of differentfragments of the PAXI gene (A) and the PAX3gene (B-E). The first lane shows the altered pattern (P) which was occasionally observed in patients or controls or both,whereas the more common SSC pattern (C) is shown in lanes 2 and 3. Arrowheads mark the observed shifted allelic bands.

657

)I 'to-O'li-';

on June 27, 2021 by guest. Protected by copyright.

http://jmg.bm

j.com/

J Med G

enet: first published as 10.1136/jmg.33.8.655 on 1 A

ugust 1996. Dow

nloaded from

http://jmg.bmj.com/

Hol et al

Table 2 Frequencies of the different SSC shifts in the PAX3 gene in Dutch patients and Table 3 Frequency of the T allele chromosome of the exoncontrols 2 CITpolymorphism in Dutch patients and controls

Patients Controls

SSCfragment No Frequency No Frequency

Exon 2 (5' intron polymorphism) 5 / 64 0.08 8 / 93 0.09Exon 2 (silent polymorphism) 42 / 113 0.37 60 / 229 0.26Exon 6 (AA polymorphism) 3 / 61 0.05 6 / 93 0.06Exon 7 (3' intron polymorphism) ND - ND -

ment (fig 2E) were shown to represent singlenucleotide substitutions in the 5' and 3'flanking intronic sequences of exon 2 (T->C,fig 3B) and 7 (G-*A, fig 3E), respectively.Another shift of the same fragment of exon 2(fig 2C) turned out to be the result of a singlenucleotide substitution (C-*T) at the thirdposition of codon 43 representing a silent basechange (Gly43Gly, fig 3C), which has previ-ously been reported by Tassabehji et al.24 In the3' half of exon 6, a C-4A change was identified(fig 2D) downstream of the homeodomain

A

B

C

D

E

Exon 7 Intron 7

5 '- CCTCTCACCTCAG gtcagtcccgtgtttctagac -3 '

Figure 3 Partial DNA and protein sequence of the paired domain exon ofPAXI (A), aswell as PAX3 exon 2 (B, C), exon 6 (D), and exon 7 (E). The nucleotide substitutions thatare responsible for the SSC shifts in fig 2 are shown. When the nucleotide substitution givesrise to an amino acid substitution in the deduced peptide, this is also shown.

Patients Controls

No Frequency No Frequency p value

T allele 46/226 0.20 67/458 0.15 0.06

resulting in an amino acid substitution(Thr315Lys, fig 3D). According to the struc-ture prediction analysis (not shown) this aminoacid substitution does not seem to be influenc-ing the protein structure. Genotyping of thecontrol group showed that all the sequencevariants were present both in patients and con-trols with approximately equal frequencies inboth groups (table 2). Interestingly, the T alleleof the exon 2 silent polymorphism seemed tobe present more often in patients than in con-trols. However, a thorough analysis of the data(heterozygosity/homozygosity scoring, T allelefrequency determination) applying chi-squarestatistics, did not show a significant associationbetween the T allele and NTD (p=0.06, oddsratio = 1.49, 95% confidence interval 0.96-2.30; table 3).

Finally, for PAX7, which closely resemblesPAX3 in structure and expression, the samegroups of patients and controls were screenedfor the presence of sequence variation in thepaired domain (exons 2 to 4, fig 1), which is theonly part of this gene cloned so far. No bandshifts were detected in the SSC analysis.

DiscussionPAX genes encode a class of highly conservedtranscription factors with a characteristic DNAbinding paired domain, which play importantroles in embryonic development.4 To deter-mine more accurately the extent to whichgenetic variation in the PAX1 and PAX3 genes,and their paralogues PAX9 and PAX7, mightpredispose to NTD we have performed SSCanalysis of both familial and sporadic patients.Analysis of the paired domain ofPAXI showeda missense mutation in one sporadic NTDpatient. The NTD was detected by amniocen-tesis and biochemical analysis of amnioticfluid, indicated by the fact that the mother wasa known carrier of a balanced translocationt(7;20)(q22;ql3.2). After pregnancy termina-tion at 19 weeks of gestation, clinical examin-ation showed an open lumbar spina bifida ofabout 1.5 cm in size. Uniparental disomy ofchromosome 7 or 20 in the fetus was excludedby the analysis of genetic markers. Cytogeneticanalysis showed the presence of the samebalanced translocation in the fetus and thematernal grandmother. Apparently, the muta-tion in the PAX1 gene, which is located at20p1 l, cosegregates with the translocationchromosomes. Although there is no indicationfor a major pathological effect of the balancedtranslocation, an influence on the phenotype ofthe fetus cannot be excluded. In fact, under amultifactorial threshold model both geneticabnormalities, that is, the PAX1 mutation andthe translocation, may have contributed to theappearance of the NTD.

C

5'-TGTGAGATCAGTCGGCA9CTCCGCGTATCCCAC-3'CysAspIleSerArgGjLeuArgValSerHis

tHis

C

I

5'-actgcgaaattacgtgctgctgttctttgctttttattttcctccagtgac ttttcccttgcttctct

Intron I Exon 2

ttttcaccttcccacagTGTCCACTCCCCTCGGC-3'

Exon 2 TI

5'-CAGGGCCGCGTCMACCAGCTCGGCGGCGTTTTTA-3'GlnGlyArgValAsnGlnLeuGlyGlyValPhe

IGly

A Exon 6 Intron 6

5' -TACCAGCCCACATCTATTCCACMG gtaccgagg -3'TyrGlnProThrSerIleProGln

Lys

658

on June 27, 2021 by guest. Protected by copyright.

http://jmg.bm

j.com/

J Med G

enet: first published as 10.1136/jmg.33.8.655 on 1 A

ugust 1996. Dow

nloaded from

http://jmg.bmj.com/

659PAX genes and human NTD

_ Mutant allele_ Wild type allele

Figure 4 Pedigree of the family in which the PAXI mutation is segregating. Presence ofthe mutation could be confirmed by AluI restriction digestion of the amplified PAXI paireddomain fragment. Heterozygous carriers show a mutant allelic band in addition to the wildtype band.

ELAQLGIRPCDISRELAQLGIRPCDISREMAHHGIRPCVISREMAHHGIRPCVISRELAQLGIRPCDISRELAQLGIRPCDISR

Q LRVSHGCVSKILARYQ LRVSHGCVSKILARYQ LRVSHGCVSKILCRYQ LRVSHGCVSKILCRYQ LRVSHGCVSKILARYH LRVSHGCVSKILARY

Figure 5 Partial protein sequence of different human and murine PAXgenes showing thatthe glutamine (Q) residue at this position in the paired domain of the PAXI gene is highlyconserved. The patient carrying the PAXI mutation has a histidine (H) residue at thisposition.

Based on data from the Splotch mouse andfrom the analysis of families and patients withWaardenburg syndrome, the PAX3 gene is alikely candidate for neural tube defects. Link-age analysis of multiple case families with thedinucleotide repeat marker25 immediately up-stream of the PAX3 gene did not provide anyindication for a major involvement of thisgene.2' However, situations of negative linkagebut positive allelic association have beenreported for other genes and disorders, such asthe TGFa gene in cleft lip and cleft palate.26 27With respect to NTD, no significant associ-

A

Turns

Alpha helices

Beta sheets

PAX1 Wild type LPNAIRLRIVELAQLGIRPCDISRtLRVSHGCVSKILARYNETGSIt

B

Figure 6 Results of the secondary protein structure prediction, of the wild type (A) andmutant (B) PAXI peptide, respectively. Computer analysis, using the Chou-Fasmanalgorithm, shows the loss of a sheet conformation at the position of the mutation.

ation (p>O. 1) was observed with any of thealleles of the dinucleotide polymorphism andsimilar results were obtained using patientsand controls from the US population (notshown). Moreover, no significant associationwas observed between NTD and the newlydetected polymorphisms described in thisstudy, although suggestive results were ob-tained with the T allele of a C/T silentpolymorphism in exon 2 (p=0.06). The T atthe polymorphic site by itself does notnecessarily have to be pathogenic to explain apossible association; however, one could imag-ine that a difference in codon usage orpre-mRNA processing might lead to a slightinequality in expression efficiency betweenboth allelic forms of the PAX3 gene. In thisrespect, embryos with a T allele would have aminor disadvantage during neurulation. How-ever, at this point the evidence for association isnot convincing and additional groups ofpatients need to be studied to determinewhether the increased frequency of the T allelein our patients has relevance for non-syndromal NTD.

In this study we have investigated whetherparticular members of the PAX gene familycould play a role in the aetiology of humanNTD. No indications for an involvement ofPAX7 and PAX9 have been obtained so far. Nosignificant association was detected betweenPAX3 and non-syndromal NTD. On the otherhand, when considering the increased fre-quency of NTD in WS 1 families,'9 PAX3mutations do seem to predispose to certainsyndromic forms of NTD. Our present resultsargue for a role of the PAXI gene in the aetiol-ogy of NTD as shown by the detection of amissense mutation in the paired domain. Atthe same time our data show that the detectedmutation in PAX1 is not sufficient to cause thedevelopment of the disorder. Other factors,environmental or genetic or both, would haveto exert a negative influence on the neurulationprocess to increase the risk further. Fromanimal studies5 the gene for PDGFRax underly-ing the Patch phenotype is a suspectedcandidate.

We thank the Dutch Working Group on Hydrocephalus andSpina Bifida of the patient organisation BOSK for their help incontacting the patients and families. We also thank Prof Dr H HRopers and Professor T Strachan for helpful discussions and Svan der Velde-Visser and E van Rossum-Boenders for cellculture and EBV transformations. This study was supported bythe Dutch Prinses Beatrix Fonds grant No 93-005 and95-0521. The cooperation of the families and the staff of spinabifida clinics in the USA is gratefully acknowledged. Thesupport ofNIH grants R29 NS29893 (SC) and HG00008 (YS)and the March of Dimes Birth Defects Foundation (WJ, SC) isgratefully acknowledged. We also thank Q Li, C Torigian, ASarangi, and E S Stenroos for technical assistance. FH, RB, BH,and EM are members of INTEGER, the International NeuralTube Embryology, Genetics and Epidemiology Researchconsortium to identify genes which predispose to neural tubedefects.

1 Jager-Roman E, Deichl A, Jakob S, et al. Fetal growth, majormalformations, and minor anomalies in infants born towomen receiving valproic acid. 7 Pediatr 1986;108:997-1004.

2 MRC Vitamin Study Research Group. Prevention of neuraltube defects: results of the Medical Research CouncilVitamin Study. Lancet 1991;338: 131-7.

3 Hol FA, Geurds MPA, Jensson 0, et al. Exclusion mappingof the gene for X-linked neural tube defects in an Icelandicfamily. Hum Genet 1994;93:452-6.

4 Strachan T, Read AP. PAX genes. Curr Opin Genet Dev1994;4:427-38.

PAX1PaxlPAX3PAX7PAX9PAX1

HUMANMOUSEHUMANHUMANHUMANPATIENT

Turns

Alpha helices

Beta sheets

PAX1 Mutant LPNAIRLRIVELAQLGIRPCDISRHLRVSHGCVSKILARYNETGSIt

on June 27, 2021 by guest. Protected by copyright.

http://jmg.bm

j.com/

J Med G

enet: first published as 10.1136/jmg.33.8.655 on 1 A

ugust 1996. Dow

nloaded from

http://jmg.bmj.com/

Hol et al

5 Helwig U, Imai K, Schmahl W, et al. Interaction betweenundulated and Patch leads to an extreme form of spinabifida in double-mutant mice. Nature Genet 1995;l1:60-3.

6 Moase CE, Trasler DG. Splotch locus mouse mutants: mod-els for neural tube defects and Waardenburg syndrometype I in humans. J Med Genet 1992;29:145-51.

7 Balling R, Deutsch U, Gruss P. undulated, a mutation affect-ing the development of the mouse skeleton, has a pointmutation in the paired box of Pax-1. Cell 1988;55:531-5.

8 Wallin J, Wilting J, Koseki H, Fritsch R, Christ B, Balling R.The role of Pax-I in axial skeleton development. Develop-ment 1994;120:1109-21.

9 De Saxe M, Kromberg JGR, Jenkins T Waardenburgsyndrome in South Africa. Part I. An evaluation of theclinical findings in 11 families. S Aft Med J 1984;66:256-61.

10 Narod SA, Siegel-Bartelt J, Hoffman HJ. Cerebellar infarc-tion in a patient with Waardenburg syndrome. Am J MedGenet 1988;31:903-7.

11 Da-Silva EO. Waardenburg I syndrome: a clinical andgenetic study of two large Brazilian kindreds, and literaturereview. Am J Med Genet 199 1;40:65-74.

12 Carezani-Gavin M, Clarren SK, Steege T. Waardenburgsyndrome associated with meningomyelocele. Am J MedGenet 1992;42:135-6.

13 Begleiter ML, Harris DJ. Waardenburg syndrome andmeningocele. Am J Med Genet 1992;44:541.

14 Chatkupt S, Chatkupt S, Johnson WG. Waardenburgsyndrome and myelomeningocele in a family. J Med Genet1993;30:83-4.

15 Moline ML, Sandlin C. Waardenburg syndrome andmeningomyelocele. Am J Med Genet 1993;47:126.

16 Ayme S, Philip N. Possible homozygous Waardenburg syn-drome in a fetus with exencephaly. Am Jf Med Genet 1995;59:263-5.

17 Baldwin CT, Hoth CF, Amos JA, da-Silva EO, Milunsky A.An exonic mutation in the HuP2 paired domain genecauses Waardenburg's syndrome. Nature 1992;355:637-8.

18 Hoth CF, Milunski A, Lipsky N, Sheffer R, Clarren SK,Baldwin CT. Mutations in the paired domain of thehuman PAX3 gene cause Klein-Waardenburg syndrome(WS-III) as well as Waardenburg syndrome type I (WS-I).AmJHum Genet 1993;52:455-62.

19 Hol FA, Hamel BCJ, Geurds MPA, et al. A frame shiftmutation in the gene for PAX3 in a girl with spina bifidaand mild symptoms of Waardenburg syndrome. J MedGenet 1995;32:52-6.

.20 Estibeiro JP, Brook FA, Copp AJ. Interaction betweensplotch (Sp) and curly tail (ct) mouse mutants in theembryonic development of neural tube defects. Develop-ment 1993;119:113-21.

21 Chatkupt S, Hol FA, Shugart YY, et al. Absence of linkagebetween familial neural tube defects and PAX3 gene. JMed Genet 1995;32:200-4.

22 Mariman ECM, Hamel BCJ. Sex ratios of affected andtransmitting members of multiple case families with neuraltube defects. 7Med Genet 1992;29:695-8.

23 Miller SA, Dykes DD, Polesky HF. A simple salting out pro-cedure for extracting DNA from human nucleated cells.Nucleic Acids Res 1988;16:1215.

24 Tassabehji M, Newton VE, Leverton K, et al. PAX3 genestructure and mutations: close analogies betweenWaardenburg syndrome and the Splotch mouse. HumMolec Genet 1994;3:1069-74.

25 Wilcox ER, Rivolta MN, Ploplis B, Potterf SB, Fex J. ThePAX3 gene is mapped to human chromosome 2 togetherwith a highly informative CA dinucleotide repeat. HumMolec Genet 1992;1:215.

26 Ardinger HH, Buetow KH, Bell GI, Bardach J, VanDemarkR, Murray JC. Association of genetic variation of thetransforming growth factor alpha gene with cleft lip andpalate. Am J Hum Genet 1989;45:348-53.

27 Chenevix-Trench G, Jones K, Green AC, Duffy DL, MartinNG. Cleft lip with or without cleft palate: associations withtransforming growth factor alpha and retinoic acid recep-tor loci. Am J'Hum Genet 1992;51: 1377-85.

28 Burri M, Tromvoukis Y, Bopp D, Frigerio G, Noll M. Con-servation of the paired domain in metazoans and its struc-ture in three isolated human genes. EMBOJ 1989;8:1183-90.

29 Tassabehji M, Read AP, Newton VE, et al. Waardenburg'ssyndrome patients have mutations in the human homo-logue of the Pax-3 paired box gene. Nature 1992;355:635-6.

30 Macina R, Barr F, Galili N, Reithman H. Genomic organi-zation of the human PAX3 gene: DNA sequence analysisof the region disrupted in alveolar rhabdomyosarcoma.Genomics 1995;26: 1-8.

31 Stapleton P, Weith A, Urbanek P, Kozmik Z, Busslinger M.Chromosomal localization of seven PAX genes andcloning of a novel family member, PAX9. Nature Genet1993;3:292-7.

660

on June 27, 2021 by guest. Protected by copyright.

http://jmg.bm

j.com/

J Med G

enet: first published as 10.1136/jmg.33.8.655 on 1 A

ugust 1996. Dow

nloaded from

http://jmg.bmj.com/