jcm02270-13r3 journal of clinic al microbiology full title ... · 31.10.2013 · 11 viruses...

1

JCM02270-13R3 1

Journal of Clinical Microbiology 2

Full length Paper (2883 words) 3

4

Full Title: 5

6

Virological Diagnosis of Central Nervous System Infections using 7

PCR coupled with Mass Spectometry Analysis of CSF samples 8

9

Running title: 10

Viruses Detection in CSF by PCR-MS 11

12

13

Nicolas Lévêque1, Jérôme Legoff

2, Catherine Mengelle

3, Séverine Mercier-Delarue

2, Yohan 14

N’guyen1, Fanny Renois

1, Fabien Tissier

1, François Simon

2, Jacques Izopet

3, Laurent 15

Andréoletti1 16

17 1Clinical and Molecular Virology Unit, University Hospital and EA-4684 Cardiovir SFR-CAP 18

santé, Faculty of Medicine, Reims, France; 2Microbiology laboratory, Saint-Louis University 19

Hospital and INSERM U941, Paris Diderot University, Paris, France; 3Department of 20

Virology, University Hospital and INSERM U1043, Toulouse Purpan, France. 21 22 23

None of the authors of the present manuscript have a commercial or other association that might 24 pose a conflict of interest (e.g., pharmaceutical stock ownership, consultancy). 25

26

27

28

29

30

31

32

*Corresponding author: Laurent Andréoletti, Clinical and Molecular Virology Unit, 33 University Hospital and EA-4684 CardioVir Faculty of Medicine, Reims, France, Avenue du 34 General Koenig, 51092 REIMS Cedex, France. Tel: (33) 3 26 78 39 93; Fax: (33) 3 26 78 41 35 34; E-mail: [email protected] 36

37

JCM Accepts, published online ahead of print on 6 November 2013J. Clin. Microbiol. doi:10.1128/JCM.02270-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on Novem

ber 7, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

http://jcm.asm.org/

2

Abstract (266 words): 38

39

Viruses are the leading cause of central nervous system (CNS) infections ahead of bacteria, 40

parasites and fungal agents. A rapid and comprehensive virologic diagnostic testing method is 41

needed to improve the therapeutic management of hospitalized pediatric or adult patients. In 42

this study, we assessed the clinical performances of PCR amplification coupled with 43

electrospray ionization/time-of-flight mass spectrometry analysis (PCR-MS) for the diagnosis 44

of viral CNS infections. Three hundred and twenty-seven cerebrospinal fluid (CSF) samples 45

prospectively tested by routine PCR assays between 2004 and 2012 in two University 46

Hospital Centres (Toulouse and Reims, France), were retrospectively analyzed by PCR-MS 47

analysis using primers targeted to adenovirus, Human Herpesviruses (HHV1-8), 48

Polyomaviruses BK and JC, Parvovirus B19 and enterovirus (EV). PCR-MS detected single 49

or multiple virus infections in 190 (83%) of the 229 samples tested positive by routine PCR 50

analysis and in 10 (10.2%) of the 98 tested negative samples. PCR-MS results correlated well 51

with HSV1, VZV and EV detection by routine PCR assays (Kappa tests= 0.80 [0.69-0.92; 52

95%], 0.85 [0.71-0.98; 95%] and 0.84 [0.78-0.90; 95%], respectively), whereas a weak 53

correlation was observed with EBV (0.34 [0.10-0.58; 95%]). Twenty-six co-infections and 16 54

uncommon neurotropic viruses (HHV7 (n=13), Parvovirus B19 (n=2) and adenovirus (n=1)) 55

were identified by the PCR-MS analysis whereas only 4 co-infections had been prospectively 56

evidenced using routine PCR assays (P<0.01). In conclusion, our results demonstrated that 57

PCR-MS analysis is a valuable tool to identify common neurotropic viruses in CSF with, 58

however, limitations that were identified regarding EBV and EV detection, and may be of 59

major interest to better understanding the clinical impact of multiple or neglected virus 60

neurological infections. 61

62

63

64

65

66

67

68

69

Key-words: neurotropic viruses, central nervous system infections, virological diagnosis, 70

PCR, mass spectrometry. 71

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

3

Viruses are the leading cause of central nervous system (CNS) infections ahead of 72

bacteria, parasites and fungal agents (1,2). They are responsible for a wide spectrum of 73

neurological disorders ranging from the frequent and benign aseptic meningitis due to 74

enteroviruses to the rare but serious Herpes simplex encephalitis (3,4,5). Polymerase chain 75

reaction (PCR) has been recognized as the reference method for the diagnosis of viral CNS 76

infections (6,7,8,9,10). Gene amplification by PCR allows both sensitive and specific virus 77

detection in the cerebrospinal fluid (CSF). It also offers the rapid virological diagnosis 78

required to improve the therapeutic management by antiviral therapy in order to limit brain 79

necrosis in cases of Herpes simplex encephalitis or to increase cost savings in hospitalized 80

cases of enterovirus-related aseptic meningitis during the epidemic season (7,8,11,12). 81

Moreover, it has been shown that quantitation of viral nucleic acid by real-time PCR assay of 82

CSF was useful in monitoring the effectiveness of antiviral therapy as well as for establishing 83

the prognosis of the disease (13,14,15). However, the small volume of CSF available 84

combined with the wide number of DNA or RNA viruses potentially responsible for 85

meningitis or encephalitis makes it challenging to complete an exhaustive diagnostic profile. 86

Currently, the virological diagnosis is determined through the combination of multiple PCR 87

and RT-PCR assays leading to a virological detection in only 45% to 52% of clinically 88

suspected CNS infections (16,17). A comprehensive virologic diagnostic testing method is 89

needed for rapid and broad viral detection and quantitation in CSF samples of patients 90

hospitalized for CNS infections. 91

This study retrospectively assessed the clinical performance of a new technology 92

coupling PCR amplification to electrospray ionization/time-of-flight mass spectrometry 93

analysis (PCR-MS) for the diagnosis of viral CNS infections (18,19). Three hundred and 94

twenty-seven CSF specimens taken from patients hospitalized in two french university 95

hospital centers for clinically suspected CNS infections were retrospectively analysed using 96

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

4

the PCR-MS technique. The results obtained by PCR-MS analysis were compared to those of 97

the qualitative routine PCR assays used prospectively and to those of real-time quantitative 98

PCR assays performed retrospectively. 99

100

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

5

MATERIALS AND METHODS 101

Study design. Cerebrospinal fluid samples collected by the virology laboratories of the 102

university hospitals of Toulouse and Reims were retrospectively selected because: (i) they 103

have been categorized positive or negative by routine PCR assays detecting the main 104

neurotropic viruses, and (ii) a minimum volume of 300µL remained for each of them. The 105

selected samples were nucleic acid extracted followed by PCR-MS analysis at the virology 106

laboratory of the Saint-Louis hospital (Paris). The nucleic acids extracts corresponding to 107

positive or discordant CSF sample analyses obtained between routine PCR techniques and 108

PCR-MS were sent back to the virology laboratory of Reims in order to be tested using a third 109

molecular assay allowing a viral load assessment. 110

Clinical specimens. Three hundred and twenty-seven CSF samples were obtained from 111

136 children (sex ratio M/F: 1.7; median age: 6 year-old ranging from 2 to 18) and 182 adults 112

(sex ratio M/F: 0.9; median age: 54 year-old ranging from 19 to 105) hospitalized between 113

2004 and 2012 and routinely sent to the Toulouse and Reims laboratories for clinically 114

suspected neurological virus infections. Cerebrospinal fluids were tested prospectively for 115

Human Herpesviruses (HSV1, HSV2, VZV, CMV, EBV and HHV6), enterovirus and JC 116

virus by “in-house” and commercially available PCR assays used in daily practice in the two 117

laboratories (Table 1) (20,21,22,23,24,25,26). CSF samples had been routinely divided in 118

aliquots and stored at -80°C since the date of collection. 119

Among these 327 CSF samples, 229 had been prospectively tested positive for single 120

(n=225) and multiple (n=4) viral infections with the routinely used PCR assays whereas 98 121

were negative. The distribution of the virus positive CSF samples selected for the present 122

investigation is shown in Table 2. 123

124

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

6

PCR-electrospray ionization time-of-flight mass spectrometry (PCR-MS). CSF 125

samples were retrospectively analysed with the PLEX-ID system (Abbott Molecular, IL, 126

USA) as previously reported (18,19). Briefly, RNA and DNA were extracted from 300µL of 127

the clinical specimens using the PLEX-ID total nucleic acid isolation kits on the PLEX-ID FH 128

and SP instruments and recovered in 200µL. For each clinical sample, 80µl of nucleic acids 129

were then distributed by the PLEX-ID Fluid handler into 8 reaction wells of 96-well assay 130

plates and amplified with the Viral IC II Spectrum assay (Abbott Molecular, IL, USA) 131

containing primers targeted to adenovirus, Human Herpesviruses (HHV1-8), polyomaviruses 132

BK and JC, Parvovirus B19 (PVB19) and enterovirus (EV) (Table 3). Cycling was done on 133

the PLEX-ID TC (Mastercycler ProS-Eppendorf) according to the manufacturer’s 134

instructions. After desalting and purification, amplicons were analyzed by the PLEX-ID 135

Analyzer. Methanol-based aerosols containing denatured ionized amplicons were sprayed into 136

the mass spectrometer. The molecular weight of the amplicons was determined by an 137

electrospray-ionization time-of-flight mass spectrometer and converted to base composition 138

by database analysis. The virus was then identified by bioinformatics analysis of the base 139

composition signatures produced by the virus target genes in each sample (27,28). 140

Viral load assessment was obtained by quantifying the total number of amplicons against 141

an internal calibrant that is included in every well with a known copy number. The internal 142

calibrant competes with the amplicon for the same primers and PCR reagents; it additionally 143

serves as an internal PCR control to confirm negative results (19). 144

Discrepancy methods used for analysis of discordant results between routine PCR 145

assays and PCR-MS. CSF samples, that displayed: (i) either discordant results between 146

prospective and retrospective analyses; (ii) or additional viruses detected with PCR-MS that 147

were not included in prospectively used PCR panel, were tested with a third molecular 148

technique. The same nucleic acid extracts as used for PCR-MS analysis were tested either 149

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

7

with end-point PCR (JC/BK consensus kit, Argene bioMerieux, Verniolle, France) or real-150

time quantitative PCR (RT-qPCR) assays for HSV1 & 2, VZV, CMV, EBV, HHV6, HHV7, 151

PVB19, ADV and EV allowing viral load assessment in virus positive CSF samples except 152

for HHV7 (HSV1 HSV2 VZV R-Gene, CMV HHV6,7,8 R-Gene, EBV R-Gene, Adenovirus 153

R-Gene, Argene bioMerieux, Verniolle, France) (29,30) (Table 1). 154

The same real-time quantitative PCR techniques were also used to determine the viral load 155

levels in positive samples by both routine PCR assays and PCR-MS in order to compare them 156

with those assessed in the samples displaying discordant results. 157

Statistical analyses. The accuracy of the PCR-MS in detecting neurotropic viruses in 158

CSF samples was determined by sensitivity and specificity considering the routine PCR 159

assays used for CSF sample prospective analysis as the reference method. The Kappa test was 160

also used for measuring the agreement between PCR-MS system and routine PCR assays. The 161

Spearman’s rank correlation was used to evaluate linear associations between viral loads 162

assessed with the PCR-MS and the RT-qPCR assays used as third analytical technique. 163

Statistical analyses were carried out with SAS software, version 8.2 (SAS Institute, Cary, NC, 164

USA). Results were considered significant for two-sided P values <0.05. 165

166

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

8

RESULTS 167

Analysis of the 327 selected CSF samples by the PCR-MS system. Among the 229 CSF 168

samples prospectively tested positive using routine PCR assays, the PCR-MS system 169

identified 218 viruses in 190 specimens (Table 2). PCR-MS assay showed concordant results 170

with routine PCR techniques for 187 viruses (81.7%) corresponding to 183 positive CSF 171

samples (79.9%). The Kappa coefficients between the PCR-MS system and routine PCR 172

assays appeared to be higher than 0.80 for HSV, VZV and EV and 0.34 for EBV (Table 4). 173

By comparison to the routine PCR assays, the PCR-MS demonstrated sensitivity above 90% 174

for HSV and VZV, 80% for EV and about 30% for EBV. Specificity ranged from 97% for 175

HSV and EBV to 99% for VZV and EV. The low number of CMV, HHV6 and JCV positive 176

samples did not allowed us to assess the accuracy of the PCR-MS in detecting these 177

neurotropic viruses in CSF samples (Table 4). Moreover, PCR-MS identified 26 co-178

infections, whereas only 4 had been detected by routine PCR techniques (P<0.01). These co-179

infections consisted of 24 double infections and two triple infections. They involved (i) EV 180

and Human Herpesviruses (n=18 (70%) mainly EV-HHV6 (n=4) and EV-HHV7 (n=7)), (ii) 181

EV and other viral species (n=4 (15%)) and (iii) different species among Human 182

Herpesviruses (n=4 (15%)) (not shown). 183

Among the 98 negative CSF samples identified by routine PCR assays, ten classical 184

neurotropic viruses were detected with PCR-MS (10/98=10.2%). Interestingly, PCR-MS 185

identified 4 HSV CNS infections that were undetected by routine PCR assays (Table 2). 186

Finally, among the 327 CSF samples tested, PCR-MS identified 16 viruses that were not 187

initially included in the panel of neurotropic viruses detected by routine PCR assays (Table 188

2). These newly detected viruses were HHV7 (n=13), PVB19 (n=2) and ADV (n=1) (Table 189

2). 190

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

9

Analysis of discrepant results between routine PCR techniques and PCR-MS 191

using a third molecular technique. Clinical samples demonstrating discrepant results 192

between routine PCR techniques and PCR-MS were analyzed with a third molecular 193

technique consisting of either end-point (JCV) or real-time quantitative PCR assays (RT-194

qPCR) allowing virus detection and quantitation except for HHV7. Overall, 73 results were 195

discordant between routine PCR techniques and PCR-MS (Table 4). 196

Forty-six viral infections prospectively diagnosed by routine PCR techniques were not 197

detected retrospectively by PCR-MS. Among these 46 routine PCR positive and PCR-MS 198

negative CSF samples, 17 (37%) were confirmed positive by a third PCR assay, whereas 29 199

(63%) remained undetectable (Table 4). Nine of the 18 EBV and 8 of the 25 EV positive CSF 200

samples that were not detected retrospectively with PCR-MS, were confirmed by RT-qPCR 201

(Table 4). They demonstrated median viral loads significantly lower than those measured in 202

positive samples by both routine PCR and PCR-MS techniques (112 copies/mL [23-384] vs. 203

2620 [93-10000] (P<0.01) for EBV; 217 copies/mL [32-5650] vs. 3695 [97-212000] (P<0.01) 204

for EV). 205

Conversely, 27 neurotropic viruses were detected by the PCR-MS alone. Nine of these 206

27 viral detections (33.3%) were confirmed by the third molecular technique used to analyze 207

discrepant samples (Table 4). 208

Comparison of viral load assessment between PCR-MS and real-time 209

quantitative PCR assays. Correlation analysis of viral load levels obtained by PCR-MS and 210

RT-qPCR assays was performed for HSV, VZV, EBV and EV positive CSF samples. 211

Quantitative values between RT-qPCR and PCR-MS were compared and showed poor 212

correlation with r2 ranging from 0.003 (P=0.77) for HSV to 0.415 for EBV (P=0.08) (data not 213

shown). 214

215

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

10

DISCUSSION 216

The aim of this work was to assess the performance characteristics of a new test based 217

on a multiplex PCR amplification coupled with electrospray ionization/time-of-flight mass 218

spectrometry analysis (PCR-MS) for the diagnosis of viral CNS infections in comparison with 219

routine PCR assays used as reference methods. Among the 229 virus positive CSF samples, 220

PCR-MS results were well correlated with routine PCR techniques for HSV, VZV and EV 221

detection demonstrating Kappa coefficients greater than or equal to 0.8. The agreement was, 222

however, weaker for EBV detection (Kappa coefficient=0.34) since only 8 of the 26 EBV 223

positive CSF specimens selected were retrospectively detected by PCR-MS. This suggests a 224

sensitivity defect of the Viral Spectrum IC II kit regarding this virus (Table 4). 225

Among the 229 positive CSF samples tested, PCR-MS system failed to detect 46 226

viruses identified by routine PCR techniques (Table 4). Three hypotheses can be claimed to 227

explain these discrepancies: (i) nucleic acid degradation occurred either during the storage of 228

the samples from the date of collection or at the time of samples thawing; this hypothesis 229

could be particularly true for samples with low viral load (101 (44%) of the 229 positive CSF 230

samples selected for this study have displayed a viral load <500 copies/mL by RT-qPCR) and 231

RNA viruses such as EV not detected retrospectively in 25 of the 154 positive samples; (ii) 232

the PCR-MS technology has a lower sensitivity in comparison to routine PCR assays: the 233

quantitation of EBV and EV viral load levels revealed that they were significantly higher in 234

the concordant CSF samples positive by both techniques than in discordant CSF samples not 235

detected retrospectively by the PCR-MS; (iii) a higher concentration of nucleic acids in 236

extracts used for prospective analysis by routine classical techniques than in those used for 237

retrospective PCR-MS analysis: the ratio between the CSF volume subjected to extraction and 238

the elution volume of nucleic acids ranged from 2 (Toulouse ) to 4 (Reims) for routine PCR 239

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

11

analyses whereas it was of only 1.5 for PCR-MS analysis leading to signal loss particularly 240

for CSF samples with low viral loads. 241

Two main strengths of the PCR-MS technology have been highlighted in the present 242

investigation on CSF samples. First, this new technology significantly improved the detection 243

of multiple viral infections by comparison to routine PCR assays (26 vs. 4, P<0.01). These co-244

infections mainly involved EV and Human Herpes viruses. The clinical relevance of viral co-245

infections of the CNS remains undefined, especially for those infections including HHV-7 246

and/or HHV-6 (10,31). These viruses could be considered as an innocent bystander of the 247

immune response in the cerebrospinal fluid, passively carried in inflammatory cells to the 248

central nervous system. In contrast, simultaneous infection of the brain by several viruses 249

could also result in an increase of the inflammatory response, edema or cerebral necrosis. 250

Secondly, PCR-MS technology identified a significant number of viruses not included in the 251

panel of classical neurotropic viruses detected by routine PCR techniques. Human Herpes 252

Virus type 7 (n=13) is currently considered as an orphan virus with uncertain neuropathogenic 253

properties even if it is frequently detected in CSF samples, particularly of children (33,34). 254

The literature on the PVB19 (n=2) is much more extensive. Many neurological manifestations 255

have been described in patients infected with PVB19 such as encephalitis, aseptic meningitis, 256

vasculitis and peripheral neuropathy involving mostly children, and, in one third of the cases, 257

immunocompromised patients (35). Adenoviruses (n=1) are opportunistic viruses responsible 258

for severe disseminated infections in immunocompromised patients, particularly in bone 259

marrow transplant recipients (36). Their involvement in immunocompetent patients is limited 260

to rare cases of aseptic meningitis (37). Overall, the use of this innovative technology 261

combining PCR and mass spectrometry could drastically increase the panel of pathogens 262

detected by comparison with routine PCR assays. In a recent study, this new technology 263

allowed the detection and semi-quantitation in cardiac tissues of 84 different common or 264

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

12

uncommon viruses, including confirmed neurological pathogens such as dengue virus, West 265

Nile virus and Japanese or St. Louis encephalitis viruses (19). The addition to the Viral 266

Spectrum IC II kit panel of emerging viruses in neurological infectious diseases such as Nipah 267

virus, Hendrah, or parechoviruses as well as the combined detection of bacteria, fungi and 268

parasites would make this new technology more attractive and could facilitate its 269

implementation in clinical microbiology laboratories (38,39). 270

The quantitative aspect of the PCR-MS technology is, however, more questionable. 271

Quantitative values between RT-qPCR and PCR-MS were compared and showed poor 272

correlation with r2 less than or equal to 0.415 for all targets. The ability of the PCR-MS 273

technology to generate quantitative data in the CSF did not seem to be reliable through the 274

results obtained in the present work. 275

The qualitative approach proposed by the PCR-MS therefore implicates this new 276

technology as a rapid screening broad-spectrum method. In fact, results concerning all the 13 277

viral species detected by the Viral IC II Spectrum assay can be given to the clinician within 6 278

to 8 hours after the arrival of the sample in the laboratory. A single technician can carry out 279

this new technology using only one CSF aliquot of 300ȝL. In this way, PCR-MS technology 280

could find its place in clinical virology laboratories as a first line test to perform a rapid and 281

broad virological diagnosis in ICU patients with severe disease or in immunocompromised 282

patients at risk for developing a severe infection potentially induced by a wide range of viral 283

species (40). Moreover, PCR-MS technology could be the second line test used for 284

neurological infections in immunocompetent patients when conventional molecular 285

techniques detecting the most common pathogens such as HSV, VZV, EBV and EV were 286

negative. Following the qualitative analysis by PCR-MS allowing a rapid implementation of 287

appropriate medical care, a RT-qPCR would be performed in order to assess the viral load in 288

the CSF for prognosis and quantitative monitoring of the disease under proper potential 289

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

13

antiviral therapy (13,14,15). However, the sensitivity defect of the PCR-MS regarding EBV 290

and EV detection identified in our study could be a limitation of its use in its present form as a 291

first line test in clinical practice since sensitivity, at least equivalent to the current molecular 292

methods, is mandatory. Moreover, the cost of the PLEX-ID platform could also limit its 293

implementation in many clinical microbiology laboratories either as a widely used first-line 294

technique but also as a second-line test whose cost would then add to the molecular 295

techniques used routinely. 296

In conclusion, our results demonstrated that PCR-MS analysis is a valuable tool to 297

identify the main common neurotropic viruses responsible for meningitis and encephalitis in 298

hospitalized pediatric and adult patients. However, we observed lower sensitivity for the 299

detection of EBV and EV by the PCR-MS method. The results of this study suggest that 300

multiplex molecular platforms, such as PCR-MS, may allow for a greater understanding of 301

the pathophysiology of CNS viral infections by allowing for a better assessment of the clinical 302

implications of viral co-infections of the CNS and an increased understanding of the potential 303

pathogenicity of neglected neurotropic viruses. 304

305

306

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

14

Acknowledgments: We thank Abbott Ibis Biosciences for supporting our study with reagents 307

and instrumentation. Special thanks to Dr Marcus Picard-Maureau (Abbott GmbH & Co. KG, 308

Europe, Wiesbaden, Germany) who supervised the molecular analyses and interpreted the 309

mass spectra obtained from the PCR-MS system at Saint-Louis University Hospital. 310

311

Transparency Declaration: The data obtained for the CSF samples were independently 312

analysed and interpreted in the Reims clinical and molecular virology unit that possesses all 313

the final data bank. None of the authors of the present manuscript have a commercial or other 314

association that might pose a conflict of interest (e.g., pharmaceutical stock ownership, 315

consultancy). The corresponding author had full access to all the data of the study and had the 316

responsibility for the decision to submit this work for publication with the agreement of all 317

the co-authors. 318

319

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

15

REFERENCES 320

1. Glaser CA, Honarmand S, Anderson LJ, Schnurr DP, Forghani B, Cossen CK, 321

Schuster FL, Christie LJ, Tureen JH. 2009. Beyond viruses: clinical profiles and 322

etiologies associated with encephalitis. Clin. Infect. Dis. 43:1565-1577. 323

2. Somand D, Meurer W. 2009. Central nervous system infections. Emerg. Med. Clin. 324

North Am. 27:89-100. 325

3. Big C, Reineck LA, Aronoff DM. 2009. Viral infections of the central nervous 326

system: a case-based review. Clin. Med. Res. 7:142-146. 327

4. Brunel D, Lévêque N, Jacques J, Renois F, Motte J, Andréoletti L. 2008. Clinical 328

and virological features of an aseptic meningitis outbreak in North-Eastern France, 329

2005. J. Clin. Virol. 42:225-228. 330

5. Steiner I. 2011. Herpes simplex virus encephalitis: new infection or reactivation? 331

Curr. Opin. Neurol. 24:268-274. 332

6. DeBiasi RL, Kleinschmidt-DeMasters BK, Weinberg A, Tyler KL. 2002. Use of 333

PCR for the diagnosis of herpesvirus infections of the central nervous system. J. Clin. 334

Virol. 25:S5-11. 335

7. Ramers C, Billman G, Hartin M, Ho S, Sawyer MH. 2000. Impact of a diagnostic 336

cerebrospinal fluid enterovirus polymerase chain reaction test on patient management. 337

JAMA 283:2680-2685. 338

8. Stellrecht KA, Harding I, Woron AM, Lepow ML, Venezia RA. 2002. The impact 339

of an enteroviral RT-PCR assay on the diagnosis of aseptic meningitis and patient 340

management. J. Clin. Virol. 25:S19-26. 341

9. Tunkel AR, Glasser CA, Bloch KC, Sejvar JJ, Marra CM, Roos KL, Hartman 342

BJ, Kaplan SL, Scheld WM, Whitley RJ, and the Infectious Diseases Society of 343

America. 2008. The management of encephalitis: clinical practice guidelines by the 344

Infectious Diseases Society of America. Clin. Infect. Dis. 47:303-327. 345

10. Leveque N, Van Haecke A, Renois F, Boutolleau D, Talmud D, Andreoletti L. 346

2011. Rapid virological diagnosis of central nervous system infections by use of a 347

multiplex reverse transcription-PCR DNA microarray. J. Clin. Microbiol. 49:3874-348

3879. 349

11. King RL, Lorch SA, Cohen DM, Hodinka RL, Cohn KA, Shah SS. 2007. Routine 350

cerebrospinal fluid enterovirus polymerase chain reaction testing reduces 351

hospitalization and antibiotic use for infants 90 days of age or younger. Pediatrics. 352

120:489-496. 353

12. Nigrovic LE, Chiang VW. 2000. Cost analysis of enteroviral polymerase chain 354

reaction in infants with fever and cerebrospinal fluid pleocytosis. Arch. Pediatr. 355

Adolesc. Med. 154:817-821. 356

13. Dalwai A, Ahmad S, Pacsa A, Al-Nakib W. 2009. Echovirus type 9 is an important 357

cause of viral encephalitis among infants and young children in Kuwait. J. Clin. Virol. 358

44:48-51. 359

14. Persson A, Bergström T, Lindh M, Namvar L, Studahl M. 2009. Varicella-zoster 360

virus CNS disease-viral load, clinical manifestations and sequels. J. Clin. Virol. 361

46:249-253. 362

15. Weinberg A, Li S, Palmer M, Tyler KL. 2002. Quantitative CSF PCR in Epstein-363

Barr virus infections of the central nervous system. Ann. Neurol. 52:543-548. 364

16. Boriskin YS, Rice PS, Stabler RA, Hinds J, Al-Ghusein H, Vass K, Butcher PD. 365

2004. DNA microarrays for virus detection in cases of central nervous system 366

infection. J. Clin. Microbiol. 42:5811-5818. 367

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

16

17. Oostenbrink R, Moons KG, Theunissen CC, Derksen-Lubsen G, Grobbee DE, 368

Moll HA. 2001. Signs of meningeal irritation at the emergency department: how often 369

bacterial meningitis? Pediatr. Emerg. Care. 17:161-164. 370

18. Mengelle C, Mansuy JM, Da Silva I, Guerin JL, Izopet J. 2013. Evaluation of a 371

polymerase chain reaction-electrospray ionization time-of-flight mass spectrometry 372

for the detection and subtyping of influenza viruses in respiratory specimens. J. Clin. 373

Virol. 57:222-226. 374

19. Nguyen Y, Renois F, Leveque N, Giusti D, Picard-Maureau M, Bruneval P, 375

Fornes P, Andreoletti L. 2013. Virus detection and semiquantitation in explanted 376

heart tissues of idiopathic dilated cardiomyopathy adult patients by use of PCR 377

coupled with mass spectrometry analysis. J. Clin. Microbiol. 51:2288-2294. 378

20. Espy MJ, Uhl JR, Mitchell S, Thorvilson JN, Svien KA, Wold AD, Smith TF. 379

2000. Diagnosis of Herpes Simplex Virus infections in the clinical laboratory by Light 380

Cycler PCR. J. Clin. Microbiol. 38:795-799. 381

21. Espy MJ, Teo R, Ross TK, Svien KA, Wold AD, Uhl JR, Smith TF. 2000. 382

Diagnosis of Varicella-Zoster Virus infections in the clinical laboratory by Light 383

Cycler PCR. J. Clin. Microbiol. 38:3187-3189. 384

22. Gault E, Michel Y, Dehée A, Belabani C, Nicolas JC, Garbarg-Chenon A. 2001. 385

Quantification of Human Cytomegalovirus DNA by real-time PCR. J. Clin. Microbiol. 386

39:772-775. 387

23. Brengel-Pesce K, Morand P, Schmuck A, Bourgeat MJ, Buisson, M, Barguès G, 388

Bouzid M, Seigneurin JM. 2002. Routine use of real-time quantitative PCR for 389

laboratory diagnosis of Epstein–Barr virus infections. J. Med. Virol. 66:360-369. 390

24. Gautheret-Dejean A, Manichanh C, Thien-Ah-Koon F, Fillet A-M, Mangeney N, 391

Vidaud M, Dhedin N, Vernant JP, Agut H. 2002. Development of real-time 392

polymerase chain reaction assay for the diagnosis of human herpesvirus-6 infection 393

and application to bone marrow transplant patients. J. Virol. Meth. 100:27-35. 394

25. Verstrepen WA, Bruynseels P, Mertens AH. 2002. Evaluation of a rapid real-time 395

RT-PCR assay for detection of enterovirus RNA in cerebrospinal fluid specimens. J. 396

Clin. Virol. 25:S39-43. 397

26. Mengelle C, Kamar N, Mansuy JM, Sandres-Sauné K, Legrand-Abravanel F, 398

Miédougé M, Rostaing L, Izopet J. 2011. JC virus DNA in the peripheral blood of 399

renal transplant patients: a 1-year prospective follow-up in France. J. Med. Virol. 400

83:132-136. 401

27. Ecker DJ, Sampath R, Massire C, Blyn LB, Hall TA, Eshoo MW, Hofstadler SA. 402

2008. Ibis T5000: a universal biosensor approach for microbiology. Nat. Rev. 403

Microbiol. 6:553-558. 404

28. Ecker JA, Massire C, Hall TA, Ranken R, Pennella T-TD, Agasino Ivy C, Blyn 405

LB, Hofstadler SA, Endy TP, Scott PT, Lindler L, Hamilton T, Gaddy C, Snow 406

K, Pe M, Fishbain J, Craft D, Deye G, Riddell S, Milstrey E, Petruccelli B, Brisse 407

S, Harpin V, Schink A, Ecker DJ, Sampath R, Eshoo MW. 2006. Identification of 408

Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR 409

and mass spectrometry. J. Clin. Microbiol. .44:2921-2932. 410

29. Lévêque N, Renois F, Talmud D, Nguyen Y, Lesaffre F, Boulagnon C, Bruneval 411

P, Fornes P, Andréoletti L. 2012. Quantitative genomic and antigenomic enterovirus 412

RNA detection in explanted heart tissue samples from patients with end-stage 413

idiopathic dilated cardiomyopathy. J. Clin. Microbiol. 50:3378-3380. 414

30. Candotti D, Etiz N, Parsyan A, Allain J-P. 2004. Identification and characterization 415

of persistent human erythrovirus infection in blood donor samples. J. Virol. 78:12169-416

12178. 417

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

17

31. Yoshikawa T, Ihira M, Suzuki K, Suga S, Matsubara T, Furukawa S, Asano Y. 418

2000. Invasion by human herpesvirus 6 and human herpesvirus 7 of the central 419

nervous system in patients with neurological signs and symptoms. Arch. Dis. Child. 420

83:170-171. 421

32. Spencer JV, Lockridge KM, Barry PA, Lin G, Tsang M, Penfold ME, Schall TJ. 422

2002. Potent immunosuppressive activities of cytomegalovirus-encoded interleukin-423

10. J. Virol. 76:1285-1292. 424

33. Tanaka K, Kondo T, Torigoe S, Okada S, Mukai T, Yamanishi K. 1994. Human 425

herpesvirus 7: another causal agent for roseola (exanthem subitum). J. Pediatr. 125:1. 426

34. Van den Berg, J. S., J. H. van Zeijl, J. J. Rotteveel, W. J. Melchers, F. J. 427

Gabreëls, and J. M. Galama. 1999. Neuroinvasion by human herpesvirus type 7 in a 428

case of exanthem subitum with severe neurologic manifestations. Neurology. 52:1077. 429

35. Douvoyiannis M, Litman N, Goldman DL. 2009. Neurologic manifestations 430

associated with parvovirus B19 infection. Clin. Infect. Dis. 48:1713-1723. 431

36. Yilmaz M, Chemaly RF, Han XY, Thall PF, Fox PS, Tarrand JJ, De Lima MJ, 432

Hosing CM, Popat UR, Shpall E, Champlin RE, Qazilbash MH. 2013. Adenoviral 433

infections in adult allogeneic hematopoietic SCT recipients: a single center 434

experience. Bone Marrow Transplant. doi: 10.1038/bmt.2013.33. 435

37. de Ory F, Avellon A, Echevarria JE, Sanchez-Seco MP, Trallero G, Cabrerizo M, 436

Casas I, Pozo F, Fedele G, Vicente D, Pena MJ, Moreno A, Niubo J, Rabella N, 437

Rubio G, Pérez-Ruiz M, Rodríguez-Iglesias M, Gimeno C, Eiros JM, Melón S, 438

Blasco M, López-Miragaya I, Varela E, Martinez-Sapiña A, Rodríguez G, 439

Marcos MÁ, Gegúndez MI, Cilla G, Gabilondo I, Navarro JM, Torres J, Aznar 440

C, Castellanos A, Guisasola ME, Negredo AI, Tenorio A, Vázquez-Morón S. 441

2013. Viral infections of the central nervous system in Spain: a prospective study. J. 442

Med. Virol. 85:554-562. 443

38. Wilson MR. 2013. Emerging viral infections. Curr. Opin. Neurol. 26:301-306. 444

39. Zhong H, Lin Y, Su L, Cao L, Xu M, Xu J. 2013. Prevalence of human 445

parechoviruses in central nervous system infections in children: a retrospective study 446

in Shanghai, China. J. Med. Virol. 85:320-326. 447

40. Meyding-Lamadé U, Strank C. 2012. Herpesvirus infections of the central nervous 448

system in immunocompromised patients. Ther. Adv. Neurol. Disord. 5:279-296. 449

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Table 1. Extraction methods and PCR tests used by the Toulouse and Reims virology laboratories for prospective CSF analysis, and by Reims

virology laboratory for retrospective analysis of discordant results between routine PCR tests and PCR-MS.

Prospective analysis Retrospective analysis of discordant results

Toulouse University Hospital Reims University Hospital Reims University Hospital

Extraction method

MagNA Pure LC Total Nucleic kit

MagNA Pure LC instrument (Roche)

Until 2009:

QIAamp Viral RNA Mini Kit

QIAamp DNA Mini Kit (Qiagen)

Since 2009:

NucliSens EasyMAG instrument (bioMerieux)

PLEX-ID total nucleic acid isolation kit (Abbott)

Input sample volume 200µl

Output elution volume 100µl





PCR assay

HSV-1 & 2 In-house (20)

Herpes Consensus Generic

(Argene-bioMerieux)

HSV1 HSV2 VZV R-Gene (Argene-bioMerieux)

VZV In-house (21)

CMV In-house (22) CMV HHV6,7,8 R-Gene (Argene-bioMerieux)

EBV In-house (23) EBV R-Gene (Argene-bioMerieux)

HHV6 In-house (24) CMV HHV6,7,8 R-Gene (Argene-bioMerieux)

Enterovirus In-house (25) Enterovirus

Consensus (Argene-bioMerieux)

Enterovirus R-gene (Argene-bioMerieux)

In-house (29)

JCV In-house (26) JC/BK Consensus (Argene-bioMerieux) JC/BK Consensus (Argene-bioMerieux)

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Table 2. Detection of neurotropic viruses in 327 CSF samples using routine PCR assays and PCR-MS.

Positive CSF samples (n=229)

Negative CSF samples (n=98)

Routine PCR assays

PCR-MS Routine PCR assays PCR-MS

Total number of virus detected (%)

233 (100)

218 (93.6)

0

12 (12.2)

Number of positive CSF (%)

229 (100)

190 (83)

0

12 (12.2)

Monoinfections (%)

225/229 (98.3)

164/190 (86.3)

0

12/12 (100)

Coinfections (%)

4/229 (1.7)

26/190 (13.7)

0

0

Classical neurotropic viruses

HSV 25 27 0 4

VZV 16 19 0 0

CMV 1 1 0 0

EBV 26 11 0 5

HHV6 6 11 0 0

JCV 5 6 0 0

Enterovirus 154 129 0 1

Viruses not included in routine diagnosis

HHV7 ND 11 ND 2

ADV ND 1 ND 0

PVB19

ND 2 ND 0

Total 233 218 0 12

ND: not done.

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Table 3. Primers included in the Viral IC II Spectrum assay for virus detection in CSF samples using the PCR-MS.

Virus Targeted Gene Target forward primer sequence reverse primer sequence

Adenovirus Penton TCGTTCCTGCCCTCACAGATCACG TAGGTCCGGCGACTGGCGTCAGT

Adenovirus Hexon TTGCAAGATGGCCACCCCATCGAT TGTGGCGCGGGCGAACTGCA

BK/JC Polyomavirus VP1 TGATGGCCCCAACCAAAAGAAAAG TAGTTTTGGCACTTGCACGGG

BK/JC Polyomavirus VP2 TGCCTTTACTTCTAGGGCTGTACGG TAGTTTTGGCACTTGCACGGG

Enterovirus 5UTR TTCCTCCGGCCCCTGAATG TGAAACACGGGCACCGAAAGTAGT

Enterovirus 5UTR TGGCTGCGTTGGCGGCC TAGCCGCATTCAGGGGCCGGA

Erythrovirus (Parvovirus B19) NS1 TGGGCCGCCAAGTACTGGAAAAAC TGTTTTCATTATTCCAGTTAACCATGCCATA

Erythrovirus (Parvovirus B19) VP1 TTACACAAGCCTGGGCAAGTTAGC TCCTGAATCCTTGCAGCACTGTC

Gamma Herpesviridae DNA POL TAAGCAGCAGCTGGCCATCAA TGCCACCCCCGTGAAGCCGTA

Gamma Herpesviridae DNA POL TCGTCCCCATCGACATGTAC TACTGTGTCCAGCTTGTAGTCTGA

Gamma Herpesviridae DNA POL TGACTTTGCCAGCCTGTACCC TCAGGGTGGAGTAGCACAGGTT

HHV1-3 DNA POL TCTGGAGTTTGACAGCGAATTCGAG TGTTGTAACCGGTGGCGAACTCGGG

HHV6-7 DNA POL TCCGCGCGGTATAATGCATGATGG TAGAACATACGCGGTTCCGAGTCACAAA

HHV5 (CMV) DNA POL TCGCGCCCAGGTAGGC TGGCCCCGGCCTCGTAGTG

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

Table 4. Comparison of neurotropic viruses’ detection with routine PCR and PCR-MS assays in the 327 CSF samples collected by the Reims

and Toulouse virology laboratories between 2004 and 2012.

Routine PCR assays

HSV VZV CMV EBV HHV6 JCV ENTEROVIRUS

Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative

PC

R-M

S v

iru

s Positive 23 8δδ

15 4** 1 0 8 8££

6 5§ 5 1

§§ 129 1

&&

Negative 2δ

294 1* 307 0 326 18£ 293 0 316 0 321 25

& 172

Kappa test

[CI 95%] 0.80 [0.69-0.92] 0.85 [0.71-0.98] NC 0.34 [0.10-0.58] NC NC 0.84 [0.78-0.90]

Sensitivity

(%) 92 94 NC 31 NC NC 84

Specificity

(%) 97 99 NC 97 NC NC 99

CI 95%: Confidence interval 95%; NC: Not Calculated. δ

None of these 2 samples was shown to be positive for HSV DNA by a third PCR method.

δδ One of these 8 samples was shown to be positive for HSV DNA by a third PCR method.

* This sample was shown to be negative for VZV DNA by a third PCR method.

** One of these 4 samples was shown to be positive for VZV DNA by a third PCR method. £

Nine of these 18 samples were shown to be positive for EBV DNA by a third PCR method. ££

Two of these 8 samples were shown to be positive for EBV DNA by a third PCR method. §

Four of these 5 samples were shown to be positive for HHV6 DNA by a third PCR method. §§

This sample was shown to be negative for JCV DNA by a third PCR method. &

Eight of these 25 samples were shown to be positive for EV RNA by a third PCR method. &&

This sample was shown to be positive for EV RNA by a third PCR method.

on Novem


.asm.org/

Dow

nloaded from

http://jcm.asm.org/

jcm02270-13r3 journal of clinic al microbiology full title ... · 31.10.2013 · 11 viruses...

Documents